Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Expanding the product portfolio of fungal type I fatty acid synthases
DEFF Research Database (Denmark)
Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia
2017-01-01
Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
International Nuclear Information System (INIS)
Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin
2015-01-01
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
Energy Technology Data Exchange (ETDEWEB)
Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)
2015-10-23
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Fatty acid synthase inhibitors isolated from Punica granatum L
International Nuclear Information System (INIS)
Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng
2012-01-01
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)
Fatty acid synthase inhibitors isolated from Punica granatum L
Energy Technology Data Exchange (ETDEWEB)
Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)
2012-05-15
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)
Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie
2011-09-02
The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
Directory of Open Access Journals (Sweden)
Saito Koji
2005-08-01
Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1
Structural and evolutionary relationships of "AT-less" type I polyketide synthase ketosynthases.
Lohman, Jeremy R; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2015-10-13
Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs.
Structural and evolutionary relationships of "AT-less" type I polyketide synthase ketosynthases
Energy Technology Data Exchange (ETDEWEB)
Lohman, Jeremy; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne E.; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, B G
2015-10-13
Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs.
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique
2013-12-01
We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Broadbent, J R; Oberg, T S; Hughes, J E; Ward, R E; Brighton, C; Welker, D L; Steele, J L
2014-03-01
Lactic acid is an important industrial chemical commonly produced through microbial fermentation. The efficiency of acid extraction is increased at or below the acid's pKa (pH 3.86), so there is interest in factors that allow for a reduced fermentation pH. We explored the role of cyclopropane synthase (Cfa) and polysorbate (Tween) 80 on acid production and membrane lipid composition in Lactobacillus casei ATCC 334 at low pH. Cells from wild-type and an ATCC 334 cfa knockout mutant were incubated in APT broth medium containing 3 % glucose plus 0.02 or 0.2 % Tween 80. The cultures were allowed to acidify the medium until it reached a target pH (4.5, 4.0, or 3.8), and then the pH was maintained by automatic addition of NH₄OH. Cells were collected at the midpoint of the fermentation for membrane lipid analysis, and media samples were analyzed for lactic and acetic acids when acid production had ceased. There were no significant differences in the quantity of lactic acid produced at different pH values by wild-type or mutant cells grown in APT, but the rate of acid production was reduced as pH declined. APT supplementation with 0.2 % Tween 80 significantly increased the amount of lactic acid produced by wild-type cells at pH 3.8, and the rate of acid production was modestly improved. This effect was not observed with the cfa mutant, which indicated Cfa activity and Tween 80 supplementation were each involved in the significant increase in lactic acid yield observed with wild-type L. casei at pH 3.8.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Structural and evolutionary relationships of “AT-less” type I polyketide synthase ketosynthases
Lohman, Jeremy R.; Ma, Ming; Osipiuk, Jerzy; Nocek, Boguslaw; Kim, Youngchang; Chang, Changsoo; Cuff, Marianne; Mack, Jamey; Bigelow, Lance; Li, Hui; Endres, Michael; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2015-01-01
Acyltransferase (AT)-less type I polyketide synthases (PKSs) break the type I PKS paradigm. They lack the integrated AT domains within their modules and instead use a discrete AT that acts in trans, whereas a type I PKS module minimally contains AT, acyl carrier protein (ACP), and ketosynthase (KS) domains. Structures of canonical type I PKS KS-AT didomains reveal structured linkers that connect the two domains. AT-less type I PKS KSs have remnants of these linkers, which have been hypothesized to be AT docking domains. Natural products produced by AT-less type I PKSs are very complex because of an increased representation of unique modifying domains. AT-less type I PKS KSs possess substrate specificity and fall into phylogenetic clades that correlate with their substrates, whereas canonical type I PKS KSs are monophyletic. We have solved crystal structures of seven AT-less type I PKS KS domains that represent various sequence clusters, revealing insight into the large structural and subtle amino acid residue differences that lead to unique active site topologies and substrate specificities. One set of structures represents a larger group of KS domains from both canonical and AT-less type I PKSs that accept amino acid-containing substrates. One structure has a partial AT-domain, revealing the structural consequences of a type I PKS KS evolving into an AT-less type I PKS KS. These structures highlight the structural diversity within the AT-less type I PKS KS family, and most important, provide a unique opportunity to study the molecular evolution of substrate specificity within the type I PKSs. PMID:26420866
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
2011-07-01
controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins
Directory of Open Access Journals (Sweden)
Manuel Fischer
2017-06-01
Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.
Du, X; Edelstein, D; Brownlee, M
2008-10-01
We determined whether fixed doses of benfotiamine in combination with slow-release alpha-lipoic acid normalise markers of reactive oxygen species-induced pathways of complications in humans. Male participants with and without type 1 diabetes were studied in the General Clinical Research Centre of the Albert Einstein College of Medicine. Glycaemic status was assessed by measuring baseline values of three different indicators of hyperglycaemia. Intracellular AGE formation, hexosamine pathway activity and prostacyclin synthase activity were measured initially, and after 2 and 4 weeks of treatment. In the nine participants with type 1 diabetes, treatment had no effect on any of the three indicators used to assess hyperglycaemia. However, treatment with benfotiamine plus alpha-lipoic acid completely normalised increased AGE formation, reduced increased monocyte hexosamine-modified proteins by 40% and normalised the 70% decrease in prostacyclin synthase activity from 1,709 +/- 586 pg/ml 6-keto-prostaglandin F(1alpha) to 4,696 +/- 533 pg/ml. These results show that the previously demonstrated beneficial effects of these agents on complication-causing pathways in rodent models of diabetic complications also occur in humans with type 1 diabetes.
Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther
2017-06-01
Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro
2004-11-15
Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.
Henritzi, Sandra; Fischer, Manuel; Grininger, Martin; Oreb, Mislav; Boles, Eckhard
2018-01-01
The ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway. The previously engineered short-chain acyl-CoA producing yeast Fas1 R1834K /Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L -1 in a 72-h fermentation. The additional accumulation of 90 mg L -1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L -1 . However, in growth tests concentrations even lower than 50.0 mg L -1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to
Ivontsin, L. A.; Mashkovtseva, E. V.; Nartsissov, Ya R.
2017-11-01
Implications of quantum-mechanical approach to the description of proton transport in biological systems are a tempting subject for an overlapping of fundamental physics and biology. The model of proton transport through the integrated membrane enzyme FoF1-ATP synthase responsible for ATP synthesis was developed. The estimation of the mathematical expectation of the proton transfer time through the half-channel was performed. Observed set of proton pathways through the inlet half-channel showed the nanosecond timescale highly dependable of some amino acid residues. There were proposed two types of crucial amino acids: critically localized (His245) and being a part of energy conserving system (Asp119).
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-11-01
Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different
Salunke, Rahul
2018-05-14
The mitochondrial F-type ATP synthase, a multi-subunit nanomotor, is critical for maintaining cellular ATP levels. In Toxoplasma gondii and other apicomplexan parasites, many subunit components, necessary for proper assembly and functioning of this enzyme, appear to be missing. Here, we report the identification of 20 novel subunits of T. gondii F-type ATP synthase from mass spectrometry analysis of partially purified monomer (~600 kDa) and dimer (>1 MDa) forms of the enzyme. Despite extreme sequence diversification, key FO subunits, a, b and d, can be identified from conserved structural features. Orthologs for these proteins are restricted to apicomplexan, chromerid and dinoflagellate species. Interestingly, their absence in ciliates indicates a major diversion, with respect to subunit composition of this enzyme, within the alveolate clade. Discovery of these highly diversified novel components of the apicomplexan F-type ATP synthase complex will facilitate the development of novel anti-parasitic agents. Structural and functional characterization of this unusual enzyme complex will advance our fundamental understanding of energy metabolism in apicomplexan species.
Salunke, Rahul; Mourier, Tobias; Banerjee, Manidipa; Pain, Arnab; Shanmugam, Dhanasekaran
2018-01-01
The mitochondrial F-type ATP synthase, a multi-subunit nanomotor, is critical for maintaining cellular ATP levels. In Toxoplasma gondii and other apicomplexan parasites, many subunit components, necessary for proper assembly and functioning of this enzyme, appear to be missing. Here, we report the identification of 20 novel subunits of T. gondii F-type ATP synthase from mass spectrometry analysis of partially purified monomer (~600 kDa) and dimer (>1 MDa) forms of the enzyme. Despite extreme sequence diversification, key FO subunits, a, b and d, can be identified from conserved structural features. Orthologs for these proteins are restricted to apicomplexan, chromerid and dinoflagellate species. Interestingly, their absence in ciliates indicates a major diversion, with respect to subunit composition of this enzyme, within the alveolate clade. Discovery of these highly diversified novel components of the apicomplexan F-type ATP synthase complex will facilitate the development of novel anti-parasitic agents. Structural and functional characterization of this unusual enzyme complex will advance our fundamental understanding of energy metabolism in apicomplexan species.
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Discriminating the reaction types of plant type III polyketide synthases.
Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu
2017-07-01
Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
7.5-Å cryo-em structure of the mycobacterial fatty acid synthase.
Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc
2013-03-11
The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.
2010-01-01
Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010
Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A
2011-01-01
Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.
Yuzawa, Satoshi; Keasling, Jay D; Katz, Leonard
2017-04-01
Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. We have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.
Energy Technology Data Exchange (ETDEWEB)
Yuzawa, Satoshi [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Keasling, Jay D. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Univ. of California, Berkeley, CA (United States). QB3 Inst.; Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States). Dept. of Bioengineering; Univ. of California, Berkeley, CA (United States). Dept. of Chemical and Biomolecular Engineering; Technical Univ. of Denmark, Horsholm (Denmark). Novo Nordisk Foundation Center for Biosustainability; Katz, Leonard [Univ. of California, Berkeley, CA (United States). QB3 Inst.
2016-11-16
Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. Finally, we have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Cross-species complementation of bacterial- and eukaryotic-type cardiolipin synthases
Directory of Open Access Journals (Sweden)
Petra Gottier
2017-11-01
Full Text Available The glycerophospholipid cardiolipin is a unique constituent of bacterial and mitochondrial membranes. It is involved in forming and stabilizing high molecular mass membrane protein complexes and in maintaining membrane architecture. Absence of cardiolipin leads to reduced efficiency of the electron transport chain, decreased membrane potential, and, ultimately, impaired respiratory metabolism. For the protozoan parasite Trypanosoma brucei cardiolipin synthesis is essential for survival, indicating that the enzymes involved in cardiolipin production represent potential drug targets. T. brucei cardiolipin synthase (TbCLS is unique as it belongs to the family of phospholipases D (PLD, harboring a prokaryotic-type cardiolipin synthase (CLS active site domain. In contrast, most other eukaryotic CLS, including the yeast ortholog ScCrd1, are members of the CDP-alcohol phosphatidyl transferase family. To study if these mechanistically distinct CLS enzymes are able to catalyze cardiolipin production in a cell that normally expresses a different type of CLS, we expressed TbCLS and ScCrd1 in CLS-deficient yeast and trypanosome strains, respectively. Our results show that TbCLS complemented cardiolipin production in CRD1 knockout yeast and partly restored wild-type colony forming capability under stress conditions. Remarkably, CL remodeling appeared to be impaired in the transgenic construct, suggesting that CL production and remodeling are tightly coupled processes that may require a clustering of the involved proteins into specific CL-synthesizing domains. In contrast, no complementation was observed by heterologous expression of ScCrd1 in conditional TbCLS knockout trypanosomes, despite proper mitochondrial targeting of the protein.
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Inhibition of fatty acid synthase prevents preadipocyte differentiation
International Nuclear Information System (INIS)
Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.
2005-01-01
Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Energy Technology Data Exchange (ETDEWEB)
Hopperton, Kathryn E., E-mail: kathryn.hopperton@mail.utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: robin.duncan@uwaterloo.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: richard.bazinet@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: m.archer@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare
International Nuclear Information System (INIS)
Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.
2014-01-01
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of
Directory of Open Access Journals (Sweden)
Mallika V
2010-03-01
Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.
International Nuclear Information System (INIS)
Chang, Soo-Ik; Hammes, G.G.
1989-01-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Tsuyoshi; Noguchi, Hiroshi [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: ssugio@rc.m-kagaku.co.jp [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: ssugio@rc.m-kagaku.co.jp [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: ssugio@rc.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2006-09-01
Pentaketide chromone synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 1.6 Å. Pentaketide chromone synthase (PCS) from Aloe arborescens is a novel plant-specific type III polyketide synthase that catalyzes the formation of 5,7-dihydroxy-2-methylchromone from five molecules of malonyl-CoA. Recombinant PCS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 73.2, b = 88.4, c = 70.0 Å, α = γ = 90.0, β = 95.6°. Diffraction data were collected to 1.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Producing biofuels using polyketide synthases
Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D
2013-04-16
The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.
Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.
Directory of Open Access Journals (Sweden)
Damien Garrido
2015-02-01
Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell
Dysregulation of muscle glycogen synthase in recovery from exercise in type 2 diabetes
DEFF Research Database (Denmark)
Pedersen, Andreas J T; Hingst, Janne Rasmuss; Friedrichsen, Martin
2015-01-01
AIMS/HYPOTHESIS: Insulin and exercise stimulate skeletal muscle glycogen synthase (GS) activity by dephosphorylation and changes in kinetic properties. The aim of this study was to investigate the effects of insulin, exercise and post-exercise insulin stimulation on GS phosphorylation, activity a...... and increased phosphorylation at sites 2 + 2a in type 2 diabetes in the recovery period imply an impaired response to exercise....
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wang, Xiaohui; Zhang, Zhongxiu; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Gao, Bowen; Wang, Jinling; Zhang, Le; Wang, Juan; Shi, Shepo; Tu, Pengfei
2017-01-01
Type III polyketide synthases (PKSs) play an important role in biosynthesis of various plant secondary metabolites and plant adaptation to environmental stresses. Aquilaria sinensis (A. sinensis) is the main plant species for production of agarwood, little is known about its PKS family. In this study, AsCHS1 and two new type III PKSs, AsPKS1 and AsPKS2, were isolated and characterized in A. sinensis calli. The comparative sequence and phylogenetic analysis indicated that AsPKS1 and AsPKS2 belonged to non-CHS group different from AsCHS1. The recombinant AsPKS1 and AsPKS2 produced the lactone-type products, suggesting their different enzyme activities from AsCHS1. Three PKS genes had a tissues-specific pattern in A. sinensis. Moreover, we examined the expression profiles of three PKS genes in calli under different abiotic stresses and hormone treatments. AsCHS1 transcript was most significantly induced by salt stress, AsPKS1 abundance was most remarkably enhanced by CdCl 2 treatment, while AsPKS2 expression was most significantly induced by mannitol treatment. Furthermore, AsCHS1, AsPKS1 and AsPKS2 expression was enhanced upon gibberellins (GA3), methyl jasmonate (MeJA), or salicylic acid (SA) treatment, while three PKS genes displayed low transcript levels at the early stage under abscisic acid (ABA) treatment. In addition, three GFP:PKSs fusion proteins were localized in the cytoplasm and cell wall in Nicotiana benthamiana cells. These results indicated the multifunctional role of three type III PKSs in polyketide biosynthesis, plant resistance to abiotic stresses and signal transduction. - Highlights: • Two new PKS genes (AsPKS1 and AsPKS2) were isolated and characterized from A. sinensis. • The recombinant AsPKS1 and AsPKS2 catalyzed lactone-type products in vitro. • AsCHS1, AsPKS1 and AsPKS2 were involved in plant responses to abiotic stresses and hormone stimuli. • Our results also indicated that AsCHS1, AsPKS1 and AsPKS2 were predominantly localized
DEFF Research Database (Denmark)
Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck
2003-01-01
In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...
Energy Technology Data Exchange (ETDEWEB)
Hossain, Mohammad Salim; Chowdhury, Abu Asad; Rahman, Mohammad Sharifur [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Nishimura, Kohji [Department of Molecular and Functional Genomics, Center for Integrated Research in Science, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Jisaka, Mitsuo; Nagaya, Tsutomu [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Shono, Fumiaki [Department of Clinical Pharmacy, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, 180 Yamashiro-cho, Tokushima-shi, Tokushima 770-8514 (Japan); Yokota, Kazushige, E-mail: yokotaka@life.shimane-u.ac.jp [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan)
2012-02-15
Lipocalin-type prostaglandin D synthase (L-PGDS) expressed preferentially in adipocytes is responsible for the synthesis of PGD{sub 2} and its non-enzymatic dehydration products, PGJ{sub 2} series, serving as pro-adipogenic factors. However, the role of L-PGDS in the regulation of adipogenesis is complex because of the occurrence of several derivatives from PGD{sub 2} and their distinct receptor subtypes as well as other functions such as a transporter of lipophilic molecules. To manipulate the expression levels of L-PGDS in cultured adipocytes, cultured preadipogenic 3T3-L1 cells were transfected stably with a mammalian expression vector having cDNA encoding murine L-PGDS oriented in the sense direction. The isolated cloned stable transfectants with L-PGDS expressed higher levels of the transcript and protein levels of L-PGDS, and synthesized PGD{sub 2} from exogenous arachidonic acid at significantly higher levels. By contrast, the synthesis of PGE{sub 2} remained unchanged, indicating no influence on the reactions of cyclooxygenase (COX) and PGE synthase. Furthermore, the ability of those transfectants to synthesize {Delta}{sup 12}-PGJ{sub 2} increased more greatly during the maturation phase. The sustained expression of L-PGDS in cultured stable transfectants hampered the storage of fats during the maturation phase of adipocytes, which was accompanied by the reduced gene expression of adipocyte-specific markers reflecting the down-regulation of the adipogenesis program. The suppressed adipogenesis was not rescued by either exogenous aspirin or peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists including troglitazone and {Delta}{sup 12}-PGJ{sub 2}. Taken together, the results indicate the negative regulation of the adipogenesis program by the enhanced expression of L-PGDS through a cellular mechanism involving the interference of the PPAR{gamma} signaling pathway without the contribution of endogenous pro-adipogenic prostanoids
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.
Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian
2010-10-01
According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the
Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe
2015-08-01
Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Santoso, D; Thornburg, R
2000-08-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Santoso, Djoko; Thornburg, Robert
2000-01-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Højlund, Kurt; Wrzesinski, Krzysztof; Larsen, Peter Mose
2003-01-01
quantitate a large number of proteins and their post-translational modifications simultaneously and is a powerful tool to study polygenic diseases like type 2 diabetes. Using this approach on human skeletal muscle biopsies, we have identified eight potential protein markers for type 2 diabetes in the fasting...... synthase beta-subunit phosphoisoform in diabetic muscle correlated inversely with fasting plasma glucose levels. These data suggest a role for phosphorylation of ATP synthase beta-subunit in the regulation of ATP synthesis and that alterations in the regulation of ATP synthesis and cellular stress proteins...
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Energy Technology Data Exchange (ETDEWEB)
Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)
2015-08-07
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.
International Nuclear Information System (INIS)
Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin
2015-01-01
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens
Directory of Open Access Journals (Sweden)
Mahiran Basri
2012-08-01
Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Trujillo, Uldaeliz
2013-02-28
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Directory of Open Access Journals (Sweden)
Uldaeliz Trujillo
Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of
Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel
2013-01-01
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Zirpel, Bastian; Stehle, Felix; Kayser, Oliver
2015-09-01
The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
p63 promotes cell survival through fatty acid synthase.
Directory of Open Access Journals (Sweden)
Venkata Sabbisetti
2009-06-01
Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.
Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg
2013-02-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.
A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.
Directory of Open Access Journals (Sweden)
Sarah Schulz
Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.
Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J
2012-01-01
In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Directory of Open Access Journals (Sweden)
Rawat Richa
2011-05-01
Full Text Available Abstract Background Cyclopropane fatty acids (CPA have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.
Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A
2018-04-03
5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
The crystal structure of human GDP-L-fucose synthase.
Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua
2013-09-01
Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.
Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid
Energy Technology Data Exchange (ETDEWEB)
Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD
2015-10-26
Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.
Use of linalool synthase in genetic engineering of scent production
Pichersky, Eran
1998-01-01
A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase
DEFF Research Database (Denmark)
Jensen, L; Andersen, L L; Schrøder, H D
2015-01-01
Trapezius myalgia is the most common type of chronic neck pain. While physical exercise reduces pain and improves muscle function, the underlying mechanisms remain unclear. Nitric oxide (NO) signaling is important in modulating cellular function, and a dysfunctional neuronal NO synthase (nNOS) ma...
Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2
Energy Technology Data Exchange (ETDEWEB)
Petry, T.W.; Krauss, R.S.; Eling, T.E.
