
Sample records for acid synthase impacts

  1. Effects and mechanism of acid rain on plant chloroplast ATP synthase. (United States)

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua


    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  2. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)


    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  3. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)


    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  4. Inhibitors of Fatty Acid Synthase for Prostate Cancer (United States)


    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  5. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision (United States)


    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  6. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny


    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  7. Subunit–subunit interactions are weakened in mutant forms of acetohydroxy acid synthase insensitive to valine inhibition

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.


    Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010

  8. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)


    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  9. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi


    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  10. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)



    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  11. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    International Nuclear Information System (INIS)

    Dotson, G.D.; Woodard, R.W.


    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

  12. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)


    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  13. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)


    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  14. Expanding the product portfolio of fungal type I fatty acid synthases

    DEFF Research Database (Denmark)

    Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia


    Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...

  15. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng


    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  16. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)


    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  17. Surface exposed amino acid differences between mesophilic and thermophilic phosphoribosyl diphosphate synthase

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; McGuire, James N


    The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...

  18. Production of Medium Chain Fatty Acids by Yarrowia lipolytica: Combining Molecular Design and TALEN to Engineer the Fatty Acid Synthase. (United States)

    Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence


    Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.

  19. Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial. Addendum (United States)


    controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the

  20. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.


    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  1. Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins

    Directory of Open Access Journals (Sweden)

    Manuel Fischer


    Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.

  2. Interleukin-2-induced survival of natural killer (NK) cells involving phosphatidylinositol-3 kinase-dependent reduction of ceramide through acid sphingomyelinase, sphingomyelin synthase, and glucosylceramide synthase. (United States)

    Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro


    Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.

  3. An engineered fatty acid synthase combined with a carboxylic acid reductase enables de novo production of 1-octanol in Saccharomyces cerevisiae. (United States)

    Henritzi, Sandra; Fischer, Manuel; Grininger, Martin; Oreb, Mislav; Boles, Eckhard


    The ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway. The previously engineered short-chain acyl-CoA producing yeast Fas1 R1834K /Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L -1 in a 72-h fermentation. The additional accumulation of 90 mg L -1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L -1 . However, in growth tests concentrations even lower than 50.0 mg L -1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to

  4. Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer (United States)


    cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different

  5. 7.5-Å cryo-em structure of the mycobacterial fatty acid synthase. (United States)

    Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc


    The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    International Nuclear Information System (INIS)

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin


    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution

  7. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    Energy Technology Data Exchange (ETDEWEB)

    Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)


    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  8. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.


    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  9. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)


    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  10. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.


    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  11. Imidazopyridine-Based Fatty Acid Synthase Inhibitors That Show Anti-HCV Activity and in Vivo Target Modulation. (United States)

    Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S


    Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.

  12. Cooperative functioning between phenylalanine ammonia lyase and isochorishmate synthase activities contributes to salicylic acid biosynthesis in soybean (United States)

    Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...

  13. An active site mutant of Escherichia coli cyclopropane fatty acid synthase forms new non-natural fatty acids providing insights on the mechanism of the enzymatic reaction. (United States)

    E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique


    We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Fatty acid synthase plays a role in cancer metabolism beyond providing fatty acids for phospholipid synthesis or sustaining elevations in glycolytic activity

    Energy Technology Data Exchange (ETDEWEB)

    Hopperton, Kathryn E., E-mail: [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)


    Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare

  15. Fatty acid synthase plays a role in cancer metabolism beyond providing fatty acids for phospholipid synthesis or sustaining elevations in glycolytic activity

    International Nuclear Information System (INIS)

    Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.


    Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of

  16. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    International Nuclear Information System (INIS)

    Chang, Soo-Ik; Hammes, G.G.


    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  17. Producing biofuels using polyketide synthases (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D


    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  18. A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site. (United States)

    Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A


    Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.

  19. Fatty acid synthase inhibition in human breast cancer cells leads to malonyl-CoA-induced inhibition of fatty acid oxidation and cytotoxicity. (United States)

    Thupari, J N; Pinn, M L; Kuhajda, F P


    Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.

  20. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto


    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  1. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz


    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  2. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi. (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei


    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  4. First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Patrick C Y Woo

    Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

  5. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)



    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  6. Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

    KAUST Repository

    Trujillo, Uldaeliz


    The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

  7. Solution structure of the tandem acyl carrier protein domains from a polyunsaturated fatty acid synthase reveals beads-on-a-string configuration.

    Directory of Open Access Journals (Sweden)

    Uldaeliz Trujillo

    Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of

  8. Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

    KAUST Repository

    Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel


    The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

  9. Production of Δ9-tetrahydrocannabinolic acid from cannabigerolic acid by whole cells of Pichia (Komagataella) pastoris expressing Δ9-tetrahydrocannabinolic acid synthase from Cannabis sativa L. (United States)

    Zirpel, Bastian; Stehle, Felix; Kayser, Oliver


    The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.

  10. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia. (United States)

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis


    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  11. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  12. [Study on the seasonal variations of the active components in Acer truncatum leaves and the inhibitory ability on fatty acid synthase]. (United States)

    Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia


    To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.

  13. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples. (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona


    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. p63 promotes cell survival through fatty acid synthase.

    Directory of Open Access Journals (Sweden)

    Venkata Sabbisetti


    Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.

  15. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases. (United States)

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg


    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.

  16. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  17. Modulation of hyaluronan synthase activity in cellular membrane fractions


    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto


    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  18. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    Directory of Open Access Journals (Sweden)

    Rawat Richa


    Full Text Available Abstract Background Cyclopropane fatty acids (CPA have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model

  19. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants. (United States)

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan


    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  20. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B


    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  1. Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme. (United States)

    Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A


    5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.


    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  3. Purification, crystallization and preliminary crystallographic analysis of human cystathionine β-synthase

    International Nuclear Information System (INIS)

    Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso


    This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme

  4. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H


    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  5. Cyclopropane fatty acid synthase mutants of probiotic human-derived Lactobacillus reuteri are defective in TNF inhibition. (United States)

    Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A


    Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.

