A small RNA activates CFA synthase by isoform-specific mRNA stabilization.
Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg
2013-11-13
Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.
In situ localization of chalcone synthase mRNA in pea root nodule development.
Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.
1992-01-01
In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it
Inhibition of fatty acid synthase prevents preadipocyte differentiation
International Nuclear Information System (INIS)
Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.
2005-01-01
Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation
Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA
Dibrov, Sergey; McLean, Jaime; Hermann, Thomas
2011-01-01
An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.
1992-01-01
Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708
Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro
2004-11-15
Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
International Nuclear Information System (INIS)
Bruns, B.; Hahlbrock, K.; Schäfer, E.
1986-01-01
The fluence dependence of the time course of accumulation of chalcone synthase mRNA in ultraviolet (UV)-light-irradiated cell suspension cultures of parsley (Petroselinum crispum) and the additional effects of blue and far-red light have been investigated. Variations of the UV fluence had no detectable influence on the initial rate of increase in mRNA amount or translational activity, nor on the preceding lag period of approximately 3 h, but strongly influenced the duration of the transient increase. The effects were the same whether the fluence rate or the time of irradiation was varied to obtain a given fluence. Blue-light pretreatment of the cells resulted in increased amounts of mRNA and abolished the apparent lag period. This effect remained cryptic without the subsequent UV-light treatment. Irradiation with long-wavelength far-red light following UV-light pulses shortened the duration of the mRNA accumulation period. This effect was not altered by a preceding blue-light treatment. Thus, three photoreceptors, a UV-B receptor, a blue-light receptor and phytochrome, participate in the regulation of chalcone synthase mRNA accumulation in this system
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Analysis of mRNA expression of genes related to fatty acids synthesis in goose fatty liver
Directory of Open Access Journals (Sweden)
Shuxia Xiang
2010-11-01
Full Text Available The aim of our study was to evaluate the effect of overfeeding on mRNA expression levels of genes involved in lipogenesis, in order to understand the mechanism of hepatic stea - tosis in the goose. Using Landes geese (Anser anser and Sichuan White geese (Anser cygnoides as experimental animals, we quantified the mRNA expression of lipogenic genes, acetyl-CoA carboxylase-α (ACCα and fatty acid synthase (FAS, and of two transcription factors, sterol regulatory element-binding proteins- 1 (SREBP-1 and carbohydrate responsive element-binding protein (ChREBP by real-time polymerase chain reaction (RTPCR, and measured the lipid and triglyceride (TG content in the liver and the plasma level of glucose, insulin and TG. Our results indicated that compared to the control group, the overfeeding induced an increase of the lipid and TG content in the liver and also of the plasma insulin and TG concentration in both breeds. However, the plasma glucose level decreased after overfeeding in the Sichuan White goose, and there was no evident change in the Landes goose. Lastly, the mRNA expression of ACCα, FAS, SREBP-1 and ChREBP in the overfed group was lower than in the control group in both breeds. We concluded that the lipogenesis pathway plays a role in overfeeding- induced hepatic steatosis and that the decreased mRNA level of related genes may be the indicator of hepatic steatosis.
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H
2018-02-12
-coenzyme A carboxylase-α, fatty acid synthase and stearoyl-CoA desaturase quadratically increased. However, lipoprotein lipase mRNA expression was not affected by treatments. The results indicated that lactation performance and milk fat synthesis increased with BCVFA supplementation by improving ruminal fermentation, nutrient digestibility and mRNA expressions of genes related to milk fat synthesis.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice
International Nuclear Information System (INIS)
Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.
2006-01-01
α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower
International Nuclear Information System (INIS)
Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.
1997-01-01
gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested
Expanding the product portfolio of fungal type I fatty acid synthases
DEFF Research Database (Denmark)
Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia
2017-01-01
Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
International Nuclear Information System (INIS)
Schnitzler, J.P.; Jungblut, T.P.; Heller, W.; Köfferlein, M.; Hutzler, P.; Heinzmann, U.; Schmelzer, E.; Ernst, D.; Langebartels, C.; Sandermann, H. Jr.
1996-01-01
Epidermal tissue was isolated from Scots pine (Pinus sylvestris L.) needles by enzymatic digestion in order to study tissue distribution of u.v.-B-screening pigments. Up to 90% of the needle content of a group of diacylated flavonol glycosides that were structurally closely related was found in the epidermal layer. Among these metabolites, 3'',6''-di-para-coumaroyl-isoquercitrin and 3'',6''-di-para-coumaroyl-astragalin were the main u.v.-B-induced compounds in cotyledons and primary needles, respectively. However, catechin and astragalin (kaempferol 3-glucoside), two non-acylated flavonoid metabolites, were only observed in total needle extracts, and at levels independent of u.v.-B treatment. According to this metabolite distribution, the mRNA of chalcone synthase, the key enzyme to flavonoids, was found in epidermal and mesophyll as well as vascular tissues. The major alkaliextractable wall-bound phenolic metabolites, astragalin, 4-coumaric acid, and ferulic acid, a minor component of the cell wall, were also found exclusively in the epidermal layer. These compounds were not stimulated by u.v.-B irradiation within the experimental period. Staining of needle cross sections and epidermal layer preparations with Naturstoffreagenz A confirmed the specific localization of wall-bound astragalin in the outer wall of the epidermal layer. Model calculations of u.v.-B absorptions at 300 nm of soluble and cell-wall-bound metabolites of the epidermal layer revealed an almost complete shielding of the mesophyll tissue from u.v.-B radiation
Fatty acid synthase inhibitors isolated from Punica granatum L
International Nuclear Information System (INIS)
Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng
2012-01-01
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)
Fatty acid synthase inhibitors isolated from Punica granatum L
Energy Technology Data Exchange (ETDEWEB)
Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)
2012-05-15
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)
Survivin mRNA antagonists using locked nucleic acid, potential for molecular cancer therapy
DEFF Research Database (Denmark)
Fisker, Niels; Westergaard, Majken; Hansen, Henrik Frydenlund
2007-01-01
We have investigated the effects of different locked nucleic acid modified antisense mRNA antagonists against Survivin in a prostate cancer model. These mRNA antagonists were found to be potent inhibitors of Survivin expression at low nanomolar concentrations. Additionally there was a pronounced ...
Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte
2014-01-01
between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...
Fernandez, J.; Yaman, I.; Mishra, R.; Merrick, W. C.; Snider, M. D.; Lamers, W. H.; Hatzoglou, M.
2001-01-01
The cationic amino acid transporter, Cat-1, facilitates the uptake of the essential amino acids arginine and lysine. Amino acid starvation causes accumulation and increased translation of cat-1 mRNA, resulting in a 58-fold increase in protein levels and increased arginine uptake. A bicistronic mRNA
Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells
Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.
1999-01-01
Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood
International Nuclear Information System (INIS)
Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.
2009-01-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Energy Technology Data Exchange (ETDEWEB)
Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)
2009-07-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Kiss, A; Jurkovicova, D; Jezova, D; Krizanova, O
2001-06-01
To study functional interactions between angiotensin II AT1 receptors and nitric oxide (NO) activity in different brain areas in rats exposed to immobilization stress. Central inhibition of nitric oxide synthase (NOS) was provided by intracerebroventricular (i.c.v.) administration of (N-omega-nitro-L-arginine-methylester) L-NAME and analysis of AT1 receptor mRNA was performed using semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) technique. The immobilization in prone position lasted 2 hrs and the rats were sacrificed 24 hr later. The hypothalamus, hippocampus, thalamus, and cortex were isolated from fresh brains. In the cortex, gene expression of AT1 receptors was unaffected either by L-NAME treatment, or by a single exposure to immobilization stress for 2 hours followed by 24 hours of rest. In the hippocampus, the repeated treatment with L-NAME increased mRNA levels of AT1 receptors approximately 9-times compared to those in the control (untreated) group. Immobilization also increased AT1 receptor mRNA levels in the hippocampus which was similar to that induced by the L-NAME. The increase of AT1 receptor mRNA levels in the hippocampus of immobilized rats was not further altered when the animals were pretreated with L-NAME. In control rats, exposure to immobilization resulted in a significant rise in mRNA levels coding for AT1 receptors in the hypothalamus, but not in the thalamus. L-NAME treatment showed a tendency of increase in AT1 receptor mRNA levels in the hypothalamus. Moreover, when animals treated with L-NAME were subjected to immobilization, a further increase in AT1 receptor mRNA levels was observed in the hypothalamus in comparison with corresponding controls. The present data indicate that a single immobilization stress results in increased gene expression of AT1 receptors in the hypothalamus and hippocampus. The rise in AT1 mRNA levels in the same brain structures after repeated treatment with L-NAME allow to suggest an
2011-07-01
controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins
Directory of Open Access Journals (Sweden)
Manuel Fischer
2017-06-01
Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.
Directory of Open Access Journals (Sweden)
Misa Ohno
Full Text Available Chitinases hydrolyze the β-1-4 glycosidic bonds of chitin, a major structural component of fungi, crustaceans and insects. Although mammals do not produce chitin or its synthase, they express two active chitinases, chitotriosidase (Chit1 and acidic mammalian chitinase (AMCase. These mammalian chitinases have attracted considerable attention due to their increased expression in individuals with a number of pathological conditions, including Gaucher disease, Alzheimer's disease and asthma. However, the contribution of these enzymes to the pathophysiology of these diseases remains to be determined. The quantification of the Chit1 and AMCase mRNA levels and the comparison of those levels with the levels of well-known reference genes can generate useful and biomedically relevant information. In the beginning, we established a quantitative real-time PCR system that uses standard DNA produced by ligating the cDNA fragments of the target genes. This system enabled us to quantify and compare the expression levels of the chitinases and the reference genes on the same scale. We found that AMCase mRNA is synthesized at extraordinarily high levels in the mouse stomach. The level of this mRNA in the mouse stomach was 7- to 10-fold higher than the levels of the housekeeping genes and was comparable to that the level of the mRNA for pepsinogen C (progastricsin, a major component of the gastric mucosa. Thus, AMCase mRNA is a major transcript in mouse stomach, suggesting that AMCase functions as a digestive enzyme that breaks down polymeric chitin and as part of the host defense against chitin-containing pathogens in the gastric contents. Our methodology is applicable to the quantification of mRNAs for multiple genes across multiple specimens using the same scale.
Quick and sensitive determination of gene expression of fatty acid ...
African Journals Online (AJOL)
User
2011-05-16
May 16, 2011 ... from fatty acid synthase (FAS) with a different glucose level in ... By using the following formula, this study was able to quantify the mRNA expression of ... hypertension, heart disease and diabetes. ... regulation of gene expression has emerged in recent ... stages of adipocyte meta-bolism are relatively well.
Santoso, D; Thornburg, R
2000-08-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.
Santoso, Djoko; Thornburg, Robert
2000-01-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367
Henritzi, Sandra; Fischer, Manuel; Grininger, Martin; Oreb, Mislav; Boles, Eckhard
2018-01-01
The ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway. The previously engineered short-chain acyl-CoA producing yeast Fas1 R1834K /Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L -1 in a 72-h fermentation. The additional accumulation of 90 mg L -1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L -1 . However, in growth tests concentrations even lower than 50.0 mg L -1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
7.5-Å cryo-em structure of the mycobacterial fatty acid synthase.
Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc
2013-03-11
The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Leick, Lotte; Plomgaard, Peter S.; Grønløkke, L.
2010-01-01
exercise. To test the hypothesis that mRNA expression of many oxidative enzymes is up-regulated late in recovery (10-24 h) after exercise, male subjects (n=8) performed a 90-min cycling exercise (70% VO(2-max)), with muscle biopsies obtained before exercise (pre), and after 10, 18 and 24 h of recovery....... The mRNA expression of carnitine-palmitoyltransferase (CPT)I, CD36, 3-hydroxyacyl-CoA-dehydrogenase (HAD), cytochrome (Cyt)c, aminolevulinate-delta-synthase (ALAS)1 and GLUT4 was 100-200% higher at 10-24 h of recovery from exercise than in a control trial. Exercise induced a 100-300% increase...... in peroxisome proliferator-activated receptor gamma co-activator (PGC)-1alpha, citrate synthase (CS), CPTI, CD36, HAD and ALAS1 mRNA contents at 10-24 h of recovery relative to before exercise. No protein changes were detected in Cytc, ALAS1 or GLUT4. This shows that mRNA expression of several training...
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
International Nuclear Information System (INIS)
Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin
2015-01-01
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
Energy Technology Data Exchange (ETDEWEB)
Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)
2015-10-23
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.
2010-01-01
Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...
E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique
2013-12-01
We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Lindefors, N; Brene, S; Herrera-Marschitz, M; Persson, H
1989-01-01
In situ hybridization histochemistry and RNA blots were used to study the expression of glutamic acid decarboxylase (GAD) mRNA in rats with or without a unilateral lesion of midbrain dopamine neurons. Two populations of GAD mRNA positive neurons were found in the intact caudate-putamen, substantia nigra and fronto-parietal cortex. In caudate-putamen, only one out of ten of the GAD mRNA positive neurons expressed high levels, while in substantia nigra every second of the positive neurons expressed high levels of GAD mRNA. Relatively few, but intensively labelled neurons were found in the intact fronto-parietal cerebral cortex. In addition, one out of six of the GAD mRNA positive neurons in the fronto-parietal cortex showed a low labeling. On the ipsilateral side, the forebrain dopamine deafferentation induced an increase in the number of neurons expressing high levels of GAD mRNA in caudate-putamen, and a decrease in fronto-parietal cortex. A smaller decrease was also seen in substantia nigra. However, the total number of GAD mRNA positive neurons were not significantly changed in any of these brain regions. The changes in the levels of GAD mRNA after the dopamine lesion were confirmed by RNA blot analysis. Hence, midbrain dopamine neurons appear to control neuronal expression of GAD mRNA by a tonic down-regulation in a fraction of GAD mRNA positive neurons in caudate-putamen, and a tonic up-regulation in a fraction of GAD mRNA positive neurons in fronto-parietal cortex and substantia nigra.
Onouchi, Hitoshi; Nagami, Yoko; Haraguchi, Yuhi; Nakamoto, Mari; Nishimura, Yoshiko; Sakurai, Ryoko; Nagao, Nobuhiro; Kawasaki, Daisuke; Kadokura, Yoshitomo; Naito, Satoshi
2005-01-01
Expression of the Arabidopsis CGS1 gene that codes for cystathionine γ-synthase is feedback regulated at the step of mRNA stability in response to S-adenosyl-L-methionine (AdoMet). A short stretch of amino acid sequence, called the MTO1 region, encoded by the first exon of CGS1 itself is involved in this regulation. Here, we demonstrate, using a cell-free system, that AdoMet induces temporal translation elongation arrest at the Ser-94 codon located immediately downstream of the MTO1 region, by analyzing a translation intermediate and performing primer extension inhibition (toeprint) analysis. This translation arrest precedes the formation of a degradation intermediate of CGS1 mRNA, which has its 5′ end points near the 5′ edge of the stalled ribosome. The position of ribosome stalling also suggests that the MTO1 region in nascent peptide resides in the ribosomal exit tunnel when translation elongation is temporarily arrested. In addition to the MTO1 region amino acid sequence, downstream Trp-93 is also important for the AdoMet-induced translation arrest. This is the first example of nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in eukaryotes. Furthermore, our data suggest that the ribosome stalls at the step of translocation rather than at the step of peptidyl transfer. PMID:16027170
SEPAROVIC, DUSKA; BREEN, PAUL; BOPPANA, NITHIN B.; VAN BUREN, ERIC; JOSEPH, NICHOLAS; KRAVEKA, JACQUELINE M.; RAHMANIYAN, MEHRDAD; LI, LI; GUDZ, TATYANA I.; BIELAWSKA, ALICJA; BAI, AIPING; BIELAWSKI, JACEK; PIERCE, JASON S.; KORBELIK, MLADEN
2013-01-01
Photodynamic therapy (PDT) is not always effective as an anticancer treatment, therefore, PDT is combined with other anticancer agents for improved efficacy. The combination of dasatinib and PDT with the silicone phthalocyanine photosensitizer Pc 4 was assessed for increased killing of SCCVII mouse squamous cell carcinoma cells, a preclinical model of head and neck squamous cell carcinoma, using apoptotic markers and colony formation as experimental end-points. Because each of these treatments regulates the metabolism of the sphingolipid ceramide, their effects on mRNA levels of ceramide synthase, a ceramide-producing enzyme, and the sphingolipid profile were determined. PDT + dasatinib induced an additive loss of clonogenicity. Unlike PDT alone or PDT + dasatinib, dasatinib induced zVAD-fmk-dependent cell killing. PDT or dasatinib-induced caspase-3 activation was potentiated after the combination. PDT alone induced mitochondrial depolarization, and the effect was inhibited after the combination. Annexin V+ and propidium iodide+ cells remained at control levels after treatments. In contrast to PDT alone, dasatinib induced upregulation of ceramide synthase 1 mRNA, and the effect was enhanced after the combination. Dasatinib induced a modest increase in C20:1-and C22-ceramide but had no effect on total ceramide levels. PDT increased the levels of 12 individual ceramides and total ceramides, and the addition of dasatinib did not affect these increases. PDT alone decreased substantially sphingosine levels and inhibited the activity of acid ceramidase, an enzyme that converts ceramide to sphingosine. The data suggest that PDT-induced increases in ceramide levels do not correlate with ceramide synthase mRNA levels but rather with inhibition of ceramidase. Cell killing was zVAD-fmk-sensitive after dasatinib but not after either PDT or the combination and enhanced cell killing after the combination correlated with potentiated caspase-3 activation and upregulation of
Energy Technology Data Exchange (ETDEWEB)
Hopperton, Kathryn E., E-mail: kathryn.hopperton@mail.utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: robin.duncan@uwaterloo.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: richard.bazinet@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: m.archer@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare
International Nuclear Information System (INIS)
Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.
2014-01-01
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of
Twisk, J.; Wit, E.C.M. de; Princen, H.M.G.
1995-01-01
In previous work we have demonstrated suppression of cholesterol 7α-hydroxylase by bile acids at the level of mRNA and transcription, resulting in a similar decline in bile acid synthesis in cultured rat hepatocytes. In view of the substantial contribution of the 'alternative' or '27-hydroxylase'
International Nuclear Information System (INIS)
Chang, Soo-Ik; Hammes, G.G.
1989-01-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Horton, J D; Cuthbert, J A; Spady, D K
1993-01-01
The concentration of LDL in plasma is strongly influenced by the amount and the type of lipid in the diet. Recent studies in the hamster have shown that dietary fatty acids differentially affect circulating LDL levels primarily by altering receptor-dependent LDL uptake in the liver. To investigate the mechanistic basis of this effect, rates of receptor-dependent LDL transport in the liver were correlated with LDL receptor protein and mRNA levels in hamsters fed safflower oil or coconut oil and varying amounts of cholesterol. Hepatic LDL receptor activity was significantly lower in animals fed coconut oil than in animals fed safflower oil at all levels of cholesterol intake (26, 53, and 61% lower at cholesterol intakes of 0, 0.06, and 0.12%, respectively). These fatty acid-induced changes in hepatic LDL receptor activity were accompanied by parallel changes in hepatic LDL receptor protein and mRNA levels, suggesting that dietary fatty acids regulate the LDL receptor pathway largely at the mRNA level. Images PMID:8349814
Producing biofuels using polyketide synthases
Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D
2013-04-16
The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.
International Nuclear Information System (INIS)
Claffey, K.P.; Herrera, V.L.; Brecher, P.; Ruiz-Opazo, N.
1987-01-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a λ gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundant mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source
Energy Technology Data Exchange (ETDEWEB)
Claffey, K.P.; Herrera, V.L.; Brecher, P.; Ruiz-Opazo, N.
1987-12-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundant mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.
Meegalla, Rupalie L; Billheimer, Jeffrey T; Cheng, Dong
2002-11-01
Glucose and insulin are anabolic signals which upregulate the transcriptions of a series of lipogenic enzymes to convert excess carbohydrate into triglycerides for efficient energy storage. These enzymes include ATP-citrate lyase (ACL), acetyl-coenzyme A carboxylase (ACC), fatty acid synthase (FAS), and glycerol-3-phosphate acyltransferase (G3PA). Acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) is important to synthesize fatty acids into triglycerides. Two DGATs from different gene families have recently been identified. In the current study, we report that glucose preferentially enhances DGAT1 mRNA expression, whereas insulin specifically increases the level of DGAT2 mRNA. Treatment of adipocytes with glucose and insulin together results in higher DGAT activity in the membrane than cells treated with either of the agents alone, indicating that glucose and insulin have additive effect on DGAT activation. In mice treated with fast/refeeding protocol, DGAT2 mRNA decreased upon fasting and was replenished upon refeeding in adipose tissue and liver. This pattern of change was not observed for DGAT1. Inasmuch as DGAT1 mRNA is less abundant in liver, we suggest that DGAT1 is more involved in fat absorption in the intestine and in basal level triglyceride synthesis in adipose tissue where it is more highly expressed. In contrast, DGAT2 is more likely to play important roles in assembly of de novo synthesized fatty acids into VLDL particles in the liver.
Mzhelskaya, M M; Klinnikova, M G; Koldysheva, E V; Lushnikova, E L
2017-10-01
The expression of VEGFR2 (Flk-1, according to immunohistochemistry) and of cyclin D2 mRNA (according to real-time PCR) in the myocardium of rats is studied in doxorubicin-induced cardiomyopathy and in response to betulonic acid amide. Doxorubicin alone and in combination with betulonic acid amide causes after 3 days a manifest reduction of cyclin D2 mRNA expression (by 38 and 63%, respectively), while injection of betulonic acid amide alone causes a 23-fold increase of cyclin D2 mRNA expression. An increase of cyclin D2 mRNA expression has been detected in all experimental groups after 14 days of experiment, the most pronounced in response to betulonic acid amide (63 times). The expression of Flk-1 in cardiomyocytes increases significantly in response to both chemical agents starting from day 3 of experiment. These results indicate that doxorubicin and betulonic acid amide induce cytoprotective reactions in the myocardium, first at the intracellular, then at the cellular levels.
Wang, S Y; Gudas, L J
1990-09-15
We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.
Self-amplifying mRNA vaccines.
Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J
2015-01-01
This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.
Yang, Surong; Chen, Changrui; Li, Yiying; Ren, Zhenghua; Zhang, Yungang; Wu, Gantong; Wang, Hao; Hu, Zhenzhen; Yao, Minghui
2013-06-01
To evaluate whether saw palmetto extract (SPE) relaxes corpus cavernosum and explore the underlying mechanisms. Forty Sprague-Dawley rats and 30 New Zealand rabbits were randomly allocated into 3 SPE-treated groups (low-, middle-, and high-dose) and 1 saline-treated control group. SPE was administered intragastrically for 7 consecutive days. Another 23 rats treated with sildenafil were used to appraise the erectile response to electrical stimulation of nerves in the corpus cavernosum. The erectile functions of rats and rabbits were evaluated 24 hours after the last SPE administration or 15 minutes after intragastric sildenafil. Outcome measures included corpus cavernosum electrical activity recording, phosphodiesterase 5 (PDE5) activity detected by the colorimetric quantitative method, and messenger ribonucleic acid (mRNA) expression level for PDE5 and inducible nitric oxide synthase (iNOS) determined using real-time polymerase chain reaction. In the SPE-treated animals, the relaxant response to electrical stimulation of nerves in the corpus cavernosum, reflected by the amplitude of the electrical activity within the cavernosum, was significantly and dose-dependently augmented. Similar effects were observed in the sildenafil-treated rats. PDE5 activity in rat and rabbit corpus cavernosum tissues was significantly and dose-dependently inhibited in SPE-treated animals, whereas the iNOS mRNA level increased compared with the saline group. PDE5 mRNA, however, was only significantly enhanced in the rats treated with the middle dose of SPE. The results suggest that SPE may have potential application value for the prevention or treatment of erectile dysfunction through an increase in iNOS mRNA expression and inhibition of PDE5 activity in corpus cavernosum smooth muscles. Copyright © 2013 Elsevier Inc. All rights reserved.
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J
2012-01-01
In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hosseinzadeh, Asghar; Ardebili, Seyed Mojtaba Mohaddes
2016-09-01
Tumor necrosis factor alpha (TNF-α), a multifunctional cytokine, is involved in apoptosis, cell proliferation, cell survival, and inflammation. It plays a dual role in cancer development and progression. It has been revealed that polyunsaturated fatty acids (PUFAs) modulate the production and activity of TNF family cytokines. The objective of the present study was to evaluate the effect of PUFAs on messenger RNA expression levels of TNF-α in patients with gastric adenocarcinoma. Thirty-four chemotherapy-naive patients diagnosed with gastric adenocarcinoma were randomly divided into two groups. The first group (17 individuals) received cisplatin without supplements and the second group (17 individuals) received cisplatin plus orally administered PUFA supplements for 3 weeks, based on treatment strategies. The gastric biopsy samples were obtained from all participants before and after treatment, and TNF-α mRNA expression levels were evaluated by quantitative real-time PCR procedure. Our findings revealed that TNF-α mRNA expression is downregulated in group II, after receiving cisplatin and omega fatty acid supplement for 3 weeks. However, this difference is not statistically significant (p > 0.05). TNF-α mRNA expression did not show significant alteration in group I, after receiving cisplatin alone. Taken together, we concluded that omega fatty acids reduce TNF-α expression at the mRNA level in patients with gastric adenocarcinoma. These data suggest that TNF-α may act as a potential target for the therapy of human gastric adenocarcinoma.
Foyer, Christine H.; Valadier, Marie-Hélène; Migge, Andrea; Becker, Thomas W.
1998-01-01
Maize (Zea mays L.) plants were grown to the nine-leaf stage. Despite a saturating N supply, the youngest mature leaves (seventh position on the stem) contained little NO3− reserve. Droughted plants (deprived of nutrient solution) showed changes in foliar enzyme activities, mRNA accumulation, photosynthesis, and carbohydrate and amino acid contents. Total leaf water potential and CO2 assimilation rates, measured 3 h into the photoperiod, decreased 3 d after the onset of drought. Starch, glucose, fructose, and amino acids, but not sucrose (Suc), accumulated in the leaves of droughted plants. Maximal extractable phosphoenolpyruvate carboxylase activities increased slightly during water deficit, whereas the sensitivity of this enzyme to the inhibitor malate decreased. Maximal extractable Suc phosphate synthase activities decreased as a result of water stress, and there was an increase in the sensitivity to the inhibitor orthophosphate. A correlation between maximal extractable foliar nitrate reductase (NR) activity and the rate of CO2 assimilation was observed. The NR activation state and maximal extractable NR activity declined rapidly in response to drought. Photosynthesis and NR activity recovered rapidly when nutrient solution was restored at this point. The decrease in maximal extractable NR activity was accompanied by a decrease in NR transcripts, whereas Suc phosphate synthase and phosphoenolpyruvate carboxylase mRNAs were much less affected. The coordination of N and C metabolism is retained during drought conditions via modulation of the activities of Suc phosphate synthase and NR commensurate with the prevailing rate of photosynthesis. PMID:9576798
International Nuclear Information System (INIS)
Petri, Marcelo H.; Tellier, Céline; Michiels, Carine; Ellertsen, Ingvill; Dogné, Jean-Michel; Bäck, Magnus
2013-01-01
Highlights: •EV-077 reduced TNF-α induced inflammation in endothelial cells. •The thromboxane mimetic U69915 enhanced vascular smooth muscle cell proliferation. •EV-077 inhibited smooth muscle cell proliferation. -- Abstract: The prothrombotic mediator thromboxane A 2 is derived from arachidonic acid metabolism through the cyclooxygenase and thromboxane synthase pathways, and transduces its effect through the thromboxane prostanoid (TP) receptor. The aim of this study was to determine the effect of the TP receptor antagonist and thromboxane synthase inhibitor EV-077 on inflammatory markers in human umbilical vein endothelial cells and on human coronary artery smooth muscle cell proliferation. To this end, mRNA levels of different proinflammatory mediators were studied by real time quantitative PCR, supernatants were analyzed by enzyme immune assay, and cell proliferation was assessed using WST-1. EV-077 significantly decreased mRNA levels of ICAM-1 and PTX3 after TNFα incubation, whereas concentrations of 6-keto PGF1α in supernatants of endothelial cells incubated with TNFα were significantly increased after EV-077 treatment. Although U46619 did not alter coronary artery smooth muscle cell proliferation, this thromboxane mimetic enhanced the proliferation induced by serum, insulin and growth factors, which was significantly inhibited by EV-077. In conclusion, EV-077 inhibited TNFα-induced endothelial inflammation and reduced the enhancement of smooth muscle cell proliferation induced by a thromboxane mimetic, supporting that the thromboxane pathway may be associated with early atherosclerosis in terms of endothelial dysfunction and vascular hypertrophy
Energy Technology Data Exchange (ETDEWEB)
Petri, Marcelo H. [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden); Tellier, Céline; Michiels, Carine [NARILIS, URBC, University of Namur, Namur (Belgium); Ellertsen, Ingvill [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden); Dogné, Jean-Michel [Department of Pharmacy, Namur Thrombosis and Hemostasis Center, University of Namur, Namur (Belgium); Bäck, Magnus, E-mail: Magnus.Back@ki.se [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden)
2013-11-15
Highlights: •EV-077 reduced TNF-α induced inflammation in endothelial cells. •The thromboxane mimetic U69915 enhanced vascular smooth muscle cell proliferation. •EV-077 inhibited smooth muscle cell proliferation. -- Abstract: The prothrombotic mediator thromboxane A{sub 2} is derived from arachidonic acid metabolism through the cyclooxygenase and thromboxane synthase pathways, and transduces its effect through the thromboxane prostanoid (TP) receptor. The aim of this study was to determine the effect of the TP receptor antagonist and thromboxane synthase inhibitor EV-077 on inflammatory markers in human umbilical vein endothelial cells and on human coronary artery smooth muscle cell proliferation. To this end, mRNA levels of different proinflammatory mediators were studied by real time quantitative PCR, supernatants were analyzed by enzyme immune assay, and cell proliferation was assessed using WST-1. EV-077 significantly decreased mRNA levels of ICAM-1 and PTX3 after TNFα incubation, whereas concentrations of 6-keto PGF1α in supernatants of endothelial cells incubated with TNFα were significantly increased after EV-077 treatment. Although U46619 did not alter coronary artery smooth muscle cell proliferation, this thromboxane mimetic enhanced the proliferation induced by serum, insulin and growth factors, which was significantly inhibited by EV-077. In conclusion, EV-077 inhibited TNFα-induced endothelial inflammation and reduced the enhancement of smooth muscle cell proliferation induced by a thromboxane mimetic, supporting that the thromboxane pathway may be associated with early atherosclerosis in terms of endothelial dysfunction and vascular hypertrophy.