1986-08-01
We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
Hopperton, Kathryn E; Duncan, Robin E; Bazinet, Richard P; Archer, Michael C
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from (14)C-labeled acetate to those supplied exogenously as (14)C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2-3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A
2017-09-01
Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.
Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G
1998-06-09
Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice
International Nuclear Information System (INIS)
Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.
2006-01-01
α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
DEFF Research Database (Denmark)
Yuzawa, Satoshi; Keasling, Jay D.; Katz, Leonard
2017-01-01
Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containin...... have applications as fuels or industrial chemicals....
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
Directory of Open Access Journals (Sweden)
Abeer Abousaab
2016-12-01
Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
Molecular cloning and characterization of strictosidine synthase, a ...
African Journals Online (AJOL)
Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...
Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J
2016-06-15
Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.
Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg
2013-01-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714
Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun
2016-11-16
The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.
International Nuclear Information System (INIS)
Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi
2008-01-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1
Energy Technology Data Exchange (ETDEWEB)
Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)
2008-03-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.
Directory of Open Access Journals (Sweden)
Mario A Cabrera-Salazar
Full Text Available Neuropathic Gaucher disease (nGD, also known as type 2 or type 3 Gaucher disease, is caused by a deficiency of the enzyme glucocerebrosidase (GC. This deficiency impairs the degradation of glucosylceramide (GluCer and glucosylsphingosine (GluSph, leading to their accumulation in the brains of patients and mouse models of the disease. These accumulated substrates have been thought to cause the severe neuropathology and early death observed in patients with nGD and mouse models. Substrate accumulation is evident at birth in both nGD mouse models and humans affected with the most severe type of the disease. Current treatment of non-nGD relies on the intravenous delivery of recombinant human glucocerebrosidase to replace the missing enzyme or the administration of glucosylceramide synthase inhibitors to attenuate GluCer production. However, the currently approved drugs that use these mechanisms do not cross the blood brain barrier, and thus are not expected to provide a benefit for the neurological complications in nGD patients. Here we report the successful reduction of substrate accumulation and CNS pathology together with a significant increase in lifespan after systemic administration of a novel glucosylceramide synthase inhibitor to a mouse model of nGD. To our knowledge this is the first compound shown to cross the blood brain barrier and reduce substrates in this animal model while significantly enhancing its lifespan. These results reinforce the concept that systemically administered glucosylceramide synthase inhibitors could hold enhanced therapeutic promise for patients afflicted with neuropathic lysosomal storage diseases.
Cabrera-Salazar, Mario A; Deriso, Matthew; Bercury, Scott D; Li, Lingyun; Lydon, John T; Weber, William; Pande, Nilesh; Cromwell, Mandy A; Copeland, Diane; Leonard, John; Cheng, Seng H; Scheule, Ronald K
2012-01-01
Neuropathic Gaucher disease (nGD), also known as type 2 or type 3 Gaucher disease, is caused by a deficiency of the enzyme glucocerebrosidase (GC). This deficiency impairs the degradation of glucosylceramide (GluCer) and glucosylsphingosine (GluSph), leading to their accumulation in the brains of patients and mouse models of the disease. These accumulated substrates have been thought to cause the severe neuropathology and early death observed in patients with nGD and mouse models. Substrate accumulation is evident at birth in both nGD mouse models and humans affected with the most severe type of the disease. Current treatment of non-nGD relies on the intravenous delivery of recombinant human glucocerebrosidase to replace the missing enzyme or the administration of glucosylceramide synthase inhibitors to attenuate GluCer production. However, the currently approved drugs that use these mechanisms do not cross the blood brain barrier, and thus are not expected to provide a benefit for the neurological complications in nGD patients. Here we report the successful reduction of substrate accumulation and CNS pathology together with a significant increase in lifespan after systemic administration of a novel glucosylceramide synthase inhibitor to a mouse model of nGD. To our knowledge this is the first compound shown to cross the blood brain barrier and reduce substrates in this animal model while significantly enhancing its lifespan. These results reinforce the concept that systemically administered glucosylceramide synthase inhibitors could hold enhanced therapeutic promise for patients afflicted with neuropathic lysosomal storage diseases.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Directory of Open Access Journals (Sweden)
Nathan Hodson
2017-12-01
Full Text Available The branch chain amino acid leucine is a potent stimulator of protein synthesis in skeletal muscle. Leucine rapidly enters the cell via the L-Type Amino Acid Transporter 1 (LAT1; however, little is known regarding the localisation and distribution of this transporter in human skeletal muscle. Therefore, we applied immunofluorescence staining approaches to visualise LAT1 in wild type (WT and LAT1 muscle-specific knockout (mKO mice, in addition to basal human skeletal muscle samples. LAT1 positive staining was visually greater in WT muscles compared to mKO muscle. In human skeletal muscle, positive LAT1 staining was noted close to the sarcolemmal membrane (dystrophin positive staining, with a greater staining intensity for LAT1 observed in the sarcoplasmic regions of type II fibres (those not stained positively for myosin heavy-chain 1, Type II—25.07 ± 5.93, Type I—13.71 ± 1.98, p < 0.01, suggesting a greater abundance of this protein in these fibres. Finally, we observed association with LAT1 and endothelial nitric oxide synthase (eNOS, suggesting LAT1 association close to the microvasculature. This is the first study to visualise the distribution and localisation of LAT1 in human skeletal muscle. As such, this approach provides a validated experimental platform to study the role and regulation of LAT1 in human skeletal muscle in response to various physiological and pathophysiological models.
Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S
2008-02-01
Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.
Thermodynamic and NMR analyses of NADPH binding to lipocalin-type prostaglandin D synthase
International Nuclear Information System (INIS)
Qin, Shubin; Shimamoto, Shigeru; Maruno, Takahiro; Kobayashi, Yuji; Kawahara, Kazuki; Yoshida, Takuya; Ohkubo, Tadayasu
2015-01-01
Lipocalin-type prostaglandin D synthase (L-PGDS) is one of the most abundant proteins in human cerebrospinal fluid (CSF) with dual functions as a prostaglandin D_2 (PGD_2) synthase and a transporter of lipophilic ligands. Recent studies revealed that L-PGDS plays important roles in protecting against various neuronal diseases induced by reactive oxygen species (ROS). However, the molecular mechanisms of such protective actions of L-PGDS remain unknown. In this study, we conducted thermodynamic and nuclear magnetic resonance (NMR) analyses, and demonstrated that L-PGDS binds to nicotinamide coenzymes, including NADPH, NADP"+, and NADH. Although a hydrophilic ligand is not common for L-PGDS, these ligands, especially NADPH showed specific interaction with L-PGDS at the upper pocket of its ligand-binding cavity with an unusually bifurcated shape. The binding affinity of L-PGDS for NADPH was comparable to that previously reported for NADPH oxidases and NADPH in vitro. These results suggested that L-PGDS potentially attenuates the activities of NADPH oxidases through interaction with NADPH. Given that NADPH is the substrate for NADPH oxidases that play key roles in neuronal cell death by generating excessive ROS, these results imply a novel linkage between L-PGDS and ROS. - Highlights: • Interactions of L-PGDS with nicotinamide coenzymes were studied by ITC and NMR. • The binding affinity of L-PGDS was strongest to NADPH among nicotinamide coenzymes. • NADPH binds to the upper part of L-PGDS ligand-binding cavity. • L-PGDS binds to both lipophilic and hydrophilic ligands. • This study implies a novel linkage between L-PGDS and reactive oxygen species.
Thermodynamic and NMR analyses of NADPH binding to lipocalin-type prostaglandin D synthase
Energy Technology Data Exchange (ETDEWEB)
Qin, Shubin [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Shimamoto, Shigeru [Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashi-Osaka, Osaka 577-8502 (Japan); Maruno, Takahiro; Kobayashi, Yuji [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kawahara, Kazuki; Yoshida, Takuya [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ohkubo, Tadayasu, E-mail: ohkubo@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2015-12-04
Lipocalin-type prostaglandin D synthase (L-PGDS) is one of the most abundant proteins in human cerebrospinal fluid (CSF) with dual functions as a prostaglandin D{sub 2} (PGD{sub 2}) synthase and a transporter of lipophilic ligands. Recent studies revealed that L-PGDS plays important roles in protecting against various neuronal diseases induced by reactive oxygen species (ROS). However, the molecular mechanisms of such protective actions of L-PGDS remain unknown. In this study, we conducted thermodynamic and nuclear magnetic resonance (NMR) analyses, and demonstrated that L-PGDS binds to nicotinamide coenzymes, including NADPH, NADP{sup +}, and NADH. Although a hydrophilic ligand is not common for L-PGDS, these ligands, especially NADPH showed specific interaction with L-PGDS at the upper pocket of its ligand-binding cavity with an unusually bifurcated shape. The binding affinity of L-PGDS for NADPH was comparable to that previously reported for NADPH oxidases and NADPH in vitro. These results suggested that L-PGDS potentially attenuates the activities of NADPH oxidases through interaction with NADPH. Given that NADPH is the substrate for NADPH oxidases that play key roles in neuronal cell death by generating excessive ROS, these results imply a novel linkage between L-PGDS and ROS. - Highlights: • Interactions of L-PGDS with nicotinamide coenzymes were studied by ITC and NMR. • The binding affinity of L-PGDS was strongest to NADPH among nicotinamide coenzymes. • NADPH binds to the upper part of L-PGDS ligand-binding cavity. • L-PGDS binds to both lipophilic and hydrophilic ligands. • This study implies a novel linkage between L-PGDS and reactive oxygen species.
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
DEFF Research Database (Denmark)
Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.
1999-01-01
cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...
Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.
Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George
2017-09-01
Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Directory of Open Access Journals (Sweden)
Häberle J
2011-08-01
Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia
International Nuclear Information System (INIS)
Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.
2006-01-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase
Energy Technology Data Exchange (ETDEWEB)
Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)
2006-03-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.
International Nuclear Information System (INIS)
Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua
2010-01-01
Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing
2017-12-01
Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate
DEFF Research Database (Denmark)
González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael
2010-01-01
The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.
Directory of Open Access Journals (Sweden)
Anna Zdyb
Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.
Andrade, Warrison A.; Agarwal, Sarika; Mo, Shunyan; Shaffer, Scott A.; Dillard, Joseph P.; Schmidt, Tobias; Hornung, Veit; Fitzgerald, Katherine A.; Kurt-Jones, Evelyn A.; Golenbock, Douglas T.
2016-01-01
The innate immune system is the first line of defense against Neisseria gonorrhoeae (GC). Exposure of cells to GC lipooligosaccharides induces a strong immune response, leading to type I interferon (IFN) production via TLR4/MD-2. In addition to living freely in the extracellular space, GC can invade the cytoplasm to evade detection and elimination. Double-stranded DNA introduced into the cytosol binds and activates the enzyme cyclic-GMP-AMP synthase (cGAS), which produces 2′3′-cGAMP and trigg...
Substrate promiscuity of a rosmarinic acid synthase from lavender (Lavandula angustifolia L.).
Landmann, Christian; Hücherig, Stefanie; Fink, Barbara; Hoffmann, Thomas; Dittlein, Daniela; Coiner, Heather A; Schwab, Wilfried
2011-08-01
One of the most common types of modification of secondary metabolites is the acylation of oxygen- and nitrogen-containing substrates to produce esters and amides, respectively. Among the known acyltransferases, the members of the plant BAHD family are capable of acylating a wide variety of substrates. Two full-length acyltransferase cDNAs (LaAT1 and 2) were isolated from lavender flowers (Lavandula angustifolia L.) by reverse transcriptase-PCR using degenerate primers based on BAHD sequences. Recombinant LaAT1 exhibited a broad substrate tolerance accepting (hydroxy)cinnamoyl-CoAs as acyl donors and not only tyramine, tryptamine, phenylethylamine and anthranilic acid but also shikimic acid and 4-hydroxyphenyllactic acid as acceptors. Thus, LaLT1 forms esters and amides like its phylogenetic neighbors. In planta LaAT1 might be involved in the biosynthesis of rosmarinic acid, the ester of caffeic acid and 3,4-dihydroxyphenyllactic acid, a major constituent of lavender flowers. LaAT2 is one of three members of clade VI with unknown function.
Directory of Open Access Journals (Sweden)
Nataliya E Chorna
Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.
Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C
2010-08-10
Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.
Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang
2008-10-24
The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay
2017-05-07
Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
DEFF Research Database (Denmark)
Beck-Nielsen, Henning
2012-01-01
This review deals with the role of glycogen storage in skeletal muscle for the development of insulin resistance and type 2 diabetes. Specifically, the role of the enzyme glycogen synthase, which seems to be locked in its hyperphosphorylated and inactivated state, is discussed. This defect seems ...... to be secondary to ectopic lipid disposition in the muscle cells. These molecular defects are discussed in the context of the overall pathophysiology of hyperglycemia in type 2 diabetic subjects. Copyright © 2012 John Wiley & Sons, Ltd....
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Directory of Open Access Journals (Sweden)
Gaetano Castaldo
2005-01-01
Full Text Available Interactions between proteins that form the ’minimal’ type II polyketide synthase in the doxorubicin producing biosynthetic pathway from Streptomyces peucetius were investigated using a yeast two-hybrid system (Y2H. Proteins that function as the so called ’chain length factor’ (DpsB and putative transacylase (DpsD were found to interact with the ketosynthase subunit (DpsA, which can also interact with itself. On the basis of these results we propose a head-to-tail homodimeric structure, which is consistent with previously published in vivo mutagenesis studies. No interactions were found between the acyl-carrier protein (DpsG and any of the other constituents of the complex, however, transient interactions, not detectable using the Y2H system, cannot be discounted and warrant further investigation.
Kalaitzis, John A; Cheng, Qian; Meluzzi, Dario; Xiang, Longkuan; Izumikawa, Miho; Dorrestein, Pieter C; Moore, Bradley S
2011-11-15
Enterocin is an atypical type II polyketide synthase (PKS) product from the marine actinomycete 'Streptomyces maritimus'. The enterocin biosynthesis gene cluster (enc) codes for proteins involved in the assembly and attachment of the rare benzoate primer that initiates polyketide assembly with the addition of seven malonate molecules and culminates in a Favorskii-like rearrangement of the linear poly-β-ketone to give its distinctive non-aromatic, caged core structure. Fundamental to enterocin biosynthesis, which utilizes a single acyl carrier protein (ACP), EncC, for both priming with benzoate and elongating with malonate, involves maintaining the correct balance of acyl-EncC substrates for efficient polyketide assembly. Here, we report the characterization of EncL as a type II thioesterase that functions to edit starter unit (mis)priming of EncC. We performed a series of in vivo mutational studies, heterologous expression experiments, in vitro reconstitution studies, and Fourier-transform mass spectrometry-monitored competitive enzyme assays that together support the proposed selective hydrolase activity of EncL toward misprimed acetyl-ACP over benzoyl-ACP to facilitate benzoyl priming of the enterocin PKS complex. While this system resembles the R1128 PKS that also utilizes an editing thioesterase (ZhuC) to purge acetate molecules from its initiation module ACP in favor of alkylacyl groups, the enterocin system is distinct in its usage of a single ACP for both priming and elongating reactions with different substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
International Nuclear Information System (INIS)
Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki
2012-01-01
The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Andrade, Warrison A; Agarwal, Sarika; Mo, Shunyan; Shaffer, Scott A; Dillard, Joseph P; Schmidt, Tobias; Hornung, Veit; Fitzgerald, Katherine A; Kurt-Jones, Evelyn A; Golenbock, Douglas T
2016-06-14
The innate immune system is the first line of defense against Neisseria gonorrhoeae (GC). Exposure of cells to GC lipooligosaccharides induces a strong immune response, leading to type I interferon (IFN) production via TLR4/MD-2. In addition to living freely in the extracellular space, GC can invade the cytoplasm to evade detection and elimination. Double-stranded DNA introduced into the cytosol binds and activates the enzyme cyclic-GMP-AMP synthase (cGAS), which produces 2'3'-cGAMP and triggers STING/TBK-1/IRF3 activation, resulting in type I IFN expression. Here, we reveal a cytosolic response to GC DNA that also contributes to type I IFN induction. We demonstrate that complete IFN-β induction by live GC depends on both cGAS and TLR4. Type I IFN is detrimental to the host, and dysregulation of iron homeostasis genes may explain lower bacteria survival in cGAS(-/-) and TLR4(-/-) cells. Collectively, these observations reveal cooperation between TLRs and cGAS in immunity to GC infection. Copyright © 2016. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Warrison A. Andrade
2016-06-01
Full Text Available The innate immune system is the first line of defense against Neisseria gonorrhoeae (GC. Exposure of cells to GC lipooligosaccharides induces a strong immune response, leading to type I interferon (IFN production via TLR4/MD-2. In addition to living freely in the extracellular space, GC can invade the cytoplasm to evade detection and elimination. Double-stranded DNA introduced into the cytosol binds and activates the enzyme cyclic-GMP-AMP synthase (cGAS, which produces 2′3′-cGAMP and triggers STING/TBK-1/IRF3 activation, resulting in type I IFN expression. Here, we reveal a cytosolic response to GC DNA that also contributes to type I IFN induction. We demonstrate that complete IFN-β induction by live GC depends on both cGAS and TLR4. Type I IFN is detrimental to the host, and dysregulation of iron homeostasis genes may explain lower bacteria survival in cGAS−/− and TLR4−/− cells. Collectively, these observations reveal cooperation between TLRs and cGAS in immunity to GC infection.
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Directory of Open Access Journals (Sweden)
Debjani Saha
Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Zhang, Junmei; Corbett, John R; Plymire, Daniel A; Greenberg, Benjamin M; Patrie, Steven M
2014-05-01
Lipocalin-type prostaglandin D-synthase (L-PGDS) in cerebrospinal fluid contributes to the maturation and maintenance of the CNS. L-PGDS PTMs may contribute to pathobiology of different CNS diseases, but methods to monitor its proteoforms are limited. Herein, we combined off-gel IEF and superficially porous LC (SPLC) with Fourier transform MS to characterize common cerebrospinal fluid L-PGDS proteoforms. Across 3D physiochemical space (pI, hydrophobicity, and mass), 217 putative proteoforms were observed from 21 to 24 kDa and pI 5-10. Glycoprotein accurate mass information, combined with MS/MS analysis of peptides generated from 2D-fractionated proteoforms, enabled the putative assignment of 208 proteoforms with varied PTM positional occupants. Fifteen structurally related N-glycans at N29 and N56 were observed, with different N-glycan compositional variants being preferred on each amino acid. We also observed that sialic acid content was a major factor for pI shifts between L-PGDS proteoforms. Other putative PTMs characterized include a core-1 HexHexNAc-O-glycan at S7, acetylation at K16 and K138, sulfonation at S41 and T142, and dioxidation at C43 and C145. The IEF-SPLC-MS platform presented provides 30-40× improved peak capacity versus conventional 2DE and shows potential for repeatable proteoform analysis of surrogate PTM-based biomarkers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Aditya Dev
2013-06-01
Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme
Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-01-01
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968
Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.
2004-01-01
Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674
Ogawa, Hiroyasu; Hatano, Sonoko; Sugiura, Nobuo; Nagai, Naoko; Sato, Takashi; Shimizu, Katsuji; Kimata, Koji; Narimatsu, Hisashi; Watanabe, Hideto
2012-01-01
Chondroitin sulfate (CS) is a linear polysaccharide consisting of repeating disaccharide units of N-acetyl-D-galactosamine and D-glucuronic acid residues, modified with sulfated residues at various positions. Based on its structural diversity in chain length and sulfation patterns, CS provides specific biological functions in cell adhesion, morphogenesis, neural network formation, and cell division. To date, six glycosyltransferases are known to be involved in the biosynthesis of chondroitin saccharide chains, and a hetero-oligomer complex of chondroitin sulfate synthase-1 (CSS1)/chondroitin synthase-1 and chondroitin sulfate synthase-2 (CSS2)/chondroitin polymerizing factor is known to have the strongest polymerizing activity. Here, we generated and analyzed CSS2(-/-) mice. Although they were viable and fertile, exhibiting no overt morphological abnormalities or osteoarthritis, their cartilage contained CS chains with a shorter length and at a similar number to wild type. Further analysis using CSS2(-/-) chondrocyte culture systems, together with siRNA of CSS1, revealed the presence of two CS chain species in length, suggesting two steps of CS chain polymerization; i.e., elongation from the linkage region up to Mr ∼10,000, and further extension. There, CSS2 mainly participated in the extension, whereas CSS1 participated in both the extension and the initiation. Our study demonstrates the distinct function of CSS1 and CSS2, providing a clue in the elucidation of the mechanism of CS biosynthesis.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V
2004-01-30
C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
Directory of Open Access Journals (Sweden)
Sheo B Singh
Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.