  6. Influence of polysorbate 80 and cyclopropane fatty acid synthase activity on lactic acid production by Lactobacillus casei ATCC 334 at low pH. (United States)

    Broadbent, J R; Oberg, T S; Hughes, J E; Ward, R E; Brighton, C; Welker, D L; Steele, J L


    Lactic acid is an important industrial chemical commonly produced through microbial fermentation. The efficiency of acid extraction is increased at or below the acid's pKa (pH 3.86), so there is interest in factors that allow for a reduced fermentation pH. We explored the role of cyclopropane synthase (Cfa) and polysorbate (Tween) 80 on acid production and membrane lipid composition in Lactobacillus casei ATCC 334 at low pH. Cells from wild-type and an ATCC 334 cfa knockout mutant were incubated in APT broth medium containing 3 % glucose plus 0.02 or 0.2 % Tween 80. The cultures were allowed to acidify the medium until it reached a target pH (4.5, 4.0, or 3.8), and then the pH was maintained by automatic addition of NH₄OH. Cells were collected at the midpoint of the fermentation for membrane lipid analysis, and media samples were analyzed for lactic and acetic acids when acid production had ceased. There were no significant differences in the quantity of lactic acid produced at different pH values by wild-type or mutant cells grown in APT, but the rate of acid production was reduced as pH declined. APT supplementation with 0.2 % Tween 80 significantly increased the amount of lactic acid produced by wild-type cells at pH 3.8, and the rate of acid production was modestly improved. This effect was not observed with the cfa mutant, which indicated Cfa activity and Tween 80 supplementation were each involved in the significant increase in lactic acid yield observed with wild-type L. casei at pH 3.8.

  7. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD


    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  8. Use of linalool synthase in genetic engineering of scent production (United States)

    Pichersky, Eran


    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  9. Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2

    Energy Technology Data Exchange (ETDEWEB)

    Petry, T.W.; Krauss, R.S.; Eling, T.E.


    We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.

  10. Fatty acid synthase regulates the chemosensitivity of breast cancer cells to cisplatin-induced apoptosis. (United States)

    Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther


    Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.

  11. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  12. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants. (United States)

    Lassner, M W; Lardizabal, K; Metz, J G


    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  13. Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase. (United States)

    Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng


    Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.

  14. Fatty acid synthase plays a role in cancer metabolism beyond providing fatty acids for phospholipid synthesis or sustaining elevations in glycolytic activity. (United States)

    Hopperton, Kathryn E; Duncan, Robin E; Bazinet, Richard P; Archer, Michael C


    Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from (14)C-labeled acetate to those supplied exogenously as (14)C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2-3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Insights Into the Bifunctional Aphidicolan-16-ß-ol Synthase Through Rapid Biomolecular Modeling Approaches

    Directory of Open Access Journals (Sweden)

    Max Hirte


    Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially

  16. Insights Into the Bifunctional Aphidicolan-16-ß-ol Synthase Through Rapid Biomolecular Modeling Approaches. (United States)

    Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B


    Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of

  17. Insights into the bifunctional Aphidicolan-16-ß-ol synthase through rapid biomolecular modelling approaches (United States)

    Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.


    Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location

  18. Negative regulation by Ser/Thr phosphorylation of HadAB and HadBC dehydratases from Mycobacterium tuberculosis type II fatty acid synthase system. (United States)

    Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie


    The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Quantum-mechanical analysis of amino acid residues function in the proton transport during F0F1-ATP synthase catalytic cycle (United States)

    Ivontsin, L. A.; Mashkovtseva, E. V.; Nartsissov, Ya R.


    Implications of quantum-mechanical approach to the description of proton transport in biological systems are a tempting subject for an overlapping of fundamental physics and biology. The model of proton transport through the integrated membrane enzyme FoF1-ATP synthase responsible for ATP synthesis was developed. The estimation of the mathematical expectation of the proton transfer time through the half-channel was performed. Observed set of proton pathways through the inlet half-channel showed the nanosecond timescale highly dependable of some amino acid residues. There were proposed two types of crucial amino acids: critically localized (His245) and being a part of energy conserving system (Asp119).

  20. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE


    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    International Nuclear Information System (INIS)

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.


    α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity

  2. Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells. (United States)

    Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P


    C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the

  3. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase


    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.


    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  4. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase. (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S


    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  5. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole


    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....




    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  7. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase. (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K


    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  8. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  9. Structure of Quinolinate Synthase from Pyrococcus horikoshii in the Presence of Its Product, Quinolinic Acid. (United States)

    Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J


    Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.

  10. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA (United States)

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg


    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  11. Production of 7,8-Dihydroxy Unsaturated Fatty Acids from Plant Oils by Whole Recombinant Cells Expressing 7,8-Linoleate Diol Synthase from Glomerella cingulata. (United States)

    Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun


    The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.

  12. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon (United States)

    Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling


    Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867

  13. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon.

    Directory of Open Access Journals (Sweden)

    Lei Gao

    Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

  14. Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon. (United States)

    Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge


    Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

  15. Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia. (United States)

    Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S


    Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

  16. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf


    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  18. Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3. (United States)

    Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian


    According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the

  19. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee


    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  20. Impact of nutrient excess and endothelial nitric oxide synthase on the plasma metabolite profile in mice

    Directory of Open Access Journals (Sweden)

    Brian E Sansbury


    Full Text Available An increase in calorie consumption is associated with the recent rise in obesity prevalence. However, our current understanding of the effects of nutrient excess on major metabolic pathways appears insufficient to develop safe and effective metabolic interventions to prevent obesity. Hence, we sought to identify systemic metabolic changes caused by nutrient excess and to determine how endothelial nitric oxide synthase (eNOS—which has anti-obesogenic properties—affects systemic metabolism by measuring plasma metabolites. Wild-type (WT and eNOS transgenic (eNOS-TG mice were placed on low fat or high fat diets for six weeks, and plasma metabolites were measured using an unbiased metabolomic approach. High fat feeding in WT mice led to significant increases in fat mass, which was associated with significantly lower plasma levels of 1,5-anhydroglucitol, lysophospholipids, 3-dehydrocarnitine, and bile acids, as well as branched chain amino acids (BCAAs and their metabolites. Plasma levels of several lipids including sphingomyelins, stearoylcarnitine, dihomo-linoleate and metabolites associated with oxidative stress were increased by high fat diet. In comparison with low fat-fed WT mice, eNOS-TG mice showed lower levels of several free fatty acids, but in contrast, the levels of bile acids, amino acids, and BCAA catabolites were increased. When placed on a high fat diet, eNOS overexpressing mice showed remarkably higher levels of plasma bile acids and elevated levels of plasma BCAAs and their catabolites compared with WT mice. Treatment with GW4064, an inhibitor of bile acid synthesis, decreased plasma bile acid levels but was not sufficient to reverse the anti-obesogenic effects of eNOS overexpression. These findings reveal unique metabolic changes in response to high fat diet and eNOS overexpression and suggest that the anti-obesity effects of eNOS are likely independent of changes in the bile acid pool.