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile
Directory of Open Access Journals (Sweden)
S. Saeidnia
2014-04-01
Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.
Stachowska, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Jakubowska, Katarzyna; Olszewska, Maria; Machaliñski, Bogusław; Chlubek, Dariusz
2007-06-27
Lipoxygenases are a family of non-heme enzyme dioxygenases. The role of lipoxygenases is synthesis of hydroperoxides of fatty acids, which perform signaling functions in the body. Studies on conjugated linoleic acids (CLAs) as fatty acids with a potential anti-atherosclerotic function have recently been initiated. The aim of the study was to test the effect of CLAs and linoleic acid on 5- and 15-lipoxygenase (5-LO, 15-LO-1) enzyme activity, their mRNA expression, and concentration in the cells. It was also desired to determine whether the CLAs are substrates for the enzymes. For the experiments monocytic cell line (THP-1) and monocytes obtained from human venous blood were used. Monocytes were differentiated to macrophages: THP-1 (CD14+) by PMA administration (100 nM for 24 h) and monocytes from blood (CD14+) by 7-day cultivation with the autologous serum (10%). After differentiation, macrophages were cultured with 30 microM CLAs or linoleic acid for 48 h. The 15- and 5-lipoxygenase products were measured by HPLC method. mRNA expression and protein content were analyzed by real-time PCR and Western blot analysis. The in vitro studies proved that both CLA isomers are not substrates for 15-LO-1; in ex vivo studies hydroxydecadienoic acid (HODE) concentration was significantly reduced (p = 0.019). The trans-10,cis-12 CLA isomer reduced HODE concentration by 28% (p = 0.046) and the cis-9,trans-11 CLA isomer by 35% (p = 0.028). In macrophages obtained from THP-1 fatty acids did not change significantly mRNA expression of the majority of the investigated genes. CLAs did not change the content of 5-LO and 15-LO-1 proteins in macrophages obtained from peripheral blood. Linoleic acid induced 15-LO-1 expression (2.6 times, p < 0.05). CLAs may perform the function of an inhibitor of lipoxygenase 15-LO-1 activity in macrophages.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.
2013-01-01
CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of
Directory of Open Access Journals (Sweden)
Hyo-Jin An
2015-12-01
Full Text Available Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae were performed using high-performance liquid chromatography (HPLC. We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO formation in lipopolysaccharide (LPS-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL. In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (COX-2, and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.
An, Hyo-Jin; Nugroho, Agung; Song, Byong-Min; Park, Hee-Juhn
2015-12-01
Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae) were performed using high-performance liquid chromatography (HPLC). We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO) formation in lipopolysaccharide (LPS)-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL). In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Trujillo, Uldaeliz
2013-02-28
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Directory of Open Access Journals (Sweden)
Uldaeliz Trujillo
Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of
Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel
2013-01-01
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Borgenvik, Marcus; Apró, William; Blomstrand, Eva
2012-03-01
Resistance exercise and amino acids are two major factors that influence muscle protein turnover. Here, we examined the effects of resistance exercise and branched-chain amino acids (BCAA), individually and in combination, on the expression of anabolic and catabolic genes in human skeletal muscle. Seven subjects performed two sessions of unilateral leg press exercise with randomized supplementation with BCAA or flavored water. Biopsies were collected from the vastus lateralis muscle of both the resting and exercising legs before and repeatedly after exercise to determine levels of mRNA, protein phosphorylation, and amino acid concentrations. Intake of BCAA reduced (P exercising legs, respectively. The level of MuRF-1 mRNA was elevated (P exercising leg two- and threefold under the placebo and BCAA conditions, respectively, whereas MuRF-1 total protein increased by 20% (P exercising muscle. In conclusion, BCAA ingestion reduced MAFbx mRNA and prevented the exercise-induced increase in MuRF-1 total protein in both resting and exercising leg. Further-more, resistance exercise differently influenced MAFbx and MuRF-1 mRNA expression, suggesting both common and divergent regulation of these two ubiquitin ligases.
Zirpel, Bastian; Stehle, Felix; Kayser, Oliver
2015-09-01
The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.
International Nuclear Information System (INIS)
Zhang, Jingjie; Ouyang, Weiming; Li, Jingxia; Zhang, Dongyun; Yu, Yonghui; Wang, York; Li, Xuejun; Huang, Chuanshu
2012-01-01
Suberoylanilide hydroxamic acid (SAHA) inhibiting cancer cell growth has been associated with its downregulation of cyclin D1 protein expression at transcription level or translation level. Here, we have demonstrated that SAHA inhibited EGF-induced Cl41 cell transformation via the decrease of cyclin D1 mRNA stability and induction of G0/G1 growth arrest. We found that SAHA treatment resulted in the dramatic inhibition of EGF-induced cell transformation, cyclin D1 protein expression and induction of G0/G1 growth arrest. Further studies showed that SAHA downregulation of cyclin D1 was only observed with endogenous cyclin D1, but not with reconstitutionally expressed cyclin D1 in the same cells, excluding the possibility of SAHA regulating cyclin D1 at level of protein degradation. Moreover, SAHA inhibited EGF-induced cyclin d1 mRNA level, whereas it did not show any inhibitory effect on cyclin D1 promoter-driven luciferase reporter activity under the same experimental conditions, suggesting that SAHA may decrease cyclin D1 mRNA stability. This notion was supported by the results that treatment of cells with SAHA decreased the half-life of cyclin D1 mRNA from 6.95 h to 2.57 h. Consistent with downregulation of cyclin D1 mRNA stability, SAHA treatment also attenuated HuR expression, which has been well-characterized as a positive regulator of cyclin D1 mRNA stability. Thus, our study identifies a novel mechanism responsible for SAHA inhibiting cell transformation via decreasing cyclin D1 mRNA stability and induction of G0/G1 growth arrest in Cl41 cells. -- Highlights: ► SAHA inhibits cell transformation in Cl41 cells. ► SAHA suppresses Cyclin D1 protein expression. ► SAHA decreases cyclin D1 mRNA stability.
Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C
2018-03-29
The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
p63 promotes cell survival through fatty acid synthase.
Directory of Open Access Journals (Sweden)
Venkata Sabbisetti
2009-06-01
Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.
Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg
2013-02-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Transformation of Cowpea Vigna unguiculata with a Full-Length DNA Copy of Cowpea Mosaic Virus M-RNA
Hille, Jacques; Goldbach, Rob
1987-01-01
A full-length DNA copy of the M-RNA of cowpea mosaic virus (CPMV), supplied with either the 35S promoter from cauliflower mosaic virus (CaMV) or the nopaline synthase promoter from Agrobacterium tumefaciens, was introduced into the T-DNA region of a Ti-plasmid-derived gene vector and transferred to
Directory of Open Access Journals (Sweden)
Rawat Richa
2011-05-01
Full Text Available Abstract Background Cyclopropane fatty acids (CPA have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.
Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A
2018-04-03
5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
International Nuclear Information System (INIS)
Ohl, S.; Hahlbrock, K.; Schäfer, E.
1989-01-01
Run-off transcription assays were used to demonstrate that both the ultraviolet (UV)-B and blue-light receptors control transcription rates for chalcone-synthase mRNA in the course of light-induced flavonoid synthesis in parsley (Petroselinum crispum Miller (A.W. Hill)) cell-suspension cultures. Blue and red light alone, presumably acting via a blue-light receptor and active phytochrome (far-red absorbing form) respectively, can induce accumulation of chalcone-synthase mRNA. The extent of the response is however considerably smaller than that obtained when these wavebands are applied in combination with UV light. A preirradiation with blue light strongly increases the response to a subsequent UV pulse and this modulating effect of blue light is stable for at least 20 h. The modulating effect is abolished by a UV induction but can be reestablished by a second irradiation with blue light. (author)
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Hsu, Shan-Ching; Huang, Ching-Jang
2006-07-01
PPARs and sterol regulatory element-binding protein-1c (SREPB-1c) are fatty acid-regulated transcription factors that control lipid metabolism at the level of gene expression. This study compared a high oleic acid-rich safflower oil (ORSO) diet and a high-butter diet for their effect on adipose mass and expressions of genes regulated by PPAR and SREPB-1c in rats. Four groups of Wistar rats were fed 30S (30% ORSO), 5S (5% ORSO), 30B (29% butter + 1% ORSO), or 5B (4% butter plus 1% ORSO) diets for 15 wk. Compared with the 30B group, the 30S group had less retroperitoneal white adipose tissue (RWAT) mass and lower mRNA expressions of lipoprotein lipase, adipocyte fatty acid-binding protein, fatty acid synthase, acetyl CoA carboxylase, and SREBP-1c in the RWAT, higher mRNA expressions of acyl CoA oxidase, carnitine palmitoyl-transferase 1A, fatty acid binding protein, and mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase in the liver (P 2 fold those of the 30B group (P < 0.05). These results suggested that the smaller RWAT mass in rats fed the high-ORSO diet might be related to the higher tissue 18:2(n-6) and 20:4(n-6). This in turn could upregulate the expressions of fatty acid catabolic genes through the activation of PPARalpha in the liver and downregulate the expressions of lipid storage and lipogenic gene through the suppression of SREBP-1c in the RWAT.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A
2011-01-01
Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.
Broadbent, J R; Oberg, T S; Hughes, J E; Ward, R E; Brighton, C; Welker, D L; Steele, J L
2014-03-01
Lactic acid is an important industrial chemical commonly produced through microbial fermentation. The efficiency of acid extraction is increased at or below the acid's pKa (pH 3.86), so there is interest in factors that allow for a reduced fermentation pH. We explored the role of cyclopropane synthase (Cfa) and polysorbate (Tween) 80 on acid production and membrane lipid composition in Lactobacillus casei ATCC 334 at low pH. Cells from wild-type and an ATCC 334 cfa knockout mutant were incubated in APT broth medium containing 3 % glucose plus 0.02 or 0.2 % Tween 80. The cultures were allowed to acidify the medium until it reached a target pH (4.5, 4.0, or 3.8), and then the pH was maintained by automatic addition of NH₄OH. Cells were collected at the midpoint of the fermentation for membrane lipid analysis, and media samples were analyzed for lactic and acetic acids when acid production had ceased. There were no significant differences in the quantity of lactic acid produced at different pH values by wild-type or mutant cells grown in APT, but the rate of acid production was reduced as pH declined. APT supplementation with 0.2 % Tween 80 significantly increased the amount of lactic acid produced by wild-type cells at pH 3.8, and the rate of acid production was modestly improved. This effect was not observed with the cfa mutant, which indicated Cfa activity and Tween 80 supplementation were each involved in the significant increase in lactic acid yield observed with wild-type L. casei at pH 3.8.
Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid
Energy Technology Data Exchange (ETDEWEB)
Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD
2015-10-26
Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.
Use of linalool synthase in genetic engineering of scent production
Pichersky, Eran
1998-01-01
A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.
The pokeweed leaf mRNA transcriptome and its regulation by jasmonic acid.
Directory of Open Access Journals (Sweden)
Kira C.M. Neller
2016-03-01
Full Text Available The American pokeweed plant, Phytolacca americana, is recognized for synthesizing pokeweed antiviral protein (PAP, a ribosome inactivating protein (RIP that inhibits the replication of several plant and animal viruses. The plant is also a heavy metal accumulator with applications in soil remediation. However, little is known about pokeweed stress responses, as large-scale sequencing projects have not been performed for this species. Here, we sequenced the mRNA transcriptome of pokeweed in the presence and absence of jasmonic acid (JA, a hormone mediating plant defense. Trinity-based de novo assembly of mRNA from leaf tissue and BLASTx homology searches against public sequence databases resulted in the annotation of 59 096 transcripts. Differential expression analysis identified JA-responsive genes that may be involved in defense against pathogen infection and herbivory. We confirmed the existence of several PAP isoforms and cloned a potentially novel isoform of PAP. Expression analysis indicated that PAP isoforms are differentially responsive to JA, perhaps indicating specialized roles within the plant. Finally, we identified 52 305 natural antisense transcript pairs, four of which comprised PAP isoforms, suggesting a novel form of RIP gene regulation. This transcriptome-wide study of a Phytolaccaceae family member provides a source of new genes that may be involved in stress tolerance in this plant. The sequences generated in our study have been deposited in the SRA database under project # SRP069141.
Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2
Energy Technology Data Exchange (ETDEWEB)
Petry, T.W.; Krauss, R.S.; Eling, T.E.
1986-08-01
We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.
Santoso; Thornburg
1998-02-01
To understand the regulation and expression of pyrimidine biosynthesis in plants, we have examined the effect of the metabolic inhibitor 5-fluoroorotic acid (FOA) on uridine-5'-monophosphate synthase (UMPSase) expression in cell cultures of Nicotiana plumbaginifolia. UMPSase is the rate-limiting step of pyrimidine biosynthesis in plants. Addition of FOA causes an up-regulation of UMPSase enzyme activity in cell cultures after a lag phase of several days. Western-blot analysis demonstrated that the up-regulation in enzyme activity was caused by increased expression of the UMPSase protein. Northern-blot analysis demonstrated a higher level of UMPSase mRNA in the FOA-induced tissues than in control tissues. Run-on transcriptional assays showed that the UMPSase gene was transcriptionally activated after FOA treatment. The mechanism of toxicity of FOA is through thymine starvation. We found that addition of thymine abrogated the FOA-mediated up-regulation of UMPSase. In addition, methotrexate and aminopterin, which affect thymine levels by inhibiting dihydrofolate reductase, also up-regulate UMPSase in N. plumbaginifolia cells.
Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther
2017-06-01
Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
mRNA levels of enzymes and receptors implicated in arachidonic acid metabolism in gliomas.
De Armas, Rafael; Durand, Karine; Guillaudeau, Angélique; Weinbreck, Nicolas; Robert, Sandrine; Moreau, Jean-Jacques; Caire, François; Acosta, Gisela; Pebet, Matias; Chaunavel, Alain; Marin, Benoît; Labrousse, François; Denizot, Yves
2010-07-01
Gliomas are tumors of the central nervous system derived from glial cells. They show cellular heterogeneity and lack specific diagnostic markers. Although a possible role for the eicosanoid cascade has been suggested in glioma tumorigenesis, the relationship between enzymes and receptors implicated in arachidonic acid metabolism, with histological tumor type has not yet been determined. Quantitative real-time reverse transcription-polymerase chain reaction was performed to measure and compare transcript levels of enzymes and receptors implicated in both lipoxygenase and cyclooxygenase pathways between oligodendrogliomas, astrocytomas, glioblastomas and mixed oligoastrocytomas. Arachidonic acid metabolism-related enzymes and receptor transcripts (i) were underexpressed in classical oligodendrogliomas compared to astrocytomas and/or glioblastomas, (ii) differed between astrocytomas and glioblastomas and (iii) had an intermediate expression in mixed oligoastrocytomas. mRNA levels of enzymes and receptors implicated both in lipoxygenase and cyclooxygenase pathways differed significantly in gliomas according to the histological type. Copyright 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
Hopperton, Kathryn E; Duncan, Robin E; Bazinet, Richard P; Archer, Michael C
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from (14)C-labeled acetate to those supplied exogenously as (14)C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2-3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Molecular cloning and functional characterization of porcine cyclic GMP-AMP synthase.
Wang, Jiang; Chu, Beibei; Du, Lili; Han, Yingqian; Zhang, Xuemei; Fan, Shuangshuang; Wang, Yueying; Yang, Guoyu
2015-06-01
Cyclic GMP-AMP synthase (cGAS), which belongs to the nucleotidyltransferase family, recognizes cytosolic DNA and induces the type I interferon (IFN) pathway through the synthesis of the second messenger cGAMP. In this study, porcine cGAS (p-cGAS) was identified and its tissue distribution, subcellular localization, and functions in innate immunity were characterized. The coding sequence of p-cGAS is 1494 bp long, encodes 497 amino acids, and is most similar (74%) to Bos taurus cGAS. p-cGAS mRNA is abundant in the spleen, duodenum, jejunum, and ileum. The subcellular distribution of p-cGAS is not only in the cytosol, but also on the endoplasmic reticulum (ER) membrane. The overexpression of wild-type p-cGAS in porcine kidney epithelial cells, but not its catalytically inactive mutants, induced IFN-β expression, which was dependent on STING and IRF3. However, the downregulation of p-cGAS by RNA interference markedly reduced IFN-β expression after pseudorabies virus (PRV) infection or poly(dA:dT) transfection. These results demonstrate that p-cGAS is an important DNA sensor, required for IFN-β activation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie
2011-09-02
The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hsin-Yu Lin
2014-01-01
Full Text Available Fatty liver disease is the most common pathological condition in the liver. Here, we generated high-fat diet-(HFD- induced nonalcoholic fatty liver disease (NAFLD in mice and tested the effects of docosahexaenoic acid (DHA and lysine during a four-week regular chow (RCfeeding. Our results showed that 1% lysine and the combination of 1% lysine + 1% DHA reduced body weight. Moreover, serum triglyceride levels were reduced by 1% DHA and 1% lysine, whereas serum alanine transaminase activity was reduced by 1% DHA and 1% DHA + 0.5% lysine. Switching to RC reduced hepatic lipid droplet accumulation, which was further reduced by the addition of DHA or lysine. Furthermore, the mRNA expressions of hepatic proinflammatory cytokines were suppressed by DHA and combinations of DHA + lysine, whereas the mRNA for the lipogenic gene, acetyl-CoA carboxylase 1 (ACC1, was suppressed by DHA. In the gonadal adipose tissues, combinations of DHA and lysine inhibited mRNA expression of lipid metabolism-associated genes, including ACC1, fatty acid synthase, lipoprotein lipase, and perilipin. In conclusion, the present study demonstrated that, in conjunction with RC-induced benefits, supplementation with DHA or lysine further ameliorated the high-fat diet-induced NAFLD and provided an alternative strategy to treat, and potentially prevent, NAFLD.
Li, Huige; Xia, Ning; Brausch, Isolde; Yao, Ying; Förstermann, Ulrich
2004-09-01
Nitric oxide (NO) produced by endothelial nitric-oxide synthase (eNOS) represents an antithrombotic and anti-atherosclerotic principle in the vasculature. Hence, an enhanced expression of eNOS in response to pharmacological interventions could provide protection against cardiovascular diseases. In EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (HUVECs), an artichoke leaf extract (ALE) increased the activity of the human eNOS promoter (determined by luciferase reporter gene assay). An organic subfraction from ALE was more potent in this respect than the crude extract, whereas an aqueous subfraction of ALE was without effect. ALE and the organic subfraction thereof also increased eNOS mRNA expression (measured by an RNase protection assay) and eNOS protein expression (determined by Western blot) both in EA.hy 926 cells and in native HUVECs. NO production (measured by NO-ozone chemiluminescence) was increased by both extracts. In organ chamber experiments, ex vivo incubation (18 h) of rat aortic rings with the organic subfraction of ALE enhanced the NO-mediated vasodilator response to acetylcholine, indicating that the up-regulated eNOS remained functional. Caffeoylquinic acids and flavonoids are two major groups of constituents of ALE. Interestingly, the flavonoids luteolin and cynaroside increased eNOS promoter activity and eNOS mRNA expression, whereas the caffeoylquinic acids cynarin and chlorogenic acid were without effect. Thus, in addition to the lipid-lowering and antioxidant properties of artichoke, an increase in eNOS gene transcription may also contribute to its beneficial cardiovascular profile. Artichoke flavonoids are likely to represent the active ingredients mediating eNOS up-regulation.
Ivontsin, L. A.; Mashkovtseva, E. V.; Nartsissov, Ya R.
2017-11-01
Implications of quantum-mechanical approach to the description of proton transport in biological systems are a tempting subject for an overlapping of fundamental physics and biology. The model of proton transport through the integrated membrane enzyme FoF1-ATP synthase responsible for ATP synthesis was developed. The estimation of the mathematical expectation of the proton transfer time through the half-channel was performed. Observed set of proton pathways through the inlet half-channel showed the nanosecond timescale highly dependable of some amino acid residues. There were proposed two types of crucial amino acids: critically localized (His245) and being a part of energy conserving system (Asp119).
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Directory of Open Access Journals (Sweden)
Sassa Shuji
2008-05-01
Full Text Available Abstract Background Zinc has a wide spectrum of biological activities and its deficiency is related to various abnormalities of cell metabolism. Methods Wistar male rats, at age of 4 weeks, were fed a low-zinc diet for six weeks. The levels of bromodeoxyuridine incorporated into the prostatic DNA and the mRNA expression levels of prostate thymidylate synthase and thymidine kinase were examined. Result The low-zinc diet caused a marked reduction in the body growth and organ weights, resulted in a low hematopoiesis, hypo-albuminemia and hypocholesterolemia. Although there were few differences in plasma biochemical markers, plasma levels of luteinizing hormone and testosterone were reduced by the low-zinc diet. Bromodeoxyuridine-immunoreactive (S-phase cells and mRNA expression levels of thymidylate synthase and thymidine kinase in the prostate cells were markedly affected by the low-zinc diet. Conclusion A low-zinc diet appears to reduce the body growth and organ weights including prostate, causing low plasma levels of luteinizing hormone and testosterone and reduction in prostate DNA replication in growing-rats.
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
Rudolph, Michael C; Monks, Jenifer; Burns, Valerie; Phistry, Meridee; Marians, Russell; Foote, Monica R; Bauman, Dale E; Anderson, Steven M; Neville, Margaret C
2010-12-01
The lactating mammary gland synthesizes large amounts of triglyceride from fatty acids derived from the blood and from de novo lipogenesis. The latter is significantly increased at parturition and decreased when additional dietary fatty acids become available. To begin to understand the molecular regulation of de novo lipogenesis, we tested the hypothesis that the transcription factor sterol regulatory element binding factor (SREBF)-1c is a primary regulator of this system. Expression of Srebf1c mRNA and six of its known target genes increased ≥2.5-fold at parturition. However, Srebf1c-null mice showed only minor deficiencies in lipid synthesis during lactation, possibly due to compensation by Srebf1a expression. To abrogate the function of both isoforms of Srebf1, we bred mice to obtain a mammary epithelial cell-specific deletion of SREBF cleavage-activating protein (SCAP), the SREBF escort protein. These dams showed a significant lactation deficiency, and expression of mRNA for fatty acid synthase (Fasn), insulin-induced gene 1 (Insig1), mitochondrial citrate transporter (Slc25a1), and stearoyl-CoA desaturase 2 (Scd2) was reduced threefold or more; however, the mRNA levels of acetyl-CoA carboxylase-1α (Acaca) and ATP citrate lyase (Acly) were unchanged. Furthermore, a 46% fat diet significantly decreased de novo fatty acid synthesis and reduced the protein levels of ACACA, ACLY, and FASN significantly, with no change in their mRNA levels. These data lead us to conclude that two modes of regulation exist to control fatty acid synthesis in the mammary gland of the lactating mouse: the well-known SREBF1 system and a novel mechanism that acts at the posttranscriptional level in the presence of SCAP deletion and high-fat feeding to alter enzyme protein.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
Molecular cloning and characterization of strictosidine synthase, a ...
African Journals Online (AJOL)
Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...
Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J
2016-06-15
Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.
Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg
2013-01-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714
Osteopontin protects against hyperoxia-induced lung injury by inhibiting nitric oxide synthases.
Zhang, Xiang-Feng; Liu, Shuang; Zhou, Yu-Jie; Zhu, Guang-Fa; Foda, Hussein D
2010-04-05
Exposure of adult mice to more than 95% O(2) produces a lethal injury by 72 hours. Nitric oxide synthase (NOS) is thought to contribute to the pathophysiology of murine hyperoxia-induced acute lung injury (ALI). Osteopontin (OPN) is a phosphorylated glycoprotein produced principally by macrophages. OPN inhibits inducible nitric oxide synthase (iNOS), which generates large amounts of nitric oxide production. However, the relationship between nitric oxide and endogenous OPN in lung tissue during hyperoxia-induced ALI has not yet been elucidated, thus we examined the role that OPN plays in the hyperoxia-induced lung injury and its relationships with NOS. One hundred and forty-four osteopontin knock-out (KO) mice and their matched wild type background control (WT) were exposed in sealed cages > 95% oxygen or room air for 24- 72 hours, and the severity of lung injury was assessed; expression of OPN, endothelial nitric oxide synthase (eNOS) and iNOS mRNA in lung tissues at 24, 48 and 72 hours of hyperoxia were studied by reverse transcription-polymerase chain reaction (RT-PCR); immunohistochemistry (IHC) was performed for the detection of iNOS, eNOS, and OPN protein in lung tissues. OPN KO mice developed more severe acute lung injury at 72 hours of hyperoxia. The wet/dry weight ratio increased to 6.85 +/- 0.66 in the KO mice at 72 hours of hyperoxia as compared to 5.31 +/- 0.92 in the WT group (P < 0.05). iNOS mRNA (48 hours: 1.04 +/- 0.08 vs. 0.63 +/- 0.09, P < 0.01; 72 hours: 0.89 +/- 0.08 vs. 0.72 +/- 0.09, P < 0.05) and eNOS mRNA (48 hours: 0.62 +/- 0.08 vs. 0.43 +/- 0.09, P < 0.05; 72 hours: 0.67 +/- 0.08 vs. 0.45 +/- 0.09, P < 0.05) expression was more significantly increased in OPN KO mice than their matched WT mice when exposed to hyperoxia. IHC study showed higher expression of iNOS (20.54 +/- 3.18 vs. 12.52 +/- 2.46, P < 0.05) and eNOS (19.83 +/- 5.64 vs. 9.45 +/- 3.82, P < 0.05) in lung tissues of OPN KO mice at 72 hours of hyperoxia. OPN can protect against
Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun
2016-11-16
The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.
Directory of Open Access Journals (Sweden)
Olivia Hoffman
Full Text Available A hallmark of acute respiratory distress syndrome (ARDS is accumulation of protein-rich edema in the distal airspaces and its removal is critical for patient survival. Previous studies have shown a detrimental role of Glycogen Synthase Kinase (GSK 3β during ARDS via inhibition of alveolar epithelial protein transport. We hypothesized that post-transcriptional regulation of GSK3β could play a functional role in ARDS resolution. To address this hypothesis, we performed an in silico analysis to identify regulatory genes whose expression correlation to GSK3β messenger RNA utilizing two lung cancer cell line array datasets. Among potential regulatory partners of GSK3β, these studies identified the RNA-binding protein ELAVL-1/HuR (Embryonic Lethal, Abnormal Vision, Drosophila-Like as a central component in a likely GSK3β signaling network. ELAVL-1/HuR is a RNA-binding protein that selectively binds to AU-rich elements of mRNA and enhances its stability thereby increasing target gene expression. Subsequent studies with siRNA suppression of ELAVL-1/HuR demonstrated deceased GSK3β mRNA and protein expression and improved clearance of FITC-albumin in A549 cells. Conversely, stabilization of ELAVL-1/HuR with the proteasome inhibitor MG-132 resulted in induction of GSK3β at mRNA and protein level and attenuated FITC-albumin clearance. Utilizing ventilator-induced lung injury or intra-tracheal installation of hydrochloric acid to induce ARDS in mice, we observed increased mRNA and protein expression of ELAVL-1/HuR and GSK3β. Together, our findings indicate a previously unknown interaction between GSK3β and ELAV-1 during ARDS, and suggest the inhibition of the ELAV-1- GSK3β pathways as a novel ARDS treatment approach.
Santoso, Djoko; Thornburg, Robert
1998-01-01
To understand the regulation and expression of pyrimidine biosynthesis in plants, we have examined the effect of the metabolic inhibitor 5-fluoroorotic acid (FOA) on uridine-5′-monophosphate synthase (UMPSase) expression in cell cultures of Nicotiana plumbaginifolia. UMPSase is the rate-limiting step of pyrimidine biosynthesis in plants. Addition of FOA causes an up-regulation of UMPSase enzyme activity in cell cultures after a lag phase of several days. Western-blot analysis demonstrated that the up-regulation in enzyme activity was caused by increased expression of the UMPSase protein. Northern-blot analysis demonstrated a higher level of UMPSase mRNA in the FOA-induced tissues than in control tissues. Run-on transcriptional assays showed that the UMPSase gene was transcriptionally activated after FOA treatment. The mechanism of toxicity of FOA is through thymine starvation. We found that addition of thymine abrogated the FOA-mediated up-regulation of UMPSase. In addition, methotrexate and aminopterin, which affect thymine levels by inhibiting dihydrofolate reductase, also up-regulate UMPSase in N. plumbaginifolia cells. PMID:9490773
International Nuclear Information System (INIS)
Kimura, Rino; Takahashi, Nobuyuki; Murota, Kaeko; Yamada, Yuko; Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko; Moriyama, Tatsuya; Goto, Tsuyoshi; Kawada, Teruo
2011-01-01
Highlights: → PPARα activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. → PPARα activation also increased oxygen consumption rate and CO 2 production and decreased secretion of triglyceride and ApoB from Caco-2 cells. → Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO 2 production in small intestinal epithelial cells. → Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. → It suggested that intestinal lipid metabolism regulated by PPARα activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-α which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPARα activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPARα activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPARα agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and production of CO 2 and acid soluble metabolites in enterocytes. Moreover
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.
Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian
2010-10-01
According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the
Gocmez, Semil Selcen; Yazir, Yusufhan; Sahin, Deniz; Karadenizli, Sabriye; Utkan, Tijen
2015-04-01
Since the discovery of nitric oxide (NO) as a neuronal messenger, its way to modulate learning and memory functions is subject of intense research. NO is an intercellular messenger in the central nervous system and is formed on demand through the conversion of L-arginine to L-citrulline via the enzyme nitric oxide synthase (NOS). Neuronal form of nitric oxide synthase may play an important role in a wide range of physiological and pathological conditions. Therefore the aim of this study was to investigate the effects of chronic 3-bromo 7-nitroindazole (3-Br 7-NI), specific neuronal nitric oxide synthase (nNOS) inhibitor, administration on spatial learning and memory performance in rats using the Morris water maze (MWM) paradigm. Male rats received either 3-Br 7-NI (20mg/kg/day) or saline via intraperitoneal injection for 5days. Daily administration of the specific neuronal nitric oxide synthase (nNOS) inhibitor, 3-Br 7-NI impaired the acquisition of the MWM task. 3-Br 7-NI also impaired the probe trial. The MWM training was associated with a significant increase in the brain-derived neurotrophic factor (BDNF) mRNA expression in the hippocampus. BDNF mRNA expression in the hippocampus did not change after 3-Br 7-NI treatment. L-arginine significantly reversed behavioural parameters, and the effect of 3-Br 7-NI was found to be NO-dependent. There were no differences in locomotor activity and blood pressure in 3-Br 7-NI treated rats. Our results may suggest that nNOS plays a key role in spatial memory formation in rats. Copyright © 2015 Elsevier Inc. All rights reserved.