Molecular cloning and functional characterization of porcine cyclic GMP-AMP synthase.
Wang, Jiang; Chu, Beibei; Du, Lili; Han, Yingqian; Zhang, Xuemei; Fan, Shuangshuang; Wang, Yueying; Yang, Guoyu
2015-06-01
Cyclic GMP-AMP synthase (cGAS), which belongs to the nucleotidyltransferase family, recognizes cytosolic DNA and induces the type I interferon (IFN) pathway through the synthesis of the second messenger cGAMP. In this study, porcine cGAS (p-cGAS) was identified and its tissue distribution, subcellular localization, and functions in innate immunity were characterized. The coding sequence of p-cGAS is 1494 bp long, encodes 497 amino acids, and is most similar (74%) to Bos taurus cGAS. p-cGAS mRNA is abundant in the spleen, duodenum, jejunum, and ileum. The subcellular distribution of p-cGAS is not only in the cytosol, but also on the endoplasmic reticulum (ER) membrane. The overexpression of wild-type p-cGAS in porcine kidney epithelial cells, but not its catalytically inactive mutants, induced IFN-β expression, which was dependent on STING and IRF3. However, the downregulation of p-cGAS by RNA interference markedly reduced IFN-β expression after pseudorabies virus (PRV) infection or poly(dA:dT) transfection. These results demonstrate that p-cGAS is an important DNA sensor, required for IFN-β activation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila
Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.
The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are
Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.
2015-01-01
Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039
Cyclic GMP-AMP Synthase is a Cytosolic DNA Sensor that Activates the Type-I Interferon Pathway
Sun, Lijun; Wu, Jiaxi; Du, Fenghe; Chen, Xiang; Chen, Zhijian J.
2013-01-01
The presence of DNA in the cytoplasm of mammalian cells is a danger signal that triggers the host immune responses such as the production of type-I interferons (IFN). Cytosolic DNA induces IFN through the production of cyclic-GMP-AMP (cGAMP), which binds to and activates the adaptor protein STING. Through biochemical fractionation and quantitative mass spectrometry, we identified a cGAMP synthase (cGAS), which belongs to the nucleotidyltransferase family. Overexpression of cGAS activated the transcription factor IRF3 and induced IFNβ in a STING-dependent manner. Knockdown of cGAS inhibited IRF3 activation and IFNβ induction by DNA transfection or DNA virus infection. cGAS bound to DNA in the cytoplasm and catalyzed cGAMP synthesis. These results indicate that cGAS is a cytosolic DNA sensor that induces interferons by producing the second messenger cGAMP. PMID:23258413
Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.
Sun, Lijun; Wu, Jiaxi; Du, Fenghe; Chen, Xiang; Chen, Zhijian J
2013-02-15
The presence of DNA in the cytoplasm of mammalian cells is a danger signal that triggers host immune responses such as the production of type I interferons. Cytosolic DNA induces interferons through the production of cyclic guanosine monophosphate-adenosine monophosphate (cyclic GMP-AMP, or cGAMP), which binds to and activates the adaptor protein STING. Through biochemical fractionation and quantitative mass spectrometry, we identified a cGAMP synthase (cGAS), which belongs to the nucleotidyltransferase family. Overexpression of cGAS activated the transcription factor IRF3 and induced interferon-β in a STING-dependent manner. Knockdown of cGAS inhibited IRF3 activation and interferon-β induction by DNA transfection or DNA virus infection. cGAS bound to DNA in the cytoplasm and catalyzed cGAMP synthesis. These results indicate that cGAS is a cytosolic DNA sensor that induces interferons by producing the second messenger cGAMP.
Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T
2016-03-01
Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.
Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai
2013-04-01
An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Directory of Open Access Journals (Sweden)
Amro Abd al fattah Amara
2012-04-01
Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B
2015-04-01
Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.
Scheirlinck, Ilse; Van der Meulen, Roel; Van Schoor, Ann; Vancanneyt, Marc; De Vuyst, Luc; Vandamme, Peter; Huys, Geert
2007-10-01
A culture-based approach was used to investigate the diversity of lactic acid bacteria (LAB) in Belgian traditional sourdoughs and to assess the influence of flour type, bakery environment, geographical origin, and technological characteristics on the taxonomic composition of these LAB communities. For this purpose, a total of 714 LAB from 21 sourdoughs sampled at 11 artisan bakeries throughout Belgium were subjected to a polyphasic identification approach. The microbial composition of the traditional sourdoughs was characterized by bacteriological culture in combination with genotypic identification methods, including repetitive element sequence-based PCR fingerprinting and phenylalanyl-tRNA synthase (pheS) gene sequence analysis. LAB from Belgian sourdoughs belonged to the genera Lactobacillus, Pediococcus, Leuconostoc, Weissella, and Enterococcus, with the heterofermentative species Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus plantarum, and Lactobacillus pontis as the most frequently isolated taxa. Statistical analysis of the identification data indicated that the microbial composition of the sourdoughs is mainly affected by the bakery environment rather than the flour type (wheat, rye, spelt, or a mixture of these) used. In conclusion, the polyphasic approach, based on rapid genotypic screening and high-resolution, sequence-dependent identification, proved to be a powerful tool for studying the LAB diversity in traditional fermented foods such as sourdough.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors
Directory of Open Access Journals (Sweden)
Daniela Hulcová
2018-03-01
Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.
Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming
2012-01-01
Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808
Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase
International Nuclear Information System (INIS)
Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.
1990-01-01
The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6
Grandvalet, Cosette; Assad-García, Juan Simón; Chu-Ky, Son; Tollot, Marie; Guzzo, Jean; Gresti, Joseph; Tourdot-Maréchal, Raphaëlle
2008-09-01
Cyclopropane fatty acid (CFA) synthesis was investigated in Oenococcus oeni. The data obtained demonstrated that acid-grown cells or cells harvested in the stationary growth phase showed changes in fatty acid composition similar to those of ethanol-grown cells. An increase of the CFA content and a decrease of the oleic acid content were observed. The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases. Quantitative real-time-PCR experiments were performed on the cfa gene of O. oeni, which encodes a putative CFA synthase. The level of cfa transcripts increased when cells were harvested in stationary phase and when cells were grown in the presence of ethanol or at low pH, suggesting transcriptional regulation of the cfa gene under different stress conditions. In contrast to Escherichia coli, only one functional promoter was identified upstream of the cfa gene of O. oeni. The function of the cfa gene was confirmed by complementation of a cfa-deficient E. coli strain. Nevertheless, the complementation remained partial because the conversion percentage of unsaturated fatty acids into CFA of the complemented strain was much lower than that of the wild-type strain. Moreover, a prevalence of cycC19 : 0 was observed in the membrane of the complemented strain. This could be due to a specific affinity of the CFA synthase from O. oeni. In spite of this partial complementation, the complemented strain of E. coli totally recovered its viability after ethanol shock (10 %, v/v) whereas its viability was only partly recovered after an acid shock at pH 3.0.
International Nuclear Information System (INIS)
Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James
2005-01-01
Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...
Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina
2010-06-01
In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Carglumic acid: a second look. Confirmed progress in a rare urea cycle disorder.
2008-04-01
(1) N-acetylglutamate synthase deficiency is a rare congenital disorder that causes hyperammonaemic comas, resulting in severe neurological morbidity and usually leading to death during childhood. (2) Carglumic acid is the first drug to be used for replacement therapy. Data available in 2003 showed beneficial effects on growth and psychomotor development. (3) In 2007, about 20 patients treated with carglumic acid for N-acetyglutamate synthase deficiency, for at least 5 years in half of cases, were all still alive. Their development was normal when treatment was initiated before complications occurred. (4) No serious adverse effects have been observed. (5) In practice, although this treatment has to continue for life, carglumic acid represents a major advance for patients with N-acetylglutamate synthase deficiency.
Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M
2017-07-11
Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced
Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin
Lechner, Matthias; Lirk, Philipp; Rieder, Josef
2005-01-01
Inducible nitric oxide synthase (iNOS) is one of three key enzymes generating nitric oxide (NO) from the amino acid l-arginine. iNOS-derived NO plays an important role in numerous physiological (e.g. blood pressure regulation, wound repair and host defence mechanisms) and pathophysiological
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
International Nuclear Information System (INIS)
Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso
2012-01-01
This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme
Ji, Yingbin; Liu, Jian; Xing, Da
2016-09-01
In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Gagne, Steve J; Stout, Jake M; Liu, Enwu; Boubakir, Zakia; Clark, Shawn M; Page, Jonathan E
2012-07-31
Δ(9)-Tetrahydrocannabinol (THC) and other cannabinoids are responsible for the psychoactive and medicinal properties of Cannabis sativa L. (marijuana). The first intermediate in the cannabinoid biosynthetic pathway is proposed to be olivetolic acid (OA), an alkylresorcinolic acid that forms the polyketide nucleus of the cannabinoids. OA has been postulated to be synthesized by a type III polyketide synthase (PKS) enzyme, but so far type III PKSs from cannabis have been shown to produce catalytic byproducts instead of OA. We analyzed the transcriptome of glandular trichomes from female cannabis flowers, which are the primary site of cannabinoid biosynthesis, and searched for polyketide cyclase-like enzymes that could assist in OA cyclization. Here, we show that a type III PKS (tetraketide synthase) from cannabis trichomes requires the presence of a polyketide cyclase enzyme, olivetolic acid cyclase (OAC), which catalyzes a C2-C7 intramolecular aldol condensation with carboxylate retention to form OA. OAC is a dimeric α+β barrel (DABB) protein that is structurally similar to polyketide cyclases from Streptomyces species. OAC transcript is present at high levels in glandular trichomes, an expression profile that parallels other cannabinoid pathway enzymes. Our identification of OAC both clarifies the cannabinoid pathway and demonstrates unexpected evolutionary parallels between polyketide biosynthesis in plants and bacteria. In addition, the widespread occurrence of DABB proteins in plants suggests that polyketide cyclases may play an overlooked role in generating plant chemical diversity.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Kitamura, Masashi; Aragane, Masako; Nakamura, Kou; Watanabe, Kazuhito; Sasaki, Yohei
2017-01-01
In Cannabis sativa L., tetrahydrocannabinol (THC) is the primary psychoactive compound and exists as the carboxylated form, tetrahydrocannabinolic acid (THCA). C. sativa is divided into two strains based on THCA content-THCA-rich (drug-type) strains and THCA-poor (fiber-type) strains. Both strains are prohibited by law in many countries including Japan, whereas the drug-type strains are regulated in Canada and some European countries. As the two strains cannot be discriminated by morphological analysis, a simple method for identifying the drug-type strains is required for quality control in legal cultivation and forensic investigation. We have developed a novel loop-mediated isothermal amplification (LAMP) assay for identifying the drug-type strains of C. sativa. We designed two selective LAMP primer sets for on-site or laboratory use, which target the drug-type THCA synthase gene. The LAMP assay was accomplished within approximately 40 min. The assay showed high specificity for the drug-type strains and its sensitivity was the same as or higher than that of conventional polymerase chain reaction. We also showed the effectiveness of melting curve analysis that was conducted after the LAMP assay. The melting temperature values of the drug-type strains corresponded to those of the cloned drug-type THCA synthase gene, and were clearly different from those of the cloned fiber-type THCA synthase gene. Moreover, the LAMP assay with simple sample preparation could be accomplished within 1 h from sample treatment to identification without the need for special devices or techniques. Our rapid, sensitive, specific, and simple assay is expected to be applicable to laboratory and on-site detection.
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
He, Quan; Kubec, Roman; Jadhav, Abhijit P; Musah, Rabi A
2011-11-01
A study of an enzyme that reacts with the sulfenic acid produced by the alliinase in Petiveria alliacea L. (Phytolaccaceae) to yield the P. alliacea lachrymator (phenylmethanethial S-oxide) showed the protein to be a dehydrogenase. It functions by abstracting hydride from sulfenic acids of appropriate structure to form their corresponding sulfines. Successful hydride abstraction is dependent upon the presence of a benzyl group on the sulfur to stabilize the intermediate formed on abstraction of hydride. This dehydrogenase activity contrasts with that of the lachrymatory factor synthase (LFS) found in onion, which catalyzes the rearrangement of 1-propenesulfenic acid to (Z)-propanethial S-oxide, the onion lachrymator. Based on the type of reaction it catalyzes, the onion LFS should be classified as an isomerase and would be called a "sulfenic acid isomerase", whereas the P. alliacea LFS would be termed a "sulfenic acid dehydrogenase". Copyright © 2011 Elsevier Ltd. All rights reserved.
Scheirlinck, Ilse; Van der Meulen, Roel; Van Schoor, Ann; Vancanneyt, Marc; De Vuyst, Luc; Vandamme, Peter; Huys, Geert
2007-01-01
A culture-based approach was used to investigate the diversity of lactic acid bacteria (LAB) in Belgian traditional sourdoughs and to assess the influence of flour type, bakery environment, geographical origin, and technological characteristics on the taxonomic composition of these LAB communities. For this purpose, a total of 714 LAB from 21 sourdoughs sampled at 11 artisan bakeries throughout Belgium were subjected to a polyphasic identification approach. The microbial composition of the traditional sourdoughs was characterized by bacteriological culture in combination with genotypic identification methods, including repetitive element sequence-based PCR fingerprinting and phenylalanyl-tRNA synthase (pheS) gene sequence analysis. LAB from Belgian sourdoughs belonged to the genera Lactobacillus, Pediococcus, Leuconostoc, Weissella, and Enterococcus, with the heterofermentative species Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus plantarum, and Lactobacillus pontis as the most frequently isolated taxa. Statistical analysis of the identification data indicated that the microbial composition of the sourdoughs is mainly affected by the bakery environment rather than the flour type (wheat, rye, spelt, or a mixture of these) used. In conclusion, the polyphasic approach, based on rapid genotypic screening and high-resolution, sequence-dependent identification, proved to be a powerful tool for studying the LAB diversity in traditional fermented foods such as sourdough. PMID:17675431
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo
2014-09-01
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo
2017-01-01
Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Li, Huige; Xia, Ning; Brausch, Isolde; Yao, Ying; Förstermann, Ulrich
2004-09-01
Nitric oxide (NO) produced by endothelial nitric-oxide synthase (eNOS) represents an antithrombotic and anti-atherosclerotic principle in the vasculature. Hence, an enhanced expression of eNOS in response to pharmacological interventions could provide protection against cardiovascular diseases. In EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (HUVECs), an artichoke leaf extract (ALE) increased the activity of the human eNOS promoter (determined by luciferase reporter gene assay). An organic subfraction from ALE was more potent in this respect than the crude extract, whereas an aqueous subfraction of ALE was without effect. ALE and the organic subfraction thereof also increased eNOS mRNA expression (measured by an RNase protection assay) and eNOS protein expression (determined by Western blot) both in EA.hy 926 cells and in native HUVECs. NO production (measured by NO-ozone chemiluminescence) was increased by both extracts. In organ chamber experiments, ex vivo incubation (18 h) of rat aortic rings with the organic subfraction of ALE enhanced the NO-mediated vasodilator response to acetylcholine, indicating that the up-regulated eNOS remained functional. Caffeoylquinic acids and flavonoids are two major groups of constituents of ALE. Interestingly, the flavonoids luteolin and cynaroside increased eNOS promoter activity and eNOS mRNA expression, whereas the caffeoylquinic acids cynarin and chlorogenic acid were without effect. Thus, in addition to the lipid-lowering and antioxidant properties of artichoke, an increase in eNOS gene transcription may also contribute to its beneficial cardiovascular profile. Artichoke flavonoids are likely to represent the active ingredients mediating eNOS up-regulation.
Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme
Directory of Open Access Journals (Sweden)
Alberto Macone
2010-03-01
Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.
Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.
Directory of Open Access Journals (Sweden)
Anke Wittmann
Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N
2014-09-01
Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Kralj, Ana; Gurgui, Mihaela; Koenig, Gabriele M.; Echten-Deckert, Gerhild van
2007-01-01
Trichothecenes are sesquiterpenoid metabolites produced by several fungal strains that impair human and animal health. Since sphingolipids were connected with fungal toxicity the aim of the present study was to test the influence of fungal metabolites on sphingolipid metabolism in neural cells. The crude extract of fungal strain Spicellum roseum induced accumulation of glucosylceramide (GlcCer), and simultaneous reduction of the formation of lactosylceramide (LacCer) and complex gangliosides in primary cultured neurons. Following a bioassay-guided fractionation of the respective fungal extract we could demonstrate that the two isolated trichothecene derivatives, 8-deoxy-trichothecin (8-dT) and trichodermol (Td-ol) were responsible for this effect. Thus, incubation of primary cultured neurons as well as of neuroblastoma B104 cells for 24 h with 30 μM of either of the two fungal metabolites resulted in uncoupling of sphingolipid biosynthesis at the level of LacCer. For the observed reduction of LacCer synthase activity by about 90% cell integrity was crucial in both cell types. In neuroblastoma cells the amount of LacCer synthase mRNA was reduced in the presence of trichothecenes, whereas in primary cultured neurons this was not the case, suggesting a post-transcriptional mechanism of action in the latter cell type. The data also show that the compounds did not interfere with the translocation of GlcCer in neuroblastoma cells. Collectively, our results demonstrate that trichodermol and 8-deoxy-trichothecin inhibit LacCer synthase activity in a cell-type-specific manner
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N
2007-12-01
Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.
Omega-6 fatty acid biomarkers and incident type 2 diabetes
Wu, Jason H.Y.; Marklund, Matti; Imamura, Fumiaki; Tintle, Nathan; Ardisson Korat, Andres V.; Goede, de Janette; Zhou, Xia; Yang, Wei Sin; Oliveira Otto, de Marcia C.; Kröger, Janine; Qureshi, Waqas; Virtanen, Jyrki K.; Bassett, Julie K.; Frazier-Wood, Alexis C.; Lankinen, Maria; Murphy, Rachel A.; Rajaobelina, Kalina; Gobbo, Del Liana C.; Forouhi, Nita G.; Luben, Robert; Khaw, Kay Tee; Wareham, Nick; Kalsbeek, Anya; Veenstra, Jenna; Luo, Juhua; Hu, Frank B.; Lin, Hung Ju; Siscovick, David S.; Boeing, Heiner; Chen, Tzu An; Steffen, Brian; Steffen, Lyn M.; Hodge, Allison; Eriksdottir, Gudny; Smith, Albert V.; Gudnason, Vilmunder; Harris, Tamara B.; Brouwer, Ingeborg A.; Berr, Claudine; Helmer, Catherine; Samieri, Cecilia; Laakso, Markku; Tsai, Michael Y.; Giles, Graham G.; Nurmi, Tarja; Wagenknecht, Lynne; Schulze, Matthias B.; Lemaitre, Rozenn N.; Chien, Kuo Liong; Soedamah-Muthu, Sabita S.; Geleijnse, Johanna M.; Sun, Qi; Harris, William S.; Lind, Lars; Ärnlöv, Johan; Riserus, Ulf; Micha, Renata; Mozaffarian, Dariush
2017-01-01
Background: The metabolic effects of omega-6 polyunsaturated fatty acids (PUFAs) remain contentious, and little evidence is available regarding their potential role in primary prevention of type 2 diabetes. We aimed to assess the associations of linoleic acid and arachidonic acid biomarkers with
Heterogeneity in limb fatty acid kinetics in type 2 diabetes
DEFF Research Database (Denmark)
Sacchetti, M; Olsen, D B; Saltin, B
2005-01-01
AIMS/HYPOTHESIS: In order to test the hypothesis that disturbances in skeletal muscle fatty acid metabolism with type 2 diabetes are not equally present in the upper and lower limbs, we studied fatty acid kinetics simultaneously across the arm and leg of type 2 diabetic patients (n=6) and matched...... control subjects (n=7) for 5 h under baseline conditions and during a 4-h hyperinsulinaemic-euglycaemic clamp. METHODS: Limb fatty acid kinetics was determined by means of continuous [U-(13)C]palmitate infusion and measurement of arteriovenous differences. RESULTS: The systemic palmitate rate...... in the dysregulation of skeletal muscle fatty acid metabolism, with only the leg, but not the arm, showing an impairment of fatty acid kinetics at baseline and during a hyperinsulinaemic-euglycaemic clamp causing a physiological increase in insulin concentration....
Presynaptic (Type III) cells in mouse taste buds sense sour (acid) taste.