  1. Nitro-Oleic Acid Prevents Hypoxia- and Asymmetric Dimethylarginine-Induced Pulmonary Endothelial Dysfunction

    Czech Academy of Sciences Publication Activity Database

    Koudelka, Adolf; Ambrožová, Gabriela; Klinke, A.; Fidlerová, Táňa; Martíšková, Hana; Kuchta, R.; Rudolph, T.K.; Kadlec, J.; Kuchtová, Z.; Woodcock, S.R.; Freeman, B.A.; Kubala, Lukáš; Pekarová, Michaela


    Roč. 30, č. 6 (2016), s. 579-586 ISSN 0920-3206 R&D Projects: GA ČR GP13-40824P; GA MŠk(CZ) LD15069 Institutional support: RVO:68081707 Keywords : fatty acids * arterial - hypertension * oxide synthase * murine model Subject RIV: BO - Biophysics Impact factor: 2.820, year: 2016

  2. 1-11C-acetate as a PET radiopharmaceutical for imaging fatty acid synthase expression in prostate cancer. (United States)

    Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S


    Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.

  3. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf


    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  4. Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.


    cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...

  5. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa) (United States)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  6. Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target. (United States)

    Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George


    Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.) (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  8. Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi

    DEFF Research Database (Denmark)

    Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi


    Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...

  9. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis). (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk


    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase. (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E


    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  11. In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum. (United States)

    Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki


    For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase

  12. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab


    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  13. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium. (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un


    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  14. Role of carglumic acid in the treatment of acute hyperammonemia due to N-acetylglutamate synthase deficiency

    Directory of Open Access Journals (Sweden)

    Häberle J


    Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia

  15. Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

    International Nuclear Information System (INIS)

    Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.


    Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase

  16. Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Parsons, James F., E-mail:; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)


    Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.

  17. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of SAICAR synthase from Streptococcus suis serotype 2

    International Nuclear Information System (INIS)

    Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua


    Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°

  18. In vivo inhibition of the mitochondrial H+-ATP synthase in neurons promotes metabolic preconditioning. (United States)

    Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M


    A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.

  19. Mitochondrial dysfunction is responsible for fatty acid synthase inhibition-induced apoptosis in breast cancer cells by PdpaMn. (United States)

    Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing


    Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate

  20. The role of ß-ketoacyl-acyl carrier protein synthase III in the condensation steps of fatty acid biosynthesis in sunflower

    DEFF Research Database (Denmark)

    González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael


    The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...

  1. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae). (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar


    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.


    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  3. Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua (United States)

    Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing


    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

  4. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    Directory of Open Access Journals (Sweden)

    Ju-Xin eRuan


    Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

  5. Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.

    Directory of Open Access Journals (Sweden)

    Anna Zdyb

    Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.

  6. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe


    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  7. Fatty acid synthase as a factor required for exercise-induced cognitive enhancement and dentate gyrus cellular proliferation.

    Directory of Open Access Journals (Sweden)

    Nataliya E Chorna

    Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.

  8. Structural characterization of the Mycobacterium tuberculosis biotin biosynthesis enzymes 7,8-diaminopelargonic acid synthase and dethiobiotin synthetase . (United States)

    Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C


    Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.

  9. Effect of centrally administered C75, a fatty acid synthase inhibitor, on gastric emptying and gastrointestinal transit in mice. (United States)

    Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang


    The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.

  10. Enantiospecific (+)- and (-)-germacrene D synthases, cloned from goldenrod, reveal a functionally active variant of the universal isoprenoid-biosynthesis aspartate-rich motif. (United States)

    Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H


    The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.

  11. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode. (United States)

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay


    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.

    Directory of Open Access Journals (Sweden)

    Damien Garrido


    Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell

  13. Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China. (United States)

    Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun


    A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.


    Directory of Open Access Journals (Sweden)

    M. A. Slugina


    Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

  15. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors. (United States)

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag


    affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at

  16. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis. (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H


    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  17. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe. (United States)

    Ghosh, Subhabrata; Mandi, Swati Sen


    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Catalytic residues Lys197 and Arg199 of Bacillus subtilis phosphoribosyl diphosphate synthase. Alanine-scanning mutagenesis of the flexible catalytic loop

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W


    Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...

  19. The C-terminal peptide of Aquifex aeolicus riboflavin synthase directs encapsulation of native and foreign guests by a cage-forming lumazine synthase. (United States)

    Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald


    Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple. (United States)

    Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin


    Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.


    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  2. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase. (United States)

    Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U


    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.

  3. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6


    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan


    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  4. Malonyl-coenzyme-A is a potential mediator of cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and xenografts. (United States)

    Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P


    A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.

  5. Predicted cycloartenol synthase protein from Kandelia obovata and Rhizophora stylosa using online software of Phyre2 and Swiss-model (United States)

    Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.


    Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.

  6. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.


    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  7. Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Chun-Hsien eHung


    Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

  8. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius


    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012

  9. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site. (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong


    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens

    Directory of Open Access Journals (Sweden)

    Mahiran Basri


    Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.

  11. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia). (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un


    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  12. C75, a fatty acid synthase inhibitor, modulates AMP-activated protein kinase to alter neuronal energy metabolism. (United States)

    Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V


    C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.

  13. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae]. (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M


    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  14. Synthesis of isoprenoid bisphosphonate ethers through C–P bond formations: Potential inhibitors of geranylgeranyl diphosphate synthase

    Directory of Open Access Journals (Sweden)

    Xiang Zhou


    Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.

  15. The LINKS motif zippers trans-acyltransferase polyketide synthase assembly lines into a biosynthetic megacomplex. (United States)

    Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T


    Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Enzymatic synthesis of S-phenyl-L-cysteine from keratin hydrolysis industries wastewater with tryptophan synthase. (United States)

    Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai


    An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Heme A synthase in bacteria depends on one pair of cysteinyls for activity. (United States)

    Lewin, Anna; Hederstedt, Lars


    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP. (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica


    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  19. Comparative Amino Acids Studies on Phac Synthases and Proteases as Well as Establishing a New Trend in Experimental Design

    Directory of Open Access Journals (Sweden)

    Amro Abd al fattah Amara


    Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In

  20. Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis. (United States)

    Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae


    Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

  1. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay


    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  2. Modulation of Escherichia coli serine acetyltransferase catalytic activity in the cysteine synthase complex

    Czech Academy of Sciences Publication Activity Database

    Benoni, Roberto; De Bei, O.; Paredi, G.; Hayes, C. S.; Franko, N.; Mozzarelli, A.; Bettati, S.; Campanini, B.


    Roč. 591, č. 9 (2017), s. 1212-1224 ISSN 0014-5793 Institutional support: RVO:61388963 Keywords : cysteine synthase * protein - protein interaction * serine acetyltransferase Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.623, year: 2016

  3. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production. (United States)

    Oberding, Lisa K; Gieg, Lisa M


    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  4. Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase. (United States)

    Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke


    Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.

  5. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B


    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....

  6. Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening (United States)

    Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming


    Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808

  7. Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase

    International Nuclear Information System (INIS)

    Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.


    The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6

  8. Identification of potential leads against 4-hydroxytetrahydrodipicolinate synthase from Mycobacterium tuberculosis


    Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.