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Energy Technology Data Exchange (ETDEWEB)
Egloff, Caroline [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Crump, Doug, E-mail: doug.crump@ec.gc.ca [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Porter, Emily; Williams, Kim L.; Letcher, Robert J.; Gauthier, Lewis T. [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Kennedy, Sean W. [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5 (Canada)
2014-09-15
The organophosphate flame retardants tris(2-butoxyethyl) phosphate (TBOEP) and triethyl phosphate (TEP) are used in a wide range of applications to suppress or delay the ignition and spread of fire. Both compounds have been detected in the environment and TBOEP was recently measured in free-living avian species. In this study, TBOEP and TEP were injected into the air cell of chicken embryos at concentrations ranging from 0 to 45,400 ng/g and 0 to 241,500 ng/g egg, respectively. Pipping success, development, hepatic mRNA expression of 9 target genes, thyroid hormone levels, and circulating bile acid concentrations were determined. Exposure to the highest doses of TBOEP and TEP resulted in negligible detection of the parent compounds in embryonic contents at pipping indicating their complete metabolic degradation. TBOEP exposure had limited effects on chicken embryos, with the exception of hepatic CYP3A37 mRNA induction. TEP exposure decreased pipping success to 68%, altered growth, increased liver somatic index (LSI) and plasma bile acids, and modulated genes associated with xenobiotic and lipid metabolism and the thyroid hormone pathway. Plasma thyroxine levels were decreased at all TEP doses, including an environmentally-relevant concentration (8 ng/g), and gallbladder hypotrophy was evident at ≥ 43,200 ng/g. Tarsus length and circulating thyroxine concentration emerged as potential phenotypic anchors for the modulation of transthyretin mRNA. The increase in plasma bile acids and LSI, gallbladder hypotrophy, and discoloration of liver tissue represented potential phenotypic outcomes associated with modulation of hepatic genes involved with xenobiotic and lipid metabolism. - Highlights: • TBOEP is not embryolethal to chicken embryos. • TEP affected embryonic viability, morphometric endpoints, and thyroid hormone levels. • TEP altered mRNA levels of xenobiotic and lipid metabolism genes. • TEP increased plasma bile acids and caused gallbladder hypotrophy
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Tucker, Mark L; Xue, Ping; Yang, Ronghui
2010-01-01
Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.
Directory of Open Access Journals (Sweden)
Thomas Klein
2015-01-01
Full Text Available Prostacyclin (PGI2 plays a critical role in nephrogenesis and renal physiology. However, our understanding of how prostacyclin release in the kidney is regulated remains poorly defined. We studied expression of prostacyclin synthase (PGIS in developing and adult human kidneys, and also in selected pediatric renal diseases. We also examined PGI2 formation in human mesangial cells in vitro. We observed abundant expression of PGIS in the nephrogenic cortex in humans and in situ hybridization revealed an identical pattern in mice. In the normal adult kidney, PGIS-immunoreactive protein and mRNA appear to localize to mesangial fields and endothelial and smooth muscle cells of arteries and peritubular capillaries. In kidney biopsies taken from pediatric patients, enhanced expression of PGIS-immunoreactive protein was noted mainly in endothelial cells of patients with IgA-nephropathy. Cultured human mesangial cells produce primarily PGI2 and prostaglandin E2, followed by prostaglandin F2α Cytokine stimulation increased PGI2 formation 24-fold. Under these conditions expression of PGIS mRNA and protein remained unaltered whereas mRNA for cyclooxygenase-2 was markedly induced. In contrast to its constitutive expression in vitro, renal expression of prostacyclin-synthase appears to be regulated both during development and in glomerular disease. Further research is needed to identify the factors involved in regulation of PGIS-expression.
Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S
2008-02-01
Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.
Oleic Acid and Hydroxytyrosol Inhibit Cholesterol and Fatty Acid Synthesis in C6 Glioma Cells
Directory of Open Access Journals (Sweden)
Paola Priore
2017-01-01
Full Text Available Recently, the discovery of natural compounds capable of modulating nervous system function has revealed new perspectives for a healthier brain. Here, we investigated the effects of oleic acid (OA and hydroxytyrosol (HTyr, two important extra virgin olive oil compounds, on lipid synthesis in C6 glioma cells. OA and HTyr inhibited both de novo fatty acid and cholesterol syntheses without affecting cell viability. The inhibitory effect of the individual compounds was more pronounced if OA and HTyr were administered in combination. A reduction of polar lipid biosynthesis was also detected, while triglyceride synthesis was marginally affected. To clarify the lipid-lowering mechanism of these compounds, their effects on the activity of key enzymes of fatty acid biosynthesis (acetyl-CoA carboxylase-ACC and fatty acid synthase-FAS and cholesterologenesis (3-hydroxy-3-methylglutaryl-CoA reductase-HMGCR were investigated in situ by using digitonin-permeabilized C6 cells. ACC and HMGCR activities were especially reduced after 4 h of 25 μM OA and HTyr treatment. No change in FAS activity was observed. Inhibition of ACC and HMGCR activities is corroborated by the decrease of their mRNA abundance and protein level. Our results indicate a direct and rapid downregulatory effect of the two olive oil compounds on lipid synthesis in C6 cells.
Czech Academy of Sciences Publication Activity Database
Baumgardt, K.; Šmídová, Klára; Rahn, H.; Lochnit, G.; Robledo, M.; Evguenieva-Hackenberg, E.
2016-01-01
Roč. 13, č. 5 (2016), s. 486-499 ISSN 1547-6286 Institutional support: RVO:61388971 Keywords : Agrobacterium * autoinducer synthase * degradosome Subject RIV: EE - Microbiology, Virology Impact factor: 3.900, year: 2016
An investigation of nutrient-dependent mRNA translation in Drosophila larvae
Directory of Open Access Journals (Sweden)
Sabarish Nagarajan
2014-10-01
Full Text Available The larval period of the Drosophila life cycle is characterized by immense growth. In nutrient rich conditions, larvae increase in mass approximately two hundred-fold in five days. However, upon nutrient deprivation, growth is arrested. The prevailing view is that dietary amino acids drive this larval growth by activating the conserved insulin/PI3 kinase and Target of rapamycin (TOR pathways and promoting anabolic metabolism. One key anabolic process is protein synthesis. However, few studies have attempted to measure mRNA translation during larval development or examine the signaling requirements for nutrient-dependent regulation. Our work addresses this issue. Using polysome analyses, we observed that starvation rapidly (within thirty minutes decreased larval mRNA translation, with a maximal decrease at 6–18 hours. By analyzing individual genes, we observed that nutrient-deprivation led to a general reduction in mRNA translation, regardless of any starvation-mediated changes (increase or decrease in total transcript levels. Although sugars and amino acids are key regulators of translation in animal cells and are the major macronutrients in the larval diet, we found that they alone were not sufficient to maintain mRNA translation in larvae. The insulin/PI3 kinase and TOR pathways are widely proposed as the main link between nutrients and mRNA translation in animal cells. However, we found that genetic activation of PI3K and TOR signaling, or regulation of two effectors – 4EBP and S6K – could not prevent the starvation-mediated translation inhibition. Similarly, we showed that the nutrient stress-activated eIF2α kinases, GCN2 and PERK, were not required for starvation-induced inhibition of translation in larvae. These findings indicate that nutrient control of mRNA translation in larvae is more complex than simply amino acid activation of insulin and TOR signaling.
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
DEFF Research Database (Denmark)
Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.
1999-01-01
cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...
Zheng, Miaoyan; Zou, Chen; Li, Mengyue; Huang, Guowei; Gao, Yuxia; Liu, Huan
2017-01-01
High incidence rate of Alzheimer’s disease (AD) is observed in patients with type 2 diabetes. Aggregated β-amyloid (Aβ) and hyperphosphorylated tau are the hallmarks of AD. Hyperphosphorylated tau has been detected in diabetic animals as well as in diabetic patients. Folates mediate the transfer of one carbon unit, required in various biochemical reactions. The effect of folate on tau phosphorylation in diabetic models still remains unknown. In this study, we investigated the effect and mechanism of folic acid on hyperphosphorylation of tau in streptozotocin (STZ)-induced diabetic mice. Diabetic mice induced by STZ, at the age of 10 weeks, were administered with three levels of folic acid: folic acid-deficient diet, diet with normal folic acid content, and 120 μg/kg folic acid diet for 8 weeks. Levels of serum folate and blood glucose were monitored. Tau phosphorylation, protein phosphatase 2A (PP2A) methylation, and Glycogen synthase kinase 3β (GSK-3β) phosphorylation were detected using Western blot. The S-adenosyl methionine:S-adenosyl homocysteine ratio (SAM:SAH) in brain tissues was also determined. DNA methyltransferase (DNMT) mRNA expression levels were detected using real-time PCR. Folic acid reduced tau hyperphosphorylation at Ser396 in the brain of diabetes mellitus (DM) mice. In addition, PP2A methylation and DNMT1 mRNA expression were significantly increased in DM mice post folic acid treatment. GSK-3β phosphorylation was not regulated by folic acid administration. Folic acid can reduce tau phosphorylation by regulating PP2A methylation in diabetic mice. These results support that folic acid can serve as a multitarget neuronal therapeutic agent for treating diabetes-associated cognitive dysfunction. PMID:28422052
Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.
Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George
2017-09-01
Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...
Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2008-01-01
Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.
Directory of Open Access Journals (Sweden)
Kexiu Song
2014-01-01
Full Text Available HDL cholesterol is known to be inversely correlated with cardiovascular disease due to its diverse antiatherogenic functions. SR-BI mediates the selective uptake of HDL-C. SR-BI knockout diminishes but does not completely block the transport of HDL; other receptors may be involved. Ectopic ATP synthase β-chain in hepatocytes has been previously characterized as an apoA-I receptor, triggering HDL internalization. This study was undertaken to identify the overexpression of ectopic ATP synthase β-chain on DIL-HDL uptake in primary hepatocytes in vitro and on plasma HDL levels in SR-BI knockout mice. Human ATP synthase β-chain cDNA was delivered to the mouse liver by adenovirus and GFP adenovirus as control. The adenovirus-mediated overexpression of β-chain was identified at both mRNA and protein levels on mice liver and validated by its increasing of DiL-HDL uptake in primary hepatocytes. In response to hepatic overexpression of β-chain, plasma HDL-C levels and cholesterol were reduced in SR-BI knockout mice, compared with the control. The present data suggest that ATP synthase β-chain can serve as the endocytic receptor of HDL, and its overexpression can reduce plasma HDL-C.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo
2017-01-01
Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602
Li, Xiaowei; Jia, Zhihao; Wang, Weilin; Wang, Lingling; Liu, Zhaoqun; Yang, Bin; Jia, Yunke; Song, Xiaorui; Yi, Qilin; Qiu, Limei; Song, Linsheng
2017-08-01
Glycogen synthase kinase-3 (GSK3) is a serine/threonine protein kinase firstly identified as a regulator of glycogen synthesis. Recently, it has been proved to be a key regulator of the immune reaction. In the present study, a GSK3 homolog gene (designated as EsGSK3) was cloned from Chinese mitten crab, Eriocheir sinensis. The open reading frame (ORF) was 1824 bp, which encoded a predicted polypeptide of 607 amino acids. There was a conserved Serine/Threonine Kinase domain and a DNA binding domain found in EsGSK3. Phylogenetic analysis showed that EsGSK3 was firstly clustered with GSK3-β from oriental river prawn Macrobrachium nipponense in the invertebrate branch, while GSK3s from vertebrates formed the other distinct branch. EsGSK3 mRNA transcripts could be detected in all tested tissues of the crab including haepatopancreas, eyestalk, muscle, gonad, haemocytes and haematopoietic tissue with the highest expression level in haepatopancreas. And EsGSK3 protein was mostly detected in the cytoplasm of haemocyte by immunofluorescence analysis. The expression levels of EsGSK3 mRNA increased significantly at 6 h after Aeromonas hydrophila challenge (p level at 48 h (p > 0.05). The mRNA expression of lipopolysaccharide-induced tumor necrosis factor (TNF)-α factor (EsLITAF) was also induced by A. hydrophila challenge. However, the mRNA expression of EsLITAF and TNF-α production was significantly suppressed after EsGSK3 was blocked in vivo with specific inhibitor lithium, while the phagocytosis of crab haemocytes was significantly promoted. These results collectively demonstrated that EsGSK3 could regulate the innate immune responses of E. sinensis by promoting TNF-α production and inhibiting haemocyte phagocytosis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Directory of Open Access Journals (Sweden)
Häberle J
2011-08-01
Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia
International Nuclear Information System (INIS)
Zhu Guangying; Liu Delin; Chen Jie
2003-01-01
Objective: To evaluate the sensitivity, specificity and clinical significance of CK19 mRNA, CEA mRNA and LUNX mRNA for detecting micrometastasis by sampling the peripheral blood and regional lymph nodes of lung cancer patients. Methods: Reverse transcriptase chain reaction (RT-PCR) was used to detect LUNX mRNA, CK19 mRNA, CEA mRNA for micrometastasis by sampling the peripheral blood of 48 lung cancer patients and 44 regional lymph nodes of such patients treated by curative resection. Peripheral blood of 30 patients with pulmonary benign lesions and 10 normal healthy volunteers and lymph nodes of 6 patients with benign pulmonary diseases served as control. Results: 1) LUNX mRNA, CK19 mRNA, CEA mRNA were expressed in all (35/35) lung cancer tissues. 2) In the peripheral blood from 48 lung cancer patients, 30 (62.5%) were positive for LUNX mRNA, 24 (50.0%) positive for CK19 mRNA and 32(66.7%) positive for CEA mRNA. The positive detection rates of micrometastasis in 44 lymph nodes from lung cancer patients were 36.4% (16 out of 44) for LUNX mRNA, 27.3% (12 out of 44) for CK19 mRNA and 40.9% (18 out of 44) for CEA mRNA. 3) In the 30 blood samples from patients with pulmonary benign diseases, 2 (6.7%) expressed CK19 mRNA, but none expressed LUNX mRNA or CEA mRNA. All the 3 molecular markers were negative in the 10 blood samples from healthy volunteers. In 11 lymph nodes from patients with pulmonary benign lesions, none was positive for any of the three markers. 4) In 44 regional lymph nodes from lung cancer patients, 6 (13.6%) were positive for metastasis by histopathological examination, with a positive rate significantly lower than that of the RT-PCR (P<0.05). 5) The micrometastatic positive rate in the peripheral blood of 40 non-small cell lung cancer (NSCLC) patients was significantly related to TNM stage (P=0.01). Conclusions: LUNX mRNA, CK19 MRNA, CEA mRNA are all appropriate target genes for the detection of micrometastasis from lung cancer. LUNX mRNA and CEA mRNA
9-cis-retinoic acid increases apolipoprotein AI secretion and mRNA expression in HepG2 cells.
Haghpassand, M; Moberly, J B
1995-10-01
HepG2 cells were studied as a model for regulation of hepatic apolipoprotein AI (apo AI) secretion and gene expression by 9-cis-retinoic acid. HepG2 cells cultured on plastic dishes were exposed to 9-cis-retinoic acid (9-cis-RA) for 48 h with a complete media change at 24 h. Apo AI mass in cultured media was determined by ELISA, by quantitative immunoblotting and by steady-state 35S-methionine labeling. Messenger RNA levels were determined by RNase protection using probes for apo AI and the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (G3PDH). 9-cis-RA increased secretion of apo AI by 52% at doses of 10 and 1 microM (6.3 +/- 0.6 vs. 4.2 +/- 0.3; P G3PDH mRNA was slightly decreased (14%, P < 0.05). Thus, 9-cis-RA stimulates apo AI expression in HepG2 cells, suggesting a role for retinoids in activating endogenous apo AI gene expression.
Glausier, JR; Kimoto, S; Fish, KN; Lewis, DA
2014-01-01
Background Altered GABA signaling in the prefrontal cortex (PFC) has been associated with cognitive dysfunction in schizophrenia and schizoaffective disorder. PFC levels of the GABA-synthesizing enzyme glutamic acid decarboxylase 67kD (GAD67) has been consistently reported to be lower in these disorders, but the status of the second GABA-synthesizing enzyme, GAD65, remains unclear. Methods GAD65 mRNA levels were quantified in PFC area 9 by quantitative polymerase chain reaction from 62 subjects with schizophrenia or schizoaffective disorder and 62 matched healthy comparison subjects. GAD65 relative protein levels were quantified in a subset of subject pairs by confocal immunofluorescence microscopy. Results Mean GAD65 mRNA levels were 13.6% lower in schizoaffective disorder subjects, but did not differ in schizophrenia subjects, relative to their matched healthy comparison subjects. In the subjects with schizoaffective disorder, mean GAD65 protein levels were 19.4% lower and were correlated with GAD65 mRNA levels. Lower GAD65 mRNA and protein measures within schizoaffective disorder subjects was not attributable to factors commonly comorbid with the diagnosis. Conclusions In concert with previous studies, these findings suggest that schizoaffective disorder is associated with lower levels of both GAD65 and GAD67 mRNA and protein in the PFC, whereas subjects with schizophrenia have lower mean levels of only GAD67 mRNA and protein. Because cognitive function is generally better preserved in subjects with schizoaffective disorder relative to subjects with schizophrenia, these findings may support an interpretation that GAD65 down-regulation provides a homeostatic response complementary to GAD67 down-regulation expression that serves to reduce inhibition in the face of lower PFC network activity. PMID:24993056
International Nuclear Information System (INIS)
Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.
2006-01-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase
Energy Technology Data Exchange (ETDEWEB)
Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)
2006-03-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.
International Nuclear Information System (INIS)
Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua
2010-01-01
Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing
2017-12-01
Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate
DEFF Research Database (Denmark)
González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael
2010-01-01
The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Responses of mRNA expression of PepT1 in small intestine to ...
African Journals Online (AJOL)
To study the effect of circulation small peptides concentration on mRNA expression in small intestine, graded amount of soybean small peptides (SSP) were infused into lactating goats through duodenal fistulas. Peptide-bound amino acid (PBAA) concentration in arterial plasma and the mRNA expression of PepT1 was ...
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Directory of Open Access Journals (Sweden)
Ye Tong Xu
2018-01-01
Full Text Available Objective The goal of this study was to investigate the effects of dietary standard ileal digestible (SID valine:lysine ratios on performance, intestinal morphology, amino acids of liver and muscle, plasma indices and mRNA expression of branched-chain amino acid (BCAA metabolism enzymes. Methods A total of 144 crossbred pigs (Duroc×Landrace×Large White weaned at 28±4 days of age (8.79±0.02 kg body weight were randomly allotted to 1 of 4 diets formulated to provide SID valine:lysine ratios of 50%, 60%, 70%, or 80%. Each diet was fed to 6 pens of pigs with 6 pigs per pen (3 gilts and 3 barrows for 28 days. Results Average daily gain increased quadratically (p<0.05, the villous height of the duodenum, jejunum and ileum increased linearly (p<0.05 as the SID valine:lysine ratio increased. The concentrations of plasma α-keto isovaleric and valine increased linearly (p<0.05, plasma aspartate, asparagine and cysteine decreased (p<0.05 as the SID valine:lysine ratio increased. An increase in SID lysine:valine levels increased mRNA expression levels of mitochondrial BCAA transaminase and branched-chain α-keto acid dehydrogenase in the longissimus dorsi muscle (p<0.05. Conclusion Using a quadratic model, a SID valine:lysine ratio of 68% was shown to maximize the growth of weaned pigs which is slightly higher than the level recommended by the National Research Council [6].
DEFF Research Database (Denmark)
Plomgaard, Peter; Penkowa, Milena; Leick, Lotte
2006-01-01
The metabolic profile of rodent muscle is generally reflected in the myosin heavy chain (MHC) fiber-type composition. The present study was conducted to test the hypothesis that metabolic gene expression is not tightly coupled with MHC fiber-type composition for all genes in human skeletal muscle....... Triceps brachii, vastus lateralis quadriceps, and soleus muscle biopsies were obtained from normally physically active, healthy, young male volunteers, because these muscles are characterized by different fiber-type compositions. As expected, citrate synthase and 3-hydroxyacyl dehydrogenase activity...... of a broad range of metabolic genes. The triceps muscle had two- to fivefold higher MHC IIa, phosphofructokinase, and LDH A mRNA content and two- to fourfold lower MHC I, lipoprotein lipase, CD36, hormone-sensitive lipase, and LDH B and hexokinase II mRNA than vastus lateralis or soleus. Interestingly...
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.
Directory of Open Access Journals (Sweden)
Anna Zdyb
Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.
Energy Technology Data Exchange (ETDEWEB)
Crump, Doug, E-mail: doug.crump@ec.gc.ca [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Porter, Emily; Egloff, Caroline; Williams, Kim L.; Letcher, Robert J.; Gauthier, Lewis T. [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Kennedy, Sean W. [National Wildlife Research Centre, Environment Canada, Ottawa, ON K1A 0H3 (Canada); Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5 (Canada)
2014-06-15
1,2-Dibromo-4-(1,2-dibromoethyl)-cyclohexane (DBE-DBCH; formerly abbreviated as TBECH) and tris(methylphenyl) phosphate (TMPP; formerly abbreviated as TCP) are additive flame retardants that are detected in the environment and biota. A recent avian in vitro screening study of 16 flame retardants identified DBE-DBCH and TMPP as important chemicals for follow-up in ovo evaluation based on their effects on cytotoxicity and mRNA expression in avian hepatocytes. In this study, technical mixtures of DBE-DBCH and TMPP were injected into the air cell of chicken embryos at concentrations ranging from 0 to 54,900 ng/g and from 0 to 261,400 ng/g, respectively, to determine effects on pipping success, development, hepatic mRNA expression, thyroid hormone levels, and circulating bile acid concentrations. Both compounds were detectable in embryos at pipping and the β-DBE-DBCH isomer was depleted more rapidly than the α-isomer in tissue samples. DBE-DBCH had limited effects on the endpoints measured, with the exception of the up-regulation of two phase I metabolizing enzymes, CYP3A37 and CYP2H1. TMPP exposure caused embryonic deformities, altered growth, increased liver somatic index (LSI) and plasma bile acid concentrations, and altered mRNA expression levels of genes associated with xenobiotic and lipid metabolism and the thyroid hormone pathway. Overall, TMPP elicited more adverse molecular and phenotypic effects than DBE-DBCH albeit at concentrations several orders of magnitude greater than those detected in the environment. The increase in plasma bile acid concentrations was a useful phenotypic anchor as it was associated with a concomitant increase in LSI, discoloration of the liver tissue, and modulation of hepatic genes involved with xenobiotic and lipid metabolism. - Highlights: • DBE-DBCH and TMPP are not embryolethal to chicken embryos. • TMPP caused deformities, morphometric alterations, and increased plasma bile acids. • DBE-DBCH and TMPP altered mRNA levels
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.
LENUS (Irish Health Repository)
Cathcart, Mary-Clare
2012-02-01
BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.
Benedito-Palos, Laura; Calduch-Giner, Josep A; Ballester-Lozano, Gabriel F; Pérez-Sánchez, Jaume
2013-04-14
The effect of ration size on muscle fatty acid (FA) composition and mRNA expression levels of key regulatory enzymes of lipid and lipoprotein metabolism have been addressed in juveniles of gilthead sea bream fed a practical diet over the course of an 11-week trial. The experimental setup included three feeding levels: (i) full ration until visual satiety, (ii) 70 % of satiation and (iii) 70 % of satiation with the last 2 weeks at the maintenance ration. Feed restriction reduced lipid content of whole body by 30 % and that of fillet by 50 %. In this scenario, the FA composition of fillet TAG was not altered by ration size, whereas that of phospholipids was largely modified with a higher retention of arachidonic acid and DHA. The mRNA transcript levels of lysophosphatidylcholine acyltransferases, phosphatidylethanolamine N-methyltransferase and FA desaturase 2 were not regulated by ration size in the present experimental model. In contrast, mRNA levels of stearoyl-CoA desaturases were markedly down-regulated by feed restriction. An opposite trend was found for a muscle-specific lipoprotein lipase, which is exclusive of fish lineage. Several upstream regulatory transcriptions were also assessed, although nutritionally mediated changes in mRNA transcripts were almost reduced to PPARα and β, which might act in a counter-regulatory way on lipolysis and lipogenic pathways. This gene expression pattern contributes to the construction of a panel of biomarkers to direct marine fish production towards muscle lean phenotypes with increased retentions of long-chain PUFA.
Energy Technology Data Exchange (ETDEWEB)
Kimura, Rino [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Takahashi, Nobuyuki, E-mail: nobu@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Murota, Kaeko [Department of Life Science, School of Science and Engineering, Kinki University, Osaka 770-8503 (Japan); Yamada, Yuko [Laboratory of Physiological Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Moriyama, Tatsuya [Department of Applied Cell Biology, Graduate School of Agriculture, Kinki University, Nara 631-8505 (Japan); Goto, Tsuyoshi; Kawada, Teruo [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan)
2011-06-24
Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. {yields} PPAR{alpha} activation also increased oxygen consumption rate and CO{sub 2} production and decreased secretion of triglyceride and ApoB from Caco-2 cells. {yields} Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO{sub 2} production in small intestinal epithelial cells. {yields} Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. {yields} It suggested that intestinal lipid metabolism regulated by PPAR{alpha} activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-{alpha} which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPAR{alpha} activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPAR{alpha} activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPAR{alpha} agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and
Greijer, AE; Verschuuren, EAM; Harmsen, MC; Dekkers, CAJ; Adriaanse, HMA; The, TH; Middeldorp, JM
The dynamics of active human cytomegalovirus (HCMV) infection was monitored by competitive nucleic acid sequence-based amplification (NASBA) assays for quantification of IE1 (UL123) and pp67 (UL65) mRNA expression levels In the blood of patients after lung transplantation. RNA was isolated from 339
Directory of Open Access Journals (Sweden)
Nataliya E Chorna
Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.
Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C
2010-08-10
Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang
2008-10-24
The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.
International Nuclear Information System (INIS)
Ogiuchi, Yosuke; Maruoka, Yasubumi; Ando, Tomohiro; Kobayashi, Makio; Ogiuchi, Hideki
2008-01-01
We conducted a clinicopathologic study on protein and mRNA levels of thymidylate synthase (TS), thymidine phosphorylase (TP) and orotate phosphoribosyl transferase (OPRT) using biopsy tissue specimens before treatment. The mRNA levels have been measured in tumor cells microdissected from paraffin-embedded specimens (Danenberg Tumor Profile method: DTP method). We studied the mRNA and protein expression as effect predictive factors in chemotherapy. The subjects consisted of 20 cases of untreated oral squamous cell carcinoma who had undergone chemotherapy with TS-1 (16 males and 4 females, tongue in 8 cases, upper gingiva in 3 cases, lower gingiva in 3 cases, buccal mucosa in 5 cases and floor of the mouth in 1 case). TS gene expressions of the responders were lower than those for the nonresponders. Furthermore, regarding males who were less than 70 years of age, stage I and II, well differentiated type and tongue, TS mRNA expression of the responders were lower than that for the nonresponders. The mRNA expression of OPRT for the male responders was lower than that for the nonresponders. No remarkable difference was observed by immunohistochemistry. In this study, the measurement of the TS levels using the DTP method may potentially act as a predictive factor of antitumor effectiveness
Kareem, Karwan Yaseen; Loh, Teck Chwen; Foo, Hooi Ling; Akit, Henny; Samsudin, Anjas Asmara
2016-08-05
Postbiotics (metabolic products by lactic acid bacteria) and prebiotics have been established as substitute to antibiotics in order to enhance immunity and growth performance in broiler chickens. Nonetheless, insufficient information is available on the effects of postbiotics and prebiotics combination on growth performance, faecal microbiota, pH and volatile fatty acids (VFA), as well as liver insulin like growth factor 1 (IGF1) and growth hormone receptor (GHR) mRNA expressions in broiler chickens. The aim of this experiment was to evaluate the effects of different types of postbiotics with different levels of prebiotic (inulin) on broiler for those parameters. The results showed that birds fed T3: (0.3 % RI11 + 0.8 % Inulin), T4: (0.3 % RI11 + 1.0 % Inulin), and T6: (0.3 % RG14+ 1.0 % Inulin) had higher (p inulin increased (p inulin combinations had beneficial effects on total BW, feed efficiency, mucosa architecture and IGF1 and GHR mRNA expression in broiler chickens.
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
Theodorakis, Nicholas G; Wang, Yining N; Korshunov, Vyacheslav A; Maluccio, Mary A; Skill, Nicholas J
2015-04-14
Portal hypertension is a common complication of liver cirrhosis and significantly increases mortality and morbidity. Previous reports have suggested that the compound thalidomide attenuates portal hypertension (PHT). However, the mechanism for this action is not fully elucidated. One hypothesis is that thalidomide destabilizes tumor necrosis factor α (TNFα) mRNA and therefore diminishes TNFα induction of nitric oxide synthase (NOS) and the production of nitric oxide (NO). To examine this hypothesis, we utilized the murine partial portal vein ligation (PVL) PHT model in combination with endothelial or inducible NOS isoform gene knockout mice. Wild type, inducible nitric oxide synthase (iNOS)(-/-) and endothelial nitric oxide synthase (eNOS)(-/-) mice received either PVL or sham surgery and were given either thalidomide or vehicle. Serum nitrate (total nitrate, NOx) was measured daily for 7 d as a surrogate of NO synthesis. Serum TNFα level was quantified by enzyme-linked immunosorbent assay. TNFα mRNA was quantified in liver and aorta tissue by reverse transcription-polymerase chain reaction. PHT was determined by recording splenic pulp pressure (SPP) and abdominal aortic flow after 0-7 d. Response to thalidomide was determined by measurement of SPP and mean arterial pressure (MAP). SPP, abdominal aortic flow (Qao) and plasma NOx were increased in wild type and iNOS(-/-) PVL mice when compared to sham operated control mice. In contrast, SPP, Qao and plasma NOx were not increased in eNOS(-/-) PVL mice when compared to sham controls. Serum TNFα level in both sham and PVL mice was below the detection limit of the commercial ELISA used. Therefore, the effect of thalidomide on serum TNFα levels was undetermined in wild type, eNOS(-/-) or iNOS(-/-) mice. Thalidomide acutely increased plasma NOx in wild type and eNOS(-/-) mice but not iNOS(-/-) mice. Moreover, thalidomide temporarily (0-90 min) decreased mean arterial pressure, SPP and Qao in wild type, e
Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay
2017-05-07
Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
LV, FENG-HUA; GAO, JIAN-ZHI; TENG, QING-LEI; ZHANG, JIN-YING
2013-01-01
Hyperlipidemia may lead to endothelial injury, due to its effects on homocysteine and vascular endothelial growth factor in the serum, and the mRNA expression levels of peroxisome proliferator-activated receptor-? (PPAR?), and caspase-3 and -8 in the vascular wall. In order to prevent and mitigate the high-fat state that results from endothelial injury, this study examined the effect of folic acid (FA) and vitamin B12 (VB12) on the expression of PPAR? and caspase-3 and -8 mRNA in the abdomina...