Huang, Yijen A; Maruyama, Yutaka; Stimac, Robert; Roper, Stephen D
2008-06-15
Taste buds contain two types of cells that directly participate in taste transduction - receptor (Type II) cells and presynaptic (Type III) cells. Receptor cells respond to sweet, bitter and umami taste stimulation but until recently the identity of cells that respond directly to sour (acid) tastants has only been inferred from recordings in situ, from behavioural studies, and from immunostaining for putative sour transduction molecules. Using calcium imaging on single isolated taste cells and with biosensor cells to identify neurotransmitter release, we show that presynaptic (Type III) cells specifically respond to acid taste stimulation and release serotonin. By recording responses in cells isolated from taste buds and in taste cells in lingual slices to acetic acid titrated to different acid levels (pH), we also show that the active stimulus for acid taste is the membrane-permeant, uncharged acetic acid moiety (CH(3)COOH), not free protons (H(+)). That observation is consistent with the proximate stimulus for acid taste being intracellular acidification, not extracellular protons per se. These findings may also have implications for other sensory receptors that respond to acids, such as nociceptors.
Interaction of humic acids and humic-acid-like polymers with herpes simplex virus type 1
Klöcking, Renate; Helbig, Björn
The study was performed in order to compare the antiviral activity against herpes simplex virus type 1 (HSV-1) of synthetic humic-acid-like polymers to that of their low-molecular-weight basic compounds and naturally occurring humic acids (HA) in vitro. HA from peat water showed a moderate antiviral activity at a minimum effective concentration (MEC) of 20 µg/ml. HA-like polymers, i.e. the oxidation products of caffeic acid (KOP), hydrocaffeic acid (HYKOP), chlorogenic acid (CHOP), 3,4-dihydroxyphenylacetic acid (3,4-DHPOP), nordihydroguaretic acid (NOROP), gentisinic acid (GENOP), pyrogallol (PYROP) and gallic acid (GALOP), generally inhibit virus multiplication, although with different potency and selectivity. Of the substances tested, GENOP, KOP, 3,4-DHPOP and HYKOP with MEC values in the range of 2 to 10 µg/ml, proved to be the most potent HSV-1 inhibitors. Despite its lower antiviral potency (MEC 40 µg/ml), CHOP has a remarkable selectivity due to the high concentration of this polymer that is tolerated by the host cells (>640 µg/ml). As a rule, the antiviral activity of the synthetic compounds was restricted to the polymers and was not preformed in the low-molecular-weight basic compounds. This finding speaks in favour of the formation of antivirally active structures during the oxidative polymerization of phenolic compounds and, indirectly, of corresponding structural parts in different HA-type substances.
Glutamic acid as anticancer agent: An overview
Dutta, Satyajit; Ray, Supratim; Nagarajan, K.
2013-01-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...
Energy Technology Data Exchange (ETDEWEB)
Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi
2016-05-13
Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.
International Nuclear Information System (INIS)
Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi
2016-01-01
Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni"2"+-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.
Zheng, Desen; Burr, Thomas J
2013-07-01
An Sfp-type phosphopantetheinyl transferase (PPTase) encoding gene F-avi5813 in Agrobacterium vitis F2/5 was found to be required for the induction of a tobacco hypersensitive response (HR) and grape necrosis. Sfp-type PPTases are post-translation modification enzymes that activate acyl-carry protein (ACP) domains in polyketide synthases (PKS) and peptidyl-carrier protein (PCP) domains of nonribosomal peptide synthases (NRPS). Mutagenesis of PKS and NRPS genes in A. vitis led to the identification of a PKS gene (F-avi4330) and NRPS gene (F-avi3342) that are both required for HR and necrosis. The gene immediately downstream of F-avi4330 (F-avi4329) encoding a predicted aminotransferase was also found to be required for HR and necrosis. Regulation of F-avi4330 and F-avi3342 by quorum-sensing genes avhR, aviR, and avsR and by a lysR-type regulator, lhnR, was investigated. It was determined that F-avi4330 expression is positively regulated by avhR, aviR, and lhnR and negatively regulated by avsR. F-avi3342 was found to be positively regulated by avhR, aviR, and avsR and negatively regulated by lhnR. Our results suggest that a putative hybrid peptide-polyketide metabolite synthesized by F-avi4330 and F-avi3342 is associated with induction of tobacco HR and grape necrosis. This is the first report that demonstrates that NRPS and PKS play essential roles in conferring the unique ability of A. vitis to elicit a non-host-specific HR and host-specific necrosis.
Directory of Open Access Journals (Sweden)
Brian E Sansbury
2014-11-01
Full Text Available An increase in calorie consumption is associated with the recent rise in obesity prevalence. However, our current understanding of the effects of nutrient excess on major metabolic pathways appears insufficient to develop safe and effective metabolic interventions to prevent obesity. Hence, we sought to identify systemic metabolic changes caused by nutrient excess and to determine how endothelial nitric oxide synthase (eNOS—which has anti-obesogenic properties—affects systemic metabolism by measuring plasma metabolites. Wild-type (WT and eNOS transgenic (eNOS-TG mice were placed on low fat or high fat diets for six weeks, and plasma metabolites were measured using an unbiased metabolomic approach. High fat feeding in WT mice led to significant increases in fat mass, which was associated with significantly lower plasma levels of 1,5-anhydroglucitol, lysophospholipids, 3-dehydrocarnitine, and bile acids, as well as branched chain amino acids (BCAAs and their metabolites. Plasma levels of several lipids including sphingomyelins, stearoylcarnitine, dihomo-linoleate and metabolites associated with oxidative stress were increased by high fat diet. In comparison with low fat-fed WT mice, eNOS-TG mice showed lower levels of several free fatty acids, but in contrast, the levels of bile acids, amino acids, and BCAA catabolites were increased. When placed on a high fat diet, eNOS overexpressing mice showed remarkably higher levels of plasma bile acids and elevated levels of plasma BCAAs and their catabolites compared with WT mice. Treatment with GW4064, an inhibitor of bile acid synthesis, decreased plasma bile acid levels but was not sufficient to reverse the anti-obesogenic effects of eNOS overexpression. These findings reveal unique metabolic changes in response to high fat diet and eNOS overexpression and suggest that the anti-obesity effects of eNOS are likely independent of changes in the bile acid pool.
Directory of Open Access Journals (Sweden)
Scott B Crown
Full Text Available The branched chain amino acids (BCAA valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0 and odd chain length (C15:0 and C17:0 fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.
gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower
International Nuclear Information System (INIS)
Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.
1997-01-01
gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
International Nuclear Information System (INIS)
Cuskin, Fiona; Solovyova, Alexandra S.; Lewis, Richard J.; Race, Paul R.
2011-01-01
The expression, purification and crystallization of the trans-acting acyltransferase PksC from the bacillaene hybrid polyketide synthase/nonribosomal peptide synthetase is described. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and diffracted to 1.44 Å resolution. The antibiotic bacillaene is biosynthesized in Bacillus subtilis by a hybrid type 1 modular polyketide synthase/nonribosomal peptide synthetase of the trans-acyltransferase (trans-AT) class. Within this system, the essential acyl-group loading activity is provided by the action of three free-standing trans-acting acyltransferases. Here, the recombinant expression, purification and crystallization of the bacillaene synthase trans-acting acyltransferase PksC are reported. A diffraction data set has been collected from a single PksC crystal to 1.44 Å resolution and the crystal was found to belong to the orthorhombic space group P2 1 2 1 2 1
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Directory of Open Access Journals (Sweden)
Steffen Kawelke
Full Text Available Wax esters are used as coatings or storage lipids in all kingdoms of life. They are synthesized from a fatty alcohol and an acyl-CoA by wax synthases. In order to get insights into the structure-function relationships of a wax synthase from Mus musculus, a domain swap experiment between the mouse acyl-CoA:wax alcohol acyltransferase (AWAT2 and the homologous mouse acyl-CoA:diacylglycerol O-acyltransferase 2 (DGAT2 was performed. This showed that the substrate specificity of AWAT2 is partially determined by two predicted transmembrane domains near the amino terminus of AWAT2. Upon exchange of the two domains for the respective part of DGAT2, the resulting chimeric enzyme was capable of incorporating up to 20% of very long acyl chains in the wax esters upon expression in S. cerevisiae strain H1246. The amount of very long acyl chains in wax esters synthesized by wild type AWAT2 was negligible. The effect was narrowed down to a single amino acid position within one of the predicted membrane domains, the AWAT2 N36R variant. Taken together, we provide first evidence that two predicted transmembrane domains in AWAT2 are involved in determining its acyl chain length specificity.
SULPHUR-CONTAINING AMINO ACIDS METABOLISM IN EXPERIMENTAL HYPER- AND HYPOTHYROIDISM IN RATS.
Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O
2017-10-01
Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg
2012-01-01
The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
DEFF Research Database (Denmark)
Højlund, Kurt; Birk, Jesper Bratz; Klein, Ditte Kjærsgaard
2009-01-01
Context: Insulin-stimulated glucose disposal is impaired in obesity and type 2 diabetes mellitus (T2DM) and is tightly linked to impaired skeletal muscle glucose uptake and storage. Impaired activation of glycogen synthase (GS) by insulin is a well-established defect in both obesity and T2DM....... The exaggerated insulin resistance in T2DM compared with obese subjects was not reflected by differences in site 3 phosphorylation but was accompanied by a significantly higher site 1b phosphorylation during insulin stimulation. Hyperphosphorylation of another Ca(2+)/calmodulin-dependent kinase-II target......, phospholamban-Thr17, was also evident in T2DM. Dephosphorylation of GS by phosphatase treatment fully restored GS activity in all groups. Conclusions: Dysregulation of GS phosphorylation plays a major role in impaired insulin regulation of GS in obesity and T2DM. In obesity, independent of T2DM...
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Beld, Joris; Abbriano, Raffaela; Finzel, Kara; Hildebrand, Mark; Burkart, Michael D
2016-04-01
In both eukaryotes and prokaryotes, fatty acid synthases are responsible for the biosynthesis of fatty acids in an iterative process, extending the fatty acid by two carbon units every cycle. Thus, odd numbered fatty acids are rarely found in nature. We tested whether representatives of diverse microbial phyla have the ability to incorporate odd-chain fatty acids as substrates for their fatty acid synthases and their downstream enzymes. We fed various odd and short chain fatty acids to the bacterium Escherichia coli, cyanobacterium Synechocystis sp. PCC 6803, green microalga Chlamydomonas reinhardtii and diatom Thalassiosira pseudonana. Major differences were observed, specifically in the ability among species to incorporate and elongate short chain fatty acids. We demonstrate that E. coli, C. reinhardtii, and T. pseudonana can produce longer fatty acid products from short chain precursors (C3 and C5), while Synechocystis sp. PCC 6803 lacks this ability. However, Synechocystis can incorporate and elongate longer chain fatty acids due to acyl-acyl carrier protein synthetase (AasS) activity, and knockout of this protein eliminates the ability to incorporate these fatty acids. In addition, expression of a characterized AasS from Vibrio harveyii confers a similar capability to E. coli. The ability to desaturate exogenously added fatty acids was only observed in Synechocystis and C. reinhardtii. We further probed fatty acid metabolism of these organisms by feeding desaturase inhibitors to test the specificity of long-chain fatty acid desaturases. In particular, supplementation with thia fatty acids can alter fatty acid profiles based on the location of the sulfur in the chain. We show that coupling sensitive gas chromatography mass spectrometry to supplementation of unnatural fatty acids can reveal major differences between fatty acid metabolism in various organisms. Often unnatural fatty acids have antibacterial or even therapeutic properties. Feeding of short
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
Expression of prostaglandin synthases (pgds and pges) during zebrafish gonadal differentiation
DEFF Research Database (Denmark)
Jørgensen, Anne; Nielsen, John E; Nielsen, Betina Frydenlund
2010-01-01
The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E2 synthase (pges) and especially the lipocalin-type prostaglandin D2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found....... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph. The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...
Fivian-Hughes, Amanda S; Houghton, Joanna; Davis, Elaine O
2012-02-01
Thymidylate synthase (TS) enzymes catalyse the biosynthesis of deoxythymidine monophosphate (dTMP or thymidylate), and so are important for DNA replication and repair. Two different types of TS proteins have been described (ThyA and ThyX), which have different enzymic mechanisms and unrelated structures. Mycobacteria are unusual as they encode both thyA and thyX, and the biological significance of this is not yet understood. Mycobacterium tuberculosis ThyX is thought to be essential and a potential drug target. We therefore analysed M. tuberculosis thyA and thyX expression levels, their essentiality and roles in pathogenesis. We show that both thyA and thyX are expressed in vitro, and that this expression significantly increased within murine macrophages. Under all conditions tested, thyA expression exceeded that of thyX. Mutational studies show that M. tuberculosis thyX is essential, confirming that the enzyme is a plausible drug target. The requirement for M. tuberculosis thyX in the presence of thyA implies that the essential function of ThyX is something other than dTM synthesis [corrected].We successfully deleted thyA from the M. tuberculosis genome, and this deletion conferred an in vitro growth defect that was not observed in vivo. Presumably ThyX performs TS activity within M. tuberculosis ΔthyA at a sufficient rate in vivo for normal growth, but the rate in vitro is less than optimal. We also demonstrate that thyA deletion confers M. tuberculosis p-aminosalicylic acid resistance, and show by complementation studies that ThyA T202A and V261G appear to be functional and non-functional, respectively.
Directory of Open Access Journals (Sweden)
Ulrike Schleicher
2016-05-01
Full Text Available Neutralization or deletion of tumor necrosis factor (TNF causes loss of control of intracellular pathogens in mice and humans, but the underlying mechanisms are incompletely understood. Here, we found that TNF antagonized alternative activation of macrophages and dendritic cells by IL-4. TNF inhibited IL-4-induced arginase 1 (Arg1 expression by decreasing histone acetylation, without affecting STAT6 phosphorylation and nuclear translocation. In Leishmania major-infected C57BL/6 wild-type mice, type 2 nitric oxide (NO synthase (NOS2 was detected in inflammatory dendritic cells or macrophages, some of which co-expressed Arg1. In TNF-deficient mice, Arg1 was hyperexpressed, causing an impaired production of NO in situ. A similar phenotype was seen in L. major-infected BALB/c mice. Arg1 deletion in hematopoietic cells protected these mice from an otherwise lethal disease, although their disease-mediating T cell response (Th2, Treg was maintained. Thus, deletion or TNF-mediated restriction of Arg1 unleashes the production of NO by NOS2, which is critical for pathogen control.
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Directory of Open Access Journals (Sweden)
Wen-Qin Bai
Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
van Rees, Bastiaan P.; Sivula, Anna; Thorén, Staffan; Yokozaki, Hiroshi; Jakobsson, Per-Johan; Offerhaus, G. Johan A.; Ristimäki, Ari
2003-01-01
Gastrointestinal carcinomas synthesize elevated levels of prostaglandin E(2) (PGE(2)), which has been mechanistically linked to carcinogenesis. Recently, microsomal prostaglandin E synthase-1 (mPGES-1) was cloned, which seems to be inducible and linked to cyclooxygenase-2 (Cox-2) in the biosynthesis
Morcillo, Rafael Jorge León; Navarrete, María Isabel Tamayo; Bote, Juan Antonio Ocampo; Monguio, Salomé Prat; García-Garrido, José Manuel
2016-01-15
Arbuscular mycorrhizal (AM) is a mutually beneficial interaction among higher plants and soil fungi of the phylum Glomeromycota. Numerous studies have pointed that jasmonic acid plays an important role in the development of the intraradical fungus. This compound belongs to a group of biologically active compounds known as oxylipins which are derived from the oxidative metabolism of polyunsaturated fatty acids. Studies of the regulatory role played by oxylipins in AM colonization have generally focused on jasmonates, while few studies exist on the 9-LOX pathway of oxylipins during AM formation. Here, the cDNA of Allene oxide synthase 3 (AOS3), a key enzyme in the 9-LOX pathway, was used in the RNA interference (RNAi) system to transform potato plants in order to suppress its expression. Results show increases in AOS3 gene expression and 9-LOX products in roots of wild type potato mycorrhizal plants. The suppression of AOS3 gene expression increases the percentage of root with mycorrhizal colonization at early stages of AM formation. AOS3 RNA interference lead to an induction of LOXA and 13-LOX genes, a reduction in AOS3 derived 9-LOX oxylipin compounds and an increase in jasmonic acid content, suggesting compensation between 9 and 13-LOX pathways. The results in a whole support the hypothesis of a regulatory role for the 9-LOX oxylipin pathway during mycorrhization. Copyright © 2015 Elsevier GmbH. All rights reserved.
Lamm, Andrew S.; Khare, Arshdeep; Conville, Patricia; Lau, Peter C. K.; Bergeron, Hélène; Rosazza, John P. N.
2009-01-01
Nocardia strain NRRL 5646, isolated from a garden soil sample in Osceola, Iowa, USA, was initially of interest as an antibiotic producer. It contained biocatalytically important enzymes and represented the first described nitric oxide synthase enzyme system in bacteria. The present polyphasic taxonomic study was undertaken to differentiate strain NRRL 5646T from related species of the genus Nocardia. Chemotaxonomic analyses included determinations of the fatty acid methyl ester profile (C16 : 1ω6c/C16 : 1ω7c, C16 : 0, C18 : 1ω9c and C18 : 0 10-methyl as major components), quinone [cyclo MK-8(H4) as the major component], polar lipid (diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylinositol and phosphatidylinositol mannoside as major components) and mycolic acid. These results supported its placement within the genus Nocardia. Biochemical testing and 16S rRNA, 65-kDa heat-shock protein (hsp65) and preprotein translocase (secA1) gene sequence analyses differentiated strain NRRL 5646T from recognized Nocardia species. Previous studies have demonstrated that other genetic sequences (carboxylic acid reductase, Nocardia phosphopantetheinyl transferase and GTP cyclohydrolase I) from strain NRRL 5646T can also be used to substantiate its uniqueness. The level of 16S rRNA gene sequence similarity between strain NRRL 5646T and the type strains of Nocardia tenerifensis and Nocardia brasiliensis was 98.8 %. However, strain NRRL 5646T could be clearly distinguished from these Nocardia species based on DNA–DNA hybridization data. Consequently, strain NRRL 5646T is considered to represent a novel species of the genus Nocardia, for which the name Nocardia iowensis sp. nov. is proposed. The type strain is NRRL 5646T (=UI 122540T=NRRL B-24671T=DSM 45197T). PMID:19622667
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Suzuki, Mamoru; Higashiura, Akifumi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan); Aritake, Kosuke; Urade, Yoshihiro; Uodome, Nobuko [Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka 565-0874 (Japan); Hossain, MD. Tofazzal [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Nakagawa, Atsushi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan)
2013-11-01
Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolution of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.
Skrha, Jan; Prázný, Martin; Hilgertová, Jirina; Weiserová, Hana
2003-03-01
Alpha-tocopherol and ascorbic acid form a part of scavenger system influencing the level of oxidative stress in diabetes mellitus. The aim of this study was to evaluate serum concentrations of alpha-tocopherol and ascorbic acid in Type 1 and Type 2 diabetes mellitus and to compare them with the presence of vascular complications as well as with oxidative stress and endothelial dysfunction. A total of 38 Type 1 and 62 Type 2 diabetic patients were subdivided into those with and without angiopathy. Serum alpha-tocopherol and ascorbic acid concentrations were estimated in all patients and in 38 healthy persons. Their results were compared with diabetes control, with oxidative stress measured by plasma malondialdehyde and with endothelial dysfunction estimated by serum N-acetyl-beta-glucosaminidase activity. In addition, the differences in biochemical variables were compared between patients with and without angiopathy. Serum alpha-tocopherol related to the sum of cholesterol and triglyceride concentrations (AT/CHT ratio) was significantly lower in diabetic patients with macroangiopathy than in those without vascular changes (pascorbic acid levels were significantly lower only in Type 2 diabetic patients with macroangiopathy as compared with healthy controls as well as with patients without vascular disease (pcholesterol or triglyceride concentrations in both Type 1 and Type 2 diabetic patients. The presence of oxidative stress together with endothelial dysfunction measured by N-acetyl-beta-glucosaminidase activity was accompanied by lower AT/CHT ratio (pascorbic acid concentration in serum. Their low concentrations may participate at the increased level of oxidative stress in these individuals.
Folic acid: a marker of endothelial function in type 2 diabetes?