    4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...

  9. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3. (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina


    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  10. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    International Nuclear Information System (INIS)

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long


    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  11. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)


    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  12. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe. (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee


    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  13. Glycogen synthase activation by sugars in isolated hepatocytes. (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J


    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  14. Carglumic acid: a second look. Confirmed progress in a rare urea cycle disorder. (United States)


    (1) N-acetylglutamate synthase deficiency is a rare congenital disorder that causes hyperammonaemic comas, resulting in severe neurological morbidity and usually leading to death during childhood. (2) Carglumic acid is the first drug to be used for replacement therapy. Data available in 2003 showed beneficial effects on growth and psychomotor development. (3) In 2007, about 20 patients treated with carglumic acid for N-acetyglutamate synthase deficiency, for at least 5 years in half of cases, were all still alive. Their development was normal when treatment was initiated before complications occurred. (4) No serious adverse effects have been observed. (5) In practice, although this treatment has to continue for life, carglumic acid represents a major advance for patients with N-acetylglutamate synthase deficiency.

  15. Indole-3-butyric acid promotes adventitious rooting in Arabidopsis thaliana thin cell layers by conversion into indole-3-acetic acid and stimulation of anthranilate synthase activity. (United States)

    Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M


    Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced

  16. Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin

    NARCIS (Netherlands)

    Lechner, Matthias; Lirk, Philipp; Rieder, Josef


    Inducible nitric oxide synthase (iNOS) is one of three key enzymes generating nitric oxide (NO) from the amino acid l-arginine. iNOS-derived NO plays an important role in numerous physiological (e.g. blood pressure regulation, wound repair and host defence mechanisms) and pathophysiological

  17. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.


    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  18. Low concentrations of salicylic acid delay methyl jasmonate-induced leaf senescence by up-regulating nitric oxide synthase activity. (United States)

    Ji, Yingbin; Liu, Jian; Xing, Da


    In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email:

  19. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou


    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  20. Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis. (United States)

    Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U


    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

  1. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita


    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  2. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck


    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  3. Biochemical identification of residues that discriminate between 3,4-dihydroxyphenylalanine decarboxylase and 3,4-dihydroxyphenylacetaldehyde synthase-mediated reactions. (United States)

    Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong


    In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2

  4. Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase. (United States)

    Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T


    Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.

  5. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum. (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia


    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  6. Methylenetetrahydrofolate reductase 677C>T and methionine synthase 2756A>G mutations: no impact on survival, cognitive functioning, or cognitive decline in nonagenarians

    DEFF Research Database (Denmark)

    Bathum, Lise; von Bornemann Hjelmborg, Jacob; Christiansen, Lene


    BACKGROUND: Several reports have shown an association between homocysteine, cognitive functioning, and survival among the oldest-old. Two common polymorphisms in the genes coding for methylenetetrahydrofolate reductase (MTHFR 677C>T) and methionine synthase (MTR 2756A>G) have an impact on plasma...... homocysteine level. METHODS: We examined the effect of the MTHFR 677C>T and MTR 2756A>G genotypes on baseline cognitive functioning, cognitive decline over 5 years measured in three assessments, and survival in a population-based cohort of 1581 nonagenarians. Cognitive functioning was assessed by using...

  7. Fluoroorotic acid-selected Nicotiana plumbaginifolia cell lines with a stable thymine starvation phenotype have lost the thymine-regulated transcriptional program. (United States)

    Santoso, D; Thornburg, R


    We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.

  8. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit. (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo


    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju


    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  10. The crystal structure of human GDP-L-fucose synthase. (United States)

    Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua


    Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.

  11. Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme

    Directory of Open Access Journals (Sweden)

    Alberto Macone


    Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.

  12. Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.

    Directory of Open Access Journals (Sweden)

    Anke Wittmann

    Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.

  13. Fluoroorotic Acid-Selected Nicotiana plumbaginifolia Cell Lines with a Stable Thymine Starvation Phenotype Have Lost the Thymine-Regulated Transcriptional Program1 (United States)

    Santoso, Djoko; Thornburg, Robert


    We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367

  14. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality. (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric


    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  15. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C


    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  16. A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation. (United States)

    Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco


    Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids. (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing


    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  18. Nitrate Activation of Cytosolic Protein Kinases Diverts Photosynthetic Carbon from Sucrose to Amino Acid Biosynthesis (United States)

    Champigny, Marie-Louise; Foyer, Christine


    The regulation of carbon partitioning between carbohydrates (principally sucrose) and amino acids has been only poorly characterized in higher plants. The hypothesis that the pathway of sucrose and amino acid biosynthesis compete for carbon skeletons and energy is widely accepted. In this review, we suggest a mechanism involving the regulation of cytosolic protein kinases whereby the flow of carbon is regulated at the level of partitioning between the pathways of carbohydrate and nitrogen metabolism via the covalent modulation of component enzymes. The addition of nitrate to wheat seedlings (Triticum aestivum) grown in the absence of exogenous nitrogen has a dramatic, if transient, impact on sucrose formation and on the activities of sucrose phosphate synthase (which is inactivated) and phosphoenolpyruvate carboxylase (which is activated). The activities of these two enzymes are modulated by protein phosphorylation in response to the addition of nitrate, but they respond in an inverse fashion. Sucrose phosphate synthase in inactivated and phosphoenolpyruvate carboxylase is activated. Nitrate functions as a signal metabolite activating the cytosolic protein kinase, thereby modulating the activities of at least two of the key enzymes in assimilate partitioning and redirecting the flow of carbon away from sucrose biosynthesis toward amino acid synthesis. PMID:16653003

  19. Up-regulation of fatty acid synthase induced by EGFR/ERK activation promotes tumor growth in pancreatic cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bian, Yong, E-mail: [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)


    Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.

  20. Up-regulation of fatty acid synthase induced by EGFR/ERK activation promotes tumor growth in pancreatic cancer

    International Nuclear Information System (INIS)

    Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin


    Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression

  1. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells. (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J


    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne


    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  3. The FoF1-ATP synthase complex contains novel subunits and is essential for procyclic Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Zíková, Alena; Schnaufer, A.; Dalley, A. R.; Panigrahi, A. K.; Stuart, K. D.


    Roč. 5, č. 5 (2009), s. 1-15 E-ISSN 1932-6203 Keywords : mitochondrion * respiratory chain * / ATP synthase * TAP-tag * RNAi Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.351, year: 2009

  4. Glutamic acid as anticancer agent: An overview


    Dutta, Satyajit; Ray, Supratim; Nagarajan, K.


    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...

  5. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum (United States)

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.