Hu, C J; Jiang, Q Y; Zhang, T; Yin, Y L; Li, F N; Su, J Y; Wu, G Y; Kong, X F
2017-12-01
Our previous study showed dietary supplementation with Arg and Glu increased intramuscular fat deposition and decreased back fat thickness in pigs, suggesting that the genes involved in lipid metabolism might be regulated differently in muscle and s.c. adipose (SA) tissues. Sixty Duroc × Large White × Landrace pigs with an average initial BW of 77.1 ± 1.3 kg were randomly assigned to 1 of 5 treatment groups (castrated male to female ratio = 1:1). Pigs in the control group were fed a basic diet, and those in experimental groups were fed the basic diet supplemented with 2.05% alanine (isonitrogenous group), 1.00% arginine (Arg group), 1.00% glutamic acid + 1.44% alanine (Glu group), or 1.00% arginine + 1.00% glutamic acid (Arg+Glu group). Fatty acid percentages and mRNA expression levels of the genes involved in lipid metabolism in muscle and SA tissues were examined. The percentages of C14:0 and C16:0 in the SA tissue of Glu group pigs and C14:0 in the longissimus dorsi (LD) muscle of Glu and Arg+Glu groups decreased ( acid synthase in the Arg+Glu group was more upregulated ( < 0.05) than that of the Arg group. An increase in the mRNA level of in the biceps femoris muscle was also observed in the Arg+Glu group ( < 0.05) compared with the basic diet and isonitrogenous groups. Collectively, these findings suggest that dietary supplementation with Arg and Glu upregulates the expression of genes involved in adipogenesis in muscle tissues and lipolysis in SA tissues.
Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.
Directory of Open Access Journals (Sweden)
Damien Garrido
2015-02-01
Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell
Directory of Open Access Journals (Sweden)
Junko Tanaka
Full Text Available Although modern proteins consist of 20 different amino acids, it has been proposed that primordial proteins consisted of a small set of amino acids, and additional amino acids have gradually been recruited into the genetic code. This hypothesis has recently been supported by comparative genome sequence analysis, but no direct experimental approach has been reported. Here, we utilized a novel experimental approach to test a hypothesis that native-like globular proteins might be easily simplified by a set of putative primitive amino acids with retention of its structure and function than by a set of putative new amino acids. We performed in vitro selection of a functional SH3 domain as a model from partially randomized libraries with different sets of amino acids using mRNA display. Consequently, a library rich in putative primitive amino acids included a larger number of functional SH3 sequences than a library rich in putative new amino acids. Further, the functional SH3 sequences were enriched from the primitive library slightly earlier than from a randomized library with the full set of amino acids, while the function and structure of the selected SH3 proteins with the primitive alphabet were comparable with those from the 20 amino acid alphabet. Application of this approach to various combinations of codons in protein sequences may be useful not only for clarifying the precise order of the amino acid expansion in the early stages of protein evolution but also for efficiently creating novel functional proteins in the laboratory.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Walsh, L; Freemont, A J; Hoyland, J A
1993-06-01
Tissue decalcification is a routine part of the preparation of bone tissue for histological studies. Although in-situ hybridization has been employed to localize mRNA of collagenous and non-collagenous bone related proteins in skeletal tissue, little is known regarding the effects of decalcifying agents on mRNA retention within tissue. In this study in-situ hybridization using an oligonucleotide probe (i.e. a poly d(T) probe) to detect total messenger RNA has been employed to investigate the effects of the decalcifying agents nitric acid, formic acid and EDTA on mRNA retention compared to undeacalcified tissue. The results show that formalin fixation and EDTA decalcification preserve substantial amounts of mRNA within the tissue. In particular, this study illustrates that it is possible to perform in-situ hybridization on formalin fixed decalcified paraffin embedded tissue.
Protein Structure and the Sequential Structure of mRNA
DEFF Research Database (Denmark)
Brunak, Søren; Engelbrecht, Jacob
1996-01-01
entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment, By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets, These signals do not originate from......A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting...... protein, The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain, A complete search for GenBank nucleotide sequences coding for structural...
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Sovadinová, I; Liedtke, A; Schirmer, K
2014-09-01
Clofibric acid (CA) is the active substance of lipid lowering drugs. It is resistant to degradation, polar in nature, and has been found ubiquitously in the aquatic environment. Though CA is classified as a peroxisomal proliferator in rodents and is considered as a potential endocrine disruptor, little information exists on the effects of CA in aquatic organisms, such as fish. In the present study, we examined the mRNA levels of peroxisome proliferator- and estrogen-sensitive genes on the exposure of primary rainbow trout (Oncorhynchus mykiss) hepatocytes to CA alone and in combination with the natural female sex hormone, 17β-estradiol (E2). Our results demonstrate that rainbow trout hepatocytes are relatively refractory to the effects of CA on the PPAR signaling pathway and lipid metabolism. Moreover, CA did not show recognizable estrogenic activity, but after the induction of vitellogenesis by E2, CA significantly reduced vitellogenin (VTG) mRNA abundance. Apparently, the indirect repression of VTG transcription, independent of estrogen receptors, occurred. The mechanism is not yet clearly understood but may involve disruption of the stabilization of VTG mRNA known to be induced by E2. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yong Wang
2015-10-01
Full Text Available This study aims to determine the polymorphism and mRNA expression pattern of the heart-type fatty acid-binding protein (H-FABP gene and their association with intramuscular fat (IMF content in the breast and leg muscles of Baicheng oil chicken (BOC. A total of 720 chickens, including 240 black Baicheng oil chicken (BBOC, 240 silky Baicheng oil chicken (SBOC, and 240 white Baicheng oil chicken (WBOC were raised. Three genotypes of H-FABP gene second extron following AA, AB, and BB were detected by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP strategy. The G939A site created AA genotype and G956A site created BB genotype. The content of IMF in AA genotype in breast muscle of BBOC was significantly higher than that of AB (p = 0.0176 and the genotype in leg muscle of WBOC was significantly higher than that of AB (p = 0.0145. The G939A site could be taken as genetic marker for higher IMF content selecting for breast muscle of BBOC and leg muscle of WBOC. The relative mRNA expression of H-FABP was measured by real-time PCR at 30, 60, 90, and 120 d. The IMF content significantly increased with age in both muscles. The mRNA expression level of H-FABP significantly decreased with age in both muscles of the three types of chickens. Moreover, a significant negative correlation between H-FABP abundance and IMF content in the leg muscles of WBOC (p = 0.035 was observed. The mRNA expression of H-FABP negatively correlated with the IMF content in both breast and leg muscles of BOC sat slaughter time.
International Nuclear Information System (INIS)
Kralj, Ana; Gurgui, Mihaela; Koenig, Gabriele M.; Echten-Deckert, Gerhild van
2007-01-01
Trichothecenes are sesquiterpenoid metabolites produced by several fungal strains that impair human and animal health. Since sphingolipids were connected with fungal toxicity the aim of the present study was to test the influence of fungal metabolites on sphingolipid metabolism in neural cells. The crude extract of fungal strain Spicellum roseum induced accumulation of glucosylceramide (GlcCer), and simultaneous reduction of the formation of lactosylceramide (LacCer) and complex gangliosides in primary cultured neurons. Following a bioassay-guided fractionation of the respective fungal extract we could demonstrate that the two isolated trichothecene derivatives, 8-deoxy-trichothecin (8-dT) and trichodermol (Td-ol) were responsible for this effect. Thus, incubation of primary cultured neurons as well as of neuroblastoma B104 cells for 24 h with 30 μM of either of the two fungal metabolites resulted in uncoupling of sphingolipid biosynthesis at the level of LacCer. For the observed reduction of LacCer synthase activity by about 90% cell integrity was crucial in both cell types. In neuroblastoma cells the amount of LacCer synthase mRNA was reduced in the presence of trichothecenes, whereas in primary cultured neurons this was not the case, suggesting a post-transcriptional mechanism of action in the latter cell type. The data also show that the compounds did not interfere with the translocation of GlcCer in neuroblastoma cells. Collectively, our results demonstrate that trichodermol and 8-deoxy-trichothecin inhibit LacCer synthase activity in a cell-type-specific manner
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Hege, Marianne; Jung, Finn; Sellmann, Cathrin; Jin, Chengjun; Ziegenhardt, Doreen; Hellerbrand, Claus; Bergheim, Ina
2018-01-01
Results of in vitro and in vivo studies suggest that consumption of beer is less harmful for the liver than consumption of spirits. It also has been suggested that secondary plant compounds derived from hops such as xanthohumol or iso-α-acids may have beneficial effects on the development of liver diseases of various etiologies. The aim of this study was to determine whether iso-α-acids consumed in doses achieved by "normal" beer consumption have beneficial effects on health. Female C57 Bl/6 J mice, pretreated for 4 d with an iso-α-acid-rich extract (∼30% iso-α-acids from hops, 0.75 mg/kg body weight), were fed one bolus of ethanol (6 g/kg body weight intragastric) or an iso-caloric maltodextrin solution. Markers of liver damage, toll-like receptor-4 signaling, and lipid peroxidation were determined. Furthermore, the effect of isohumulone on the lipopolysaccharide-dependent activation of J774 A.1 macrophages, used as a model of Kupffer cells, was determined. In the liver, acute ethanol administration led to a significant accumulation of fat (∼10-fold), which was accompanied by significantly higher inducible nitric oxide synthase protein level, elevated nitric oxide production, and increased plasminogen activator inhibitor 1 protein concentration when compared to controls. In mice pretreated with iso-α-acids, these effects of alcohol were markedly attenuated. Pretreatment of J774 A.1 macrophages with isohumulone significantly attenuated lipopolysaccharide-induced mRNA expression of inducible nitric oxide synthase and interleukin-6 as well as the release of nitric oxide. Taken together, iso-α-acids markedly attenuated the development of acute alcohol-induced damage in mice. Copyright © 2017 Elsevier Inc. All rights reserved.
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
L-Myo-inositol 1-phosphate synthase in the aquatic fern Azolla filiculoides.
Benaroya, Rony Oren; Zamski, Eli; Tel-Or, Elisha
2004-02-01
L-Myo-inositol 1-phosphate synthase (INPS EC 5.5.1.4) catalyzes the conversion of D-glucose 6-phosphate to L-myo-inositol 1-phosphate. INPS is a key enzyme involved in the biosynthesis of phytate which is a common form of stored phosphates in higher plants. The present study monitored the increase of INPS expression in Azolla filiculoides resulting from exposure to inorganic phosphates, metals and salt stress. The expression of INPS was significantly higher in Azolla plants that were grown in rich mineral growth medium than those maintained on nutritional growth medium. The expression of INPS protein and corresponding mRNA increased in plants cultured in minimal nutritional growth medium when phosphate or Zn2+, Cd2+ and NaCl were added to the growth medium. When employing rich mineral growth medium, INPS protein content increased with the addition of Zn2+, but decreased in the presence of Cd2+ and NaCl. These results indicated that accumulation of phytate in Azolla is a result of the intensified expression of INPS protein and mRNA, and its regulation may be primarily derived by the uptake of inorganic phosphate, and Zn2+, Cd2+ or NaCl.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Creelman, R A; Tierney, M L; Mullet, J E
1992-06-01
Jasmonic acid (JA) and its methyl ester, methyl jasmonate (MeJA), are plant lipid derivatives that resemble mammalian eicosanoids in structure and biosynthesis. These compounds are proposed to play a role in plant wound and pathogen responses. Here we report the quantitative determination of JA/MeJA in planta by a procedure based on the use of [13C,2H3]MeJA as an internal standard. Wounded soybean (Glycine max [L] Merr. cv. Williams) stems rapidly accumulated MeJA and JA. Addition of MeJA to soybean suspension cultures also increased mRNA levels for three wound-responsive genes (chalcone synthase, vegetative storage protein, and proline-rich cell wall protein) suggesting a role for MeJA/JA in the mediation of several changes in gene expression associated with the plants' response to wounding.
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
Protein functional features are reflected in the patterns of mRNA translation speed.
López, Daniel; Pazos, Florencio
2015-07-09
The degeneracy of the genetic code makes it possible for the same amino acid string to be coded by different messenger RNA (mRNA) sequences. These "synonymous mRNAs" may differ largely in a number of aspects related to their overall translational efficiency, such as secondary structure content and availability of the encoded transfer RNAs (tRNAs). Consequently, they may render different yields of the translated polypeptides. These mRNA features related to translation efficiency are also playing a role locally, resulting in a non-uniform translation speed along the mRNA, which has been previously related to some protein structural features and also used to explain some dramatic effects of "silent" single-nucleotide-polymorphisms (SNPs). In this work we perform the first large scale analysis of the relationship between three experimental proxies of mRNA local translation efficiency and the local features of the corresponding encoded proteins. We found that a number of protein functional and structural features are reflected in the patterns of ribosome occupancy, secondary structure and tRNA availability along the mRNA. One or more of these proxies of translation speed have distinctive patterns around the mRNA regions coding for certain protein local features. In some cases the three patterns follow a similar trend. We also show specific examples where these patterns of translation speed point to the protein's important structural and functional features. This support the idea that the genome not only codes the protein functional features as sequences of amino acids, but also as subtle patterns of mRNA properties which, probably through local effects on the translation speed, have some consequence on the final polypeptide. These results open the possibility of predicting a protein's functional regions based on a single genomic sequence, and have implications for heterologous protein expression and fine-tuning protein function.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Misra, Rajesh Chandra; Garg, Anchal; Roy, Sudeep; Chanotiya, Chandan Singh; Vasudev, Prema G; Ghosh, Sumit
2015-11-01
Ent-labdane-related diterpene (ent-LRD) specialized (i.e. secondary) metabolites of the medicinal plant kalmegh (Andrographis paniculata) have long been known for several pharmacological activities. However, our understanding of the ent-LRD biosynthetic pathway has remained largely incomplete. Since ent-LRDs accumulate in leaves, we carried out a comparative transcriptional analysis using leaf and root tissues, and identified 389 differentially expressed transcripts, including 223 transcripts that were preferentially expressed in leaf tissue. Analysis of the transcripts revealed various specialized metabolic pathways, including transcripts of the ent-LRD biosynthetic pathway. Two class II diterpene synthases (ApCPS1 and ApCPS2) along with one (ApCPS1') and two (ApCPS2' and ApCPS2″) transcriptional variants that were the outcomes of alternative splicing of the precursor mRNA and alternative transcriptional termination, respectively, were identified. ApCPS1 and ApCPS2 encode for 832- and 817-amino acids proteins, respectively, and are phylogenetically related to the dicotyledons ent-copalyl diphosphate synthases (ent-CPSs). The spatio-temporal patterns of ent-LRD metabolites accumulation and gene expression suggested a likely role for ApCPS1 in general (i.e. primary) metabolism, perhaps by providing precursor for the biosynthesis of phytohormone gibberellin (GA). However, ApCPS2 is potentially involved in tissue-specific accumulation of ent-LRD specialized metabolites. Bacterially expressed recombinant ApCPS2 catalyzed the conversion of (E,E,E)-geranylgeranyl diphosphate (GGPP), the general precursor of diterpenes to ent-copalyl diphosphate (ent-CPP), the precursor of ent-LRDs. Taken together, these results advance our understanding of the tissue-specific accumulation of specialized ent-LRDs of medicinal importance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sailen Barik
2017-12-01
Full Text Available A significant number of proteins in all living species contains amino acid repeats (AARs of various lengths and compositions, many of which play important roles in protein structure and function. Here, I have surveyed select homopolymeric single [(An] and double [(ABn] AARs in the human proteome. A close examination of their codon pattern and analysis of RNA structure propensity led to the following set of empirical rules: (1 One class of amino acid repeats (Class I uses a mixture of synonymous codons, some of which approximate the codon bias ratio in the overall human proteome; (2 The second class (Class II disregards the codon bias ratio, and appears to have originated by simple repetition of the same codon (or just a few codons; and finally, (3 In all AARs (including Class I, Class II, and the in-betweens, the codons are chosen in a manner that precludes the formation of RNA secondary structure. It appears that the AAR genes have evolved by orchestrating a balance between codon usage and mRNA secondary structure. The insights gained here should provide a better understanding of AAR evolution and may assist in designing synthetic genes.
Barik, Sailen
2017-12-01
A significant number of proteins in all living species contains amino acid repeats (AARs) of various lengths and compositions, many of which play important roles in protein structure and function. Here, I have surveyed select homopolymeric single [(A)n] and double [(AB)n] AARs in the human proteome. A close examination of their codon pattern and analysis of RNA structure propensity led to the following set of empirical rules: (1) One class of amino acid repeats (Class I) uses a mixture of synonymous codons, some of which approximate the codon bias ratio in the overall human proteome; (2) The second class (Class II) disregards the codon bias ratio, and appears to have originated by simple repetition of the same codon (or just a few codons); and finally, (3) In all AARs (including Class I, Class II, and the in-betweens), the codons are chosen in a manner that precludes the formation of RNA secondary structure. It appears that the AAR genes have evolved by orchestrating a balance between codon usage and mRNA secondary structure. The insights gained here should provide a better understanding of AAR evolution and may assist in designing synthetic genes.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
DEFF Research Database (Denmark)
Xue, Z T; Larsen, K; Jochimsen, B U
1991-01-01
The effect of lowering oxygen concentration on the expression of nodulin genes in soybean callus tissue devoid of the microsymbiont has been examined. Poly(A)+ RNA was isolated from tissue cultivated in 4% oxygen and in normal atmosphere. Quantitative mRNA hybridization experiments using nodule...
Individual bile acids have differential effects on bile acid signaling in mice
International Nuclear Information System (INIS)
Song, Peizhen; Rockwell, Cheryl E.; Cui, Julia Yue; Klaassen, Curtis D.
2015-01-01
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In the liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Individual bile acids have differential effects on bile acid signaling in mice
Energy Technology Data Exchange (ETDEWEB)
Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu; Klaassen, Curtis D., E-mail: curtisklaassenphd@gmail.com
2015-02-15
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In the liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Adenovirus-mediated sphingomyelin synthase 2 increases atherosclerotic lesions in ApoE KO mice
Directory of Open Access Journals (Sweden)
Zhao Yarui
2011-01-01
Full Text Available Abstract Background Sphingomyelin synthase 2 (SMS2 contributes to de novo sphingomyelin (SM biosynthesis. Its activity is related to SM levels in the plasma and the cell membrane. In this study, we investigated the possibility of a direct relationship between SMS and atherosclerosis. Methods The Adenovirus containing SMS2 gene was given into 10-week ApoE KO C57BL/6J mice by femoral intravenous injection. In the control group, the Adenovirus containing GFP was given. To confirm this model, we took both mRNA level examination (RT-PCR and protein level examination (SMS activity assay. Result We generated recombinant adenovirus vectors containing either human SMS2 cDNA (AdV-SMS2 or GFP cDNA (AdV-GFP. On day six after intravenous infusion of 2 × 1011 particle numbers into ten-week-old apoE KO mice, AdV-SMS2 treatment significantly increased liver SMS2 mRNA levels and SMS activity (by 2.7-fold, 2.3-fold, p Conclusions Our results present direct morphological evidence for the pro-atherogenic capabilities of SMS2. SMS2 could be a potential target for treating atherosclerosis.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.
Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D
2018-03-01
Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.
Directory of Open Access Journals (Sweden)
Clarence T. Sasaki
2018-04-01
Full Text Available PURPOSE: Bile-containing gastroesophageal reflux may promote cancer at extraesophageal sites. Acidic bile can accelerate NF-κB activation and molecular events, linked to premalignant changes in murine hypopharyngeal mucosa (HM. We hypothesize that short-term in vivo topical application of NF-κB inhibitor BAY 11-7082 can prevent acidic bile–induced early preneoplastic molecular events, suggesting its potential role in disease prevention. EXPERIMENTAL DESIGN: We topically exposed HM (C57Bl/6j wild-type to a mixture of bile acids at pH 3.0 with and without BAY 11-7082 3 times/day for 7 days. We used immunofluorescence, Western blotting, immunohistochemistry, quantitative polymerase chain reaction, and polymerase chain reaction microarrays to identify NF-κB activation and its associated oncogenic mRNA and miRNA phenotypes, in murine hypopharyngeal cells in vitro and in murine HM in vivo. RESULTS: Short-term exposure of HM to acidic bile is a potent stimulus accelerating the expression of NF-κB signaling (70 out of 84 genes and oncogenic molecules. Topical application of BAY 11-7082 sufficiently blocks the effect of acidic bile. BAY 11-7082 eliminates NF-κB activation in regenerating basal cells of acidic bile–treated HM and prevents overexpression of molecules central to head and neck cancer, including bcl-2, STAT3, EGFR, TNF-α, and WNT5A. NF-κB inhibitor reverses the upregulated “oncomirs” miR-155 and miR-192 and the downregulated “tumor suppressors” miR-451a and miR-375 phenotypes in HM affected by acidic bile. CONCLUSION: There is novel evidence that acidic bile–induced NF-κB–related oncogenic mRNA and miRNA phenotypes are generated after short-term 7-day mucosal exposure and that topical mucosal application of BAY 11-7082 can prevent the acidic bile–induced molecular alterations associated with unregulated cell growth and proliferation of hypopharyngeal cells.
Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens
Directory of Open Access Journals (Sweden)
Mahiran Basri
2012-08-01
Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V
2004-01-30
C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
International Nuclear Information System (INIS)
Stevens, A.
1982-01-01
Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T
2016-03-01
Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.
Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai
2013-04-01
An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.
Elk-3 is a transcriptional repressor of nitric-oxide synthase 2.
Chen, Yen-Hsu; Layne, Matthew D; Chung, Su Wol; Ejima, Kuniaki; Baron, Rebecca M; Yet, Shaw-Fang; Perrella, Mark A
2003-10-10
The inducible isoform of nitric-oxide synthase (NOS2), a key enzyme catalyzing the dramatic increase in nitric oxide by lipopolysaccharide (LPS), plays an important role in the pathophysiology of endotoxemia and sepsis. Recent evidence suggests that Ets transcription factors may contribute to NOS2 induction by inflammatory stimuli. In this study, we investigated the role of Ets transcription factors in the regulation of NOS2 by LPS and transforming growth factor (TGF)-beta 1. Transient transfection assays in macrophages showed that Ets-2 produced an increase in NOS2 promoter activity, whereas the induction by Ets-1 was modest and NERF2 had no effect. Elk-3 (Net/Erp/Sap-2a) markedly repressed NOS2 promoter activity in a dose-dependent fashion, and overexpression of Elk-3 blunted the induction of endogenous NOS2 message. Mutation of the Net inhibitory domain of Elk-3, but not the C-terminal-binding protein interaction domain, partially alleviated this repressive effect. We also found that deletion of the Ets domain of Elk-3 completely abolished its repressive effect on the NOS2 promoter. LPS administration to macrophages led to a dose-dependent decrease in endogenous Elk-3 mRNA levels, and this decrease in Elk-3 preceded the induction of NOS2 mRNA. In a mouse model of endotoxemia, the expression of Elk-3 in kidney, lung, and heart was significantly down-regulated after systemic administration of LPS, and this down-regulation also preceded NOS2 induction. Moreover, TGF-beta 1 significantly increased endogenous Elk-3 mRNA levels that had been down-regulated by LPS in macrophages. This increase in Elk-3 correlated with a TGF-beta 1-induced down-regulation of NOS2. Taken together, our data suggest that Elk-3 is a strong repressor of NOS2 promoter activity and mRNA levels and that endogenous expression of Elk-3 inversely correlates with NOS2. Thus, Elk-3 may serve as an important mediator of NOS2 gene expression.
Nerve growth factor mRNA in brain: localization by in situ hybridization
International Nuclear Information System (INIS)
Rennert, P.D.; Heinrich, G.
1986-01-01
Nerve Growth Factor is a 118 amino acid polypeptide that plays an important role in the differentiation and survival of neurons. The recent discovery that a mRNA that encodes beta Nerve Growth Factor is present in brain suggests that the Nerve Growth Factor gene may not only regulate gene expression of peripheral but also of central neurons. To identify the site(s) of Nerve Growth Factor mRNA production in the brain and to determine which cells express the Nerve Growth Factor gene, the technique of in situ hybridization was employed. A 32P-labeled RNA probe complementary to Nerve Growth Factor mRNA hybridized to cells in the stratum granulosum of the dentate gyrus and the stratum pyramidale of the hippocampus. These observations identify for the first time cellular sites of Nerve Growth Factor gene expression in the central nervous system, and suggest that Nerve Growth Factor mRNA is produced by neurons
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
Jin, Li; Piao, Zhe Hao; Liu, Chun Ping; Sun, Simei; Liu, Bin; Kim, Gwi Ran; Choi, Sin Young; Ryu, Yuhee; Kee, Hae Jin; Jeong, Myung Ho
2018-03-01
Hypertension causes cardiac hypertrophy and leads to heart failure. Apoptotic cells are common in hypertensive hearts. Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) is associated with apoptosis. We recently demonstrated that gallic acid reduces nitric oxide synthase inhibition-induced hypertension. Gallic acid is a trihydroxybenzoic acid and has been shown to have beneficial effects, such as anti-cancer, anti-calcification and anti-oxidant activity. The purpose of this study was to determine whether gallic acid regulates cardiac hypertrophy and apoptosis in essential hypertension. Gallic acid significantly lowered systolic and diastolic blood pressure in spontaneously hypertensive rats (SHRs). Wheat germ agglutinin (WGA) and H&E staining revealed that gallic acid reduced cardiac enlargement in SHRs. Gallic acid treatment decreased cardiac hypertrophy marker genes, including atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP), in SHRs. The four isoforms, α, β, δ and γ, of CaMKII were increased in SHRs and were significantly reduced by gallic acid administration. Gallic acid reduced cleaved caspase-3 protein as well as bax, p53 and p300 mRNA levels in SHRs. CaMKII δ overexpression induced bax and p53 expression, which was attenuated by gallic acid treatment in H9c2 cells. Gallic acid treatment reduced DNA fragmentation and the TUNEL positive cells induced by angiotensin II. Taken together, gallic acid could be a novel therapeutic for the treatment of hypertension through suppression of CaMKII δ-induced apoptosis. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Directory of Open Access Journals (Sweden)
Amro Abd al fattah Amara
2012-04-01
Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Uehara, Maiko; Tabata, Eri; Ishii, Kazuhiro; Sawa, Akira; Ohno, Misa; Sakaguchi, Masayoshi; Matoska, Vaclav; Bauer, Peter O; Oyama, Fumitaka
2018-05-09
Mice and humans express two active chitinases: acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Both chitinases are thought to play important roles in specific pathophysiological conditions. The crab-eating monkey ( Macaca fascicularis ) is one of the most frequently used nonhuman primate models in basic and applied biomedical research. Here, we performed gene expression analysis of two chitinases in normal crab-eating monkey tissues by way of quantitative real-time polymerase chain reaction (qPCR) using a single standard DNA molecule. Levels of AMCase and CHIT1 messenger RNAs (mRNAs) were highest in the stomach and the lung, respectively, when compared to other tissues. Comparative gene expression analysis of mouse, monkey, and human using monkey⁻mouse⁻human hybrid standard DNA showed that the AMCase mRNA levels were exceptionally high in mouse and monkey stomachs while very low in the human stomach. As for the CHIT1 mRNA, we detected higher levels in the monkey lung when compared with those of mouse and human. The differences of mRNA expression between the species in the stomach tissues were basically reflecting the levels of the chitinolytic activities. These results indicate that gene expression of AMCase and CHIT1 differs between mammalian species and requiring special attention in handling data in chitinase-related studies in particular organisms.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming
2012-01-01
Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808
Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase
International Nuclear Information System (INIS)
Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.
1990-01-01
The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...
Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries
Directory of Open Access Journals (Sweden)
Daniela Toro-Ascuy
2016-11-01
Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.
Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina
2010-06-01
In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Discovery of Proteomic Code with mRNA Assisted Protein Folding
Directory of Open Access Journals (Sweden)
Jan C. Biro
2008-12-01
Full Text Available The 3x redundancy of the Genetic Code is usually explained as a necessity to increase the mutation-resistance of the genetic information. However recent bioinformatical observations indicate that the redundant Genetic Code contains more biological information than previously known and which is additional to the 64/20 definition of amino acids. It might define the physico-chemical and structural properties of amino acids, the codon boundaries, the amino acid co-locations (interactions in the coded proteins and the free folding energy of mRNAs. This additional information, which seems to be necessary to determine the 3D structure of coding nucleic acids as well as the coded proteins, is known as the Proteomic Code and mRNA Assisted Protein Folding.
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Carglumic acid: a second look. Confirmed progress in a rare urea cycle disorder.
2008-04-01
(1) N-acetylglutamate synthase deficiency is a rare congenital disorder that causes hyperammonaemic comas, resulting in severe neurological morbidity and usually leading to death during childhood. (2) Carglumic acid is the first drug to be used for replacement therapy. Data available in 2003 showed beneficial effects on growth and psychomotor development. (3) In 2007, about 20 patients treated with carglumic acid for N-acetyglutamate synthase deficiency, for at least 5 years in half of cases, were all still alive. Their development was normal when treatment was initiated before complications occurred. (4) No serious adverse effects have been observed. (5) In practice, although this treatment has to continue for life, carglumic acid represents a major advance for patients with N-acetylglutamate synthase deficiency.
Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M
2017-07-11
Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced
Energy Technology Data Exchange (ETDEWEB)
Liu Yong; Wang Jianshe; Wei Yanhong; Zhang Hongxia; Liu Yang [Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Beijing 100101 (China); Dai Jiayin [Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Beijing 100101 (China)], E-mail: daijy@ioz.ac.cn
2008-07-07
Perfluorooctanoic acid (PFOA), a potentially toxic perfluorinated compound (PFC), has been widely disseminated in the environment. In the present study, rare minnows (Gobiocypris rarus) exposed to PFOA exhibited histopathological gill damage, including epithelial hyperplasia of the lamellae, inflammatory cell infiltration, and lamellar fusion. Cytochrome P450s (CYPs) play a central role in the metabolism and biotransformation of a wide range of endogenous substrates and foreign compounds. Thus, we studied the CYPs and the effects of waterborne PFOA on their corresponding mRNA levels in the gills of rare minnows. Two novel CYP cDNAs (CYP1A and CYP3A) were identified in rare minnow and their mRNAs were ubiquitously expressed in all tissues examined. Upregulation of CYP3A mRNA was observed in the gills of male rare minnows exposed to 30 mg/L PFOA, while no significant changes occurred in exposed females. In contrast, down regulation of CYP1A mRNA was detected in the gills of male and female minnows exposed to PFOA. However, the effect of PFOA on gill mRNA levels of their potential regulators, aryl hydrocarbon receptor (AhR) for CYP1A, and pregnane X receptor (PXR) for CYP3A, were not consistent with the observed effects of PFOA on the corresponding CYP mRNA concentrations. This suggests a different or more complex transcriptional regulation of CYP expression following PFOA exposure.
Richert, Lysiane; Lamboley, Christelle; Viollon-Abadie, Catherine; Grass, Peter; Hartmann, Nicole; Laurent, Stephane; Heyd, Bruno; Mantion, Georges; Chibout, Salah-Dine; Staedtler, Frank
2003-09-01
The mRNA expression profile in control and clofibric acid (CLO)-treated mouse, rat, and human hepatocytes was analyzed using species-specific oligonucleotide DNA microarrays (Affymetrix). A statistical empirical Bayes procedure was applied in order to select the significantly differentially expressed genes. Treatment with the peroxisome proliferator CLO induced up-regulation of genes involved in peroxisome proliferation and in cell proliferation as well as down-regulation of genes involved in apoptosis in hepatocytes of rodent but not of human origin. CLO treatment induced up-regulation of microsomal cytochrome P450 4a genes in rodent hepatocytes and in two of six human hepatocyte cultures. In addition, genes encoding phenobarbital-inducible cytochrome P450s were also up-regulated by CLO in rodent and human hepatocyte cultures. Up-regulation of phenobarbital-inducible UDP-glucuronosyl-transferase genes by CLO was observed in both rat and human but not in mouse hepatocytes. CLO treatment induced up-regulation of L-fatty acid binding protein (L-FABP) gene in hepatocytes of both rodent and human origin. However, while genes of the cytosolic, microsomal, and mitochondrial pathways involved in fatty acid transport and metabolism were up-regulated by CLO in both rodent and human hepatocyte cultures, genes of the peroxisomal pathway of lipid metabolism were up-regulated in rodents only. An up-regulation of hepatocyte nuclear factor 1alpha (HNF1alpha) by CLO was observed only in human hepatocyte cultures, suggesting that this trans-activating factor may play a key role in the regulation of fatty acid metabolism in human liver as well as in the nonresponsiveness of human liver to CLO-induced regulation of cell proliferation and apoptosis.
International Nuclear Information System (INIS)
Richert, Lysiane; Lamboley, Christelle; Viollon-Abadie, Catherine; Grass, Peter; Hartmann, Nicole; Laurent, Stephane; Heyd, Bruno; Mantion, Georges; Chibout, Salah-Dine; Staedtler, Frank
2003-01-01
The mRNA expression profile in control and clofibric acid (CLO)-treated mouse, rat, and human hepatocytes was analyzed using species-specific oligonucleotide DNA microarrays (Affymetrix). A statistical empirical Bayes procedure was applied in order to select the significantly differentially expressed genes. Treatment with the peroxisome proliferator CLO induced up-regulation of genes involved in peroxisome proliferation and in cell proliferation as well as down-regulation of genes involved in apoptosis in hepatocytes of rodent but not of human origin. CLO treatment induced up-regulation of microsomal cytochrome P450 4a genes in rodent hepatocytes and in two of six human hepatocyte cultures. In addition, genes encoding phenobarbital-inducible cytochrome P450s were also up-regulated by CLO in rodent and human hepatocyte cultures. Up-regulation of phenobarbital-inducible UDP-glucuronosyl-transferase genes by CLO was observed in both rat and human but not in mouse hepatocytes. CLO treatment induced up-regulation of L-fatty acid binding protein (L-FABP) gene in hepatocytes of both rodent and human origin. However, while genes of the cytosolic, microsomal, and mitochondrial pathways involved in fatty acid transport and metabolism were up-regulated by CLO in both rodent and human hepatocyte cultures, genes of the peroxisomal pathway of lipid metabolism were up-regulated in rodents only. An up-regulation of hepatocyte nuclear factor 1α (HNF1α) by CLO was observed only in human hepatocyte cultures, suggesting that this trans-activating factor may play a key role in the regulation of fatty acid metabolism in human liver as well as in the nonresponsiveness of human liver to CLO-induced regulation of cell proliferation and apoptosis
Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin
Lechner, Matthias; Lirk, Philipp; Rieder, Josef
2005-01-01
Inducible nitric oxide synthase (iNOS) is one of three key enzymes generating nitric oxide (NO) from the amino acid l-arginine. iNOS-derived NO plays an important role in numerous physiological (e.g. blood pressure regulation, wound repair and host defence mechanisms) and pathophysiological
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
International Nuclear Information System (INIS)
Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso
2012-01-01
This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme
Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture
DEFF Research Database (Denmark)
Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic
2005-01-01
RNA and protein could be detected. The data suggest that iNOS expression may be a molecular mechanism mediating the adaptive response of trigeminal ganglia cells to the serum free stressful stimulus the culture environment provides. It may act as a cellular signalling molecule that is expressed after cell......Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular......, reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. In trigeminal ganglia cells not subjected to culture, endothelial (e) and neuronal (n) but not inducible (i) NOS mRNA and protein were detected. Culture of rat neurones resulted in a rapid axonal outgrowth of NOS positive...
Ji, Yingbin; Liu, Jian; Xing, Da
2016-09-01
In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
International Nuclear Information System (INIS)
Higuchi, K.; Hospattankar, A.V.; Law, S.W.; Meglin, N.; Cortright, J.; Brewer, H.B. Jr.
1988-01-01
Human apolipoprotein B (apoB) is present in plasma as two separate isoproteins, designated apoB-100 (512 kDa) and apoB-48 (250 kDa). ApoB is encoded by a single gene on chromosome 2, and a single nuclear mRNA is edited and processed into two separate apoB mRNAs. A 14.1-kilobase apoB mRNA codes for apoB-100, and the second mRNA, which codes for apoB-48, contains a premature stop codon generated by a single base substitution of cytosine to uracil at nucleotide 6,538, which converts the translated CAA codon coding for the amino acid glutamine at residue 2,153 in apoB-100 to a premature in-frame stop codon (UAA). Two 30-base synthetic oligonucleotides, designated apoB-Stop and apoB-Gln, were synthesized containing the complementary sequence to the stop codon (UAA) and glutamine codon (CAA), respectively. The combined results from these studies establish that both human intestine and liver contain the two distinct apoB mRNAs, an mRNA that codes for apoB-100 and an apoB mRNA that contains the premature stop codon, which codes for apoB-48. The premature in-frame stop codon is not tissue specific and is present in both human liver and intestine
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Eungwanichayapant, P D; Popluechai, S
2009-02-01
Catechins are a group of polyphenols found in tea (Camellia sinensis var. sinensis) at high levels. They are beneficial for health. From the study on accumulation of catechins in shoots and mature leaves of a tea cultivar, Oolong No. 17, using high-performance liquid chromatography (HPLC), it was found that the amounts of most catechins in the shoots were higher than those in the mature leaves, with an exception of catechins gallate (CG) that was found in trace amounts in both the shoots and mature leaves. mRNA accumulation of genes involved in catechin synthesis was studied using reverse transcriptase-polymerase chain reaction (RT-PCR). The results showed that the mRNA accumulation of the genes were higher in the shoots than in the mature leaves. These genes included genes of phenylalanine ammonia-lyase 1 (PAL1; EC 4.3.1.5), chalcone synthase (CHS; EC 2.3.1.74), dihydroflavonol 4-reductase (DFR; EC 1.1.1.219), leucoanthocyanidin reductase (LCR; EC 1.17.1.3), and flavanone 3-hydroxylase (F3H; EC 1.14.11.9).
The effects of valproic acid on the mRNA expression of Natriuretic ...
African Journals Online (AJOL)
Mona Hajikazemi
2017-04-28
Apr 28, 2017 ... Real Time RT-PCR was used to quantify differential mRNA expression of NPR-A and KCNQ1 genes. Two-way ANOVA and bonferroni post-tests were used to analyze data statistically. Results: We showed that VPA treatment inhibits the growth of SW-480 cells more efficiently compared to. HT-29. NPR-A ...
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul
2015-05-15
Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo
2014-09-01
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
The crystal structure of human GDP-L-fucose synthase.
Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua
2013-09-01
Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.
Co-ordinate activation of lipogenic enzymes in hepatocellular carcinoma.
Yahagi, Naoya; Shimano, Hitoshi; Hasegawa, Kiyoshi; Ohashi, Kenichi; Matsuzaka, Takashi; Najima, Yuho; Sekiya, Motohiro; Tomita, Sachiko; Okazaki, Hiroaki; Tamura, Yoshiaki; Iizuka, Yoko; Ohashi, Ken; Nagai, Ryozo; Ishibashi, Shun; Kadowaki, Takashi; Makuuchi, Masatoshi; Ohnishi, Shin; Osuga, Jun-ichi; Yamada, Nobuhiro
2005-06-01
Hepatocellular carcinoma is a very common neoplastic disease in countries where hepatitis viruses B and/or C are prevalent. Small hepatocellular carcinoma lesions detected by ultrasonography at an early stage are often hyperechoic because they are composed of well-differentiated cancer cells that are rich in triglyceride droplets. The triglyceride content of hepatocytes depends in part on the rate of lipogenesis. Key lipogenic enzymes, such as fatty acid synthase, are co-ordinately regulated at the transcriptional level. We therefore examined the mRNA expression of lipogenic enzymes in human hepatocellular carcinoma samples from 10 patients who had undergone surgical resection. All of the samples exhibited marked elevation of expression of mRNA for lipogenic enzymes, such as fatty acid synthase, acetyl-CoA carboxylase and ATP citrate lyase, compared with surrounding non-cancerous liver tissue. In contrast, the changes in mRNA expression of SREBP-1, a transcription factor that regulates a battery of lipogenic enzymes, did not show a consistent trend. In some cases where SREBP-1 was elevated, the main contributing isoform was SREBP-1c rather than SREBP-1a. Thus, lipogenic enzymes are markedly induced in hepatocellular carcinomas, and in some cases SREBP-1c is involved in this activation.
International Nuclear Information System (INIS)
Bengtsson, Astrid M; Jönsson, Gunilla; Magnusson, Cecilia; Salim, Tavga; Axelsson, Cecilia; Sjölander, Anita
2013-01-01
Cysteinyl leukotrienes (CysLTs) are potent pro-inflammatory mediators that are increased in samples from patients with inflammatory bowel diseases (IBDs). Individuals with IBDs have enhanced susceptibility to colon carcinogenesis. In colorectal cancer, the balance between the pro-mitogenic cysteinyl leukotriene 1 receptor (CysLT 1 R) and the differentiation-promoting cysteinyl leukotriene 2 receptor (CysLT 2 R) is lost. Further, our previous data indicate that patients with high CysLT 1 R and low CysLT 2 R expression have a poor prognosis. In this study, we examined whether the balance between CysLT 1 R and CysLT 2 R could be restored by treatment with the cancer chemopreventive agent all-trans retinoic acid (ATRA). To determine the effect of ATRA on CysLT 2 R promoter activation, mRNA level, and protein level, we performed luciferase gene reporter assays, real-time polymerase chain reactions, and Western blots in colon cancer cell lines under various conditions. ATRA treatment induces CysLT 2 R mRNA and protein expression without affecting CysLT 1 R levels. Experiments using siRNA and mutant cell lines indicate that the up-regulation is retinoic acid receptor (RAR) dependent. Interestingly, ATRA also up-regulates mRNA expression of leukotriene C 4 synthase, the enzyme responsible for the production of the ligand for CysLT 2 R. Importantly, ATRA-induced differentiation of colorectal cancer cells as shown by increased expression of MUC-2 and production of alkaline phosphatase, both of which could be reduced by a CysLT 2 R-specific inhibitor. This study identifies a novel mechanism of action for ATRA in colorectal cancer cell differentiation and demonstrates that retinoids can have anti-tumorigenic effects through their action on the cysteinyl leukotriene pathway
Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme
Directory of Open Access Journals (Sweden)
Alberto Macone
2010-03-01
Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.
Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.
Directory of Open Access Journals (Sweden)
Anke Wittmann
Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.
International Nuclear Information System (INIS)
Morales, Ana I.; Vicente-Sanchez, Cesar; Jerkic, Mirjana; Santiago, Jose M.; Sanchez-Gonzalez, Penelope D.; Perez-Barriocanal, Fernando; Lopez-Novoa, Jose M.
2006-01-01
Inflammation can play a key role in Cd-induced dysfunctions. Quercetin is a potent oxygen free radical scavenger and a metal chelator. Our aim was to study the effect of quercetin on Cd-induced kidney damage and metallothionein expression. The study was performed in Wistar rats that were administered during 9 weeks with either cadmium (1.2 mg Cd/kg/day, s.c.), quercetin (50 mg/kg/day, i.p.) or cadmium + quercetin. Renal toxicity was evaluated by measuring blood urea nitrogen concentration and urinary excretion of enzymes marker of tubular damage. Endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) renal expression were assessed by Western blot. Renal expression of metallothionein 1 and 2 (MT-1, MT-2) and eNOS mRNA was assessed by Northern blot. Our data demonstrated that Cd-induced renal toxicity was markedly reduced in rats that also received quercetin. MT-1 and MT-2 mRNA levels in kidney were substantially increased during treatment with Cd, being even higher when the animals received Cd and quercetin. Renal eNOS expression was significantly higher in rats receiving Cd and quercetin than in animals receiving Cd alone or in control rats. In the group that received Cd, COX-2 and iNOS expression was markedly higher than in control rats. In the group Cd + quercetin, no changes in COX-2 and iNOS expression were observed compared with the control group. Our results demonstrate that quercetin treatment prevents Cd-induced overexpression of iNOS and COX-2, and increases MT expression. These effects can explain the protection by quercetin of Cd-induced nephrotoxicity
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines
International Nuclear Information System (INIS)
Toki, Yasumichi; Sasaki, Katsunori; Tanaka, Hiroki; Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro; Torimoto, Yoshihiro; Ohtake, Takaaki; Kohgo, Yutaka
2016-01-01
Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.
A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines
Energy Technology Data Exchange (ETDEWEB)
Toki, Yasumichi [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Sasaki, Katsunori, E-mail: k-sasaki@asahikawa-med.ac.jp [Department of Gastrointestinal Immunology and Regenerative Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Tanaka, Hiroki [Department of Legal Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Torimoto, Yoshihiro [Oncology Center, Asahikawa Medical University Hospital, Hokkaido 078-8510 (Japan); Ohtake, Takaaki; Kohgo, Yutaka [Department of Gastroenterology, International University of Health and Welfare Hospital, Tochigi 329-2763 (Japan)
2016-08-05
Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Suppression of FAT/CD36 mRNA by human growth hormone in pancreatic β-cells
DEFF Research Database (Denmark)
Dalgaard, Louise Torp; Thams, Peter Grevsen; Gaarn, Louise Winkel
2011-01-01
of this study was to examine the effect of human growth hormone (hGH) on mRNAs of fatty acid transport and binding proteins expressed in pancreatic β-cells, and to examine this in relation to β-cell survival after exposure to fatty acids. hGH decreased mRNA levels of FAT/CD36, whereas mRNAs of GPR40, FASN, FABP...
Suppression of FAT/CD36 mRNA by human growth hormone in pancreatic ß-cells
DEFF Research Database (Denmark)
Dalgaard, Louise Torp; Thams, Peter Grevsen; Gaarn, Louise Winkel
2011-01-01
of this study was to examine the effect of human growth hormone (hGH) on mRNAs of fatty acid transport and binding proteins expressed in pancreatic ß-cells, and to examine this in relation to ß-cell survival after exposure to fatty acids. hGH decreased mRNA levels of FAT/CD36, whereas mRNAs of GPR40, FASN, FABP...
Energy Technology Data Exchange (ETDEWEB)
Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)
2015-08-07
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.
International Nuclear Information System (INIS)
Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin
2015-01-01
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression
Bodero, Marcia; Hoogenboom, Ron L A P; Bovee, Toine F H; Portier, Liza; de Haan, Laura; Peijnenburg, Ad; Hendriksen, Peter J M
2018-02-01
A study with DNA microarrays was performed to investigate the effects of two diarrhetic and one azaspiracid shellfish poison, okadaic acid (OA), dinophysistoxin-1 (DTX-1) and azaspiracid-1 (AZA-1) respectively, on the whole-genome mRNA expression of undifferentiated intestinal Caco-2 cells. Previously, the most responding genes were used to develop a dedicated array tube test to screen shellfish samples on the presence of these toxins. In the present study the whole genome mRNA expression was analyzed in order to reveal modes of action and obtain hints on potential biomarkers suitable to be used in alternative bioassays. Effects on key genes in the most affected pathways and processes were confirmed by qPCR. OA and DTX-1 induced almost identical effects on mRNA expression, which strongly indicates that OA and DTX-1induce similar toxic effects. Biological interpretation of the microarray data indicates that both compounds induce hypoxia related pathways/processes, the unfolded protein response (UPR) and endoplasmic reticulum (ER) stress. The gene expression profile of AZA-1 is different and shows increased mRNA expression of genes involved in cholesterol synthesis and glycolysis, suggesting a different mode of action for this toxin. Future studies should reveal whether identified pathways provide suitable biomarkers for rapid detection of DSPs in shellfish. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
International Nuclear Information System (INIS)
Tanaka, R.D.; Clarke, C.F.; Fogelman, A.M.; Edwards, P.A.
1986-01-01
Differential hybridization has been used to identify genes in rat liver that encode transcripts which are increased by the drugs cholestyramine and mevinolin and are decreased by dietary cholesterol. This approach should prove useful in isolating and identifying coordinately regulated genes involved in the isoprene biosynthetic pathway. Rat liver poly (A) + RNA was isolated from animals fed diets supplemented with either cholestyramine and mevinolin or with cholesterol. Radiolabeled cDNAs generated from these two RNA preparations were used to screen a rat cDNAs library. A preliminary screen of 10,000 recombinants has led to the identification of a clone with an insert of 1200 bp that hybridizes to a mRNA species of about 1200 nt. The level of this RNA species in rat liver is elevated by the drugs cholestyramine and mevinolin and is decreased by cholesterol feeding. This RNA species is also decreased by mevalonate administration to rats. The regulation of this 1200 nt mRNA species mirrors that of HMG CoA reductase and HMG CoA synthase. It seems very likely that this 1200 nt mRNA encodes a polypeptide which is involved in the isoprene biosynthetic pathway
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
International Nuclear Information System (INIS)
Gotanda, Keisuke; Hirota, Takeshi; Matsumoto, Nozomi; Ieiri, Ichiro
2013-01-01
Thymidylate synthase (TYMS) is an important folate-dependent enzyme in DNA synthesis and an important target for cancer chemotherapy. High TYMS expression levels in tumors are generally associated with resistance to 5-fluorouracil (5-FU). The cause of the variability in TYMS expression is still not fully understood, however, only a small proportion of the TYMS expression can be explained by TYMS genetic polymorphisms. The purpose of this study is to identify novel microRNAs (miRNAs) which regulate the expression of TYMS and to determine whether miRNAs binding to the 3′-untranslated region (UTR) of TYMS mRNA affect the proliferation of HeLa cells treated with 5-FU. An in silico search was performed to find potential binding sites of miRNAs in TYMS mRNA. The efficacy of predicted miRNAs at the 3′-UTR of TYMS mRNA was evaluated using a dual-luciferase reporter assay. TYMS mRNA and protein expression in HeLa cells was quantified with real-time RT-PCR and Western blotting, respectively. The effects of miR-433 on cell proliferative activity were determined by WST-8 assay. The overexpression of miR-433 was associated with significantly decreased reporter activity in the plasmid containing the 3′-UTR of TYMS mRNA (P < 0.01). The levels of TYMS mRNA and protein in HeLa cells were significantly decreased by the overexpression of miR-433 (P < 0.05). Furthermore, miR-433 increased inhibition of cell proliferation in HeLa cells treated with 5-FU at over 2.0 μM. The results indicate that miR-433 post-transcriptionally regulates the expression of TYMS mRNA and protein, and increases sensitivity to 5-FU in HeLa cells. This is the first report showing that a miRNA regulating TYMS expression has a significant impact on sensitivity to 5-FU treatment
Glutamic acid as anticancer agent: An overview
Dutta, Satyajit; Ray, Supratim; Nagarajan, K.
2013-01-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...
Impact of gastro-esophageal reflux on mucin mRNA expression in the esophageal mucosa.
van Roon, Aafke H C; Mayne, George C; Wijnhoven, Bas P L; Watson, David I; Leong, Mary P; Neijman, Gabriëlle E; Michael, Michael Z; McKay, Andrew R; Astill, David; Hussey, Damian J
2008-08-01
Changes in the expression of mucin genes in the esophageal mucosa associated with uncomplicated gastro-esophageal reflux disease have not been evaluated even though such changes could be associated with reflux-induced mucosal damage. We therefore sought to identify reflux-induced changes in mucin gene expression using a cell line and biopsies from the esophageal mucosa in patients with and without reflux. MUC-1, MUC-3, MUC-4, and MUC-5AC gene expressions were investigated in the HET-1A cell line following exposure to acid (pH 4) and/or bile (120 muM of a bile salt milieu), and in esophageal mucosal biopsies from controls, subjects with non-erosive gastro-esophageal reflux, and subjects with reflux associated with ulcerative esophagitis (erosive). The mucosal biopsies were also evaluated for IL-6 mRNA expression (inflammatory marker) and CK-14 mRNA expression (mucosal basal cell layer marker). Gene expression was determined using real-time reverse transcriptase-polymerase chain reaction analysis. In the cell line studies, there were differences in mRNA levels for all of the evaluated mucins following treatment with either acid or the acid and bile combination. In the studies which evaluated tissue specimens, IL-6 and CK-14 mRNA levels increased according to degree of reflux pathology. The expression of MUC-1 and MUC-4 in mucosa from patients with erosive reflux was lower than in subjects without reflux and in patients with non-erosive reflux, whereas the expression of MUC-3 and MUC-5AC was increased (although these differences did not reach significance at p reflux groups. The correlation between IL-6 and MUC-3 was significant within the control and erosive reflux groups, and the correlation between MUC-1 and MUC-5AC was significant within the erosive reflux group. The results of this study suggest that the profile of mucin expression in the esophageal mucosa is influenced by the pH and composition of the gastro-esophageal reflux. Further work should explore the
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
International Nuclear Information System (INIS)
Nishida, Yoshihiro; Knudson, Warren; Knudson, Cheryl B.; Ishiguro, Naoki
2005-01-01
Osteosarcoma is a common malignant bone tumor associated with childhood and adolescence. The results of numerous studies have suggested that hyaluronan plays an important role in regulating the aggressive behavior of various types of cancer cells. However, no studies have addressed hyaluronan with respect to osteosarcomas. In this investigation, the mRNA expression copy number of three mammalian hyaluronan synthases (HAS) was determined using competitive RT-PCR in the osteoblastic osteosarcoma cell line, MG-63. MG-63 are highly malignant osteosarcoma cells with an abundant hyaluronan-rich matrix. The results demonstrated that HAS-2 is the predominant HAS in MG-63. Accumulation of intracellular hyaluronan increased in association with the proliferative phase of these cells. The selective inhibition of HAS-2 mRNA in MG-63 cells by antisense phosphorothioate oligonucleotides resulted in reduced hyaluronan accumulation by these cells. As expected, the reduction in hyaluronan disrupted the assembly of cell-associated matrices. However, of most interest, coincident with the reduction in hyaluronan, there was a substantial decrease in cell proliferation, a decrease in cell motility and a decrease in cell invasiveness. These data suggest that hyaluronan synthesized by HAS-2 in MG-63 plays a crucial role in osteosarcoma cell proliferation, motility, and invasion
Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge
2008-08-01
To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Larsen, F S
1993-01-01
In patients with non-insulin-dependent diabetes mellitus (NIDDM) and matched control subjects we examined the interrelationships between in vivo nonoxidative glucose metabolism and glucose oxidation and the muscle activities, as well as the immunoreactive protein and mRNA levels of the rate-limit...
mRNA Cancer Vaccines-Messages that Prevail.
Grunwitz, Christian; Kranz, Lena M
2017-01-01
During the last decade, mRNA became increasingly recognized as a versatile tool for the development of new innovative therapeutics. Especially for vaccine development, mRNA is of outstanding interest and numerous clinical trials have been initiated. Strikingly, all of these studies have proven that large-scale GMP production of mRNA is feasible and concordantly report a favorable safety profile of mRNA vaccines. Induction of T-cell immunity is a multi-faceted process comprising antigen acquisition, antigen processing and presentation, as well as immune stimulation. The effectiveness of mRNA vaccines is critically dependent on making the antigen(s) of interest available to professional antigen-presenting cells, especially DCs. Efficient delivery of mRNA into DCs in vivo remains a major challenge in the mRNA vaccine field. This review summarizes the principles of mRNA vaccines and highlights the importance of in vivo mRNA delivery and recent advances in harnessing their therapeutic potential.
Principles of mRNA transport in yeast.
Heym, Roland Gerhard; Niessing, Dierk
2012-06-01
mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.
International Nuclear Information System (INIS)
Nykopp, Timo K; Rilla, Kirsi; Tammi, Markku I; Tammi, Raija H; Sironen, Reijo; Hämäläinen, Kirsi; Kosma, Veli-Matti; Heinonen, Seppo; Anttila, Maarit
2010-01-01
Hyaluronan accumulation correlates with the degree of malignancy in many solid tumor types, including malignant endometrial carcinomas. To elucidate the mechanism of hyaluronan accumulation, we examined the expression levels of the hyaluronan synthases (HAS1, HAS2 and HAS3) and hyaluronidases (HYAL1 and HYAL2), and correlated them with hyaluronan content and HAS1-3 immunoreactivity. A total of 35 endometrial tissue biopsies from 35 patients, including proliferative and secretory endometrium (n = 10), post-menopausal proliferative endometrium (n = 5), complex atypical hyperplasia (n = 4), grade 1 (n = 8) and grade 2 + 3 (n = 8) endometrioid adenocarcinomas were divided for gene expression by real-time RT-PCR, and paraffin embedded blocks for hyaluronan and HAS1-3 cytochemistry. The mRNA levels of HAS1-3 were not consistently changed, while the immunoreactivity of all HAS proteins was increased in the cancer epithelium. Interestingly, HAS3 mRNA, but not HAS3 immunoreactivity, was increased in post-menopausal endometrium compared to normal endometrium (p = 0.003). The median of HYAL1 mRNA was 10-fold and 15-fold lower in both grade 1 and grade 2+3 endometrioid endometrial cancers, as compared to normal endometrium (p = 0.004-0.006), and post-menopausal endometrium (p = 0.002), respectively. HYAL2 mRNA was also reduced in cancer (p = 0.02) and correlated with HYAL1 (r = 0.8, p = 0.0001). There was an inverse correlation between HYAL1 mRNA and the epithelial hyaluronan staining intensity (r = -0.6; P = 0.001). The results indicated that HYAL1 and HYAL2 were coexpressed and significantly downregulated in endometrioid endometrial cancer and correlated with the accumulation of hyaluronan. While immunoreactivity for HASs increased in the cancer cells, tumor mRNA levels for HASs were not changed, suggesting that reduced turnover of HAS protein may also have contributed to the accumulation of hyaluronan
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
DEFF Research Database (Denmark)
Krakauer, M.; Sorensen, P.; Khademi, M.
2008-01-01
volunteers served to confirm initial findings. mRNA was analyzed by real-time reverse transcriptase polymerase chain reaction (PCR). RESULTS: We found elevated expression of interleukin (IL)-23 and IL-10 in untreated MS patients. IFN-beta therapy increased IL-10 and decreased IL-23 expression independently...... of the regulatory cytokine IL-10. The elevated IL-23 mRNA levels in MS patients are noteworthy in view of the newly discovered IL-23-driven Th17 T-cell subset, which is crucial in animal models of MS. Since IFN-beta therapy resulted in decreased IL-23 mRNA levels, the Th17 axis could be another target of IFN...
SULPHUR-CONTAINING AMINO ACIDS METABOLISM IN EXPERIMENTAL HYPER- AND HYPOTHYROIDISM IN RATS.
Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O
2017-10-01
Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis
Amino acid limitation induces down-regulation of WNT5a at transcriptional level
International Nuclear Information System (INIS)
Wang Zuguang; Chen Hong
2009-01-01
An aberrant WNT signaling contributes to the development and progression of multiple cancers. WNT5a is one of the WNT signaling molecules. This study was designed to test the hypothesis that amino acid deprivation induces changes in the WNT signaling pathway in colon cancer cells. Results showed that targets of the amino acid response pathway, ATF3 and p21, were induced in the human colon cancer cell line SW480 during amino acid limitation. There was a significant decrease in the WNT5a mRNA level following amino acid deprivation. The down-regulation of WNT5a mRNA by amino acid deprivation is not due to mRNA destabilization. There is a reduction of nuclear β-catenin protein level by amino acid limitation. Under amino acid limitation, phosphorylation of ERK1/2 was increased and the blockage of ERK1/2 by the inhibitor U0126 partially restored WNT5a mRNA level. In conclusion, amino acid limitation in colon cancer cells induces phosphorylation of ERK1/2, which then down-regulates WNT5a expression.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Enhanced Delivery and Potency of Self-Amplifying mRNA Vaccines by Electroporation in Situ
Directory of Open Access Journals (Sweden)
Kaustuv Banerjee
2013-08-01
Full Text Available Nucleic acid-based vaccines such as viral vectors, plasmid DNA (pDNA, and mRNA are being developed as a means to address limitations of both live-attenuated and subunit vaccines. DNA vaccines have been shown to be potent in a wide variety of animal species and several products are now licensed for commercial veterinary but not human use. Electroporation delivery technologies have been shown to improve the generation of T and B cell responses from synthetic DNA vaccines in many animal species and now in humans. However, parallel RNA approaches have lagged due to potential issues of potency and production. Many of the obstacles to mRNA vaccine development have recently been addressed, resulting in a revival in the use of non-amplifying and self-amplifying mRNA for vaccine and gene therapy applications. In this paper, we explore the utility of EP for the in vivo delivery of large, self-amplifying mRNA, as measured by reporter gene expression and immunogenicity of genes encoding HIV envelope protein. These studies demonstrated that EP delivery of self-amplifying mRNA elicited strong and broad immune responses in mice, which were comparable to those induced by EP delivery of pDNA.
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Energy Technology Data Exchange (ETDEWEB)
Nakanaga, Kazue; Maeda Shinji; Matsuoka, Masanori; Kashiwabara, Yoshiko [National Inst. of Infectious Diseases, Tokyo (Japan)
1999-02-01
This study aimed to develop a specific method for detection and quantitative determination of mRNA that allows estimation of viable counts of M. leprae and other mycobacteria. Of heart-shock protein of 65 kDa (hsp65), mRNA was used as an indicator to discriminate the living cells and died ones. To compare mRNA detections by RNase protection assay (RPA) and Northern blot hybridization (NBH), labelled anti-sense RNA for hsp65 gene of M. leprae was synthesized using plasmid pUC8/N5. The anti-sense RNA synthesized from the template DNA containing about 580 bp (194 to 762) of hsp65 gene. When compared with NBH method, the amount of probe required for the detection by RPA method was 1/30 or less and the detection sensitivity of RPA was also 10 times higher. In addition, complicated procedures were needed to eliminate non-specific reactions in NBH method. These results indicated that RPA method is more convenient and superior for the mRNA detection. However, isotope degradation in the probe used for RPA method might affect the results. Therefore, {sup 33}P of {sup 35}P, of which degradation energy is less that {sup 32}P should be used for labelling. Total RNA was effectively extracted from M. chelonae, M. marinum by AGPC method, but not from M. leprae. In conclusion, RPA is a very effective detection method for these mRNA, but it seems necessary to further improve the sensitivity of detection for a small amount of test materials. (M.N.)
International Nuclear Information System (INIS)
Nakanaga, Kazue; Maeda Shinji; Matsuoka, Masanori; Kashiwabara, Yoshiko
1999-01-01
This study aimed to develop a specific method for detection and quantitative determination of mRNA that allows estimation of viable counts of M. leprae and other mycobacteria. Of heart-shock protein of 65 kDa (hsp65), mRNA was used as an indicator to discriminate the living cells and died ones. To compare mRNA detections by RNase protection assay (RPA) and Northern blot hybridization (NBH), labelled anti-sense RNA for hsp65 gene of M. leprae was synthesized using plasmid pUC8/N5. The anti-sense RNA synthesized from the template DNA containing about 580 bp (194 to 762) of hsp65 gene. When compared with NBH method, the amount of probe required for the detection by RPA method was 1/30 or less and the detection sensitivity of RPA was also 10 times higher. In addition, complicated procedures were needed to eliminate non-specific reactions in NBH method. These results indicated that RPA method is more convenient and superior for the mRNA detection. However, isotope degradation in the probe used for RPA method might affect the results. Therefore, 33 P of 35 P, of which degradation energy is less that 32 P should be used for labelling. Total RNA was effectively extracted from M. chelonae, M. marinum by AGPC method, but not from M. leprae. In conclusion, RPA is a very effective detection method for these mRNA, but it seems necessary to further improve the sensitivity of detection for a small amount of test materials. (M.N.)
International Nuclear Information System (INIS)
Huang, T.-Y.; Chu, H.-C.; Lin, Y.-L.; Lin, C.-K.; Hsieh, T.-Y.; Chang, W.-K.; Chao, Y.-C.; Liao, C.-L.
2009-01-01
In addition to its antimicrobial activity, minocycline exerts anti-inflammatory effects in several disease models. However, whether minocycline affects the pathogenesis of inflammatory bowel disease has not been determined. We investigated the effects of minocycline on experimental colitis and its underlying mechanisms. Acute and chronic colitis were induced in mice by treatment with dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS), and the effect of minocycline on colonic injury was assessed clinically and histologically. Prophylactic and therapeutic treatment of mice with minocycline significantly diminished mortality rate and attenuated the severity of DSS-induced acute colitis. Mechanistically, minocycline administration suppressed inducible nitric oxide synthase (iNOS) expression and nitrotyrosine production, inhibited proinflammatory cytokine expression, repressed the elevated mRNA expression of matrix metalloproteinases (MMPs) 2, 3, 9, and 13, diminished the apoptotic index in colonic tissues, and inhibited nitric oxide production in the serum of mice with DSS-induced acute colitis. In DSS-induced chronic colitis, minocycline treatment also reduced body weight loss, improved colonic histology, and blocked expression of iNOS, proinflammatory cytokines, and MMPs from colonic tissues. Similarly, minocycline could ameliorate the severity of TNBS-induced acute colitis in mice by decreasing mortality rate and inhibiting proinflammatory cytokine expression in colonic tissues. These results demonstrate that minocycline protects mice against DSS- and TNBS-induced colitis, probably via inhibition of iNOS and MMP expression in intestinal tissues. Therefore, minocycline is a potential remedy for human inflammatory bowel diseases.
International Nuclear Information System (INIS)
Yamane, Takumi; Kobayashi-Hattori, Kazuo; Oishi, Yuichi
2011-01-01
Highlights: ► Adiponectin promotes hyaluronan synthesis along with an increase in HAS2 transcripts. ► Adiponectin also increases the phosphorylation of AMPK. ► A pharmacological activator of AMPK increases mRNA levels of PPARα and HAS2. ► Adiponectin-induced HAS2 mRNA expression is blocked by a PPARα antagonist. ► Adiponectin promotes hyaluronan synthesis via an AMPK/PPARα-dependent pathway. -- Abstract: Although adipocytokines affect the functions of skin, little information is available on the effect of adiponectin on the skin. In this study, we investigated the effect of adiponectin on hyaluronan synthesis and its regulatory mechanisms in human dermal fibroblasts. Adiponectin promoted hyaluronan synthesis along with an increase in the mRNA levels of hyaluronan synthase 2 (HAS2), which plays a primary role in hyaluronan synthesis. Adiponectin also increased the phosphorylation of AMP-activated protein kinase (AMPK). A pharmacological activator of AMPK, 5-aminoimidazole-4-carboxamide-1β-ribofuranoside (AICAR), increased mRNA levels of peroxisome proliferator-activated receptor-α (PPARα), which enhances the expression of HAS2 mRNA. In addition, AICAR increased the mRNA levels of HAS2. Adiponectin-induced HAS2 mRNA expression was blocked by GW6471, a PPARα antagonist, in a concentration-dependent manner. These results show that adiponectin promotes hyaluronan synthesis along with increases in HAS2 transcripts through an AMPK/PPARα-dependent pathway in human dermal fibroblasts. Thus, our study suggests that adiponectin may be beneficial for retaining moisture in the skin, anti-inflammatory activity, and the treatment of a variety of cutaneous diseases.
International Nuclear Information System (INIS)
Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi
2008-01-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1
Energy Technology Data Exchange (ETDEWEB)
Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)
2008-03-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.
Directory of Open Access Journals (Sweden)
Julian Eigendorf
2018-05-01
Full Text Available We present here a longitudinal study determining the effects of two 3 week-periods of high intensity high volume interval training (HIHVT (90 intervals of 6 s cycling at 250% maximum power, Pmax/24 s on a cycle ergometer. HIHVT was evaluated by comparing performance tests before and after the entire training (baseline, BSL, and endpoint, END and between the two training sets (intermediate, INT. The mRNA expression levels of myosin heavy chain (MHC isoforms and markers of energy metabolism were analyzed in M. vastus lateralis biopsies by quantitative real-time PCR. In incremental tests peak power (Ppeak was increased, whereas V˙O2peak was unaltered. Prolonged time-to-exhaustion was found in endurance tests with 65 and 80% Pmax at INT and END. No changes in blood levels of lipid metabolites were detected. Training-induced decreases of hematocrit indicate hypervolemia. A shift from slow MHCI/β to fast MHCIIa mRNA expression occurred after the first and second training set. The mRNA expression of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α, a master regulator of oxidative energy metabolism, decreased after the second training set. In agreement, a significant decrease was also found for citrate synthase mRNA after the second training set, indicating reduced oxidative capacity. However, mRNA expression levels of glycolytic marker enzyme glyceraldehyde-3-phosphate dehydrogenase did not change after the first and second training set. HIHVT induced a nearly complete slow-to-fast fiber type transformation on the mRNA level, which, however, cannot account for the improvements of performance parameters. The latter might be explained by the well-known effects of hypervolemia on exercise performance.
Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe
2015-08-01
Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
DEFF Research Database (Denmark)
Gerber, Lucie; Madsen, Steffen S; Jensen, Frank B
2017-01-01
Cortisol and nitric oxide (NO) are regulators of ion transport and metabolic functions in fish. In the gill, they show opposite effects on Na(+)/K(+)-ATPase (NKA) activity: cortisol stimulates NKA activity while NO inhibits NKA activity. We hypothesized that cortisol may impact NO production...... in osmoregulatory tissues by regulating NO synthase (NOS) expression. We evaluated the influence of cortisol treatment on mRNA expression of Nos1 and Nos2 in gill, kidney and middle intestine of both freshwater (FW) and seawater (SW) acclimated rainbow trout and found both tissue- and salinity-dependent effects....... Nos2 expression was down-regulated in the gill by cortisol injection in both FW and SW trout. This was substantiated by incubating gill tissue with cortisol ex vivo. Similarly, cortisol injection significantly down-regulated Nos2 expression in kidney of SW fish but not in FW fish. In the middle...
Beld, Joris; Abbriano, Raffaela; Finzel, Kara; Hildebrand, Mark; Burkart, Michael D
2016-04-01
In both eukaryotes and prokaryotes, fatty acid synthases are responsible for the biosynthesis of fatty acids in an iterative process, extending the fatty acid by two carbon units every cycle. Thus, odd numbered fatty acids are rarely found in nature. We tested whether representatives of diverse microbial phyla have the ability to incorporate odd-chain fatty acids as substrates for their fatty acid synthases and their downstream enzymes. We fed various odd and short chain fatty acids to the bacterium Escherichia coli, cyanobacterium Synechocystis sp. PCC 6803, green microalga Chlamydomonas reinhardtii and diatom Thalassiosira pseudonana. Major differences were observed, specifically in the ability among species to incorporate and elongate short chain fatty acids. We demonstrate that E. coli, C. reinhardtii, and T. pseudonana can produce longer fatty acid products from short chain precursors (C3 and C5), while Synechocystis sp. PCC 6803 lacks this ability. However, Synechocystis can incorporate and elongate longer chain fatty acids due to acyl-acyl carrier protein synthetase (AasS) activity, and knockout of this protein eliminates the ability to incorporate these fatty acids. In addition, expression of a characterized AasS from Vibrio harveyii confers a similar capability to E. coli. The ability to desaturate exogenously added fatty acids was only observed in Synechocystis and C. reinhardtii. We further probed fatty acid metabolism of these organisms by feeding desaturase inhibitors to test the specificity of long-chain fatty acid desaturases. In particular, supplementation with thia fatty acids can alter fatty acid profiles based on the location of the sulfur in the chain. We show that coupling sensitive gas chromatography mass spectrometry to supplementation of unnatural fatty acids can reveal major differences between fatty acid metabolism in various organisms. Often unnatural fatty acids have antibacterial or even therapeutic properties. Feeding of short
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Directory of Open Access Journals (Sweden)
Priscila Camillo Teixeira
2011-06-01
Full Text Available BACKGROUND: Chronic Chagas disease cardiomyopathy (CCC is an inflammatory dilated cardiomyopathy with a worse prognosis than other cardiomyopathies. CCC occurs in 30 % of individuals infected with Trypanosoma cruzi, endemic in Latin America. Heart failure is associated with impaired energy metabolism, which may be correlated to contractile dysfunction. We thus analyzed the myocardial gene and protein expression, as well as activity, of key mitochondrial enzymes related to ATP production, in myocardial samples of end-stage CCC, idiopathic dilated (IDC and ischemic (IC cardiomyopathies. METHODOLOGY/PRINCIPAL FINDINGS: Myocardium homogenates from CCC (N=5, IC (N=5 and IDC (N=5 patients, as well as from heart donors (N=5 were analyzed for protein and mRNA expression of mitochondrial creatine kinase (CKMit and muscular creatine kinase (CKM and ATP synthase subunits aplha and beta by immunoblotting and by real-time RT-PCR. Total myocardial CK activity was also assessed. Protein levels of CKM and CK activity were reduced in all three cardiomyopathy groups. However, total CK activity, as well as ATP synthase alpha chain protein levels, were significantly lower in CCC samples than IC and IDC samples. CCC myocardium displayed selective reduction of protein levels and activity of enzymes crucial for maintaining cytoplasmic ATP levels. CONCLUSIONS/SIGNIFICANCE: The selective impairment of the CK system may be associated to the loss of inotropic reserve observed in CCC. Reduction of ATP synthase alpha levels is consistent with a decrease in myocardial ATP generation through oxidative phosphorylation. Together, these results suggest that the energetic deficit is more intense in the myocardium of CCC patients than in the other tested dilated cardiomyopathies.
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Dere, Edward; Spade, Daniel J.; Hall, Susan J.; Altemus, Aimee; Smith, James D.; Phillips, Jonathan A.; Moffit, Jeffrey S.; Blanchard, Kerry T.; Boekelheide, Kim
2017-01-01
The human testis is sensitive to toxicant-induced injury but current methods for detecting adverse effects are limited, insensitive and unreliable. Animal studies use sensitive histopathological endpoints to assess toxicity, but require testicular tissue that is not available during human clinical trials. More sensitive and reliable molecular biomarkers of testicular injury are needed to better monitor testicular toxicity in both clinical and preclinical. Adult male Wistar Han rats were exposed for 4 weeks to compounds previously associated with testicular injury, including cisplatin (0, 0.2, 0.3, or 0.4 mg/kg/day), BI665915 (0, 20, 70, 100 mg/kg/d), BI665636 (0, 20, 100 mg/kg/d) or BI163538 (0, 70, 150, 300 mg/kg/d) to evaluate reproductive toxicity and assess changes in sperm mRNA levels. None of the compounds resulted in any significant changes in body, testis or epididymis weights, nor were there decreases in testicular homogenization resistant spermatid head counts. Histopathological evaluation found that only BI665915 treatment caused any testicular effects, including minor germ cell loss and disorganization of the seminiferous tubule epithelium, and an increase in the number of retained spermatid heads. A custom PCR-array panel was used to assess induced changes in sperm mRNA. BI665915 treatment resulted in a significant increase in clusterin (Clu) levels and decreases in GTPase, IMAP family member 4 (Gimap4), prostaglandin D2 synthase (Ptgds) and transmembrane protein with EGF like and two follistatin like domains 1 (Tmeff1) levels. Correlation analysis between transcript levels and quantitative histopathological endpoints found a modest association between Clu with retained spermatid heads. These results demonstrate that sperm mRNA levels are sensitive molecular indicators of testicular injury that can potentially be translated into a clinical setting. - Highlights: • Testing of pharmaceutical compounds identified altered sperm mRNA transcripts.
Energy Technology Data Exchange (ETDEWEB)
Dere, Edward [Division of Urology, Rhode Island Hospital, Providence, RI (United States); Department of Pathology and Laboratory Medicine, Brown University, Providence, RI (United States); Spade, Daniel J.; Hall, Susan J. [Department of Pathology and Laboratory Medicine, Brown University, Providence, RI (United States); Altemus, Aimee; Smith, James D.; Phillips, Jonathan A.; Moffit, Jeffrey S.; Blanchard, Kerry T. [Boehringer Ingelheim Pharmaceuticals, Ridgefield, CT (United States); Boekelheide, Kim, E-mail: kim_boekelheide@brown.edu [Department of Pathology and Laboratory Medicine, Brown University, Providence, RI (United States)
2017-04-01
The human testis is sensitive to toxicant-induced injury but current methods for detecting adverse effects are limited, insensitive and unreliable. Animal studies use sensitive histopathological endpoints to assess toxicity, but require testicular tissue that is not available during human clinical trials. More sensitive and reliable molecular biomarkers of testicular injury are needed to better monitor testicular toxicity in both clinical and preclinical. Adult male Wistar Han rats were exposed for 4 weeks to compounds previously associated with testicular injury, including cisplatin (0, 0.2, 0.3, or 0.4 mg/kg/day), BI665915 (0, 20, 70, 100 mg/kg/d), BI665636 (0, 20, 100 mg/kg/d) or BI163538 (0, 70, 150, 300 mg/kg/d) to evaluate reproductive toxicity and assess changes in sperm mRNA levels. None of the compounds resulted in any significant changes in body, testis or epididymis weights, nor were there decreases in testicular homogenization resistant spermatid head counts. Histopathological evaluation found that only BI665915 treatment caused any testicular effects, including minor germ cell loss and disorganization of the seminiferous tubule epithelium, and an increase in the number of retained spermatid heads. A custom PCR-array panel was used to assess induced changes in sperm mRNA. BI665915 treatment resulted in a significant increase in clusterin (Clu) levels and decreases in GTPase, IMAP family member 4 (Gimap4), prostaglandin D2 synthase (Ptgds) and transmembrane protein with EGF like and two follistatin like domains 1 (Tmeff1) levels. Correlation analysis between transcript levels and quantitative histopathological endpoints found a modest association between Clu with retained spermatid heads. These results demonstrate that sperm mRNA levels are sensitive molecular indicators of testicular injury that can potentially be translated into a clinical setting. - Highlights: • Testing of pharmaceutical compounds identified altered sperm mRNA transcripts.
Dmitryjuk, Małgorzata; Łopieńska-Biernat, Elżbieta; Zaobidna, Ewa Anna
2014-01-01
The in vitro effect of ivermectin lethal dose on the activity of trehalose-6-phosphate synthase (TPS) and phosphatase (TPP) and the expression of their mRNA (tps1, tps2, and tpp genes) in the muscle of adult female Ascaris suum was investigated. The presence of ivermectin in the medium caused a decrease in TPS and TPP activities during the experiment compared with the start and control groups. The exception was the group of worms grown for 8 hours in a IVM solution, in which there was a littl...
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Esumi, H; Takahashi, Y; Sekiya, T; Sato, S; Nagase, S; Sugimura, T
1982-01-01
Analbuminemic rats, which lack serum albumin, were previously found to have no albumin mRNA in the cytoplasm of the liver. In the present study, the existence of nuclear albumin mRNA precursors in the liver of analbuminemic rats was examined by RNA X cDNA hybridization kinetics. Albumin mRNA precursors were present in the nuclei of analbuminemic rat liver at almost normal levels, despite the absence of albumin mRNA from the cytoplasm. Nuclear RNA of analbuminemic rat liver was subjected to el...
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin
2017-02-01
Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.
Weber, T E; Kerr, B J; Spurlock, M E
2008-10-01
Soy protein regulates adiponectin and peroxisome proliferator-activated receptor alpha (PPARalpha) in some species, but the effect of dietary soy protein on adiponectin and PPARalpha in the pig has not been studied. Therefore, the objective of this study was to determine whether soya bean meal reduction or replacement influences serum adiponectin, adiponectin mRNA, serum metabolites and the expression of PPARalpha and other genes involved in lipid deposition. Thirty-three pigs (11 pigs per treatment) were subjected to one of three dietary treatments: (i) reduced crude protein (CP) diet containing soya bean meal (RCP-Soy), (ii) high CP diet containing soya bean meal (HCP-Soy) or (iii) high CP diet with corn gluten meal replacing soya bean meal (HCP-CGM) for 35 days. Dietary treatment had no effect on overall growth performance, feed intake or measures of body composition. There was no effect of dietary treatment on serum adiponectin or leptin. Dietary treatment did not affect the abundance of the mRNAs for adiponectin, PPARalpha, PPARgamma2, lipoprotein lipase or fatty acid synthase in adipose tissue. The mRNA expression of PPARalpha, PPARgamma2, lipoprotein lipase or fatty acid synthetase in loin muscle was not affected by dietary treatment. In liver tissue, the relative abundance of PPARalpha mRNA was greater (p Soy diets when compared to pigs fed RCP-Soy or HCP-CGM diets. Hepatic mRNA expression of acyl-CoA oxidase or fatty acid synthase was not affected by dietary treatment. Western blot analysis indicated that hepatic PPARalpha protein levels were decreased (p Soy diets when compared to pigs fed the HCP-Soy diets. These data suggest that increasing the soy protein content of swine diets increases hepatic expression of PPARalpha without associated changes in body composition.
Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes
Mendoza-Cantú, Ania; Castorena-Torres, Fabiola; de León, Mario Bermúdez; Cisneros, Bulmaro; López-Carrillo, Lizbeth; Rojas-García, Aurora E.; Aguilar-Salinas, Alberto; Manno, Maurizio; Albores, Arnulfo
2006-01-01
Print workers are exposed to organic solvents, of which the systemic toxicant toluene is a main component. Toluene induces expression of cytochrome P450 2E1 (CYP2E1), an enzyme involved in its own metabolism and that of other protoxicants, including some procarcinogens. Therefore, we investigated the association between toluene exposure and the CYP2E1 response, as assessed by mRNA content in peripheral lymphocytes or the 6-hydroxychlorzoxazone (6OH-CHZ)/chlorzoxazone (CHZ) quotient (known as CHZ metabolic ratio) in plasma, and the role of genotype (5′-flanking region RsaI/PstI polymorphic sites) in 97 male print workers. The geometric mean (GM) of toluene concentration in the air was 52.80 ppm (10–760 ppm); 54% of the study participants were exposed to toluene concentrations that exceeded the maximum permissible exposure level (MPEL). The GM of urinary hippuric acid at the end of a work shift (0.041 g/g creatinine) was elevated relative to that before the shift (0.027 g/g creatinine; p < 0.05). The GM of the CHZ metabolic ratio was 0.33 (0–9.3), with 40% of the subjects having ratios below the GM. However, the average CYP2E1 mRNA level in peripheral lymphocytes was 1.07 (0.30–3.08), and CYP2E1 mRNA levels within subjects correlated with the toluene exposure ratio (environmental toluene concentration:urinary hippuric acid concentration) (p = 0.014). Genotype did not alter the association between the toluene exposure ratio and mRNA content. In summary, with further validation, CYP2E1 mRNA content in peripheral lymphocytes could be a sensitive and noninvasive biomarker for the continuous monitoring of toluene effects in exposed persons. PMID:16581535
International Nuclear Information System (INIS)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma
2010-01-01
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Energy Technology Data Exchange (ETDEWEB)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)
2010-07-02
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Kato, M; Hayakawa, Y; Hyodo, H; Ikoma, Y; Yano, M
2000-04-01
1-Aminocyclopropane-1-carboxylate (ACC) synthase was rapidly induced in mesocarp tissue of Cucurbita maxima after wounding in the cut surface layer in 1 mm thickness (ca. 9 cells) (first layer) in both the enzyme activity and the levels of transcript. This led to a rapid accumulation of ACC and hence ethylene production. In the inside tissue (1-2 mm) (second layer), no significant induction of ACC synthase was observed, which resulted in a low level of ACC, although ethylene was evolved at a much lower rate than the first one. In contrast to ACC synthase, ACC oxidase was induced markedly in both the first and second layers and the development of its activity and the levels of mRNA remained high until later stages. It was considered that wound ethylene was closely associated with the development of ACC oxidase, since 2,5-norbornadiene (NBD), an inhibitor of ethylene action, substantially suppressed it. Phenylalanine ammonia-lyase (PAL) greatly increased in activity after wounding similarly to that of ACC synthase, in which increase in PAL activity occurred predominantly in the first layer. Induction of peroxidase activity after wounding had a close correlation in profile with that of ACC oxidase in that marked increases in the activity were observed in both the first and second layers and were strongly suppressed by NBD application. Four peroxidase isozymes were found by PAGE, among which a fraction was newly detected after wounding.
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Suzuki, Mamoru; Higashiura, Akifumi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan); Aritake, Kosuke; Urade, Yoshihiro; Uodome, Nobuko [Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka 565-0874 (Japan); Hossain, MD. Tofazzal [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Nakagawa, Atsushi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan)
2013-11-01
Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolution of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.
Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng
2013-02-08
The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.
Hofacer, Rylon; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Magrisso, I Jack; Benoit, Stephen C; McNamara, Robert K
2011-09-01
This study investigated the effects of perinatal dietary omega-3 (n-3) fatty acid depletion and subsequent repletion on the expression of genes that regulate long-chain (LC) polyunsaturated fatty acid biosynthesis in rat liver and brain. It was hypothesized that chronic n-3 fatty acid deficiency would increase liver Fads1 and Fads2 messenger RNA (mRNA) expression/activity and that n-3 fatty acid repletion would normalize this response. Adult rats fed the n-3-free diet during perinatal development exhibited significantly lower erythrocyte, liver, and frontal cortex LCn-3 fatty acid composition and reciprocal elevations in LC omega-6 (n-6) fatty acid composition compared with controls (CONs) and repleted rats. Liver Fads2, but not Fads1, Elovl2, or Elovl5, mRNA expression was significantly greater in n-3-deficient (DEF) rats compared with CONs and was partially normalized in repleted rats. The liver 18:3n-6/18:2n-6 ratio, an index of delta6-desturase activity, was significantly greater in DEF rats compared with CON and repleted rats and was positively correlated with Fads2 mRNA expression among all rats. The liver 18:3n-6/18:2n-6 ratio, but not Fads2 mRNA expression, was also positively correlated with erythrocyte and frontal cortex LCn-6 fatty acid compositions. Neither Fads1 or Fads2 mRNA expression was altered in brain cortex of DEF rats. These results confirm previous findings that liver, but not brain, delta6-desaturase expression and activity indices are negatively regulated by dietary n-3 fatty acids. Copyright © 2011 Elsevier Inc. All rights reserved.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Identifying airway sensitizers: cytokine mRNA profiles induced by various anhydrides
International Nuclear Information System (INIS)
Plitnick, L.M.; Loveless, S.E.; Ladics, G.S.; Holsapple, M.P.; Smialowicz, R.J.; Woolhiser, M.R.; Anderson, P.K.; Smith, C.; Selgrade, M.J.K.
2003-01-01
Exposure to low molecular weight (LMW) chemicals in the workplace has been linked to a variety of respiratory effects. Within the LMW chemicals, one of the major classes involved in these effects are the acid anhydrides. The immunological basis of respiratory hypersensitivity involves CD4+ cells. By virtue of their induction of cytokines typical of CD4+ T-helper type 2 (Th2) cells--interleukin (IL)-4, 10, and 13--respiratory sensitizers may be identified and differentiated from contact sensitizers which induce Th1 cytokines (IL-2 and IFN-γ). Our previous work suggested that the ribonuclease protection assay (RPA) was useful in identifying the respiratory sensitizer, trimellitic anhydride (TMA), based on quantitative differences in Th2 cytokine mRNA as compared to the contact sensitizer dinitrochlorobenzene (DNCB). Therefore, the purpose of the studies described in this report was to expand the chemicals tested in the RPA. To this end, four acid anhydrides with known respiratory sensitization potential, TMA, maleic anhydride (MA), phthalic anhydride (PA) and hexahydrophthalic anhydride (HHPA), were tested. Although previously determined to induce immunologically equivalent responses in a local lymph node assay (LLNA), the initial dose chosen (2.5%) failed to induce Th2 cytokine mRNA expression. To determine if the lack of cytokine expression was related to dose, LLNAs were conducted at higher doses for each of the anhydrides. The highest doses evaluated (four- to six-fold higher than those used in the initial RPA) gave equivalent proliferative responses for the various anhydrides and were used for subsequent RPA testing. At these higher doses, significant increases in Th2 versus Th1 cytokine mRNA were observed for all anhydrides tested. These results suggest that the RPA has the potential to serve as a screen for the detection of LMW airway sensitizing chemicals. However, the basis for selecting immunologically equivalent doses may require some modification
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Saxton Arnold M
2009-01-01
Full Text Available Abstract A dramatic rise in the incidence of obesity in the U.S. has accelerated the search for interventions that may impact this epidemic. One recently recognized target for such intervention is adipose tissue, which secretes a variety of bioactive substances including prostaglandins. Prostaglandin E2 (PGE2 has been shown to decrease lipolysis in adipocytes, but limited studies have explored alternative mechanisms by which PGE2 might impact obesity, such as adipogenesis or lipogenesis. Studies conducted on ApcMin/+ mice indicated that selective inhibition of the cyclooxygenase (COX-2 enzyme led to significant reductions in fatty acid synthase (FAS activity in adipose tissue suggesting lipogenic effects of PGE2. To further investigate whether these lipid mediators directly regulate lipogenesis, we used 3T3-L1 adipocytes to determine the impact of eicosapentaenoic acid (EPA and celecoxib on PGE2 formation and FAS used as a lipogenic marker. Both arachidonic acid (AA and EPA dose-dependently increased PGE secretion from adipocytes. AA was expectedly more potent and exhibiting at 150 uM dose a 5-fold increase in PGE2 secretion over EPA. Despite higher secretion of PGE by EPA and AA compared to control, neither PUFA significantly altered FAS activity. By contrast both AA and EPA significantly decreased FAS mRNA levels. Addition of celecoxib, a selective COX-2 inhibitor, significantly decreased PGE2 secretion (p 2 and celecoxib further decreased the FAS activity compared to PGE2 alone or untreated controls. In conclusion, EPA-mediated inhibition of AA metabolism did not significantly alter FAS activity while both AA and EPA significantly decreased FAS mRNA expression. COX-2 inhibition significantly decreased PGE2 production resulting in a decrease in FAS activity and expression that was not reversed with the addition of exogenous PGE2, suggesting an additional mechanism that is independent of COX-2.