Directory of Open Access Journals (Sweden)
Arduino A Mangoni
2005-04-01
Full Text Available Arduino A Mangoni1, Roy A Sherwood2, Belinda Asonganyi2, Emma L Ouldred3, Stephen Thomas4, Stephen HD Jackson31Department of Clinical Pharmacology, Centre for Neuroscience, School of Medicine, Flinders University, Adelaide, SA, Australia; 2Clinical Biochemistry, King’s College Hospital, London, UK; 3Department of Health Care of the Elderly, Guy’s, King’s, and St Thomas’ School of Medicine, King’s College, London, UK; 4Department of Diabetic Medicine, King’s College Hospital, London, UKObjectives: Endothelial dysfunction is a common feature of type 2 diabetes. Recent studies suggest that the B-vitamin folic acid exerts direct beneficial effects on endothelial function, beyond the well known homocysteine lowering effects. Therefore, folic acid might represent a novel “biomarker” of endothelial function. We sought to determine whether plasma levels of folic acid determine endothelial-dependent vasodilation in patients with type 2 diabetes.Methods: Forearm arterial blood flow (FABF was measured at baseline and during intrabrachial infusion of the endothelial-dependent vasodilator acetylcholine (15 µg/min and the endothelial-independent vasodilator sodium nitroprusside (2 µg/min in 26 type 2 diabetic patients (age 56.5 ± 0.9 years, means ± SEM with no history of cardiovascular disease.Results: FABF ratio (ie, the ratio between the infused and control forearm FABF significantly increased during acetylcholine (1.10 ± 0.04 vs 1.52 ± 0.07, p < 0.001 and sodium nitroprusside (1.12 ± 0.11 vs 1.62 ± 0.06, p < 0.001 infusions. After correcting for age, gender, diabetes duration, smoking, hypertension, body mass index, microalbuminuria, glycated hemoglobin, low-density lipoprotein cholesterol, and homocysteine, multiple regression analysis showed that plasma folic acid concentration was the only independent determinant (p = 0.037, R2 = 0.22 of acetylcholine-mediated, but not sodium nitroprusside-mediated, vasodilatation
Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng
2013-02-08
The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.
Gallego-Marin, Carolina; Schrum, Jacob E; Andrade, Warrison A; Shaffer, Scott A; Giraldo, Lina F; Lasso, Alvaro M; Kurt-Jones, Evelyn A; Fitzgerald, Katherine A; Golenbock, Douglas T
2018-01-15
Innate immune receptors have a key role in the sensing of malaria and initiating immune responses. As a consequence of infection, systemic inflammation emerges and is directly related to signs and symptoms during acute disease. We have previously reported that plasmodial DNA is the primary driver of systemic inflammation in malaria, both within the phagolysosome and in the cytosol of effector cells. In this article, we demonstrate that Plasmodium falciparum genomic DNA delivered to the cytosol of human monocytes binds and activates cyclic GMP-AMP synthase (cGAS). Activated cGAS synthesizes 2'3'-cGAMP, which we subsequently can detect using liquid chromatography-tandem mass spectrometry. 2'3'-cGAMP acts as a second messenger for STING activation and triggers TBK1/IRF3 activation, resulting in type I IFN production in human cells. This induction of type I IFN was independent of IFI16. Access of DNA to the cytosolic compartment is mediated by hemozoin, because incubation of purified malaria pigment with DNase abrogated IFN-β induction. Collectively, these observations implicate cGAS as an important cytosolic sensor of P. falciparum genomic DNA and reveal the role of the cGAS/STING pathway in the induction of type I IFN in response to malaria parasites. Copyright © 2018 by The American Association of Immunologists, Inc.
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Effect of glycogen synthase overexpression on insulin-stimulated muscle glucose uptake and storage.
Fogt, Donovan L; Pan, Shujia; Lee, Sukho; Ding, Zhenping; Scrimgeour, Angus; Lawrence, John C; Ivy, John L
2004-03-01
Insulin-stimulated muscle glucose uptake is inversely associated with the muscle glycogen concentration. To investigate whether this association is a cause and effect relationship, we compared insulin-stimulated muscle glucose uptake in noncontracted and postcontracted muscle of GSL3-transgenic and wild-type mice. GSL3-transgenic mice overexpress a constitutively active form of glycogen synthase, which results in an abundant storage of muscle glycogen. Muscle contraction was elicited by in situ electrical stimulation of the sciatic nerve. Right gastrocnemii from GSL3-transgenic and wild-type mice were subjected to 30 min of electrical stimulation followed by hindlimb perfusion of both hindlimbs. Thirty minutes of contraction significantly reduced muscle glycogen concentration in wild-type (49%) and transgenic (27%) mice, although transgenic mice retained 168.8 +/- 20.5 micromol/g glycogen compared with 17.7 +/- 2.6 micromol/g glycogen for wild-type mice. Muscle of transgenic and wild-type mice demonstrated similar pre- (3.6 +/- 0.3 and 3.9 +/- 0.6 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) and postcontraction (7.9 +/- 0.4 and 7.0 +/- 0.4 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) insulin-stimulated glucose uptakes. However, the [14C]glucose incorporated into glycogen was greater in noncontracted (151%) and postcontracted (157%) transgenic muscle vs. muscle of corresponding wild-type mice. These results indicate that glycogen synthase activity is not rate limiting for insulin-stimulated glucose uptake in skeletal muscle and that the inverse relationship between muscle glycogen and insulin-stimulated glucose uptake is an association, not a cause and effect relationship.
Value of heart-type fatty acid-binding protein (H-FABP) for ...
African Journals Online (AJOL)
Key Words: heart-type fatty acid-binding protein, acute coronary syndrome, biomarker. ... is essential to prevent major complications and death. Routinely used biomarkers such ..... fatty acid binding proteins: their function and physiological sig-.
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
International Nuclear Information System (INIS)
Lee, Miyoung; Lee, Sangchoon; Cho, Junehaeng; Ryu, Seong Eon; Yoon, Moonyoung; Koo, Bonsung
2013-01-01
Acetolactate synthase (ALS) is a thiamine diphosphate (ThDP)-dependent enzyme that catalyzes the decarboxylation of pyruvate and then condenses the hydroxyethyl moiety with another molecule of pyruvate to give 2-acetolactate (AL). AL is a key metabolic intermediate in various metabolic pathways of microorganisms. In addition, AL can be converted to acetoin, an important physiological metabolite that is excreted by many microorganisms. There are two types of ALSs reported in the literature, anabolic aceto-hydroxyacid synthase (AHAS) and catabolic ALSs (cALS). The anabolic AHAS is primarily found in plants, fungi, and bacteria, is involved in the biosynthesis of branched-chain amino acids (BCAAs), and contains flavin adenine dinucleotide (FAD), whereas the cALS is found only in some bacteria and is involved in the butanediol fermentation pathway. Both of the enzymes are ThDP-dependent and require a divalent metal ion for catalytic activity. Despite the similarities of the reactions catalyzed, the cALS can be distinguished from anabolic AHAS by a low optimal pH of about 6.0, FAD-independent functionality, a genetic location within the butanediol operon, and lack of a regulatory subunit. It is noteworthy that the structural and functional features of AHAS have been extensively studied, in contrast to those of cALS, for which only limited information is available. To date, the only crystal structure of cALS reported is from Klebsiella pneumonia, which revealed that the overall structure of K. pneumonia ALS is similar to that of AHAS except for the FAD binding region found in AHAS
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa
2018-05-11
(-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.
Theodorakis, Nicholas G; Wang, Yining N; Korshunov, Vyacheslav A; Maluccio, Mary A; Skill, Nicholas J
2015-04-14
Portal hypertension is a common complication of liver cirrhosis and significantly increases mortality and morbidity. Previous reports have suggested that the compound thalidomide attenuates portal hypertension (PHT). However, the mechanism for this action is not fully elucidated. One hypothesis is that thalidomide destabilizes tumor necrosis factor α (TNFα) mRNA and therefore diminishes TNFα induction of nitric oxide synthase (NOS) and the production of nitric oxide (NO). To examine this hypothesis, we utilized the murine partial portal vein ligation (PVL) PHT model in combination with endothelial or inducible NOS isoform gene knockout mice. Wild type, inducible nitric oxide synthase (iNOS)(-/-) and endothelial nitric oxide synthase (eNOS)(-/-) mice received either PVL or sham surgery and were given either thalidomide or vehicle. Serum nitrate (total nitrate, NOx) was measured daily for 7 d as a surrogate of NO synthesis. Serum TNFα level was quantified by enzyme-linked immunosorbent assay. TNFα mRNA was quantified in liver and aorta tissue by reverse transcription-polymerase chain reaction. PHT was determined by recording splenic pulp pressure (SPP) and abdominal aortic flow after 0-7 d. Response to thalidomide was determined by measurement of SPP and mean arterial pressure (MAP). SPP, abdominal aortic flow (Qao) and plasma NOx were increased in wild type and iNOS(-/-) PVL mice when compared to sham operated control mice. In contrast, SPP, Qao and plasma NOx were not increased in eNOS(-/-) PVL mice when compared to sham controls. Serum TNFα level in both sham and PVL mice was below the detection limit of the commercial ELISA used. Therefore, the effect of thalidomide on serum TNFα levels was undetermined in wild type, eNOS(-/-) or iNOS(-/-) mice. Thalidomide acutely increased plasma NOx in wild type and eNOS(-/-) mice but not iNOS(-/-) mice. Moreover, thalidomide temporarily (0-90 min) decreased mean arterial pressure, SPP and Qao in wild type, e
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Characterization of Lactic Acid Bacteria Isolated from Sauce-type Kimchi.
Jung, Suk Hee; Park, Joung Whan; Cho, Il Jae; Lee, Nam Keun; Yeo, In-Cheol; Kim, Byung Yong; Kim, Hye Kyung; Hahm, Young Tae
2012-09-01
This study was carried out to investigate the isolation and characterization of lactic acid bacteria (LAB) from naturally fermented sauce-type kimchi. Sauce-type kimchi was prepared with fresh, chopped ingredients (Korean cabbage, radish, garlic, ginger, green onion, and red pepper). The two isolated bacteria from sauce-type kimchi were identified as Pediococcus pentosaceus and Lactobacillus brevis by 16S rDNA sequencing and tentatively named Pediococcus sp. IJ-K1 and Lactobacillus sp. IJ-K2, respectively. Pediococcus sp. IJ-K1 was isolated from the early and middle fermentation stages of sauce-type kimchi whereas Lactobacillus sp. IJ-K2 was isolated from the late fermentation stage. The resistance of Pediococcus sp. IJ-K1 and Lactobacillus sp. IJ-K2 to artificial gastric and bile acids led to bacterial survival rates that were 100% and 84.21%, respectively.
DEFF Research Database (Denmark)
Vestergaard, H; Andersen, P H; Lund, S
1994-01-01
The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan
2016-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...
Directory of Open Access Journals (Sweden)
I MADE ARTIKA
2010-09-01
Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.
Modulation of hyaluronan synthase activity in cellular membrane fractions.
Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto
2009-10-30
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.
Chandra, Saurav B; Mohan, Sumathy; Ford, Bridget M; Huang, Lei; Janardhanan, Preethi; Deo, Kaiwalya S; Cong, Linlin; Muir, Eric R; Duong, Timothy Q
2016-06-01
Reduced bioavailability of nitric oxide due to impaired endothelial nitric oxide synthase (eNOS) activity is a leading cause of endothelial dysfunction in diabetes. Enhancing eNOS activity in diabetes is a potential therapeutic target. This study investigated basal cerebral blood flow and cerebrovascular reactivity in wild-type mice, diabetic mice (Ins2(Akita+/-)), nondiabetic eNOS-overexpressing mice (TgeNOS), and the cross of two transgenic mice (TgeNOS-Ins2(Akita+/-)) at six months of age. The cross was aimed at improving eNOS expression in diabetic mice. The major findings were: (i) Body weights of Ins2(Akita+/-) and TgeNOS-Ins2(Akita+/-) were significantly different from wild-type and TgeNOS mice. Blood pressure of TgeNOS mice was lower than wild-type. (ii) Basal cerebral blood flow of the TgeNOS group was significantly higher than cerebral blood flow of the other three groups. (iii) The cerebrovascular reactivity in the Ins2(Akita+/-) mice was significantly lower compared with wild-type, whereas that in the TgeNOS-Ins2(Akita+/-) was significantly higher compared with the Ins2(Akita+/-) and TgeNOS groups. Overexpression of eNOS rescued cerebrovascular dysfunction in diabetic animals, resulting in improved cerebrovascular reactivity. These results underscore the possible role of eNOS in vascular dysfunction in the brain of diabetic mice and support the notion that enhancing eNOS activity in diabetes is a potential therapeutic target. © The Author(s) 2015.
Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K
2014-01-01
Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.
Widespread occurrence of secondary lipid biosynthesis potential in microbial lineages.
Directory of Open Access Journals (Sweden)
Christine N Shulse
Full Text Available Bacterial production of long-chain omega-3 polyunsaturated fatty acids (PUFAs, such as eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3, is constrained to a narrow subset of marine γ-proteobacteria. The genes responsible for de novo bacterial PUFA biosynthesis, designated pfaEABCD, encode large, multi-domain protein complexes akin to type I iterative fatty acid and polyketide synthases, herein referred to as "Pfa synthases". In addition to the archetypal Pfa synthase gene products from marine bacteria, we have identified homologous type I FAS/PKS gene clusters in diverse microbial lineages spanning 45 genera representing 10 phyla, presumed to be involved in long-chain fatty acid biosynthesis. In total, 20 distinct types of gene clusters were identified. Collectively, we propose the designation of "secondary lipids" to describe these biosynthetic pathways and products, a proposition consistent with the "secondary metabolite" vernacular. Phylogenomic analysis reveals a high degree of functional conservation within distinct biosynthetic pathways. Incongruence between secondary lipid synthase functional clades and taxonomic group membership combined with the lack of orthologous gene clusters in closely related strains suggests horizontal gene transfer has contributed to the dissemination of specialized lipid biosynthetic activities across disparate microbial lineages.
Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana
2017-08-01
SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Fields, Peter A; Strothers, Chad M; Mitchell, Mark A
2008-05-01
The Galápagos marine iguana, Amblyrhynchus cristatus, is unique among lizards in foraging subtidally, leading to activity across a broad range of ambient temperatures ( approximately 14-40 degrees C). To determine whether the marine iguana shows any biochemical changes consistent with maintaining enzyme function at both warm and cold body temperatures, we examined the function of the aerobic enzyme citrate synthase (CS) and the muscle isoform of the anaerobic enzyme lactate dehydrogenase (A(4)-LDH) in A. cristatus and a confamilial species, Iguana iguana, from 14 to 46 degrees C. We also deduced amino acid sequences from cDNA of each enzyme. In CS, despite two amino acid substitutions, we found no difference in the apparent Michaelis-Menten constant K(m) of oxaloacetate at any temperature, indicating that the substrate affinity of CS in A. cristatus has not adapted to changes in thermal environment. In A(4)-LDH, we used site-directed mutagenesis to show that the substitutions T9A and I283V (A. cristatus --> I. iguana) individually have no effect on kinetics, but together significantly decrease the K(m) of pyruvate and catalytic rate constant (k(cat)) of the A. cristatus ortholog. Thus, our data show that A. cristatus A(4)-LDH has not become cold adapted in response to this species' aquatic foraging behavior, and instead may be consistent with moderate warm adaptation with respect to the I. iguana ortholog.
DEFF Research Database (Denmark)
Nielsen, Stine Elkjaer; Sugaya, Takeshi; Hovind, Peter
2010-01-01
Urinary liver-type fatty acid-binding protein (u-LFABP) is a marker of tubulointerstitial inflammation and has been shown to be increased in patients with type 1 diabetes and is further increased in patients who progress to micro- and macroalbuminuria. Our aim was to evaluate u-LFABP as a predictor...... of progression to micro- and macroalbuminuria in type 1 diabetes....
Lücker, J.; Schwab, W.; Hautum, van B.; Blaas, J.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.
2004-01-01
Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun
2017-01-01
Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Directory of Open Access Journals (Sweden)
Yulia Sklyarova
2017-10-01
Full Text Available Small intestinal injury is known to be one of the most commonly appearing pathologies, resulting in the use of medications such as: nonsteroidal anti-inflammatory drugs (NSAIDs, antitumor drugs and angiotensin-converting enzyme (ACE inhibitors. The principal objective of this study is to evaluate the action of a novel mercaptoacrylic acid derivative able to release H2S on parameters of NO-synthase system and oxidative stress. Inducing enteropathy, three types of medications were used: indomethacin, an NSAID (35 mg/kg; methotrexate, an antitumor drug (10 mg/kg; and enalapril, an ACE inhibitor (2 mg/kg/day. 2-[(4-chlorophenyl-carbamoyl-methyl]-3-(3,5-di-tert-butyl-4-hydroxyphenyl-acrylic acid (2C3DHTA was introduced based on the background of medication-induced enteropathy (10 mg/kg/day. The survey showed that malondialdehyde (MDA concentration, myeloperoxidase (MPO activity, superoxide dismutase (SOD, catalase, and NO-synthases (NOS were determined in the small intestinal mucosa. The increase in inducible NO-synthase (iNOS activity was due to indomethacin and methotrexate administration. Constitutive NO-synthase (cNOS activity was decreased by an ACE-inhibitor. The cytoprotective effect was demonstrated by 2C3DHTA, which returned iNOS activity to its control level and increased cNOS activity. The enterotoxic action of studied medication was accompanied by the development of oxidative stress manifested, activity of MPO was increased. MPO activity and manifestations of oxidative stress were decreased by 2C3DHTA. Effects of 2C3DHTA can be explained by the action of H2S, released from this compound in the gastrointestinal (GI system.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
DEFF Research Database (Denmark)
Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.
2010-01-01
In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Directory of Open Access Journals (Sweden)
Carolina Emilia Storniolo
2014-01-01
Full Text Available Epidemiological and clinical studies have reported that olive oil reduces the incidence of cardiovascular disease. However, the mechanisms involved in this beneficial effect have not been delineated. The endothelium plays an important role in blood pressure regulation through the release of potent vasodilator and vasoconstrictor agents such as nitric oxide (NO and endothelin-1 (ET-1, respectively, events that are disrupted in type 2 diabetes. Extra virgin olive oil contains polyphenols, compounds that exert a biological action on endothelial function. This study analyzes the effects of olive oil polyphenols on endothelial dysfunction using an in vitro model that simulates the conditions of type 2 diabetes. Our findings show that high glucose and linoleic and oleic acids decrease endothelial NO synthase phosphorylation, and consequently intracellular NO levels, and increase ET-1 synthesis by ECV304 cells. These effects may be related to the stimulation of reactive oxygen species production in these experimental conditions. Hydroxytyrosol and the polyphenol extract from extra virgin olive oil partially reversed the above events. Moreover, we observed that high glucose and free fatty acids reduced NO and increased ET-1 levels induced by acetylcholine through the modulation of intracellular calcium concentrations and endothelial NO synthase phosphorylation, events also reverted by hydroxytyrosol and polyphenol extract. Thus, our results suggest a protective effect of olive oil polyphenols on endothelial dysfunction induced by hyperglycemia and free fatty acids.
The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase
Directory of Open Access Journals (Sweden)
Santos Diógenes S
2008-04-01
Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and
Directory of Open Access Journals (Sweden)
Joan Crous-Masó
2018-05-01
Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.
DEFF Research Database (Denmark)
Nielsen, Stine Elkjaer; Sugaya, Takeshi; Hovind, Peter
2010-01-01
Urinary liver-type fatty acid-binding protein (u-LFABP) is a marker of tubulointerstitial inflammation and has been shown to be increased in patients with type 1 diabetes and is further increased in patients who progress to micro- and macroalbuminuria. Our aim was to evaluate u-LFABP as a predictor...
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation
DEFF Research Database (Denmark)
Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.
2010-01-01
The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found...... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...
Directory of Open Access Journals (Sweden)
Ines Lakhal-Naouar
Full Text Available BACKGROUND: Gene expression analysis in Leishmania donovani (Ld identified an orthologue of the urea cycle enzyme, argininosuccinate synthase (LdASS, that was more abundantly expressed in amastigotes than in promastigotes. In order to characterize in detail this newly identified protein in Leishmania, we determined its enzymatic activity, subcellular localization in the parasite and affect on virulence in vivo. METHODOLOGY/PRINCIPAL FINDINGS: Two parasite cell lines either over expressing wild type LdASS or a mutant form (G128S associated with severe cases of citrullinemia in humans were developed. In addition we also produced bacterially expressed recombinant forms of the same proteins. Our results demonstrated that LdASS has argininosuccinate synthase enzymatic activity that is abolished using an ASS specific inhibitor (MDLA: methyl-D-L-Aspartic acid. However, the mutant form of the protein is inactive. We demonstrate that though LdASS has a glycosomal targeting signal that binds the targeting apparatus in vitro, only a small proportion of the total cellular ASS is localized in a vesicle, as indicated by protection from protease digestion of the crude organelle fraction. The majority of LdASS was found to be in the cytosolic fraction that may include large cytosolic complexes as indicated by the punctate distribution in IFA. Surprisingly, comparison to known glycosomal proteins by IFA revealed that LdASS was located in a structure different from the known glycosomal vesicles. Significantly, parasites expressing a mutant form of LdASS associated with a loss of in vitro activity had reduced virulence in vivo in BALB/c mice as demonstrated by a significant reduction in the parasite load in spleen and liver. CONCLUSION/SIGNIFICANCE: Our study suggests that LdASS is an active enzyme, with unique localization and essential for parasite survival and growth in the mammalian host. Based on these observations LdASS could be further explored as a
Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases
International Nuclear Information System (INIS)
Blacklock, Brenda J.; Jaworski, Jan G.