    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  6. Assembly factors of F1FO-ATP synthase across genomes

    Czech Academy of Sciences Publication Activity Database

    Pícková, Andrea; Potocký, Martin; Houštěk, Josef


    Roč. 59, č. 3 (2005), s. 393-402 ISSN 0887-3585 R&D Projects: GA MŠk(CZ) 1M0520; GA MZd(CZ) NR7790 Grant - others:GA UK(CZ) 12/2002; GA UK(CZ) 11/2004; EC Framework Programme(XE) LSHM-CT-2004-503116 Institutional research plan: CEZ:AV0Z50110509 Keywords : assembly * ATP synthase * phylogenetic and sequence analysis Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 4.684, year: 2005

  7. gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower

    International Nuclear Information System (INIS)

    Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.


    gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested

  8. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau


    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  9. Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis). (United States)

    Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes


    Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

  10. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6). (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine


    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Systematic replacement of lysine with glutamine and alanine in Escherichia coli malate synthase G: effect on crystallization

    International Nuclear Information System (INIS)

    Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James


    Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success

  12. ATP Synthase Deficiency due to TMEM70 Mutation Leads to Ultrastructural Mitochondrial Degeneration and Is Amenable to Treatment

    Directory of Open Access Journals (Sweden)

    Anne K. Braczynski


    Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.

  13. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Directory of Open Access Journals (Sweden)

    Berta Alquézar


    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.


    Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O


    Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis

  15. Deregulation of acetohydroxy-acid synthase: loss of allosteric inhibition conferred by mutations in the catalytic subunit

    Czech Academy of Sciences Publication Activity Database

    Kopecký, Jan; Kyselková, Martina; Šigutová, Lucie; Pospíšil, Stanislav; Felsberg, Jürgen; Spížek, Jaroslav; Janata, Jiří


    Roč. 53, č. 6 (2008), s. 467-471 ISSN 0015-5632 R&D Projects: GA ČR GA204/01/1001; GA ČR GA204/05/0616 Institutional research plan: CEZ:AV0Z50200510 Keywords : acetohydroxy acid * ilvb genes * sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  16. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence. (United States)

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter


    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    International Nuclear Information System (INIS)

    Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi


    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

  18. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)


    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

  19. Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype. (United States)

    Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe


    Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. The Tomato Terpene Synthase Gene Family1[W][OA (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran


    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  1. Probing fatty acid metabolism in bacteria, cyanobacteria, green microalgae and diatoms with natural and unnatural fatty acids. (United States)

    Beld, Joris; Abbriano, Raffaela; Finzel, Kara; Hildebrand, Mark; Burkart, Michael D


    In both eukaryotes and prokaryotes, fatty acid synthases are responsible for the biosynthesis of fatty acids in an iterative process, extending the fatty acid by two carbon units every cycle. Thus, odd numbered fatty acids are rarely found in nature. We tested whether representatives of diverse microbial phyla have the ability to incorporate odd-chain fatty acids as substrates for their fatty acid synthases and their downstream enzymes. We fed various odd and short chain fatty acids to the bacterium Escherichia coli, cyanobacterium Synechocystis sp. PCC 6803, green microalga Chlamydomonas reinhardtii and diatom Thalassiosira pseudonana. Major differences were observed, specifically in the ability among species to incorporate and elongate short chain fatty acids. We demonstrate that E. coli, C. reinhardtii, and T. pseudonana can produce longer fatty acid products from short chain precursors (C3 and C5), while Synechocystis sp. PCC 6803 lacks this ability. However, Synechocystis can incorporate and elongate longer chain fatty acids due to acyl-acyl carrier protein synthetase (AasS) activity, and knockout of this protein eliminates the ability to incorporate these fatty acids. In addition, expression of a characterized AasS from Vibrio harveyii confers a similar capability to E. coli. The ability to desaturate exogenously added fatty acids was only observed in Synechocystis and C. reinhardtii. We further probed fatty acid metabolism of these organisms by feeding desaturase inhibitors to test the specificity of long-chain fatty acid desaturases. In particular, supplementation with thia fatty acids can alter fatty acid profiles based on the location of the sulfur in the chain. We show that coupling sensitive gas chromatography mass spectrometry to supplementation of unnatural fatty acids can reveal major differences between fatty acid metabolism in various organisms. Often unnatural fatty acids have antibacterial or even therapeutic properties. Feeding of short

  2. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase. (United States)

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R


    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  3. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)


    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  4. Generation and Functional Evaluation of Designer Monoterpene Synthases. (United States)

    Srividya, N; Lange, I; Lange, B M


    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  5. Pathogenic cycle between the endogenous nitric oxide synthase inhibitor asymmetrical dimethylarginine and the leukocyte-derived hemoprotein myeloperoxidase

    Czech Academy of Sciences Publication Activity Database

    von Leitner, E.C.; Klinke, A.; Atzler, D.; Slocum, J.L.; Lund, N.; Kielstein, J.T.; Maas, R.; Schmidt-Haupt, R.; Pekarová, Michaela; Hellwinkel, O.; Tsikas, D.; D'Alecy, L.G.; Lau, D.; Willems, S.; Kubala, Lukáš; Ehmke, H.; Meinertz, T.; Blankenberg, S.; Schwedhelm, E.; Gadegbeku, C.A.; Boger, R.H.; Baldus, S.; Sydow, K.


    Roč. 124, č. 4 (2011), s. 2735-U342 ISSN 0009-7322 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : arteriosclerosis * leukocytes * nitric oxide synthase Subject RIV: BO - Biophysics Impact factor: 14.739, year: 2011

  6. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.


    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  7. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft


    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  8. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  9. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues (United States)

    Koo, Hyun Jo; Gang, David R.


    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  10. Preliminary Evaluation Of DWPF Impacts Of Boric Acid Use In Cesium Strip FOR SWPF And MCU

    International Nuclear Information System (INIS)

    Stone, M.


    A new solvent system is being evaluated for use in the Modular Caustic-Side Solvent Extraction Unit (MCU) and in the Salt Waste Processing Facility (SWPF). The new system includes the option to replace the current dilute nitric acid strip solution with boric acid. To support this effort, the impact of using 0.01M, 0.1M, 0.25M and 0.5M boric acid in place of 0.001M nitric acid was evaluated for impacts on the DWPF facility. The evaluation only covered the impacts of boric acid in the strip effluent and does not address the other changes in solvents (i.e., the new extractant, called MaxCalix, or the new suppressor, guanidine). Boric acid additions may lead to increased hydrogen generation during the SRAT and SME cycles as well as change the rheological properties of the feed. The boron in the strip effluent will impact glass composition and could require each SME batch to be trimmed with boric acid to account for any changes in the boron from strip effluent additions. Addition of boron with the strip effluent will require changes in the frit composition and could lead to changes in melt behavior. The severity of the impacts from the boric acid additions is dependent on the amount of boric acid added by the strip effluent. The use of 0.1M or higher concentrations of boric acid in the strip effluent was found to significantly impact DWPF operations while the impact of 0.01M boric acid is expected to be relatively minor. Experimental testing is required to resolve the issues identified during the preliminary evaluation. The issues to be addressed by the testing are: (1) Impact on SRAT acid addition and hydrogen generation; (2) Impact on melter feed rheology; (3) Impact on glass composition control; (4) Impact on frit production; and (5) Impact on melter offgas. A new solvent system is being evaluated for use in the Modular Caustic-Side Solvent Extraction Unit (MCU) and in the Salt Waste Processing Facility (SWPF). The new system includes the option to replace the

  11. New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Kohji, E-mail: [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Suzuki, Mamoru; Higashiura, Akifumi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan); Aritake, Kosuke; Urade, Yoshihiro; Uodome, Nobuko [Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka 565-0874 (Japan); Hossain, MD. Tofazzal [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Nakagawa, Atsushi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan)


    Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolution of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.