Tan, Xiangling; Qi, Wen-Ning; Gu, Xiaosong; Urbaniak, James R; Chen, Long-En
2006-01-01
This study investigated the effects of intermittent pneumatic compression (IPC) on expression of nitric oxide synthase (NOS) isoforms in compressed (anterior tibialis, AT) and uncompressed (cremaster muscles, CM) skeletal muscles. Following IPC application of 0.5, 1, and 5h on both legs of rats, the endothelial NOS (eNOS) mRNA expression was significantly up-regulated to 1.2-, 1.8, and 2.7-fold from normal, respectively, in both AT and CM, and protein expression increased more than 1.5-fold of normal at each time point. Similarly, neuronal NOS expression was up-regulated, but to a lesser degree. In contrast, inducible NOS expression was significantly and time-dependently down-regulated in both muscles. After IPC cessation, eNOS levels returned to normal in both AT and CM. The results confirm our hypothesis that IPC-induced vasodilation is mediated by regulating expression of NOS isoforms, in particular eNOS, in both compressed and uncompressed skeletal muscles. The results also suggest the importance of precisely characterizing expression of each NOS isoform in tissue pathophysiology.
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Directory of Open Access Journals (Sweden)
Chao Yang
Full Text Available The energy available from the diet, which affects fat deposition in vivo, is a major factor in the expression of genes regulating fat deposition in the longissimus dorsi muscle. Providing high-energy diets to yaks might increase intramuscular fat deposition and fatty acid concentrations under a traditional grazing system in cold seasons. A total of fifteen adult castrated male yaks with an initial body weight 274.3 ± 3.14 kg were analyzed for intramuscular adipose deposition and fatty acid composition. The animals were divided into three groups and fed low-energy (LE: 5.5 MJ/kg, medium-energy (ME: 6.2 MJ/kg and high-energy (HE: 6.9 MJ/kg diets, respectively. All animals were fed ad libitum twice daily at 08:00-09:00 am and 17:00-18:00 pm and with free access to water for 74 days, including a 14-d period to adapt to the diets and the environment. Intramuscular fat (IMF content, fatty acid profile and mRNA levels of genes involved in fatty acid synthesis were determined. The energy levels of the diets significantly (P<0.05 affected the content of IMF, total SFA, total MUFA and total PUFA. C16:0, C18:0 and C18:1n9c account for a large proportion of total fatty acids. Relative expression of acetyl-CoA carboxylase (ACACA, fatty acid synthase (FASN, stearoyl-CoA desaturase (SCD, sterol regulatory element-binding protein-1c (SREBP-1c, peroxisome proliferator-activated receptor γ (PPARγ and fatty acid-binding protein 4 (FABP4 was greater in HE than in LE yaks (P<0.05. Moreover, ME yaks had higher (P<0.05 mRNA expression levels of PPARγ, ACACA, FASN, SCD and FABP4 than did the LE yaks. The results demonstrate that the higher energy level of the diets increased IMF deposition and fatty acid content as well as increased intramuscular lipogenic gene expression during the experimental period.
The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet
Dunlap, Dacey; Patrick, Patricia
2012-01-01
During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…
Natural selection and algorithmic design of mRNA.
Cohen, Barry; Skiena, Steven
2003-01-01
Messenger RNA (mRNA) sequences serve as templates for proteins according to the triplet code, in which each of the 4(3) = 64 different codons (sequences of three consecutive nucleotide bases) in RNA either terminate transcription or map to one of the 20 different amino acids (or residues) which build up proteins. Because there are more codons than residues, there is inherent redundancy in the coding. Certain residues (e.g., tryptophan) have only a single corresponding codon, while other residues (e.g., arginine) have as many as six corresponding codons. This freedom implies that the number of possible RNA sequences coding for a given protein grows exponentially in the length of the protein. Thus nature has wide latitude to select among mRNA sequences which are informationally equivalent, but structurally and energetically divergent. In this paper, we explore how nature takes advantage of this freedom and how to algorithmically design structures more energetically favorable than have been built through natural selection. In particular: (1) Natural Selection--we perform the first large-scale computational experiment comparing the stability of mRNA sequences from a variety of organisms to random synonymous sequences which respect the codon preferences of the organism. This experiment was conducted on over 27,000 sequences from 34 microbial species with 36 genomic structures. We provide evidence that in all genomic structures highly stable sequences are disproportionately abundant, and in 19 of 36 cases highly unstable sequences are disproportionately abundant. This suggests that the stability of mRNA sequences is subject to natural selection. (2) Artificial Selection--motivated by these biological results, we examine the algorithmic problem of designing the most stable and unstable mRNA sequences which code for a target protein. We give a polynomial-time dynamic programming solution to the most stable sequence problem (MSSP), which is asymptotically no more complex
Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa
2018-05-11
(-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.
Tissue-specific mRNA expression profiling in grape berry tissues
Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C
2007-01-01
Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and
Tissue-specific mRNA expression profiling in grape berry tissues
Directory of Open Access Journals (Sweden)
Cramer Grant R
2007-06-01
Full Text Available Abstract Background Berries of grape (Vitis vinifera contain three major tissue types (skin, pulp and seed all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin and mesocarp (pulp, not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell
Preynat, A; Lapierre, H; Thivierge, M C; Palin, M F; Cardinault, N; Matte, J J; Desrochers, A; Girard, C L
2010-05-01
The present experiment was undertaken to study the interactions between dietary supplements of rumen-protected methionine (RPM) and intramuscular injections of folic acid and vitamin B(12), given from 3 wk before calving to 16 wk of lactation, on hepatic metabolism of lactating dairy cows. Sixty multiparous Holstein cows were assigned to 10 blocks of 6 cows each according to their previous milk production. Within each block, 3 cows were fed a diet calculated to supply Met as 1.83% of metabolizable protein, whereas the 3 other cows were fed the same diet supplemented with 18g of RPM calculated to provide Met as 2.23% of metabolizable protein. Within each level of Met, the cows received no vitamin supplement or weekly intramuscular injections of 160mg of folic acid alone or combined with 10mg of vitamin B(12). Liver biopsies were taken at 2, 4, 8, and 16 wk of lactation. Liver concentrations of folates and vitamin B(12) were increased by their respective supplements but this response to vitamin supplements was altered by methionine supply. Concentrations of total lipids and triglycerides increased in livers of cows fed RPM, whereas concentrations of cholesterol ester, cholesterol, diglycerides, phosphatidylethanolamine, and phosphatidylcholine were not affected. Folic acid, alone or combined with vitamin B(12), tended to increase the ratio of phosphatidylcholine to phosphatidylethanolamine. Gene expression of 5,10-methylene-tetrahydrofolate reductase, microsomal transfer protein, and phosphatidylethanolamine methyltransferase were higher in liver of cows fed RPM supplements. The relative mRNA abundance of 5,10-methylene-tetrahydrofolate reductase and methylmalonyl-CoA mutase were increased by the combined injections of folic acid and vitamin B(12), whereas those of methionine synthase and methionine synthase reductase were not affected by treatments. These results suggest that increasing supply of methyl groups, as preformed labile methyl groups or through
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Extracellular vesicles from human liver stem cells restore argininosuccinate synthase deficiency.
Herrera Sanchez, Maria Beatriz; Previdi, Sara; Bruno, Stefania; Fonsato, Valentina; Deregibus, Maria Chiara; Kholia, Sharad; Petrillo, Sara; Tolosano, Emanuela; Critelli, Rossana; Spada, Marco; Romagnoli, Renato; Salizzoni, Mauro; Tetta, Ciro; Camussi, Giovanni
2017-07-27
Argininosuccinate synthase (ASS)1 is a urea cycle enzyme that catalyzes the conversion of citrulline and aspartate to argininosuccinate. Mutations in the ASS1 gene cause citrullinemia type I, a rare autosomal recessive disorder characterized by neonatal hyperammonemia, elevated citrulline levels, and early neonatal death. Treatment for this disease is currently restricted to liver transplantation; however, due to limited organ availability, substitute therapies are required. Recently, extracellular vesicles (EVs) have been reported to act as intercellular transporters carrying genetic information responsible for cell reprogramming. In previous studies, we isolated a population of stem cell-like cells known as human liver stem cells (HLSCs) from healthy liver tissue. Moreover, EVs derived from HLSCs were reported to exhibit regenerative effects on the liver parenchyma in models of acute liver injury. The aim of this study was to evaluate whether EVs derived from normal HLSCs restored ASS1 enzymatic activity and urea production in hepatocytes differentiated from HLSCs derived from a patient with type I citrullinemia. HLSCs were isolated from the liver of a patient with type I citrullinemia (ASS1-HLSCs) and characterized by fluorescence-activated cell sorting (FACS), immunofluorescence, and DNA sequencing analysis. Furthermore, their differentiation capabilities in vitro were also assessed. Hepatocytes differentiated from ASS1-HLSCs were evaluated by the production of urea and ASS enzymatic activity. EVs derived from normal HLSCs were purified by differential ultracentrifugation followed by floating density gradient. The EV content was analyzed to identify the presence of ASS1 protein, mRNA, and ASS1 gene. In order to obtain ASS1-depleted EVs, a knockdown of the ASS1 gene in HLSCs was performed followed by EV isolation from these cells. Treating ASS1-HLSCs with EVs from HLSCs restored both ASS1 activity and urea production mainly through the transfer of ASS1 enzyme
Directory of Open Access Journals (Sweden)
Kira C. M. Neller
2018-05-01
Full Text Available The American pokeweed plant, Phytolacca americana, displays broad-spectrum resistance to plant viruses and is a heavy metal hyperaccumulator. However, little is known about the regulation of biotic and abiotic stress responses in this non-model plant. To investigate the control of miRNAs in gene expression, we sequenced the small RNA transcriptome of pokeweed treated with jasmonic acid (JA, a hormone that mediates pathogen defense and stress tolerance. We predicted 145 miRNAs responsive to JA, most of which were unique to pokeweed. These miRNAs were low in abundance and condition-specific, with discrete expression change. Integration of paired mRNA-Seq expression data enabled us to identify correlated, novel JA-responsive targets that mediate hormone biosynthesis, signal transduction, and pathogen defense. The expression of approximately half the pairs was positively correlated, an uncommon finding that we functionally validated by mRNA cleavage. Importantly, we report that a pokeweed-specific miRNA targets the transcript of OPR3, novel evidence that a miRNA regulates a JA biosynthesis enzyme. This first large-scale small RNA study of a Phytolaccaceae family member shows that miRNA-mediated control is a significant component of the JA response, associated with widespread changes in expression of genes required for stress adaptation.
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
Mun, Bong-Gyu; Khan, Abdul Latif; Waqas, Muhammad; Kim, Hyun-Ho; Shahzad, Raheem; Imran, Muhammad
2018-01-01
This study investigated the regulatory role of exogenous salicylic acid (SA) in rice and its effects on toxic reactive oxygen and nitrogen species during short-term salinity stress. SA application (0.5 and 1.0 mM) during salinity-induced stress (100 mM NaCl) resulted in significantly longer shoot length and higher chlorophyll and biomass accumulation than with salinity stress alone. NaCl-induced reactive oxygen species production led to increased levels of lipid peroxidation in rice plants, which were significantly reduced following SA application. A similar finding was observed for superoxide dismutase; however, catalase (CAT) and ascorbate peroxidase (APX) were significantly reduced in rice plants treated with SA and NaCl alone and in combination. The relative mRNA expression of OsCATA and OsAPX1 was lower in rice plants during SA stress. Regarding nitrogenous species, S-nitrosothiol (SNO) was significantly reduced initially (one day after treatment [DAT]) but then increased in plants subjected to single or combined stress conditions. Genes related to SNO biosynthesis, S-nitrosoglutathione reductase (GSNOR1), NO synthase-like activity (NOA), and nitrite reductase (NIR) were also assessed. The mRNA expression of GSNOR1 was increased relative to that of the control, whereas OsNOA was expressed at higher levels in plants treated with SA and NaCl alone relative to the control. The mRNA expression of OsNR was decreased in plants subjected to single or combination treatment, except at 2 DAT, compared to the control. In conclusion, the current findings suggest that SA can regulate the generation of NaCl-induced oxygen and nitrogen reactive species in rice plants. PMID:29558477
Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.
Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi
2017-03-01
Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes
Directory of Open Access Journals (Sweden)
Jones Sophie
2012-08-01
Full Text Available Abstract Background Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Methods Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA and reverse-transcriptase PCR (RT-PCR. Results Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (p Conclusions This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan
2016-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...
Directory of Open Access Journals (Sweden)
I MADE ARTIKA
2010-09-01
Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.
Modulation of hyaluronan synthase activity in cellular membrane fractions.
Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto
2009-10-30
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.
Directory of Open Access Journals (Sweden)
Abeer Abousaab
2016-12-01
Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.
Directory of Open Access Journals (Sweden)
Peng Li
2013-11-01
Full Text Available Background: NEFA plays numerous roles in the metabolism of glucose, lipids, and proteins. A number of experimental studies have shown that NEFA may have an important role in fatty acid metabolism in the liver, especially in dairy cows that experience negative energy balance (NEB during early lactation. Methods: In this study, using fluorescent quantitative RT-PCR, ELISA, and primary hepatocytes cultured in vitro, we examined the effect of NEFA (0, 0.2, 0.4, 0.8, 1.6, and 3.2 mmol/L on fatty acid metabolism by monitoring the mRNA and protein expression of the following key enzymes: long chain acyl-CoA synthetase (ACSL, carnitine palmitoyltransferase IA (CPT IA, long chain acyl-CoA dehydrogenase (ACADL, and acetyl-CoA carboxylase (ACC. Results: The mRNA and protein expression levels of ACSL and ACADL markedly increased as the concentration of NEFA in the media was increased. The mRNA and protein expression levels of CPT IA were enhanced significantly when the NEFA concentrations increased from 0 to 1.6 mmol/L and decreased significantly when the NEFA concentrations increased from 1.6 to 3.2 mmol/L. The mRNA and protein expression of ACC decreased gradually with increasing concentrations of NEFA. Conclusion: These findings indicate that increased NEFA significantly promote the activation and β-oxidation of fatty acids, but very high NEFA concentrations may inhibit the translocation of fatty acids into mitochondria of hepatocytes. This may explain the development of ketosis or liver lipidosis in dairy cows. CPT IA might be the key control enzyme of the fatty acid oxidation process in hepatocytes.
Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.
Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A
2016-04-20
As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E
2017-08-01
Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Shaker, Olfat; Ghallab, Noha A; Hamdy, Ebtehal; Sayed, Safinaz
2013-10-01
There is few data concerning the pathogenesis and contribution of inducible nitric oxide synthase (iNOS) in the inflammatory reactions of the periodontium in the course of diabetes. This study evaluated the expression of iNOS in the gingival biopsies of periodontitis patients with and without type 2 diabetes. 80 subjects were evaluated in four groups: patients with chronic periodontitis and diabetes, patients with chronic periodontitis, periodontally healthy patients with diabetes, and systemically and periodontally healthy control subjects. Gingival biopsies were subjected to immunohistochemistry as well as reverse transcription polymerase chain reaction (RT-PCR) for determination of iNOS. All diseased gingival tissues had a significant increase in iNOS expression by immunohistochemistry (Pperiodontitis and diabetic patients regarding iNOS(+) cells. Meanwhile, these two groups had significantly increased iNOS(+) cells when compared to periodontitis patients (Pperiodontitis showed significantly higher levels of iNOS mRNA expression compared to samples from periodontitis patients and diabetic patients (Pperiodontitis, periodontitis patients and diabetic patients, the higher mRNA for iNOS observed in diabetes and periodontitis may indicate a possible involvement of this mediator in the periodontal destruction of type 2 diabetes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun
2017-01-01
Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.
Tian, Yuhu; Huo, Meijun; Li, Guangsheng; Li, Yanyan; Wang, Jundong
2016-10-01
F toxicity to immune system, especially to macrophage, has been studied a lot recently. Nuclear factor-kappa B (NF-κB), as a transcription factor, plays a central role in immune and inflammatory responses via the regulation of downstream gene expression. Recent studies indicated that fluoride effect on inflammatory cytokine secretion, however, the molecular mechanism was less understood. In our study, peritoneal macrophages (PMs) were divided several groups and were administrated sodium fluoride (NaF, 50, 100, 200, 400, 800 μM) and/or lipopolysaccharide (LPS, 30 ng/mg). The mRNA expression of p65, inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-α) and interleukin-1 beta (IL-1β) in macrophages exposed to fluoride was determined by quantitative real-time RT-PCR respectively. The translocation of NF-κB from cytoplasm to nucleus, which in a way reflects NF-κB activity, was demonstrated by Immunofluorescence and ELISA. Our results showed that fluoride had a dose-dependent effect on NF-κB activity, which coincided with LPS-induced mRNA expression of its downstream genes, iNOS and IL-1β. Fluoride alone causes no effect on gene expression. However, the mRNA expression of TNF-α showed non-NF-κB-dependent manner. Therefore, we come to the conclusion that fluoride can regulate LPS-induced mRNA expression of iNOS and IL-1β via NF-κB pathway in mouse peritoneal macrophages. Copyright © 2016 Elsevier Ltd. All rights reserved.
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei
2012-01-01
Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686
DEFF Research Database (Denmark)
Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.
2010-01-01
In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase
Directory of Open Access Journals (Sweden)
Santos Diógenes S
2008-04-01
Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and
Directory of Open Access Journals (Sweden)
Joan Crous-Masó
2018-05-01
Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Hao, Li-Jun; Lin, Yan; Zhang, Wei; Tian, Jiao; Wang, Ya; Chen, Peng-De; Hu, Chong-Kang; Zeng, Ling-Chao; Yang, Jie; Wang, Bao-Xi; Jiang, Xun
2017-06-01
To investigate the change in the expression of tight junction protein ZO-1 in intestinal epithelial cells (Caco-2 cells) and the protective effect of eicosapentaenoic acid (EPA) after adherent-invasive Escherichia coli (E.coli) LF82 infection. The Caco-2 cell line was used to establish an in vitro model of tight junction of intestinal epithelial cells. Caco-2 cells were divided into EPA treatment groups (0, 25, 50, 100, and 200 μmol/L EPA) and EPA (0, 25, 50, 100, and 200 μmol/L EPA)+E.coli LF82 treatment (0, 6, and 12 hours) groups. A microscope was used to observe the morphological characteristics of the cells. MTT assay was used to determine the cell growth curve. The activity of alkaline phosphatase (ALP) at both sides of the cell membrane was compared to evaluate the Caco-2 cell model. MTT assay and flow cytometry were used to investigate the effects of different concentrations of EPA on the survival rate and apoptosis rate of Caco-2 cells. RT-qPCR was used to measure the mRNA expression of ZO-1 in Caco-2 cells after EPA and/or E.coli LF82 treatment. ELISA was used to measure the change in the level of tumor necrosis factor-α (TNF-α) in culture supernatant. After EPA treatment (25 and 50 μmol/L), the proliferation of Caco-2 cells was induced in a dose-dependent manner. The survival rates of the cells were significantly higher than those in the control group (PE.coli LF82 treatment groups had decreasing mRNA expression of ZO-1 in Caco-2 cells over the time of treatment and had significantly lower mRNA expression of ZO-1 than the untreated group (PE.coli LF82 and 25 or 50 μmol/L EPA for 6 or 12 hours showed an increase in the mRNA expression of ZO-1 with the increasing concentration of EPA, as well as significantly higher mRNA expression of ZO-1 than the Caco-2 cells treated with E.coli LF82 alone (PE.coli LF82 alone for 6 or 12 hours had increasing secretion of TNF-α over the time of treatment and had significantly higher secretion than the untreated
Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases
International Nuclear Information System (INIS)
Blacklock, Brenda J.; Jaworski, Jan G.
2006-01-01
The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates
Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)
2011-01-01
Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Assumpção, Renata P; Mucci, Daniela B; Fonseca, Fernanda C P; Marcondes, Henrique; Sardinha, Fátima L C; Citelli, Marta; Tavares do Carmo, Maria G
2017-10-01
Long-chain polyunsaturated fatty acids (LC-PUFA), mainly docosahexaenoic (DHA) and arachidonic acids (AA), are critical for adequate fetal growth and development. We investigated mRNA expression of proteins involved in hydrolysis, uptake and/or transport of fatty acids in placenta of fifteen full term normal pregnancies and eleven pregnancies complicated by intrauterine growth restriction (IUGR) with normal umbilical blood flows. The mRNA expression of LPL, FATPs (-1, -2 and -4) and FABPs (-1 and -3) was increased in IUGR placentas, however, tissue profile of LC-PUFA was not different between groups. Erythrocytes from both mothers and fetuses of the IUGR group showed lower concentrations of AA and DHA and inferior DHA/ALA ratio compared to normal pregnancies (P < 0.05). We hypothesize that reduced circulating levels of AA and DHA could up-regulate mRNA expression of placental fatty acids transporters, as a compensatory mechanism, however this failed to sustain normal LC-PUFA supply to the fetus in IUGR. Copyright © 2017 Elsevier Ltd. All rights reserved.
Enzymatic regulation of organic acid metabolism in an alkali-tolerant ...
African Journals Online (AJOL)
Tuoyo Aghomotsegin
2016-10-05
Oct 5, 2016 ... seedlings of C. virgata were treated with varying salt and alkali stress. First, the composition and .... mechanisms of organic acid accumulation in C. virgata ..... dehydrogenase and ferredoxin-dependent glutamate synthase in.
Yang, Di; Li, Ren; Qiu, Li-Hong; Li, Chen
2009-04-01
To quantify the IL-1 beta mRNA and IL-6 mRNA expression induced by lipopolysaccharides (LPS)extracted from Porphyromonas endodontalis(P.e) in osteoblasts, and to relate P.e-LPS to bone absorption pathogenesis in lesions of chronical apical periodontitis. MG63 was treated with different concentrations of P.e-LPS(0-50 microg/mL) for different hours(0-24h). The expression of IL-1 beta mRNA and IL-6 mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR).Statistical analysis was performed using one- way ANOVA and Dunnett t test with SPSS11.0 software package. The level of IL-1 beta mRNA and IL-6 mRNA increased significantly after treatment with P.e-LPS at more than 5 microg/mL (P<0.01)and for more than 1 hour (P<0.01), which indicated that P.e-LPS induced osteoblasts to express IL-1 beta mRNA and IL-6 mRNA in dose and time dependent manners. P.e-LPS may promote bone resorption in lesions of chronical apical periodontitis by inducing IL-1 beta mRNA and IL-6 mRNA expression in osteoblasts.
Sooman, Linda; Wennman, Anneli; Hamberg, Mats; Hoffmann, Inga; Oliw, Ernst H
2016-02-01
The genome of Aspergillus niger codes for a fusion protein (EHA25900), which can be aligned with ~50% sequence identity to 9S-dioxygenase (DOX)-allene oxide synthase (AOS) of Fusarium oxysporum, homologues of the Fusarium and Colletotrichum complexes and with over 62% sequence identity to homologues of Aspergilli, including (DOX)-9R-AOS of Aspergillus terreus. The aims were to characterize the enzymatic activities of EHA25900 and to identify crucial amino acids for the stereospecificity. Recombinant EHA25900 oxidized 18:2n-6 sequentially to 9R-hydroperoxy-10(E),12(Z)-octadecadienoic acid (9R-HPODE) and to a 9R(10)-allene oxide. 9S- and 9R-DOX-AOS catalyze abstraction of the pro-R hydrogen at C-11, but the direction of oxygen insertion differs. A comparison between twelve 9-DOX domains of 9S- and 9R-DOX-AOS revealed conserved amino acid differences, which could contribute to the chirality of products. The Gly616Ile replacement of 9R-DOX-AOS (A. niger) increased the biosynthesis of 9S-HPODE and the 9S(10)-allene oxide, whereas the Phe627Leu replacement led to biosynthesis of 9S-HPODE and the 9S(10)-allene oxide as main products. The double mutant (Gly616Ile, Phe627Leu) formed over 90% of the 9S stereoisomer of HPODE. 9S-HPODE was formed by antarafacial hydrogen abstraction and oxygen insertion, i.e., the original H-abstraction was retained but the product chirality was altered. We conclude that 9R-DOX-AOS can be altered to 9S-DOX-AOS by replacement of two amino acids (Gly616Ile, Phe627Leu) in the DOX domain. Copyright © 2015 Elsevier B.V. All rights reserved.
Glutamic acid as anticancer agent: An overview.
Dutta, Satyajit; Ray, Supratim; Nagarajan, K
2013-10-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.
CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.
Busi, Florent; Cresteil, Thierry
2005-09-01
The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.
Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J
2008-01-28
Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of
Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke
2008-08-01
Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.
Triacetic acid lactone production from Saccharomyces cerevisiae
Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...
Directory of Open Access Journals (Sweden)
Soundharrajan Ilavenil
2015-08-01
Full Text Available Synthetic drugs are commonly used to cure various human ailments at present. However, the uses of synthetic drugs are strictly regulated because of their adverse effects. Thus, naturally occurring molecules may be more suitable for curing disease without unfavorable effects. Therefore, we investigated phenyllactic acid (PLA from Lactobacillus plantarum with respect to its effects on adipogenic genes and their protein expression in 3T3-L1 pre-adipocytes by qPCR and western blot techniques. PLA enhanced differentiation and lipid accumulation in 3T3-L1 cells at the concentrations of 25, 50, and 100 μM. Maximum differentiation and lipid accumulation were observed at a concentration of 100 μM of PLA, as compared with control adipocytes (p < 0.05. The mRNA and protein expression of PPAR-γ2, C/EBP‑α, adiponectin, fatty acid synthase (FAS, and SREBP-1 were increased by PLA treatment as compared with control adipocytes (p < 0.05. PLA stimulates PPAR-γ mRNA expression in a concentration dependent manner, but this expression was lesser than agonist (2.83 ± 0.014 fold of PPAR-γ2. Moreover, PLA supplementation enhances glucose uptake in 3T3-L1 pre-adipocytes (11.81 ± 0.17 mM compared to control adipocytes, but this glucose uptake was lesser than that induced by troglitazone (13.75 ± 0.95 mM and insulin treatment (15.49 ± 0.20 mM. Hence, we conclude that PLA treatment enhances adipocyte differentiation and glucose uptake via activation of PPAR-γ2, and PLA may thus be the potential candidate for preventing Type 2 Diabetes Mellitus (T2DM.
Nitric oxide production from macrophages is regulated by arachidonic acid metabolites.
Imai, Y; Kolb, H; Burkart, V
1993-11-30
In activated macrophages the inducible form of the enzyme nitric oxide (NO) synthase generates high amounts of the toxic mediator NO. After 20 h of treatment with LPS rat peritoneal macrophages release 12-16 nmol NO2-/10(5) cells which is detectable in the culture supernatant by the Griess reaction as a measure of NO formation. The addition of aminoguanidine (1 mM), a preferential inhibitor of the inducible NO-synthase, completely abolished NO2-accumulation. Incubation with indomethacin or acetyl-salicylic acid, preferential inhibitors of the cyclooxygenase pathway of the arachidonic acid metabolism, did not influence NO2- levels. Nordihydro-guaiaretic acid (50 microM), a preferential inhibitor of the lipoxygenase pathway, caused strong reduction of NO2- accumulation to 1.9 +/- 0.3 nmol/200 microliter. Simultaneous inhibition of cyclo- and lipoxygenase by BW755c resulted in an intermediate effect (7.3 +/- 1.1 nmol/200 microliter NO2-). These results show that the induction of NO production in activated macrophages is regulated by products of the lipoxygenase-pathway of the arachidonic acid metabolism.
Directory of Open Access Journals (Sweden)
Ehsan Karimi
2012-11-01
Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
Directory of Open Access Journals (Sweden)
Qiong Liao
2016-06-01
Full Text Available AIM: To clarify how the endothelial nitric oxide synthase (eNOS, NOS3 make effect on outflow facility through the trabecular meshwork (TM. METHODS: Inhibition of NOS3 gene expression in human TM cells were conducted by three siRNAs. Then the mRNA and protein levels of NOS3 in siRNA-treated and negative control (NC cells were determined, still were the collagen, type IV, alpha 1 (COL4A1 and fibronectin 1 by real-time PCR and Western blot analysis. In addition, NOS3 concentrations in culture supernatant fluids of TM cells were measured. Cell cycle and cell apoptosis analysis were performed using flow cytometry. RESULTS: The mRNA level of NOS3 was decreased by three different siRNA interference, similar results were obtained not only of the relative levels of NOS3 protein, but also the expression levels of COL4A1 and fibronectin 1. The number of cells in S phase was decreased, while contrary result was obtained in G2 phase. The number of apoptotic cells in siRNA-treated groups were significant increased compared to the NC samples. CONCLUSION: Abnormal NOS3 expression can make effects on the proteins levels of extracellular matrix component (e.g. fibronectin 1 and COL4A1. Reduced NOS3 restrains the TM cell cycle progression at the G2/M-phase transition and induced cell apoptosis.
Georgiou, Tassos; Wen, Yao-Tseng; Chang, Chung-Hsing; Kolovos, Panagiotis; Kalogerou, Maria; Prokopiou, Ekatherine; Neokleous, Anastasia; Huang, Chin-Te; Tsai, Rong-Kung
2017-03-01
The purpose of this study was to investigate the therapeutic effect of omega-3 polyunsaturated fatty acid (ω-3 PUFA) administration in a rat model of anterior ischemic optic neuropathy (rAION). The level of blood arachidonic acid/eicosapentaenoic acid (AA/EPA) was measured to determine the suggested dosage. The rAION-induced rats were administered fish oil (1 g/day EPA) or phosphate-buffered saline (PBS) by daily gavage for 10 consecutive days to evaluate the neuroprotective effects. Blood fatty acid analysis showed that the AA/EPA ratio was reduced from 17.6 to ≤1.5 after 10 days of fish oil treatment. The retinal ganglion cell (RGC) densities and the P1-N2 amplitude of flash visual-evoked potentials (FVEP) were significantly higher in the ω-3 PUFA-treated group, compared with the PBS-treated group (P optic nerve (ON) by 3.17-fold in the rAION model. The M2 macrophage markers, which decrease inflammation, were induced in the ω-3 PUFA-treated group in contrast to the PBS-treated group. In addition, the mRNA levels of tumor necrosis factor-alpha, interleukin-1 beta, and inducible nitric oxide synthase were significantly reduced in the ω-3 PUFA-treated group. The administration of ω-3 PUFAs has neuroprotective effects in rAION, possibly through dual actions of the antiapoptosis of RGCs and anti-inflammation via decreasing inflammatory cell infiltration, as well as the regulation of macrophage polarization to decrease the cytokine-induced injury of the ON.