2006-01-01
The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates
Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)
2011-01-01
Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
and γγ-turns in proteins revisited: A new set of amino acid turn-type de
Indian Academy of Sciences (India)
mine, valine, glutamic acid and alanine has decreased for β-turns. Certain new amino acid preferences were observed for both turn types and individual amino acids showed turn-type dependent positional preferences. The rationale for new amino acid preferences are discussed in the light of hydrogen bonds and other.
Association of serum uric acid level and blood pressure in type 2 diabetes mellitus
Savira, M.; Rusdiana; Syahputra, M.
2018-03-01
Uric acid is an end product of purine degradation in humans and primarily excreted through urine. In adulthood, concentrations rise steadily over time and vary with height, body weight, blood pressure, renal function, and alcohol intake. Uric acid is known as anti-oxidant, it has a beneficial role in diseases. Elevated serum uric acid associated with anincreased risk of cardiovascular disease. It has been found that elevated levels of uric acid associated with high risks of acomplication of type 2 diabetes mellitus and It has astrong association between elevated uric acid levels and obesity, metabolic syndrome, diabetes mellitus, hypertension, cardiovascular and renal disorders. The aim of the study analyzed the association between serum uric acid level and blood pressure in type 2 diabetes mellitus patients. This research is descriptive analytic research with a cross sectional design included 50 diabetic subjects aged over 40 years old. Subjects picked by consecutive sampling then we examined the weight, height, waist size, blood pressure, fasting blood sugar, and serum uric acid level. Statistical analysis using chi-square found that there was no significant association between serum uric acid level and systole and diastole pressure in type 2 diabetes mellitus patients (p>0.005).
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Enzymatic regulation of organic acid metabolism in an alkali-tolerant ...
African Journals Online (AJOL)
Tuoyo Aghomotsegin
2016-10-05
Oct 5, 2016 ... seedlings of C. virgata were treated with varying salt and alkali stress. First, the composition and .... mechanisms of organic acid accumulation in C. virgata ..... dehydrogenase and ferredoxin-dependent glutamate synthase in.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Sooman, Linda; Wennman, Anneli; Hamberg, Mats; Hoffmann, Inga; Oliw, Ernst H
2016-02-01
The genome of Aspergillus niger codes for a fusion protein (EHA25900), which can be aligned with ~50% sequence identity to 9S-dioxygenase (DOX)-allene oxide synthase (AOS) of Fusarium oxysporum, homologues of the Fusarium and Colletotrichum complexes and with over 62% sequence identity to homologues of Aspergilli, including (DOX)-9R-AOS of Aspergillus terreus. The aims were to characterize the enzymatic activities of EHA25900 and to identify crucial amino acids for the stereospecificity. Recombinant EHA25900 oxidized 18:2n-6 sequentially to 9R-hydroperoxy-10(E),12(Z)-octadecadienoic acid (9R-HPODE) and to a 9R(10)-allene oxide. 9S- and 9R-DOX-AOS catalyze abstraction of the pro-R hydrogen at C-11, but the direction of oxygen insertion differs. A comparison between twelve 9-DOX domains of 9S- and 9R-DOX-AOS revealed conserved amino acid differences, which could contribute to the chirality of products. The Gly616Ile replacement of 9R-DOX-AOS (A. niger) increased the biosynthesis of 9S-HPODE and the 9S(10)-allene oxide, whereas the Phe627Leu replacement led to biosynthesis of 9S-HPODE and the 9S(10)-allene oxide as main products. The double mutant (Gly616Ile, Phe627Leu) formed over 90% of the 9S stereoisomer of HPODE. 9S-HPODE was formed by antarafacial hydrogen abstraction and oxygen insertion, i.e., the original H-abstraction was retained but the product chirality was altered. We conclude that 9R-DOX-AOS can be altered to 9S-DOX-AOS by replacement of two amino acids (Gly616Ile, Phe627Leu) in the DOX domain. Copyright © 2015 Elsevier B.V. All rights reserved.
Gallic acid and p-coumaric acid attenuate type 2 diabetes-induced neurodegeneration in rats.
Abdel-Moneim, Adel; Yousef, Ahmed I; Abd El-Twab, Sanaa M; Abdel Reheim, Eman S; Ashour, Mohamed B
2017-08-01
The brain of diabetics revealed deterioration in many regions, especially the hippocampus. Hence, the present study aimed to evaluate the effects of gallic acid and p-coumaric acid against the hippocampal neurodegeneration in type 2 diabetic rats. Adult male albino rats were randomly allocated into four groups: Group 1 served as control ones and others were induced with diabetes. Group 2 considered as diabetic, and groups 3 and 4 were further orally treated with gallic acid (20 mg/kg b.wt./day) and p-coumaric acid (40 mg/kg b.wt./day) for six weeks. Diabetic rats revealed significant elevation in the levels of serum glucose, blood glycosylated hemoglobin and serum tumor necrosis factor-α, while the level of serum insulin was significantly declined. Furthermore, the brain of diabetic rats showed a marked increase in oxidative stress and a decrease of antioxidant parameters as well as upregulation the protein expression of Bax and downregulation the protein expression of Bcl-2 in the hippocampus. Treatment of diabetic rats with gallic acid and p-coumaric acid significantly ameliorated glucose tolerance, diminished the brain oxidative stress and improved antioxidant status, declined inflammation and inhibited apoptosis in the hippocampus. The overall results suggested that gallic acid and p-coumaric acid may inhibit hippocampal neurodegeneration via their potent antioxidant, anti-inflammatory and anti-apoptotic properties. Therefore, both compounds can be recommended as hopeful adjuvant agents against brain neurodegeneration in diabetics.
Glutamic acid as anticancer agent: An overview.
Dutta, Satyajit; Ray, Supratim; Nagarajan, K
2013-10-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.
Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R
2010-11-13
The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).
Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke
2008-08-01
Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.
Triacetic acid lactone production from Saccharomyces cerevisiae
Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...
Method of recovering phosphoric acid type decontaminating electrolytes by electrodeposition
International Nuclear Information System (INIS)
Sasaki, Takashi; Wada, Koichi; Kobayashi, Toshio.
1985-01-01
Purpose: To recoving phosphoric acid type highly concentrated decontaminating liquid used for the electrolytic decontamination of contaminated equipments, components, etc in nuclear power plants or the like through electrodeposition by diaphragm electrolysis. Method: Before supplying phosphoric acid decontaminating liquid at high concentration used in the electrolytic decontaminating step to an electrodeposition recovering tank, phosphoric acid in the decontaminating electrolyte is extracted with solvents and decomposed liquid extracts (electrolyte reduced with the phosphoric acid component) are supplied to the cathode chamber of the electrodeposition recovering tank, where phosphoric acid is back-extracted with water from the solvents after extraction of phosphoric acid. Then, the back-extracted liquids (aqueous phosphoric acid solution scarcely containing metal ions) are sent to the anode chamber of the electrodeposition recovering tank. Metal ions in the liquid are captured by electrodeposition in the cathode chamber, as well as phosphoric acid in the liquids is concentrated to the initial concentration of the electrolyte in the anode chamber for reuse as the decontaminating electrolyte. As the phosphoric acid extracting agent used in the electrodeposition recovering step for the decontaminating electrolyte, water-insoluble and non-combustible tributyl phosphate (TBP) is most effective. (Horiuchi, T.)
Nitric oxide production from macrophages is regulated by arachidonic acid metabolites.
Imai, Y; Kolb, H; Burkart, V
1993-11-30
In activated macrophages the inducible form of the enzyme nitric oxide (NO) synthase generates high amounts of the toxic mediator NO. After 20 h of treatment with LPS rat peritoneal macrophages release 12-16 nmol NO2-/10(5) cells which is detectable in the culture supernatant by the Griess reaction as a measure of NO formation. The addition of aminoguanidine (1 mM), a preferential inhibitor of the inducible NO-synthase, completely abolished NO2-accumulation. Incubation with indomethacin or acetyl-salicylic acid, preferential inhibitors of the cyclooxygenase pathway of the arachidonic acid metabolism, did not influence NO2- levels. Nordihydro-guaiaretic acid (50 microM), a preferential inhibitor of the lipoxygenase pathway, caused strong reduction of NO2- accumulation to 1.9 +/- 0.3 nmol/200 microliter. Simultaneous inhibition of cyclo- and lipoxygenase by BW755c resulted in an intermediate effect (7.3 +/- 1.1 nmol/200 microliter NO2-). These results show that the induction of NO production in activated macrophages is regulated by products of the lipoxygenase-pathway of the arachidonic acid metabolism.
Directory of Open Access Journals (Sweden)
Ehsan Karimi
2012-11-01
Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme
DEFF Research Database (Denmark)
Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini
2014-01-01
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside...... to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP...
Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S
2016-09-01
Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Miziorko, H.M.; Behnke, C.E.
1985-01-01
3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A
2002-11-01
Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Sydor, Tobias; von Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert
2013-03-01
Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. © 2012 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Ardala Breda
Full Text Available The 5-phospho-α-D-ribose 1-diphosphate (PRPP metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS. Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P(i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P(i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure
Breda, Ardala; Martinelli, Leonardo K. B.; Bizarro, Cristiano V.; Rosado, Leonardo A.; Borges, Caroline B.; Santos, Diógenes S.; Basso, Luiz A.
2012-01-01
The 5-phospho-α-D-ribose 1-diphosphate (PRPP) metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P) and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS). Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of Pi. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of Pi would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure determination of Mt
Directory of Open Access Journals (Sweden)
Yi-Hsuan Wu
Full Text Available ATP synthase is present on the plasma membrane of several types of cancer cells. Citreoviridin, an ATP synthase inhibitor, selectively suppresses the proliferation and growth of lung cancer without affecting normal cells. However, the global effects of targeting ectopic ATP synthase in vivo have not been well defined. In this study, we performed quantitative proteomic analysis using isobaric tags for relative and absolute quantitation (iTRAQ and provided a comprehensive insight into the complicated regulation by citreoviridin in a lung cancer xenograft model. With high reproducibility of the quantitation, we obtained quantitative proteomic profiling with 2,659 proteins identified. Bioinformatics analysis of the 141 differentially expressed proteins selected by their relative abundance revealed that citreoviridin induces alterations in the expression of glucose metabolism-related enzymes in lung cancer. The up-regulation of enzymes involved in gluconeogenesis and storage of glucose indicated that citreoviridin may reduce the glycolytic intermediates for macromolecule synthesis and inhibit cell proliferation. Using comprehensive proteomics, the results identify metabolic aspects that help explain the antitumorigenic effect of citreoviridin in lung cancer, which may lead to a better understanding of the links between metabolism and tumorigenesis in cancer therapy.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Babbitt, Shalon E; Hsu, Jennifer; Mendez, Deanna L; Kranz, Robert G
2017-07-05
C-type cytochromes (cyts c) are generally characterized by the presence of two thioether attachments between heme and two cysteine residues within a highly conserved CXXCH motif. Most eukaryotes use the System III cyt c biogenesis pathway composed of holocytochrome c synthase (HCCS) to catalyze thioether formation. Some protozoan organisms express a functionally equivalent, natural variant of cyt c with an XXXCH heme-attachment motif, resulting in a single covalent attachment. Previous studies have shown that recombinant HCCS can produce low levels of the XXXCH single thioether variant. However, cyt c variants containing substitutions at the C-terminal cysteine of the heme-attachment site (i.e., resulting in CXXXH) have never been observed in nature, and attempts to biosynthesize a recombinant version of this cyt c variant have been largely unsuccessful. In this study, we report the biochemical analyses of an HCCS-matured CXXXH cyt c variant, comparing its biosynthesis and properties to those of the XXXCH variant. The results indicate that although HCCS mediates heme attachment to the N-terminal cysteine in CXXXH cyt c variants, up to 50% of the cyt c produced is modified in an oxygen-dependent manner, resulting in a mixed population of cyt c. Since this aerobic modification occurs only in the context of CXXXH, we also propose that natural HCCS-mediated heme attachment to CXXCH likely initiates at the C-terminal cysteine.
Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K
2001-01-01
The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.
Energy Technology Data Exchange (ETDEWEB)
Halavaty, Andrei S. [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Kim, Youngchang [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Zhou, Min [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Onopriyenko, Olena; Skarina, Tatiana [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N. [Center for Structural Genomics of Infectious Diseases, (United States); J. Craig Venter Institute, Rockville, MD 20850 (United States); Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Savchenko, Alexei [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Anderson, Wayne F., E-mail: wf-anderson@northwestern.edu [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States)
2012-10-01
The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.
International Nuclear Information System (INIS)
Halavaty, Andrei S.; Kim, Youngchang; Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James; Zhou, Min; Onopriyenko, Olena; Skarina, Tatiana; Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N.; Joachimiak, Andrzej; Savchenko, Alexei; Anderson, Wayne F.
2012-01-01
The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS SA ), Vibrio cholerae (AcpS VC ) and Bacillus anthracis (AcpS BA ) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS BA is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS BA may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP
Hernández-Blanco, Camilo; Feng, Dong Xin; Hu, Jian; Sánchez-Vallet, Andrea; Deslandes, Laurent; Llorente, Francisco; Berrocal-Lobo, Marta; Keller, Harald; Barlet, Xavier; Sánchez-Rodríguez, Clara; Anderson, Lisa K.; Somerville, Shauna; Marco, Yves; Molina, Antonio
2007-01-01
Cellulose is synthesized by cellulose synthases (CESAs) contained in plasma membrane–localized complexes. In Arabidopsis thaliana, three types of CESA subunits (CESA4/IRREGULAR XYLEM5 [IRX5], CESA7/IRX3, and CESA8/IRX1) are required for secondary cell wall formation. We report that mutations in these proteins conferred enhanced resistance to the soil-borne bacterium Ralstonia solanacearum and the necrotrophic fungus Plectosphaerella cucumerina. By contrast, susceptibility to these pathogens was not altered in cell wall mutants of primary wall CESA subunits (CESA1, CESA3/ISOXABEN RESISTANT1 [IXR1], and CESA6/IXR2) or POWDERY MILDEW–RESISTANT5 (PMR5) and PMR6 genes. Double mutants indicated that irx-mediated resistance was independent of salicylic acid, ethylene, and jasmonate signaling. Comparative transcriptomic analyses identified a set of common irx upregulated genes, including a number of abscisic acid (ABA)–responsive, defense-related genes encoding antibiotic peptides and enzymes involved in the synthesis and activation of antimicrobial secondary metabolites. These data as well as the increased susceptibility of ABA mutants (abi1-1, abi2-1, and aba1-6) to R. solanacearum support a direct role of ABA in resistance to this pathogen. Our results also indicate that alteration of secondary cell wall integrity by inhibiting cellulose synthesis leads to specific activation of novel defense pathways that contribute to the generation of an antimicrobial-enriched environment hostile to pathogens. PMID:17351116
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
DEFF Research Database (Denmark)
Oeemig, Jesper S; Jørgensen, Mathilde L; Hansen, Mikka S
2009-01-01
In this manuscript, we present the backbone and side chain assignments of human brain-type fatty acid binding protein, also known as FABP7, in its apo form and in four different holo forms, bound to DHA, oleic acid, linoleic acid and elaidic acid.......In this manuscript, we present the backbone and side chain assignments of human brain-type fatty acid binding protein, also known as FABP7, in its apo form and in four different holo forms, bound to DHA, oleic acid, linoleic acid and elaidic acid....
Structure of the Y94F mutant of Escherichia coli thymidylate synthase
International Nuclear Information System (INIS)
Roberts, Sue A.; Hyatt, David C.; Honts, Jerry E.; Changchien, Liming; Maley, Gladys F.; Maley, Frank; Montfort, William R.
2006-01-01
Mutation of Tyr94 of E. coli thymidylate synthase to phenylalanine leads to a protein with k cat reduced by a factor of 400. The Y94F structure is essentially identical to the wild-type structure, which is consistent with a catalytic role for the phenolic OH. Tyr94 of Escherichia coli thymidylate synthase is thought to be involved, either directly or by activation of a water molecule, in the abstraction of a proton from C5 of the 2′-deoxyuridine 5′-monophosphate (dUMP) substrate. Mutation of Tyr94 leads to a 400-fold loss in catalytic activity. The structure of the Y94F mutant has been determined in the native state and as a ternary complex with thymidine 5′-monophosphate (dTMP) and 10-propargyl 5,8-dideazafolate (PDDF). There are no structural changes ascribable to the mutation other than loss of a water molecule hydrogen bonded to the tyrosine OH, which is consistent with a catalytic role for the phenolic OH
Structure of the Y94F mutant of Escherichia coli thymidylate synthase
Energy Technology Data Exchange (ETDEWEB)
Roberts, Sue A.; Hyatt, David C. [Department of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, AZ 85721 (United States); Honts, Jerry E. [Department of Biology, Drake University, Des Moines, IA 50311 (United States); Changchien, Liming; Maley, Gladys F.; Maley, Frank [Wadsworth Center, New York State Department of Health, Albany, NY 12201-0509 (United States); Montfort, William R., E-mail: montfort@email.arizona.edu [Department of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, AZ 85721 (United States)
2006-09-01
Mutation of Tyr94 of E. coli thymidylate synthase to phenylalanine leads to a protein with k{sub cat} reduced by a factor of 400. The Y94F structure is essentially identical to the wild-type structure, which is consistent with a catalytic role for the phenolic OH. Tyr94 of Escherichia coli thymidylate synthase is thought to be involved, either directly or by activation of a water molecule, in the abstraction of a proton from C5 of the 2′-deoxyuridine 5′-monophosphate (dUMP) substrate. Mutation of Tyr94 leads to a 400-fold loss in catalytic activity. The structure of the Y94F mutant has been determined in the native state and as a ternary complex with thymidine 5′-monophosphate (dTMP) and 10-propargyl 5,8-dideazafolate (PDDF). There are no structural changes ascribable to the mutation other than loss of a water molecule hydrogen bonded to the tyrosine OH, which is consistent with a catalytic role for the phenolic OH.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
A Mendelian Randomization Study of Circulating Uric Acid and Type 2 Diabetes
Sluijs, Ivonne; Holmes, Michael V.; van der Schouw, Yvonne T.; Beulens, Joline W J; Asselbergs, Folkert W.; Huerta, José María; Palmer, Tom M.; Arriola, Larraitz; Balkau, Beverley; Barricarte, Aurelio; Boeing, Heiner; Clavel-Chapelon, Françoise; Fagherazzi, Guy; Franks, Paul W.; Gavrila, Diana; Kaaks, Rudolf; Khaw, Kay T ee; Kühn, Tilman; Molina-Montes, Esther; Mortensen, Lotte M axild; Nilsson, Peter M.; Overvad, Kim; Palli, Domenico; Panico, Salvatore; Quirós, J. Ramón; Rolandsson, Olov; Sacerdote, Carlotta; Sala, Núria; Schmidt, Julie A.; Scott, Robert A.; Sieri, Sabina; Slimani, Nadia; Spijkerman, Annemieke M W; Tjonneland, Anne; Travis, Ruth C.; Tumino, Rosario; van der A, Daphne L.; Sharp, Stephen J.; Forouhi, Nita G.; Langenberg, Claudia; Riboli, Elio; Wareham, Nicholas J.
2015-01-01
We aimed to investigate the causal effect of circulating uric acid concentrations on type 2 diabetes risk. A Mendelian randomization study was performed using a genetic score with 24 uric acid-associated loci. We used data of the European Prospective Investigation into Cancer and Nutrition
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...