  12. Modulation of fatty acid synthase degradation by concerted action of p38 MAP kinase, E3 ligase COP1, and SH2-tyrosine phosphatase Shp2. (United States)

    Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng


    The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.

  13. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina


    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  14. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera). (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi


    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  15. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae. (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng


    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia. (United States)

    Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S


    En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.

  17. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.


    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  18. Vasoactive systems in L-NAME hypertension: the role of inducible nitric oxide synthase

    Czech Academy of Sciences Publication Activity Database

    Pecháňová, Olga; Dobešová, Zdenka; Čejka, Jakub; Kuneš, Jaroslav; Zicha, Josef


    Roč. 22, č. 1 (2004), s. 167-173 ISSN 0263-6352 R&D Projects: GA ČR GA305/03/0769; GA MŠk LN00A069 Grant - others:VEGA(SK) 2/3185/23; SAV(SK) APVT51-017902 Institutional research plan: CEZ:AV0Z5011922 Keywords : nitric oxide synthase * L-NAME hypertension * aminoguanidine Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 4.871, year: 2004

  19. (-)-Epigallocatechin 3-Gallate Synthetic Analogues Inhibit Fatty Acid Synthase and Show Anticancer Activity in Triple Negative Breast Cancer. (United States)

    Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa


    (-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.

  20. Impacts of impregnation with boric acid and borax on the red colour ...

    African Journals Online (AJOL)

    Impacts of impregnation with boric acid and borax on the red colour tone of some hardwoods and varnishes. H Keskin, M Atar, A Ketizmen. Abstract. This study was performed to determine the impacts of impregnation with boric acid and borax on the red colour tone of some hardwoods and varnishes. For this purpose, the ...

  1. The stress-related, rhizobial small RNA RcsR1 destabilizes the autoinducer synthase encoding mRNA sinI in Sinorhizobium meliloti

    Czech Academy of Sciences Publication Activity Database

    Baumgardt, K.; Šmídová, Klára; Rahn, H.; Lochnit, G.; Robledo, M.; Evguenieva-Hackenberg, E.


    Roč. 13, č. 5 (2016), s. 486-499 ISSN 1547-6286 Institutional support: RVO:61388971 Keywords : Agrobacterium * autoinducer synthase * degradosome Subject RIV: EE - Microbiology, Virology Impact factor: 3.900, year: 2016

  2. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)



    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  3. Overexpression of Farnesyl Diphosphate Synthase in Arabidopsis Mitochondria Triggers Light-dependent Lesion Formation and Alters Cytokinin Homeostasis

    Czech Academy of Sciences Publication Activity Database

    Manzano, D.; Busquets, A.; Closa, M.; Hoyerová, Klára; Schaller, H.; Kamínek, Miroslav; Arró, M.; Ferrer, A.


    Roč. 61, 1-2 (2006), s. 195-213 ISSN 0167-4412 R&D Projects: GA AV ČR(CZ) IAA600380507 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * cytokinin * farnesyl diphosphate synthase * isoprenoid Subject RIV: EF - Botanics Impact factor: 3.577, year: 2006

  4. Evolution of cyclizing 5-aminolevulinate synthases in the biosynthesis of actinomycete secondary metabolites: outcomes for genetic screening techniques

    Czech Academy of Sciences Publication Activity Database

    Petříčková, Kateřina; Chroňáková, Alica; Zelenka, Tomáš; Chrudimský, Tomáš; Pospíšil, Stanislav; Petříček, Miroslav; Krištůfek, Václav


    Roč. 6, AUG 2015 (2015) ISSN 1664-302X R&D Projects: GA MŠk LH12191 Institutional support: RVO:61388971 ; RVO:60077344 Keywords : 5-aminolevulinate synthase * C5N unit * Streptomyces Subject RIV: EE - Microbiology, Virology Impact factor: 4.165, year: 2015

  5. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva


    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  6. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1 (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.


    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  7. Bioengineering of the plant culture of Capsicum frutescens with vanillin synthase gene for the production of vanillin


    Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan


    Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...

  8. Bioenergetic Consequences of FLAG Tag Addition to the C-Terminus of Subunit 8 of Yeast Saccharomyces cerevisiae Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)



    Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.

  9. Modulation of hyaluronan synthase activity in cellular membrane fractions. (United States)

    Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto


    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.


    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B


    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  11. Pycnogenol® effects on skin elasticity and hydration coincide with increased gene expressions of collagen type I and hyaluronic acid synthase in women. (United States)

    Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J


    In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.

  12. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases* (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.


    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  13. In silico investigation of lavandulyl flavonoids for the development of potent fatty acid synthase-inhibitory prototypes. (United States)

    Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun


    Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B


    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  15. The time-dependent effect of provinolsTM on brain NO synthase activity in L-NAME-induced hypertension

    Czech Academy of Sciences Publication Activity Database

    Jendeková, L.; Kojšová, S.; Andriantsitohaina, R.; Pecháňová, Olga


    Roč. 55, č. S1 (2006), S31-S37 ISSN 0862-8408 Grant - others:VEGA(SK) 2/6148/26; VEGA(SK) 1/342906 Institutional research plan: CEZ:AV0Z50110509 Keywords : red wine polyphenols * oxidative damage * nitric oxide synthase Subject RIV: ED - Physiology Impact factor: 2.093, year: 2006

  16. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)


    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  17. Characterization of the human gene (TBXAS1) encoding thromboxane synthase. (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T


    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  18. Yeast cells lacking all known ceramide synthases continue to make complex sphingolipids and to incorporate ceramides into glycosylphosphatidylinositol (GPI) anchors

    DEFF Research Database (Denmark)

    Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.


    In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...