International Nuclear Information System (INIS)
Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo
1988-01-01
Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged
Directory of Open Access Journals (Sweden)
Ning Xia
2014-03-01
Full Text Available Artichoke (Cynara scolymus L. is one of the world’s oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC. Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1–100 µg/mL, 6 h or 24 h. Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.
Xia, Ning; Pautz, Andrea; Wollscheid, Ursula; Reifenberg, Gisela; Förstermann, Ulrich; Li, Huige
2014-03-24
Artichoke (Cynara scolymus L.) is one of the world's oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS) in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC). Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1-100 µg/mL, 6 h or 24 h). Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside) led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.
International Nuclear Information System (INIS)
Nakanaga, Kazue; Maeda, Shinji; Matsuoka, Masanori; Kashiwabara, Yoshiko
2000-01-01
Since RNase protection assay (RPA) system for specific detection of mRNA from M. lepra was established in the previous year, modification of the system was attempted to detect a trace amount of mRNA in this study. Thus, RNA amplification was examined using nucleic aid sequence-based amplification method (NASBA). Since 32 P CTP was used as an isotope for synthesis of anti-sense RNA probe in the previous method, the label compound was exchanged to that with a lower energy in this study, resulting that the half life of the probe was increased and handling of the probe became easier. Several short bands consisting of 100-130b were detected in total RNA sample of M.marinum and M.choelonae by RPA using T1 probe (194-762, 580b). Whereas the new probe M1 detected longer bands of about 350b from M.marinum RNA and of 250b from M.chelonae, M. bovis BCG and M. kansaii. However, T1 probe was more suitable for specific detection of M.leprae hsp 65 than M1 probe because high and low homogeneous regions are coexisting in the gene. Specific mRNA was detectable from only 3 pg of total RNA by the use of NASBA. RNA recovery for QIAGEN was about 50%, however, the sensitivity of NASBA method was estimated to be several ten to hundred thousands times higher, suggesting that this method is very effective for detection and determination of trace amount of mRNA. (M.N.)
Energy Technology Data Exchange (ETDEWEB)
Nakanaga, Kazue; Maeda, Shinji; Matsuoka, Masanori; Kashiwabara, Yoshiko [National Inst. of Infectious Deseases, Tokyo (Japan)
2000-02-01
Since RNase protection assay (RPA) system for specific detection of mRNA from M. lepra was established in the previous year, modification of the system was attempted to detect a trace amount of mRNA in this study. Thus, RNA amplification was examined using nucleic aid sequence-based amplification method (NASBA). Since {sup 32}P CTP was used as an isotope for synthesis of anti-sense RNA probe in the previous method, the label compound was exchanged to that with a lower energy in this study, resulting that the half life of the probe was increased and handling of the probe became easier. Several short bands consisting of 100-130b were detected in total RNA sample of M.marinum and M.choelonae by RPA using T1 probe (194-762, 580b). Whereas the new probe M1 detected longer bands of about 350b from M.marinum RNA and of 250b from M.chelonae, M. bovis BCG and M. kansaii. However, T1 probe was more suitable for specific detection of M.leprae hsp 65 than M1 probe because high and low homogeneous regions are coexisting in the gene. Specific mRNA was detectable from only 3 pg of total RNA by the use of NASBA. RNA recovery for QIAGEN was about 50%, however, the sensitivity of NASBA method was estimated to be several ten to hundred thousands times higher, suggesting that this method is very effective for detection and determination of trace amount of mRNA. (M.N.)
Park, Kiyun; Kwak, Inn-Sil
2012-12-01
The objective of this study was conducted to identify the possibility of using Chironomus metallothionein (MT) and vitellogenin (VTG) as biomarkers of stress caused by endocrinedisrupting chemicals (EDCs), heavy metals, herbicides and veterinary antibiotics. We characterized the MT and VTG cDNA in Chironomus riparius and evaluated their mRNA expression profiles following exposure to different environmental pollutants. The gene expression analysis showed that the MT mRNA levels increased significantly after long-term exposure to cadmium (Cd), copper (Cu), Lead (Pb), di(2-ethylhexyl) phthalate (DEHP), and 2,4-dichlorophenoxyacetic acid (2,4-D). Moreover, the VTG mRNA expression increased significantly in C. riparius larvae exposed to BPA, NP, DEHP, Cd, 2,4-D and fenbendazole. Evaluation of the long-term effects of environmental pollutants revealed up regulation of Chironomus MT mRNA in response to DEHP exposure among EDCs, and the level of the VTG mRNA was increased significantly following treatment with Cd and herbicide 2,4-D at all concentrations in a dose-dependent manner. These results indicate that VTG could be used as a potential biomarker of herbicide and Cd as well as EDCs, while MT was a potential biomarker of heavy metals such as Cd, Cu, and Pb in aquatic environments.
International Nuclear Information System (INIS)
Miziorko, H.M.; Behnke, C.E.
1985-01-01
3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue
Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A
2002-11-01
Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.
Directory of Open Access Journals (Sweden)
Donald B Bloch
Full Text Available The mRNA processing body (P-body is a cellular structure that regulates the stability of cytoplasmic mRNA. MARF1 is a murine oocyte RNA-binding protein that is associated with maintenance of mRNA homeostasis and genomic stability. In this study, autoantibodies were used to identify Limkain B (LMKB, the human orthologue of MARF1, as a P-body component. Indirect immunofluorescence demonstrated that Ge-1 (a central component of the mammalian core-decapping complex co-localized with LMKB in P-bodies. Two-hybrid and co-immunoprecipitation assays were used to demonstrate interaction between Ge-1 and LMKB. The C-terminal 120 amino acids of LMKB mediated interaction with Ge-1 and the N-terminal 1094 amino acids of Ge-1 were required for interaction with LMKB. LMKB is the first protein identified to date that interacts with this portion of Ge-1. LMKB was expressed in human B and T lymphocyte cell lines; depletion of LMKB increased expression of IFI44L, a gene that has been implicated in the cellular response to Type I interferons. The interaction between LMKB/MARF1, a protein that contains RNA-binding domains, and Ge-1, which interacts with core-decapping proteins, suggests that LMKB has a role in the regulation of mRNA stability. LMKB appears to have different functions in different cell types: maintenance of genomic stability in developing oocytes and possible dampening of the inflammatory response in B and T cells.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K
2001-01-01
The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes.
Jones, Sophie; Sutherland, Colin J; Hermsen, Cornelus; Arens, Theo; Teelen, Karina; Hallett, Rachel; Corran, Patrick; van der Vegte-Bolmer, Marga; Sauerwein, Robert; Drakeley, Chris J; Bousema, Teun
2012-08-08
Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA) and reverse-transcriptase PCR (RT-PCR). Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (pFTA Classic Card but not the 903 Protein Saver Card or Whatman 3MM filter paper. The sensitivity of gametocyte detection was decreased when papers were stored at high humidity. This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Palmitate attenuates osteoblast differentiation of fetal rat calvarial cells
Energy Technology Data Exchange (ETDEWEB)
Yeh, Lee-Chuan C.; Ford, Jeffery J. [Department of Biochemistry, The University of Texas Health Science Center at San Antonio, TX (United States); Lee, John C. [Department of Biochemistry, The University of Texas Health Science Center at San Antonio, TX (United States); The Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, TX (United States); Adamo, Martin L., E-mail: adamo@biochem.uthscsa.edu [Department of Biochemistry, The University of Texas Health Science Center at San Antonio, TX (United States); The Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, TX (United States)
2014-07-18
Highlights: • Palmitate inhibits osteoblast differentiation. • Fatty acid synthase. • PPARγ. • Acetyl Co-A carboxylase inhibitor TOFA. • Fetal rat calvarial cell culture. - Abstract: Aging is associated with the accumulation of ectopic lipid resulting in the inhibition of normal organ function, a phenomenon known as lipotoxicity. Within the bone marrow microenvironment, elevation in fatty acid levels may produce an increase in osteoclast activity and a decrease in osteoblast number and function, thus contributing to age-related osteoporosis. However, little is known about lipotoxic mechanisms in intramembraneous bone. Previously we reported that the long chain saturated fatty acid palmitate inhibited the expression of the osteogenic markers RUNX2 and osteocalcin in fetal rat calvarial cell (FRC) cultures. Moreover, the acetyl CoA carboxylase inhibitor TOFA blocked the inhibitory effect of palmitate on expression of these two markers. In the current study we have extended these observations to show that palmitate inhibits spontaneous mineralized bone formation in FRC cultures in association with reduced mRNA expression of RUNX2, alkaline phosphatase, osteocalcin, and bone sialoprotein and reduced alkaline phosphatase activity. The effects of palmitate on osteogenic marker expression were inhibited by TOFA. Palmitate also inhibited the mRNA expression of fatty acid synthase and PPARγ in FRC cultures, and as with osteogenic markers, this effect was inhibited by TOFA. Palmitate had no effect on FRC cell proliferation or apoptosis, but inhibited BMP-7-induced alkaline phosphatase activity. We conclude that palmitate accumulation may lead to lipotoxic effects on osteoblast differentiation and mineralization and that increases in fatty acid oxidation may help to prevent these lipotoxic effects.
Palmitate attenuates osteoblast differentiation of fetal rat calvarial cells
International Nuclear Information System (INIS)
Yeh, Lee-Chuan C.; Ford, Jeffery J.; Lee, John C.; Adamo, Martin L.
2014-01-01
Highlights: • Palmitate inhibits osteoblast differentiation. • Fatty acid synthase. • PPARγ. • Acetyl Co-A carboxylase inhibitor TOFA. • Fetal rat calvarial cell culture. - Abstract: Aging is associated with the accumulation of ectopic lipid resulting in the inhibition of normal organ function, a phenomenon known as lipotoxicity. Within the bone marrow microenvironment, elevation in fatty acid levels may produce an increase in osteoclast activity and a decrease in osteoblast number and function, thus contributing to age-related osteoporosis. However, little is known about lipotoxic mechanisms in intramembraneous bone. Previously we reported that the long chain saturated fatty acid palmitate inhibited the expression of the osteogenic markers RUNX2 and osteocalcin in fetal rat calvarial cell (FRC) cultures. Moreover, the acetyl CoA carboxylase inhibitor TOFA blocked the inhibitory effect of palmitate on expression of these two markers. In the current study we have extended these observations to show that palmitate inhibits spontaneous mineralized bone formation in FRC cultures in association with reduced mRNA expression of RUNX2, alkaline phosphatase, osteocalcin, and bone sialoprotein and reduced alkaline phosphatase activity. The effects of palmitate on osteogenic marker expression were inhibited by TOFA. Palmitate also inhibited the mRNA expression of fatty acid synthase and PPARγ in FRC cultures, and as with osteogenic markers, this effect was inhibited by TOFA. Palmitate had no effect on FRC cell proliferation or apoptosis, but inhibited BMP-7-induced alkaline phosphatase activity. We conclude that palmitate accumulation may lead to lipotoxic effects on osteoblast differentiation and mineralization and that increases in fatty acid oxidation may help to prevent these lipotoxic effects
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...
Directory of Open Access Journals (Sweden)
Scott B. Shappell
2001-01-01
Full Text Available Recent studies in prostate tissues and especially cell lines have suggested roles for arachidonic acid (AA metabolizing enzymes in prostate adenocarcinoma (Pca development or progression. The goal of this study was to more fully characterize lipoxygenase (LOX and cyclooxygenase-2 (COX-2 gene expression and AA metabolism in benign and malignant prostate using snap-frozen tissues obtained intraoperatively and mRNA analyses and enzyme assays. Formation of 15-hydroxyeicosatetraenoic acid (15-HETE was detected in 23/29 benign samples and 15-LOX-2 mRNA was detected in 21/25 benign samples. In pairs of pure benign and Pca from the same patients, 15-HETE production and 15-LOX-2 mRNA were reduced in Pca versus benign in 9/14 (P=.04 and 14/17 (P=.002, respectively. Under the same conditions, neither 5HETE nor 12-HETE formation was detectable in 29 benign and 24 tumor samples; with a more sensitive assay, traces were detected in some samples, but there was no clear association with tumor tissue. COX-2 mRNA was detected by nuclease protection assay in 7/16 benign samples and 5/16 tumors. In benign and tumor pairs from 10 patients, COX-2 was higher in tumor versus benign in only 2, with similar results by in situ hybridization. Paraffin immunoperoxidase for COX2 was performed in whole mount sections from 87 additional radical prostatectomy specimens, with strong expression in ejaculatory duct as a positive control and corroboration with in situ hybridization. No immunostaining was detected in benign prostate or tumor in 45% of cases. Greater immunostaining in tumor versus benign was present in only 17% of cases, and correlated with high tumor grade (Gleason score 8 and 9 vs. 5 to 7. In conclusion, reduced 15-LOX-2 expression and 15-HETE formation is the most characteristic alteration of AA metabolism in Pca. Increased 12-HETE and 5-HETE formation in Pca were not discernible. Increased COX-2 expression is not a typical abnormality in Pca in general, but
International Nuclear Information System (INIS)
Ökvist, Mats; Sasso, Severin; Roderer, Kathrin; Kast, Peter; Krengel, Ute
2009-01-01
Two shikimate-pathway enzymes from M. tuberculosis, the intracellular chorismate mutase (MtCM) and DAHP synthase (MtDS), were produced recombinantly and purified. MtCM was crystallized alone and in complex with MtDS and analyzed by X-ray diffraction. Chorismate mutase catalyzes a key step in the shikimate-biosynthetic pathway and hence is an essential enzyme in bacteria, plants and fungi. Mycobacterium tuberculosis contains two chorismate mutases, a secreted and an intracellular one, the latter of which (MtCM; Rv0948c; 90 amino-acid residues; 10 kDa) is the subject of this work. Here are reported the gene expression, purification and crystallization of MtCM alone and of its complex with another shikimate-pathway enzyme, DAHP synthase (MtDS; Rv2178c; 472 amino-acid residues; 52 kDa), which has been shown to enhance the catalytic efficiency of MtCM. The MtCM–MtDS complex represents the first noncovalent enzyme complex from the common shikimate pathway to be structurally characterized. Soaking experiments with a transition-state analogue are also reported. The crystals of MtCM and the MtCM–MtDS complex diffracted to 1.6 and 2.1 Å resolution, respectively
Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G
1998-06-09
Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.
Substrate promiscuity of a rosmarinic acid synthase from lavender (Lavandula angustifolia L.).
Landmann, Christian; Hücherig, Stefanie; Fink, Barbara; Hoffmann, Thomas; Dittlein, Daniela; Coiner, Heather A; Schwab, Wilfried
2011-08-01
One of the most common types of modification of secondary metabolites is the acylation of oxygen- and nitrogen-containing substrates to produce esters and amides, respectively. Among the known acyltransferases, the members of the plant BAHD family are capable of acylating a wide variety of substrates. Two full-length acyltransferase cDNAs (LaAT1 and 2) were isolated from lavender flowers (Lavandula angustifolia L.) by reverse transcriptase-PCR using degenerate primers based on BAHD sequences. Recombinant LaAT1 exhibited a broad substrate tolerance accepting (hydroxy)cinnamoyl-CoAs as acyl donors and not only tyramine, tryptamine, phenylethylamine and anthranilic acid but also shikimic acid and 4-hydroxyphenyllactic acid as acceptors. Thus, LaLT1 forms esters and amides like its phylogenetic neighbors. In planta LaAT1 might be involved in the biosynthesis of rosmarinic acid, the ester of caffeic acid and 3,4-dihydroxyphenyllactic acid, a major constituent of lavender flowers. LaAT2 is one of three members of clade VI with unknown function.
International Nuclear Information System (INIS)
Curtis, A.; Szelke, M.; Fink, G.
1986-01-01
Large precursors have also been predicted using the immunoprecipitation technique which relies upon the identification of large immunoreactive molecules following in vitro translation of mRNA. The mRNA is presumed to represent the largest form of a nascent precursor polypeptide molecule irrespective of the number of biosynthetic cleavage steps which are necessary to liberate the active peptide. However, as has been shown for somatostatin, nonprotein modifications may be made which apparently increase molecular weight, such as glycosylation or phosphorylation of the molecule. The authors employed the immunoprecipitation technique to confirm earlier chromatographic studies that the hypothalamic decapeptide, luteinizing hormone releasing hormone (LHRH) is also synthesized by way of a large precursor form. The authors' finding show that the translation of hypothalamic mRNA produces a primary translation product with an apparent molecule weight of 28,000 which contains an amino acid sequence immunologically similar to that of biologically active LHRH. The procedure involved the incorporation of a radioactive amino acid into polypeptides synthesized by in vitro translation of hypothalamic messenger RNA. The resulting complex protein mixture was immunoprecipitated with a specific anti-LHRH serum, and the immunoprecipitate was identified by polyacrylamide gel electrophoresis and autoradiography
The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.
Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra
2016-04-01
The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae
2007-01-01
In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...
International Nuclear Information System (INIS)
Han, J.H.; Stratowa, C.; Rutter, W.J.
1987-01-01
The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase
Effects of cavernous nerve reconstruction on expression of nitric oxide synthase isoforms in rats.
Schlenker, Boris; Matiasek, Kaspar; Saur, Dieter; Gratzke, Christian; Bauer, Ricarda M; Herouy, Yared; Arndt, Christian; Blesch, Armin; Hartung, Rudolf; Stief, Christian G; Weidner, Norbert; May, Florian
2010-12-01
To evaluate the expression of nitric oxide synthase (NOS) isoforms after various reconstruction techniques in rats, to improve the understanding of neuronal repair mechanisms after radical prostatectomy, as Schwann cell-seeded guidance tubes have been shown to promote cavernous nerve regeneration, and glial cell-line-derived neurotrophic factor (GDNF)-overexpressing Schwann cells enhance nerve regenerative capacity. Segments (5 mm) of the cavernous nerve were excised bilaterally, followed by immediate bilateral microsurgical reconstruction. In four rats per group, the eight nerves were reconstructed by autologous nerve grafting (A), interposition of Schwann cell-seeded silicon tubes (B), or silicon tubes seeded with GDNF-hypersecreting Schwann cells (C). Further rats were either sham-operated (D) or had nerve excision without repair (E). Erectile function was evaluated after 6 weeks by re-laparotomy, electrical nerve stimulation and morphological evaluation of reconstructed nerves. NOS isoform mRNA expression was analysed by reverse transcription-polymerase chain reaction in tissue specimens taken from the corpora cavernosa. GDNF-transduced Schwann cell grafts restored erectile function better than untransduced Schwann cell and autologous nerve grafts (88% vs 75% vs 38%; not significant). Tissue specimens in group C had the highest expression of neuronal NOS mRNA in relation to the neuronal marker PGP9.5 among all treatment groups (not significant). Compared to nerve grafts (A) and negative controls (E) nNOS/PGP9.5 expression was significantly higher (P Schwann cell grafts (P < 0.05). Restoration of erectile function is paralleled by an increase of neuronal NOS expression in rats. Further experiments will determine the physiological role of neuronal NOS in erectile nerve repair processes. © 2010 THE AUTHORS. JOURNAL COMPILATION © 2010 BJU INTERNATIONAL.
Directory of Open Access Journals (Sweden)
Vallbohmer Daniel
2009-05-01
Full Text Available Abstract Background Thymidylate synthase (TS is known to have a unique 28 bp tandemly repeated sequence in the promoter region, and the majorities of subjects have a heterozygous double repeat/triple repeat genotype in their non-cancerous tissue. Loss of heterozygosity (LOH at the TS locus is known to occur in cancer patients, but there is no evidence that it is present in precancerous tissue. The aim of this study was to analyze the frequency and timing of LOH at the TS locus in Barrett-associated adenocarcinoma (BA and its precursory lesions, such as intestinal metaplasia (IM and dysplasia. Methods One hundred twenty-three samples (including 37 with gastroesophageal reflux disease (GERD, 29 with IM, 13 with dysplasia, and 44 with BA were obtained from 100 patients. Biopsies were obtained from the lower esophageal mucosa/IM/dysplasia/BA, when available. Normal squamous tissue from the upper esophagus was taken as a control. All tissues were analyzed for the TS genotype and TS mRNA expression using the real-time reverse-transcription polymerase chain reaction (RT-PCR method after laser-capture microdissection. Results Among the patients with informative heterozygous genotype in their control samples, no sample with LOH at the TS locus was observed in the lower esophageal mucosa in GERD patients (0/22 samples. However, 6 out of 21 samples (28.6% had LOH in IM, 2 of 7 (28.6% in dysplasia, and 10 of 25 (40.0% in BA. No significant difference in TS mRNA expression levels was observed between TS genotypes. Conclusion Our results demonstrate that LOH is a relatively frequent and early event in the IM-BA sequence.
Directory of Open Access Journals (Sweden)
S. Suresh
2016-01-01
Full Text Available The molecular structure of the three compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III has been determined using Gaussian 03W program with B3LYP method using 6-311++G (d,p basis set calculations. The molecular structures were fully optimized with atomic numbering scheme adopted in the study. To understand the mode of binding and molecular interaction, the docking studies of compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III have been carried out with prostaglandin H2 synthase-1 (1PGE as target using induced fit docking. The molecular docking results show that the interactions and energy for Aceclofenac, Salicylic Acid, and Piroxicam show the best results when docked with prostaglandin H2 synthase-1 (1PGE. The hydrogen bonding interactions of compound I (Aceclofenac are prominent with Arginine moiety, those of compound II (Salicylic Acid are prominent with Tyrosine and Serine moieties, and compound III (Piroxicam shows such interaction with Tyrosine and Arginine moieties. These interactions of prostaglandin H2 synthase-1 (1PGE with substrates are responsible for governing COX-1 inhibitor potency which in turn is a direct measure of the potency of the drug.
Cytochrome P450-2C11 mRNA is not expressed in endothelial cells dissected from rat renal arterioles.
Heil, Sandra G; De Vriese, An S; Kluijtmans, Leo A J; Dijkman, Henry; van Strien, Denise; Akkers, Robert; Blom, Henk J
2005-01-01
Cytochrome P450 (CYP) isoenzymes (CYP2C and CYP2J) are involved in the production of epoxyeicosatrienoic acids, which are postulated as endothelium-derived hyperpolarizing factors (EDHFs). We hypothesized that if CYP2C11 is involved in the EDHF-mediated responses, its mRNA should be expressed in endothelial cells. We, therefore, examined the mRNA expression of CYP2C11 in endothelial cells of renal arterioles. Laser microdissection was applied to isolate endothelial cells from the renal arterioles of 4 male and 4 female Wistar rats. As a positive control of CYP2C11 expression, hepatocytes were also dissected from these rats. RNA was isolated and real-time quantitative polymerase chain reaction (Q-PCR) analysis was applied. Q-PCR analysis showed that CYP2C11 mRNA was not expressed in laser microdissected endothelial cells of renal arterioles of male and female rats. CYP2C11 mRNA expression was highly abundant in hepatocytes dissected from male livers, but in female livers hardly any CYP2C11 mRNA was detected. We have shown that endothelial cells can be dissected from small renal arterioles by laser microdissection to study the mRNA expression of specific genes by Q-PCR. Using this novel tool, we demonstrated that the CYP2C11 mRNA was not expressed in the endothelial cells of renal arterioles. Therefore, we speculate that CYP2C11 does not contribute to the EDHF-mediated responses in renal arterioles. Copyright (c) 2005 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Astrid Ardiyanti
2012-08-01
Full Text Available Two SNPs, i.e. L127V and T172M, of bovine growth hormone (GH causing the presence of GH gene haplotypes A, B, and C was previously shown to alter intramuscular fatty acid (FA composition in Japanese Black (JB heifers. To determine the SNP effect on somatotropic hormone concentration and lipogenesis, we measured plasma GH, insulin, and insulin-like growth factor-1 (IGF-1 concentrations. We also measured mRNA levels of fatty acid synthase (FASN, stearoyl-coA desaturase (SCD, and sterol regulatory element binding proteins-1 (SREBP-1 and FA composition in diaphragm tissues. Heifers with genotype CC had the lowest plasma insulin concentration and FASN and SCD mRNA levels among genotypes. FASN mRNA levels in haplotype A tended to positively correlate with saturated FA (SFA content and negatively correlated with C18:2 and unsaturated FA (USFA contents. SCD mRNA levels in haplotype A positively correlated with monounsaturated FA (MUFA contents and negatively correlated with C18:0 content. They also tended to positively correlate with C16:1, C18:1, and USFA contents and USFA/SFA ratio and negatively correlate with SFA content. Taken together, GH gene polymorphism affects the lipogenic genes expression levels and their relationships with fatty acid compositions in diaphragm tissues of JB heifers at 31 months of age.
mRNA localization mechanisms in Trypanosoma cruzi.
Directory of Open Access Journals (Sweden)
Lysangela R Alves
Full Text Available Asymmetric mRNA localization is a sophisticated tool for regulating and optimizing protein synthesis and maintaining cell polarity. Molecular mechanisms involved in the regulated localization of transcripts are widespread in higher eukaryotes and fungi, but not in protozoa. Trypanosomes are ancient eukaryotes that branched off early in eukaryote evolution. We hypothesized that these organisms would have basic mechanisms of mRNA localization. FISH assays with probes against transcripts coding for proteins with restricted distributions showed a discrete localization of the mRNAs in the cytoplasm. Moreover, cruzipain mRNA was found inside reservosomes suggesting new unexpected functions for this vacuolar organelle. Individual mRNAs were also mobilized to RNA granules in response to nutritional stress. The cytoplasmic distribution of these transcripts changed with cell differentiation, suggesting that localization mechanisms might be involved in the regulation of stage-specific protein expression. Transfection assays with reporter genes showed that, as in higher eukaryotes, 3'UTRs were responsible for guiding mRNAs to their final location. Our results strongly suggest that Trypanosoma cruzi have a core, basic mechanism of mRNA localization. This kind of controlled mRNA transport is ancient, dating back to early eukaryote evolution.
Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg
2010-01-01
The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase
International Nuclear Information System (INIS)
Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.
2016-01-01
The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)
David-Schwartz, Rakefet; Runo, Steven; Townsley, Brad; Machuka, Jesse; Sinha, Neelima
2008-01-01
It has been shown that the parasitic plant dodder (Cuscuta pentagona) establishes a continuous vascular system through which water and nutrients are drawn. Along with solutes, viruses and proteins, mRNA transcripts are transported from the host to the parasite. The path of the transcripts and their stability in the parasite have yet to be revealed. To discover the route of mRNA transportation, the in situ reverse transcriptase-polymerase chain reaction (RT-PCR) technique was used to locally amplify host transcript within parasitic tissue. The stability of host mRNA molecules was also checked by monitoring specific transcripts along the growing dodder thread. Four mRNAs, alpha and beta subunits of PYROPHOSPHATE (PPi)-DEPENDENT PHOSPHOFRUCTOKINASE (LePFP), the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), and GIBBERELLIC ACID INSENSITIVE (LeGAI), were found to move from host (tomato (Solanum lycopersicum)) to dodder. LePFP mRNA was localized to the dodder parenchyma cells and to the phloem. LePFP transcripts were found in the growing dodder stem up to 30 cm from the tomato-dodder connection. These results suggest that mRNA molecules are transferred from host to parasite via symplastic connections between parenchyma cells, move towards the phloem, and are stable for a long distance in the parasite. This may allow developmental coordination between the parasite and its host.
Król, P; Igielski, R; Pollmann, S; Kępczyńska, E
2015-05-01
Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Sihto, Henna-Maria; Tasara, Taurai; Stephan, Roger; Johler, Sophia
2014-07-01
Staphylococcus aureus represents the most prevalent cause of food-borne intoxications worldwide. While being repressed by competing bacteria in most matrices, this pathogen exhibits crucial competitive advantages during growth at high salt concentrations or low pH, conditions frequently encountered in food production and preservation. We aimed to identify reference genes that could be used to normalize qPCR mRNA expression levels during growth of S. aureus in food-related osmotic (NaCl) and acidic (lactic acid) stress adaptation models. Expression stability of nine housekeeping genes was evaluated in full (LB) and nutrient-deficient (CYGP w/o glucose) medium under conditions of osmotic (4.5% NaCl) and acidic stress (lactic acid, pH 6.0) after 2-h exposure. Among the set of candidate reference genes investigated, rplD, rpoB,gyrB, and rho were most stably expressed in LB and thus represent the most suitable reference genes for normalization of qPCR data in osmotic or lactic acid stress models in a rich medium. Under nutrient-deficient conditions, expression of rho and rpoB was highly stable across all tested conditions. The presented comprehensive data on changes in expression of various S. aureus housekeeping genes under conditions of osmotic and lactic acid stress facilitate selection of reference genes for qPCR-based stress response models. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
Yun, Seok Joong; Yan, Chunri; Jeong, Pildu; Kang, Ho Won; Kim, Ye-Hwan; Kim, Eun-Ah; Lee, Ok-Jun; Kim, Won Tae; Moon, Sung-Kwon; Kim, Isaac Yi; Choi, Yung-Hyun; Kim, Wun-Jae
2015-07-01
Infections and inflammation in the prostate play a critical role in carcinogenesis, and S100A8 and S100A9 are key mediators in acute and chronic inflammation. Therefore, we investigated the differences of S100A8/A9 expression between prostate cancer (CaP) and benign prostatic hyperplasia (BPH) tissues, and we evaluated the possibilities of urinary nucleic acids of S100A8/A9 as diagnostic and prognostic markers. Tissues from 132 CaP patients who underwent prostatectomy or transurethral resection and 90 BPH patients who underwent transurethral prostatectomy were assessed.sd In addition, S100A8 and S100A9 nucleic acid levels were measured in the urine of 283 CaP patients and 363 BPH controls. S100A8 and S100A9 mRNA levels were lower in CaP than BPH tissues (P BPH tissues stained more strongly for both S100A8 and S100A9 than CaP tissues (P BPH (P = 0.001 and BPH. Both were more highly expressed in patients with aggressive disease and shorter biochemical recurrence-free time. S100A8/A9 urinary cell-free nucleic acid levels correlated positively with expression levels obtained from tissue staining. Therefore, S100A8/A9 measurement in tissues and urine may have diagnostic and prognostic value in CaP.
A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.
Directory of Open Access Journals (Sweden)
Sarah Schulz
Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.
Directory of Open Access Journals (Sweden)
Sheo B Singh
Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.
International Nuclear Information System (INIS)
Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.
1986-01-01
Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.