International Nuclear Information System (INIS)
Ökvist, Mats; Sasso, Severin; Roderer, Kathrin; Kast, Peter; Krengel, Ute
2009-01-01
Two shikimate-pathway enzymes from M. tuberculosis, the intracellular chorismate mutase (MtCM) and DAHP synthase (MtDS), were produced recombinantly and purified. MtCM was crystallized alone and in complex with MtDS and analyzed by X-ray diffraction. Chorismate mutase catalyzes a key step in the shikimate-biosynthetic pathway and hence is an essential enzyme in bacteria, plants and fungi. Mycobacterium tuberculosis contains two chorismate mutases, a secreted and an intracellular one, the latter of which (MtCM; Rv0948c; 90 amino-acid residues; 10 kDa) is the subject of this work. Here are reported the gene expression, purification and crystallization of MtCM alone and of its complex with another shikimate-pathway enzyme, DAHP synthase (MtDS; Rv2178c; 472 amino-acid residues; 52 kDa), which has been shown to enhance the catalytic efficiency of MtCM. The MtCM–MtDS complex represents the first noncovalent enzyme complex from the common shikimate pathway to be structurally characterized. Soaking experiments with a transition-state analogue are also reported. The crystals of MtCM and the MtCM–MtDS complex diffracted to 1.6 and 2.1 Å resolution, respectively
Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte
2014-01-01
between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...
The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.
Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra
2016-04-01
The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae
2007-01-01
In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...
Directory of Open Access Journals (Sweden)
S. Suresh
2016-01-01
Full Text Available The molecular structure of the three compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III has been determined using Gaussian 03W program with B3LYP method using 6-311++G (d,p basis set calculations. The molecular structures were fully optimized with atomic numbering scheme adopted in the study. To understand the mode of binding and molecular interaction, the docking studies of compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III have been carried out with prostaglandin H2 synthase-1 (1PGE as target using induced fit docking. The molecular docking results show that the interactions and energy for Aceclofenac, Salicylic Acid, and Piroxicam show the best results when docked with prostaglandin H2 synthase-1 (1PGE. The hydrogen bonding interactions of compound I (Aceclofenac are prominent with Arginine moiety, those of compound II (Salicylic Acid are prominent with Tyrosine and Serine moieties, and compound III (Piroxicam shows such interaction with Tyrosine and Arginine moieties. These interactions of prostaglandin H2 synthase-1 (1PGE with substrates are responsible for governing COX-1 inhibitor potency which in turn is a direct measure of the potency of the drug.
Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg
2010-01-01
The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448
Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation.
López-Gallardo, Ester; Llobet, Laura; Emperador, Sonia; Montoya, Julio; Ruiz-Pesini, Eduardo
2016-09-01
The oxidative phosphorylation system (OXPHOS) includes nuclear chromosome (nDNA)- and mitochondrial DNA (mtDNA)-encoded polypeptides. Many rare OXPHOS disorders, such as striatal necrosis syndromes, are caused by genetic mutations. Despite important advances in sequencing procedures, causative mutations remain undetected in some patients. It is possible that etiologic factors, such as environmental toxins, are the cause of these cases. Indeed, the inhibition of a particular enzyme by a poison could imitate the biochemical effects of pathological mutations in that enzyme. Moreover, environmental factors can modify the penetrance or expressivity of pathological mutations. We studied the interaction between mitochondrially encoded ATP synthase 6 (p.MT-ATP6) subunit and an environmental exposure that may contribute phenotypic differences between healthy individuals and patients suffering from striatal necrosis syndromes or other mitochondriopathies. We analyzed the effects of the ATP synthase inhibitor tributyltin chloride (TBTC), a widely distributed environmental factor that contaminates human food and water, on transmitochondrial cell lines with or without an ATP synthase mutation that causes striatal necrosis syndrome. Doses were selected based on TBTC concentrations previously reported in human whole blood samples. TBTC modified the phenotypic effects caused by a pathological mtDNA mutation. Interestingly, wild-type cells treated with this xenobiotic showed similar bioenergetics when compared with the untreated mutated cells. In addition to the known genetic causes, our findings suggest that environmental exposure to TBTC might contribute to the etiology of striatal necrosis syndromes. López-Gallardo E, Llobet L, Emperador S, Montoya J, Ruiz-Pesini E. 2016. Effects of tributyltin chloride on cybrids with or without an ATP synthase pathologic mutation. Environ Health Perspect 124:1399-1405; http://dx.doi.org/10.1289/EHP182.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase
International Nuclear Information System (INIS)
Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.
2016-01-01
The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Ma, Ming; Kwong, Thomas; Lim, Si-Kyu; Ju, Jianhua; Lohman, Jeremy R.; Shen, Ben
2013-01-01
The iso-migrastatin (iso-MGS) biosynthetic gene cluster from Streptomyces platensis NRRL 18993 consists of 11 genes, featuring an acyltransferase (AT)-less type I polyketide synthase (PKS) and three tailoring enzymes MgsIJK. Systematic inactivation of mgsIJK in S. platensis enabled us to (i) identify two nascent products (10 and 13) of the iso-MGS AT-less type I PKS, establishing an unprecedented novel feature for AT-less type I PKSs, and (ii) account for the formation of all known post-PKS biosynthetic intermediates (10-17) generated by the three tailoring enzymes MgsIJK, which possessed significant substrate promiscuities. PMID:23394593
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
Król, P; Igielski, R; Pollmann, S; Kępczyńska, E
2015-05-01
Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Directory of Open Access Journals (Sweden)
Jeffrey D Nanson
Full Text Available Ketoacyl-acyl carrier protein reductases (FabG are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP linked thioesters within the bacterial type II fatty acid synthesis (FASII pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG, the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
International Nuclear Information System (INIS)
Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.
1986-01-01
Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor
Resistance Training in Type 2 Diabetic Patients Improves Uric Acid Levels
Directory of Open Access Journals (Sweden)
R. Sousa Moisés S.S.
2014-12-01
Full Text Available Resistance training (RT can provide several benefits for individuals with Type 2 diabetes. The aim of this study was to investigate the effects of resistance training on the strength levels and uric acid (UA concentration in individuals with Type 2 diabetes. The study included 68 patients (57.7±9.0 years that participated in an organized program of RT for 12 weeks. The volunteers were divided into two groups: an experimental group (EG; n=34 that performed the resistance training program consisting of seven exercises executed in an alternating order based on segments; and a control group (CG; n=34 that maintained their normal daily life activities. Muscle strength and uric acid were measured both pre- and post-experiment. The results showed a significant increase in strength of the subjects in the EG for all exercises included in the study (p<0.001. Comparing the strength levels of the post-test, intergroup differences were found in supine sitting (p<0.001, leg extension (p<0.001, shoulder press (p<0.001, leg curl (p=0.001, seated row (p<0.001, leg press (p=0.001 and high pulley (p<0.001. The measured uric acid was significantly increased in both experimental and control groups (p<0.001 and p=0.001, respectively. The intergroup comparison showed a significant increase for the EG (p=0.024. We conclude that the training program was effective for strength gains despite an increase in uric acid in Type 2 diabetics.
Selective inhibition of type 2 fatty acid synthetase by the antibiotic thiolactomycin
International Nuclear Information System (INIS)
Nishida, Ikuo; Kawaguchi, Akihiko; Yamada, Mitsuhiro
1984-01-01
The antibiotic thiolactomycin inhibits the fatty acid synthesis from both [1- 14 C]-acetate and [2 14 C] malonyl-CoA of spinach leaves, developing castor bean endosperms and avocado mesocarp. On the other hand, fatty acid synthetases of Brevibacterium ammoniagenes and Corynebacterium glutamicum are much less sensitive to this antibiotic. As Hayashi et al. have indicated in their paper that thiolactomycin inhibits fatty acid synthetase of Escherichia coli but has little effect on the synthetases of yeast and rat liver, thiolactomycin is suggested to be a selective inhibitor of type 2 fatty acid synthetases. (author)
Selective inhibition of type 2 fatty acid synthetase by the antibiotic thiolactomycin
Energy Technology Data Exchange (ETDEWEB)
Nishida, Ikuo; Kawaguchi, Akihiko; Yamada, Mitsuhiro (Tokyo Univ. (Japan). Faculty of Science)
1984-03-01
The antibiotic thiolactomycin inhibits the fatty acid synthesis from both (1-/sup 14/C)-acetate and (2/sup 14/C) malonyl-CoA of spinach leaves, developing castor bean endosperms and avocado mesocarp. On the other hand, fatty acid synthetases of Brevibacterium ammoniagenes and Corynebacterium glutamicum are much less sensitive to this antibiotic. As Hayashi et al. have indicated in their paper that thiolactomycin inhibits fatty acid synthetase of Escherichia coli but has little effect on the synthetases of yeast and rat liver, thiolactomycin is suggested to be a selective inhibitor of type 2 fatty acid synthetases.
Metabolically engineered cells for the production of polyunsaturated fatty acids
DEFF Research Database (Denmark)
2005-01-01
The present invention relates to the construction and engineering of cells, more particularly microorganisms for producing PUFAs with four or more double bonds from non-fatty acid substrates through heterologous expression of an oxygen requiring pathway. The invention especially involves...... improvement of the PUFA content in the host organism through fermentation optimization, e.g. decreasing the temperature and/or designing an optimal medium, or through improving the flux towards fatty acids by metabolic engineering, e.g. through over-expression of fatty acid synthases, over-expression of other...
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Aqueous Boric acid injection facility of PWR type reactor
International Nuclear Information System (INIS)
Matsuoka, Tsuyoshi; Iwami, Masao.
1996-01-01
If a rupture should be caused in a secondary system of a PWR type reactor, pressure of a primary coolant recycling system is lowered, and a back flow check valve is opened in response to the lowering of the pressure. Then, low temperature aqueous boric acid in the lower portion of a pressurized tank is flown into the primary coolant recycling system based on the pressure difference, and the aqueous boric acid reaches the reactor core together with coolants to suppress reactivity. If the injection is continued, high temperature aqueous boric acid in the upper portion boils under a reduced pressure, further urges the low temperature aqueous boric acid in the lower portion by the steam pressure and injects the same to the primary system. The aqueous boric acid stream from the pressurized tank flowing by self evaporation of the high temperature aqueous boric acid itself is rectified by a rectifying device to prevent occurrence of vortex flow, and the steam is injected in a state of uniform stream. When the pressure in the pressurized tank is lowered, a bypass valve is opened to introduce the high pressure fluid of primary system into the pressurized tank to keep the pressure to a predetermined value. When the pressure in the pressurized tank is elevated to higher than the pressure of the primary system, a back flow check valve is opened, and high pressure aqueous boric acid is flown out of the pressurized tank to keep the pressure to a predetermined value. (N.H.)
Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice
Nørregaard, Rikke; Tao, Shixin; Nilsson, Line; Woodgett, James R.; Kakade, Vijayakumar; Yu, Alan S. L.; Howard, Christiana; Rao, Reena
2015-01-01
In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To investigate the role of GSK3α in urine concentration, we compared GSK3α knockout (GSK3αKO) mice with wild-type (WT) littermates. Under normal conditions, GSK3αKO mice had higher water intake and urine outp...
Mihalik, Stephanie J.; Michaliszyn, Sara F.; de las Heras, Javier; Bacha, Fida; Lee, SoJung; Chace, Donald H.; DeJesus, Victor R.; Vockley, Jerry; Arslanian, Silva A.
2012-01-01
OBJECTIVE We compared acylcarnitine (AcylCN) species, common amino acid and fat oxidation (FOX) byproducts, and plasma amino acids in normal weight (NW; n = 39), obese (OB; n = 64), and type 2 diabetic (n = 17) adolescents. RESEARCH DESIGN AND METHODS Fasting plasma was analyzed by tandem mass spectrometry, body composition by dual energy X-ray absorptiometry and computed tomography, and total-body lipolysis and substrate oxidation by [2H5]glycerol and indirect calorimetry, respectively. In v...
Triacetic acid lactone production in industrial Saccharomyces yeast strains
Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...
International Nuclear Information System (INIS)
Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou
2010-01-01
Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.
The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.
Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard
2015-05-22
HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Fan, Aili; Zocher, Georg; Stec, Edyta; Stehle, Thilo; Li, Shu-Ming
2015-01-01
The tryptophan prenyltransferases FgaPT2 and 7-DMATS (7-dimethylallyl tryptophan synthase) from Aspergillus fumigatus catalyze C4- and C7-prenylation of the indole ring, respectively. 7-DMATS was found to accept l-tyrosine as substrate as well and converted it to an O-prenylated derivative. An acceptance of l-tyrosine by FgaPT2 was also observed in this study. Interestingly, isolation and structure elucidation revealed the identification of a C3-prenylated l-tyrosine as enzyme product. Molecular modeling and site-directed mutagenesis led to creation of a mutant FgaPT2_K174F, which showed much higher specificity toward l-tyrosine than l-tryptophan. Its catalytic efficiency toward l-tyrosine was found to be 4.9-fold in comparison with that of non-mutated FgaPT2, whereas the activity toward l-tryptophan was less than 0.4% of that of the wild-type. To the best of our knowledge, this is the first report on an enzymatic C-prenylation of l-tyrosine as free amino acid and altering the substrate preference of a prenyltransferase by mutagenesis. PMID:25477507
International Nuclear Information System (INIS)
Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.
2009-01-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Energy Technology Data Exchange (ETDEWEB)
Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)
2009-07-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.
Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P
2012-01-01
Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Pfeiffer, Daniel; Jendrossek, Dieter
2014-01-01
Poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) is the key enzyme of PHB synthesis in Ralstonia eutropha and other PHB-accumulating bacteria and catalyzes the polymerization of 3-hydroxybutyryl-CoA to PHB. Activity assays of R. eutropha PHB synthase are characterized by the presence of lag phases and by low specific activity. It is assumed that the lag phase is caused by the time necessary to convert the inactive PhaC1 monomer into the active dimeric form by an unknown priming process. The lag phase can be reduced by addition of nonionic detergents such as hecameg [6-O-(N-heptyl-carbamoyl)-methyl-α-D-glucopyranoside], which apparently accelerates the formation of PhaC1 dimers. We identified the PHB granule-associated protein (PGAP) PhaM as the natural primer (activator) of PHB synthase activity. PhaM was recently discovered as a novel type of PGAP with multiple functions in PHB metabolism. Addition of PhaM to PHB synthase assays resulted in immediate polymerization of 3HB coenzyme A with high specific activity and without a significant lag phase. The effect of PhaM on (i) PhaC1 activity, (ii) oligomerization of PhaC1, (iii) complex formation with PhaC1, and (iv) PHB granule formation in vitro and in vivo was shown by cross-linking experiments of purified proteins (PhaM, PhaC1) with glutardialdehyde, by size exclusion chromatography, and by fluorescence microscopic detection of de novo-synthesized PHB granules.
Institute of Scientific and Technical Information of China (English)
YU Yang; HOU Wen-sheng; YaeI Hacham; SUN Shi; WU Cun-xiang; Ifat Matityahu; SONG Shikui; RacheI Amir; HAN Tian-fu
2018-01-01
Soybean (Glycine max (L.) Merr.) is a major crop that provides plant-origin protein and oil for humans and livestock. Although the soybean vegetative tissues and seeds provide a major source of high-quality protein, they suffer from low concentration of an essential sulfur-containing amino acid, methionine, which significantly limits their nutritional quality. The level of methionine is mainly controlled by the first unique enzyme of methionine synthesis, cystathione γ-synthase (CGS). Aiming to elevate methionine level in vegetative tissues and seeds, we constitutively over-expressed a feedback-insensitive Arabidopsis CGS (AtD-CGS) in soybean cultivars, Zigongdongdou (ZD) and Jilinxiaoli 1 (JX). The levels of soluble methionine increased remarkably in leaves of transgenic soybeans compared to wild-type plants (6.6- and 7.3-fold in two transgenic ZD lines, and 3.7-fold in one transgenic JX line). Furthermore, the total methionine contents were significantly increased in seeds of the transgenic ZD lines (1.5- to 4.8-fold increase) and the transgenic JX lines (1.3- to 2.3-fold increase) than in the wild type. The protein contents of the transgenic soybean seeds were significantly elevated compared to the wild type, suggesting that the scarcity of methionine in soybeans may limit protein accumulation in soybean seeds. The increased protein content did not alter the profile of major storage proteins in the seeds. Generally, this study provides a promising strategy to increase the levels of methionine and protein in soybean through the breeding programs.
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
Cyclic GMP-AMP Synthase is an Innate Immune Sensor of HIV and Other Retroviruses
Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J.
2013-01-01
Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic-GMP-AMP (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type-I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse transcribed HIV DNA triggers the...
Stan-Lotter, Helga; Hochstein, Lawrence I.
1989-01-01
A purified ATPase associated with membranes from Halobacterium saccharovorum was compared with the F sub 1 moiety from the Escherichia coli ATP Synthase. The halobacterial enzyme was composed of two major (I and II) and two minor subunits (III and IV), whose molecular masses were 87 kDa, 60 kDa, 29 kDa, and 20 kDa, respectively. The isoelectric points of these subunits ranged from 4.1 to 4.8, which in the case of the subunits I and II was consistent with the presence of an excess of acidic amino acids (20 to 22 Mol percent). Peptide mapping of sodium dodecylsulfate-denatured subunits I and II showed no relationship between the primary structures of the individual halobacterial subunits or similarities to the subunits of the F sub 1 ATPase (EC 3.6.1.34) from E. coli. Trypsin inactivation of the halobacterial ATPase was accompanied by the partial degradation of the major subunits. This observation, taken in conjunction with molecular masses of the subunits and the native enzyme, was consistent with the previously proposed stoichiometry of 2:2:1:1. These results suggest that H. saccharovorum, and possibly, Halobacteria in general, possess an ATPase which is unlike the ubiquitous F sub o F sub 1 - ATP Synthase.
Zhang, Ke; Li, Huidong; Chen, Wuxi; Zhao, Minli; Cui, Haiyang; Min, Qingsong; Wang, Haijun; Chen, Shulin; Li, Demao
2017-05-01
Docosapentaenoic acid/docosahexaenoic acid ratio (DPA/DHA ratio) in Schizochytrium was relatively stable. But ideally the ratio of DPA/DHA will vary according to the desired end use. This study reports several ways of modulating the DPA/DHA ratio. Incubation times changed the DPA/DHA ratio, and changes in this ratio were associated with the variations in the saturated fatty acid (SFAs) content. Propionic acid sharply increased the SFAs content in lipids, dramatically decreased the even-chain SFAs content, and reduced the DPA/DHA ratio. Pentanoic acid (C5:0) and heptanoic acid (C7:0) had similar effects as propionic acid, whereas butyric acid (C4:0), hexanoic acid (C6:0), and octanoic acid (C8:0) did not change the fatty acid profile and the DPA/DHA ratio. Transcription analyses show that β-oxidation might be responsible for this phenomenon. Iodoacetamide upregulated polyunsaturated fatty acid (PUFA) synthase genes, reduced the DHA content, and improved the DPA content, causing the DPA/DHA ratio to increase. These results present new insights into the regulation of the DPA/DHA ratio.
Abscisic acid-type sesquiterpenes and ansamycins from Amycolatopsis alba DSM 44262.
Li, Xiao-Mei; Li, Xiao-Man; Lu, Chun-Hua
2017-10-01
Two new abscisic acid-type sesquiterpenes (1, 2), and one new ansamycin (3), together with four known ansamycins, namely ansacarbamitocins 4-7, were isolated from the fermentation extract of Amycolatopsis alba DSM 44262. The structures of the new compounds were elucidated to be (E)-3-methyl-5-(2,6,6-trimethyl-3-oxocyclohex-1-enyl)pent-2-enoic acid (1) and (E)-3-methyl-5-(2,6,6-trimethyl-4-oxocyclohex-2-enyl)pent-2-enoic acid (2), and 9-O-methylansacarbamitocin A1 (3), on the basis of comprehensive analysis of spectroscopic data, respectively. The antimicrobial activities were also evaluated for all seven compounds.
Energy Technology Data Exchange (ETDEWEB)
Marcella, Aaron M.; Culbertson, Sannie J.; Shogren-Knaak, Michael A.; Barb, Adam W.
2017-11-01
The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05 and 4.10 Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a KD = 62 ± 13 nM, followed by the binding of two more equivalents of holo-ACPP with KD = 1.2 ± 0.2 μM. Cooperativity was not observed for apo-ACPP which bound with KD = 2.4 ± 0.1 μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis.