  19. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi


    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  20. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S


    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  1. (−-Epigallocatechin 3-Gallate Synthetic Analogues Inhibit Fatty Acid Synthase and Show Anticancer Activity in Triple Negative Breast Cancer

    Directory of Open Access Journals (Sweden)

    Joan Crous-Masó


    Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.

  2. Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.


    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  3. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.


    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  4. Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA) (United States)


    Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583

  5. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean


    Good, Laura Lee


    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  6. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao


    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  7. Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates. (United States)

    Wang, Huicong; Ma, Fangfang; Cheng, Lailiang


    Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

  8. Enzymatic regulation of organic acid metabolism in an alkali-tolerant ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin


    Oct 5, 2016 ... seedlings of C. virgata were treated with varying salt and alkali stress. First, the composition and .... mechanisms of organic acid accumulation in C. virgata ..... dehydrogenase and ferredoxin-dependent glutamate synthase in.

  9. Replacement of two amino acids of 9R-dioxygenase-allene oxide synthase of Aspergillus niger inverts the chirality of the hydroperoxide and the allene oxide. (United States)

    Sooman, Linda; Wennman, Anneli; Hamberg, Mats; Hoffmann, Inga; Oliw, Ernst H


    The genome of Aspergillus niger codes for a fusion protein (EHA25900), which can be aligned with ~50% sequence identity to 9S-dioxygenase (DOX)-allene oxide synthase (AOS) of Fusarium oxysporum, homologues of the Fusarium and Colletotrichum complexes and with over 62% sequence identity to homologues of Aspergilli, including (DOX)-9R-AOS of Aspergillus terreus. The aims were to characterize the enzymatic activities of EHA25900 and to identify crucial amino acids for the stereospecificity. Recombinant EHA25900 oxidized 18:2n-6 sequentially to 9R-hydroperoxy-10(E),12(Z)-octadecadienoic acid (9R-HPODE) and to a 9R(10)-allene oxide. 9S- and 9R-DOX-AOS catalyze abstraction of the pro-R hydrogen at C-11, but the direction of oxygen insertion differs. A comparison between twelve 9-DOX domains of 9S- and 9R-DOX-AOS revealed conserved amino acid differences, which could contribute to the chirality of products. The Gly616Ile replacement of 9R-DOX-AOS (A. niger) increased the biosynthesis of 9S-HPODE and the 9S(10)-allene oxide, whereas the Phe627Leu replacement led to biosynthesis of 9S-HPODE and the 9S(10)-allene oxide as main products. The double mutant (Gly616Ile, Phe627Leu) formed over 90% of the 9S stereoisomer of HPODE. 9S-HPODE was formed by antarafacial hydrogen abstraction and oxygen insertion, i.e., the original H-abstraction was retained but the product chirality was altered. We conclude that 9R-DOX-AOS can be altered to 9S-DOX-AOS by replacement of two amino acids (Gly616Ile, Phe627Leu) in the DOX domain. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Glutamic acid as anticancer agent: An overview. (United States)

    Dutta, Satyajit; Ray, Supratim; Nagarajan, K


    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.

  11. Homocysteine regulates fatty acid and lipid metabolism in yeast. (United States)

    Visram, Myriam; Radulovic, Maja; Steiner, Sabine; Malanovic, Nermina; Eichmann, Thomas O; Wolinski, Heimo; Rechberger, Gerald N; Tehlivets, Oksana


    S -Adenosyl-l-homocysteine hydrolase (AdoHcy hydrolase; Sah1 in yeast/AHCY in mammals) degrades AdoHcy, a by-product and strong product inhibitor of S -adenosyl-l-methionine (AdoMet)-dependent methylation reactions, to adenosine and homocysteine (Hcy). This reaction is reversible, so any elevation of Hcy levels, such as in hyperhomocysteinemia (HHcy), drives the formation of AdoHcy, with detrimental consequences for cellular methylation reactions. HHcy, a pathological condition linked to cardiovascular and neurological disorders, as well as fatty liver among others, is associated with a deregulation of lipid metabolism. Here, we developed a yeast model of HHcy to identify mechanisms that dysregulate lipid metabolism. Hcy supplementation to wildtype cells up-regulated cellular fatty acid and triacylglycerol content and induced a shift in fatty acid composition, similar to changes observed in mutants lacking Sah1. Expression of the irreversible bacterial pathway for AdoHcy degradation in yeast allowed us to dissect the impact of AdoHcy accumulation on lipid metabolism from the impact of elevated Hcy. Expression of this pathway fully suppressed the growth deficit of sah1 mutants as well as the deregulation of lipid metabolism in both the sah1 mutant and Hcy-exposed wildtype, showing that AdoHcy accumulation mediates the deregulation of lipid metabolism in response to elevated Hcy in yeast. Furthermore, Hcy supplementation in yeast led to increased resistance to cerulenin, an inhibitor of fatty acid synthase, as well as to a concomitant decline of condensing enzymes involved in very long-chain fatty acid synthesis, in line with the observed shift in fatty acid content and composition. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Silencing onion lachrymatory factor synthase causes a significant change in the sulfur secondary metabolite profile. (United States)

    Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke


    Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.

  13. Triacetic acid lactone production from Saccharomyces cerevisiae (United States)

    Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...

  14. Nitric oxide production from macrophages is regulated by arachidonic acid metabolites. (United States)

    Imai, Y; Kolb, H; Burkart, V


    In activated macrophages the inducible form of the enzyme nitric oxide (NO) synthase generates high amounts of the toxic mediator NO. After 20 h of treatment with LPS rat peritoneal macrophages release 12-16 nmol NO2-/10(5) cells which is detectable in the culture supernatant by the Griess reaction as a measure of NO formation. The addition of aminoguanidine (1 mM), a preferential inhibitor of the inducible NO-synthase, completely abolished NO2-accumulation. Incubation with indomethacin or acetyl-salicylic acid, preferential inhibitors of the cyclooxygenase pathway of the arachidonic acid metabolism, did not influence NO2- levels. Nordihydro-guaiaretic acid (50 microM), a preferential inhibitor of the lipoxygenase pathway, caused strong reduction of NO2- accumulation to 1.9 +/- 0.3 nmol/200 microliter. Simultaneous inhibition of cyclo- and lipoxygenase by BW755c resulted in an intermediate effect (7.3 +/- 1.1 nmol/200 microliter NO2-). These results show that the induction of NO production in activated macrophages is regulated by products of the lipoxygenase-pathway of the arachidonic acid metabolism.

  15. Involvement of Salicylic Acid on Antioxidant and Anticancer Properties, Anthocyanin Production and Chalcone Synthase Activity in Ginger (Zingiber officinale Roscoe Varieties

    Directory of Open Access Journals (Sweden)

    Ehsan Karimi


    Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of

  16. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others


    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  17. Folate/Folic Acid Knowledge, Intake, and Self-Efficacy of College-Aged Women: Impact of Text Messaging and Availability of a Folic Acid-Containing Supplement (United States)

    Rampersaud, Gail C.; Sokolow, Andrew; Gruspe, Abigail; Colee, James C.; Kauwell, Gail P. A.