Chen, Yang; Jernerén, Fredrik; Oliw, Ernst H
2017-07-01
Plants and fungi form jasmonic acid from α-linolenic acid. The first two steps of biosynthesis in plants occur by sequential transformation by 13S-lipoxygenase and allene oxide synthase (AOS). The biosynthesis in fungi may follow this classical scheme, but the only fungal AOS discovered so far are cytochromes P450 (CYP) fused to 8- and 9-dioxygenases (DOX). In the present report, we purified recombinant 9S-DOX-AOS of Fusarium oxysporum from cell lysate by cobalt affinity chromatography to near homogeneity and studied key residues by site-directed mutagenesis. Sequence homology with 8R-DOX-linoleate diol synthases (8R-DOX-LDS) suggested that Tyr414 catalyzes hydrogen abstraction and that Cys1051 forms the heme thiolate ligand. Site-directed mutagenesis (Tyr414Phe; Cys1051Ser) led to loss of 9S-DOX and 9S-AOS activities, respectively, but other important residues in the CYP parts of 5,8- and 7,8-LDS or 9R-AOS were not conserved. The UV-visible spectrum of 9S-DOX-AOS showed a Soret band at 409 nm, which shifted to 413 nm in the Cys1051Ser mutant. The 9S-AOS of the Tyr414Phe mutant transformed 9S-hydroperoxides of α-linolenic and linoleic acids to allene oxides/α-ketols, but it did not transform 13-hydroperoxides. We conclude that 9S- and 8R-DOX catalyze hydrogen abstraction at C-11 and C-8, respectively, by homologous Tyr residues. Copyright © 2017 Elsevier Inc. All rights reserved.
Amoutzias, Grigoris D.; Chaliotis, Anargyros; Mossialos, Dimitris
2016-01-01
Considering that 70% of our planet’s surface is covered by oceans, it is likely that undiscovered biodiversity is still enormous. A large portion of marine biodiversity consists of microbiomes. They are very attractive targets of bioprospecting because they are able to produce a vast repertoire of secondary metabolites in order to adapt in diverse environments. In many cases secondary metabolites of pharmaceutical and biotechnological interest such as nonribosomal peptides (NRPs) and polyketides (PKs) are synthesized by multimodular enzymes named nonribosomal peptide synthetases (NRPSes) and type-I polyketide synthases (PKSes-I), respectively. Novel findings regarding the mechanisms underlying NRPS and PKS evolution demonstrate how microorganisms could leverage their metabolic potential. Moreover, these findings could facilitate synthetic biology approaches leading to novel bioactive compounds. Ongoing advances in bioinformatics and next-generation sequencing (NGS) technologies are driving the discovery of NRPs and PKs derived from marine microbiomes mainly through two strategies: genome-mining and metagenomics. Microbial genomes are now sequenced at an unprecedented rate and this vast quantity of biological information can be analyzed through genome mining in order to identify gene clusters encoding NRPSes and PKSes of interest. On the other hand, metagenomics is a fast-growing research field which directly studies microbial genomes and their products present in marine environments using culture-independent approaches. The aim of this review is to examine recent developments regarding discovery strategies of bioactive compounds synthesized by NRPS and type-I PKS derived from marine microbiomes and to highlight the vast diversity of NRPSes and PKSes present in marine environments by giving examples of recently discovered bioactive compounds. PMID:27092515
Directory of Open Access Journals (Sweden)
Grigoris D. Amoutzias
2016-04-01
Full Text Available Considering that 70% of our planet’s surface is covered by oceans, it is likely that undiscovered biodiversity is still enormous. A large portion of marine biodiversity consists of microbiomes. They are very attractive targets of bioprospecting because they are able to produce a vast repertoire of secondary metabolites in order to adapt in diverse environments. In many cases secondary metabolites of pharmaceutical and biotechnological interest such as nonribosomal peptides (NRPs and polyketides (PKs are synthesized by multimodular enzymes named nonribosomal peptide synthetases (NRPSes and type-I polyketide synthases (PKSes-I, respectively. Novel findings regarding the mechanisms underlying NRPS and PKS evolution demonstrate how microorganisms could leverage their metabolic potential. Moreover, these findings could facilitate synthetic biology approaches leading to novel bioactive compounds. Ongoing advances in bioinformatics and next-generation sequencing (NGS technologies are driving the discovery of NRPs and PKs derived from marine microbiomes mainly through two strategies: genome-mining and metagenomics. Microbial genomes are now sequenced at an unprecedented rate and this vast quantity of biological information can be analyzed through genome mining in order to identify gene clusters encoding NRPSes and PKSes of interest. On the other hand, metagenomics is a fast-growing research field which directly studies microbial genomes and their products present in marine environments using culture-independent approaches. The aim of this review is to examine recent developments regarding discovery strategies of bioactive compounds synthesized by NRPS and type-I PKS derived from marine microbiomes and to highlight the vast diversity of NRPSes and PKSes present in marine environments by giving examples of recently discovered bioactive compounds.
Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Kelley, M.J.; Carman, G.M.
1987-01-01
The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism
Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe
2014-08-01
Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
International Nuclear Information System (INIS)
Yamakawa, Satoko; Oshita, Koji; Sabarudin, Akhmad; Oshima, Mitsuko; Motomizu, Shoji
2004-01-01
A chitosan-based resin possessing the iminodi(methyphosphonic acid) moiety (IDP-type chitrosan resin) was synthesized by using cross-linked chitosan as a base material. The adsorption behavior of trace metal ions on the IDP-type chitosan resin was systematically investigated using a mini-column (1 ml of the resin) packed with the resin. The concentrations of metal ions in the effluents were measured by ICP-MS and ICP-AES. The resin could adsorb four metals, such as In(III), Sn(II), Th(IV), and U(VI), by almost 100% over a wide pH range (1-7). Uranium(VI) and thorium could not be eluted with nitric acid and hydrochloric acid (1-6 M); other metal ions were easily and readily eluted with 1 M nitric acid. The IDP-type chitosan resin synthesized in this work can be applied to the separation of U(VI) and Th(IV) from other metal ions. (author)
Oliw, Ernst H; Hamberg, Mats
2017-08-01
Fungi can produce jasmonic acid (JA) and its isoleucine conjugate in large quantities, but little is known about the biosynthesis. Plants form JA from 18:3 n -3 by 13 S -lipoxygenase (LOX), allene oxide synthase, and allene oxide cyclase. Shaking cultures of Fusarium oxysporum f. sp. tulipae released over 200 mg of jasmonates per liter. Nitrogen powder of the mycelia expressed 10 R -dioxygenase-epoxy alcohol synthase activities, which was confirmed by comparison with the recombinant enzyme. The 13 S -LOX of F. oxysporum could not be detected in the cell-free preparations. Incubation of mycelia in phosphate buffer with [17,17,18,18,18- 2 H 5 ]18:3 n -3 led to biosynthesis of a [ 2 H 5 ]12-oxo-13-hydroxy-9 Z ,15 Z -octadecadienoic acid (α-ketol), [ 2 H 5 ]12-oxo-10,15 Z -phytodienoic acid (12-OPDA), and [ 2 H 5 ]13-keto- and [ 2 H 5 ]13 S -hydroxyoctadecatrienoic acids. The α-ketol consisted of 90% of the 13 R stereoisomer, suggesting its formation by nonenzymatic hydrolysis of an allene oxide with 13 S configuration. Labeled and unlabeled 12-OPDA were observed following incubation with 0.1 mM [ 2 H 5 ]18:3 n -3 in a ratio from 0.4:1 up to 47:1 by mycelia of liquid cultures of different ages, whereas 10 times higher concentration of [ 2 H 5 ]13 S -hydroperoxyoctadecatrienoic acid was required to detect biosynthesis of [ 2 H 5 ]12-OPDA. The allene oxide is likely formed by a cytochrome P450 or catalase-related hydroperoxidase. We conclude that F. oxysporum , like plants, forms jasmonates with an allene oxide and 12-OPDA as intermediates. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells
International Nuclear Information System (INIS)
Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.
1986-01-01
Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
DEFF Research Database (Denmark)
Gaster, Michael; Petersen, Ingrid; Højlund, Kurt
2002-01-01
The most well-described defect in the pathophysiology of type 2 diabetes is reduced insulin-mediated glycogen synthesis in skeletal muscles. It is unclear whether this defect is primary or acquired secondary to dyslipidemia, hyperinsulinemia, or hyperglycemia. We determined the glycogen synthase...
Directory of Open Access Journals (Sweden)
Marie Izac
Full Text Available It has been claimed that citrate synthase, aconitase and isocitrate dehydrogenase activities are non-functional in Bordetella pertussis and that this might explain why this bacterium's growth is sometimes associated with accumulation of polyhydroxybutyrate (PHB and/or free fatty acids. However, the sequenced genome includes the entire citric acid pathway genes. Furthermore, these genes were expressed and the corresponding enzyme activities detected at high levels for the pathway when grown on a defined medium imitating the amino acid content of complex media often used for growth of this pathogenic microorganism. In addition, no significant PHB or fatty acids could be detected. Analysis of the carbon balance and stoichiometric flux analysis based on specific rates of amino acid consumption, and estimated biomass requirements coherent with the observed growth rate, clearly indicate that a fully functional tricarboxylic acid cycle operates in contrast to previous reports.
Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie
2014-09-01
Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.
Inference of Transcription Regulatory Network in Low Phytic Acid Soybean Seeds
Directory of Open Access Journals (Sweden)
Neelam Redekar
2017-11-01
Full Text Available A dominant loss of function mutation in myo-inositol phosphate synthase (MIPS gene and recessive loss of function mutations in two multidrug resistant protein type-ABC transporter genes not only reduce the seed phytic acid levels in soybean, but also affect the pathways associated with seed development, ultimately resulting in low emergence. To understand the regulatory mechanisms and identify key genes that intervene in the seed development process in low phytic acid crops, we performed computational inference of gene regulatory networks in low and normal phytic acid soybeans using a time course transcriptomic data and multiple network inference algorithms. We identified a set of putative candidate transcription factors and their regulatory interactions with genes that have functions in myo-inositol biosynthesis, auxin-ABA signaling, and seed dormancy. We evaluated the performance of our unsupervised network inference method by comparing the predicted regulatory network with published regulatory interactions in Arabidopsis. Some contrasting regulatory interactions were observed in low phytic acid mutants compared to non-mutant lines. These findings provide important hypotheses on expression regulation of myo-inositol metabolism and phytohormone signaling in developing low phytic acid soybeans. The computational pipeline used for unsupervised network learning in this study is provided as open source software and is freely available at https://lilabatvt.github.io/LPANetwork/.
ATP Synthase, a Target for Dementia and Aging?
Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R
2018-02-01
Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.
Heat transfer, erosion and acid condensation characteristics for novel H-type finned oval tube
International Nuclear Information System (INIS)
Wang, Y; Zhao, X; Tang, G
2015-01-01
Low efficiency of heat transfer, acid corrosion and erosion of economizers affect the economy and security in coal-fired power plants significantly. The H-type finned oval tube is proposed to alleviate these problems. Based on the H-type finned oval tube, we investigated three novel types of fins, including bleeding dimples, longitudinal vortex generators (LVGs), and compound dimple-LVG. We considered the three aspects together, and obtained the heat transfer, acid condensation rate and erosion loss. The results show that the tube bank with the new structured fins can improve the performance on the three aspects, and the compound dimple-LVG performs the highest comprehensive effect. (paper)
Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji
2016-02-01
Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.
Quick and sensitive determination of gene expression of fatty acid ...
African Journals Online (AJOL)
User
2011-05-16
May 16, 2011 ... from fatty acid synthase (FAS) with a different glucose level in ... By using the following formula, this study was able to quantify the mRNA expression of ... hypertension, heart disease and diabetes. ... regulation of gene expression has emerged in recent ... stages of adipocyte meta-bolism are relatively well.
Structural and functional annotation of citrate synthase from Aspergillus niger ANJ-120.
Mustafa, Ghulam; Arif, Rawaba; Bukhari, Shazia Anwer; Ali, Muhammad; Sharif, Sumaira; Atta, Asia
2018-03-01
Citrate synthase (CS) is involved in citric acid biosynthesis which is a well-established metabolic pathway. The condensation of acetyl-CoA with oxaloacetate is catalyzed by CS. Citric acid (CA) has a number of applications in pharmaceutical industry. CA in combination with bicarbonates is used as an effervescent in the preparations of tablets and powders. It has also been used as an anticoagulant and acidulant to form mild astringent. In current study, detailed structural and functional analyses of CS protein were carried out using various bioinformatics tools. Structural modeling was also done by building 3D model of CS from Aspergillus niger ANJ-120 using Modeller 9.16 software. The 3D Model was then evaluated using different online approaches. Furthermore, superimposition of query and template structures, Root Mean Squared Deviation and visualization of generated model were done through UCSF Chimera 1.5.3. Even though various roles of CS protein were already known and verified experimentally, here we presented a structural analysis of CS protein. The structural investigation of CS protein will be helpful for protein engineering strategies and understanding the interactions among proteins. Due to large number of applications, the production of citric acid by A. niger and its bioinformatics studies will offer substantial improvement in commercial scale intensification of this useful product.
Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model
International Nuclear Information System (INIS)
Różycki, Bartosz; Cieplak, Marek
2014-01-01
We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme
Selectivity of the surface binding site (SBS) on barley starch synthase I
DEFF Research Database (Denmark)
Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica
2014-01-01
Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...
Studying the loading effect of acidic type antioxidant on amorphous silica nanoparticle carriers
Ravinayagam, Vijaya; Rabindran Jermy, B.
2017-06-01
The study investigates the suitable nanosilica carriers to transport acidic type cargo molecules for potential targeted drug delivery application. Using phenolic acidic type antioxidant gallic acid (GA) as model compound, the present study investigates the loading effect of GA (0.3-15.9 mmol GA g-1 support) on textural characteristics of amorphous silica nanoparticles such as Q10 silica (1D), structured two-dimensional Si-MCM-41 (2D), and three-dimensional Si-SBA-16 (3D). The variation in the nature of textures after GA loading was analyzed using X-ray diffraction, N2 adsorption, FT-IR, scanning electron microscopy with energy dispersive X-ray spectroscopy, and high-resolution transmission electron microscopy. Among the nanocarriers, high adsorption of GA was found in the following order: Si-SBA-16 (3D)˜Si-KIT-6 (3D) > Si-MCM-41 (2D) > ultralarge pore FDU-12 (ULPFDU-12; 3D) > Q10 (1D)˜mesostructured cellular silica foam (MSU-F). 3D-type silicas Si-SBA-16 and KIT-6 were shown to maintain structural integrity at acidic condition (pH ˜3) and accommodate GA in non-crystalline form. In the case of ULPFDU-12 and MSU-F cellular foam, only crystalline deposition of GA occurs with a significant variation in the surface area and pore volume. [Figure not available: see fulltext.
Directory of Open Access Journals (Sweden)
Irina Petrache
Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.
Kinetics and equilibria of cyanide binding to prostaglandin H synthase.
MacDonald, I D; Dunford, H B
1989-09-01
Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Chen, Chao; Cao, Ruikai; Shrestha, Ruben; Ward, Christina; Katz, Benjamin B; Fischer, Christopher J; Tomich, John M; Li, Ping
2015-05-15
Polyhydroxybutyrate (PHB) synthases (PhaCs) catalyze the formation of biodegradable PHB polymers that are considered as an ideal alternative to petroleum-based plastics. To provide strong evidence for the preferred mechanistic model involving covalent and noncovalent intermediates, a substrate analog HBOCoA was synthesized chemoenzymatically. Substitution of sulfur in the native substrate HBCoA with an oxygen in HBOCoA enabled detection of (HB)nOCoA (n = 2-6) intermediates when the polymerization was catalyzed by wild-type (wt-)PhaECAv at 5.84 h(-1). This extremely slow rate is due to thermodynamically unfavorable steps that involve the formation of enzyme-bound PHB species (thioesters) from corresponding CoA oxoesters. Synthesized standards (HB)nOCoA (n = 2-3) were found to undergo both reacylation and hydrolysis catalyzed by the synthase. Distribution of the hydrolysis products highlights the importance of the penultimate ester group as previously suggested. Importantly, the reaction between primed synthase [(3)H]-sT-PhaECAv and HBOCoA yielded [(3)H]-sTet-O-CoA at a rate constant faster than 17.4 s(-1), which represents the first example that a substrate analog undergoes PHB chain elongation at a rate close to that of the native substrate (65.0 s(-1)). Therefore, for the first time with a wt-synthase, strong evidence was obtained to support our favored PHB chain elongation model.
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer
Abu-Soud, Husam M.; Stuehr, Dennis J.
1993-11-01
Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.
Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.
Gauba, Esha; Guo, Lan; Du, Heng
2017-01-01
Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.
International Nuclear Information System (INIS)
Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako
2014-01-01
Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl- 14 C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with
Energy Technology Data Exchange (ETDEWEB)
Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)
2014-10-03
Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or
Cárdenas-Rodríguez, Noemí; Coballase-Urrutia, Elvia; Rivera-Espinosa, Liliana; Romero-Toledo, Arantxa; Sampieri, Aristides III; Ortega-Cuellar, Daniel; Montesinos-Correa, Hortencia; Floriano-Sánchez, Esaú; Carmona-Aparicio, Liliana
2013-01-01
It is estimated that at least 100 million people worldwide will suffer from epilepsy at some point in their lives. This neurological disorder induces brain death due to the excessive liberation of glutamate, which activates the postsynaptic N-methyl-D-aspartic acid (NMDA) receptors, which in turn cause the reuptake of intracellular calcium (excitotoxicity). This excitotoxicity elicits a series of events leading to nitric oxide synthase (NOS) activation and the generation of reactive oxygen species (ROS). Several studies in experimental models and in humans have demonstrated that certain antiepileptic drugs (AEDs) exhibit antioxidant effects by modulating the activity of various enzymes associated with this type of stress. Considering the above-mentioned data, we aimed to compile evidence elucidating how AEDs such as valproic acid (VPA), oxcarbazepine (OXC), and topiramate (TPM) modulate oxidative stress. PMID:24454986
Marcella, Aaron M; Culbertson, Sannie J; Shogren-Knaak, Michael A; Barb, Adam W
2017-11-24
The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05and 4.10Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a K D =62±13nM, followed by the binding of two more equivalents of holo-ACPP with K D =1.2±0.2μM. Cooperativity was not observed for apo-ACPP which bound with K D =2.4±0.1μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells
Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.
1999-01-01
Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
International Nuclear Information System (INIS)
Zhang, H.
2016-01-01
We analyzed sugar accumulation and the activities of sugar-metabolic enzymes in ripening fruits of three cultivars of watermelon; a high-sugar type w2, a low-sugar type (w1), and their hybrid. In w2, the glucose and fructose contents were higher than the sucrose content in the earlier stage of fruit development, and fruit growth was accompanied by increases in glucose, fructose, and sucrose contents. The sucrose content increased substantially after 20 days after anthesis (DAA) and it was the main soluble sugar in mature fruit (sucrose: hexoses ratio, 0.71). In W, the fructose and glucose contents were significantly higher than the sucrose content in mature fruit (sucrose: hexoses ratio, 0.25). Comparing the two parent cultivars, sucrose was the most important factor affecting the total sugar content in mature fruit, although glucose and fructose also contributed to total sugar contents. The fructose and glucose contents in the fruit of F1 were mid-way between those of their parents, while the sucrose content was closer to that of W (sucrose:hexoses ratio in F1, 0.26). In the early stage of fruit development of W2, the activities of acid invertase and neutral invertase were higher than those of sucrose synthase and sucrose phosphate synthase. After 20 DAA, the acid invertase and neutral invertase activities decreased and those of sucrose synthase and sucrose phosphate synthase increased, leading to increased sucrose content. In W1, the activities of acid invertase and neutral invertase were higher than those of sucrose synthase and sucrose phosphate synthase at the early stage. The sucrose synthase and sucrose phosphate synthase activities were lower in W1 than in W2 at the later stages of fruit development. The patterns of sugar accumulation and sugar-metabolic enzyme activities during fruit development in F1 were similar to those in W1. (author)
Molecular cloning and characterization of glucose transporter 1 ...
African Journals Online (AJOL)
Glucose transporter type-1 (glut1) and citrate synthase plays crucial role in glucose transport and regulation of tricarboxylic acid cycle (TCA) cycle in mammalian energy metabolism. The present study was aimed to clone and characterize glut1 and citrate synthase cDNA in water buffalo (Bubalus bubalis). Total of 90 ...
Cochrane, Rachel V. K.; Sanichar, Randy; Lambkin, Gareth R.; Reiz, Béla; Xu, Wei; Tang, Yi; Vederas, John C.
2015-01-01
The anti-malarial agent cladosporin is a nanomolar inhibitor of Plasmodium falciparum lysyl-tRNA synthetase, and exhibits activity against both blood and liver stage infection. Cladosporin can be isolated from the fungus Cladosporium cladosporioides, where it was believed to be biosynthesized by a highly reducing (HR) and non-reducing (NR) iterative type I polyketide synthase (PKS) pair. Genome sequencing of the host organism, and subsequent heterologous expression of these enzymes in Sacchar...