    Objective: To evaluate the impact of educational text messages (TMs) on folate/folic acid knowledge and consumption among college-aged women, and to evaluate the impact of providing folic acid supplements on folate/folic acid intake among college-aged women. Participants: A total of 162 women (18-24 years) recruited from a university. Methods: The…

  18. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus


    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  19. Active-site-directed inhibition of 3-hydroxy-3-methylglutaryl coenzyme A synthase by 3-chloropropionyl coenzyme A

    International Nuclear Information System (INIS)

    Miziorko, H.M.; Behnke, C.E.


    3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue

  20. Unusual 4-hydroxybenzaldehyde synthase activity from tissue cultures of the vanilla orchid Vanilla planifolia. (United States)

    Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A


    Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.

  1. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae). (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes


    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.


    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  3. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase (United States)

    Ober, Dietrich; Hartmann, Thomas


    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  4. [Effect of L-arginine and the nitric oxide synthase blocker L-NNA on calcium capacity in rat liver mitochondria with differing resistance to hypoxia]. (United States)

    Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K


    The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.

  5. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank


    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...


    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  7. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  8. The assembly of F1FO-ATP synthase is disrupted upon interference of RNA editing in Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Hashimi, Hassan; Benkovičová, V.; Čermáková, P.; Lai, De Hua; Horváth, A.; Lukeš, Julius


    Roč. 40, č. 1 (2010), s. 45-54 ISSN 0020-7519 R&D Projects: GA ČR GA204/06/1558; GA AV ČR IAA500960705 Institutional research plan: CEZ:AV0Z60220518 Keywords : RNA editing * ATP synthase * mitochondrion * Trypanosoma * respiratory complex * membrane potential Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.822, year: 2010

  9. A novel noncovalent complex of chorismate mutase and DAHP synthase from Mycobacterium tuberculosis: protein purification, crystallization and X-ray diffraction analysis

    International Nuclear Information System (INIS)

    Ökvist, Mats; Sasso, Severin; Roderer, Kathrin; Kast, Peter; Krengel, Ute


    Two shikimate-pathway enzymes from M. tuberculosis, the intracellular chorismate mutase (MtCM) and DAHP synthase (MtDS), were produced recombinantly and purified. MtCM was crystallized alone and in complex with MtDS and analyzed by X-ray diffraction. Chorismate mutase catalyzes a key step in the shikimate-biosynthetic pathway and hence is an essential enzyme in bacteria, plants and fungi. Mycobacterium tuberculosis contains two chorismate mutases, a secreted and an intracellular one, the latter of which (MtCM; Rv0948c; 90 amino-acid residues; 10 kDa) is the subject of this work. Here are reported the gene expression, purification and crystallization of MtCM alone and of its complex with another shikimate-pathway enzyme, DAHP synthase (MtDS; Rv2178c; 472 amino-acid residues; 52 kDa), which has been shown to enhance the catalytic efficiency of MtCM. The MtCM–MtDS complex represents the first noncovalent enzyme complex from the common shikimate pathway to be structurally characterized. Soaking experiments with a transition-state analogue are also reported. The crystals of MtCM and the MtCM–MtDS complex diffracted to 1.6 and 2.1 Å resolution, respectively

  10. Plant polyketide synthases: a chalcone synthase-type enzyme which performs a condensation reaction with methylmalonyl-CoA in the biosynthesis of C-methylated chalcones. (United States)

    Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G


    Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.

  11. Substrate promiscuity of a rosmarinic acid synthase from lavender (Lavandula angustifolia L.). (United States)

    Landmann, Christian; Hücherig, Stefanie; Fink, Barbara; Hoffmann, Thomas; Dittlein, Daniela; Coiner, Heather A; Schwab, Wilfried


    One of the most common types of modification of secondary metabolites is the acylation of oxygen- and nitrogen-containing substrates to produce esters and amides, respectively. Among the known acyltransferases, the members of the plant BAHD family are capable of acylating a wide variety of substrates. Two full-length acyltransferase cDNAs (LaAT1 and 2) were isolated from lavender flowers (Lavandula angustifolia L.) by reverse transcriptase-PCR using degenerate primers based on BAHD sequences. Recombinant LaAT1 exhibited a broad substrate tolerance accepting (hydroxy)cinnamoyl-CoAs as acyl donors and not only tyramine, tryptamine, phenylethylamine and anthranilic acid but also shikimic acid and 4-hydroxyphenyllactic acid as acceptors. Thus, LaLT1 forms esters and amides like its phylogenetic neighbors. In planta LaAT1 might be involved in the biosynthesis of rosmarinic acid, the ester of caffeic acid and 3,4-dihydroxyphenyllactic acid, a major constituent of lavender flowers. LaAT2 is one of three members of clade VI with unknown function.

  12. Impacts of atmospheric pollution on the plant communities of British acid grasslands

    Energy Technology Data Exchange (ETDEWEB)

    Payne, Richard J., E-mail: [School of Science and the Environment, Manchester Metropolitan University, Chester St., Manchester M1 5GD (United Kingdom); Geography, School of Environment and Development, University of Manchester, Oxford Road, Manchester M13 9PL (United Kingdom); Stevens, Carly J. [Faculty of Science, Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Lancaster Environment Centre, Lancaster University, Bailrigg, Lancaster LA1 4YQ (United Kingdom); Dise, Nancy B. [School of Science and the Environment, Manchester Metropolitan University, Chester St., Manchester M1 5GD (United Kingdom); Gowing, David J. [Faculty of Science, Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Pilkington, Michael G.; Phoenix, Gareth K. [Department of Animal and Plant Sciences, Alfred Denny Building, University of Sheffield, Sheffield S10 2TN (United Kingdom); Emmett, Bridget A. [Centre for Ecology and Hydrology, Environment Centre Wales, Deiniol Road, Bangor, Gwynedd LL57 2UW (United Kingdom); Ashmore, Michael R. [Environment Department, University of York, Heslington, York YO10 5DD (United Kingdom)


    Air pollutants are recognised as important agents of ecosystem change but few studies consider the effects of multiple pollutants and their interactions. Here we use ordination, constrained cluster analysis and indicator value analyses to identify potential environmental controls on species composition, ecological groupings and indicator species in a gradient study of UK acid grasslands. The community composition of these grasslands is related to climate, grazing, ozone exposure and nitrogen deposition, with evidence for an interaction between the ecological impacts of base cation and nitrogen deposition. Ozone is a key agent in species compositional change but is not associated with a reduction in species richness or diversity indices, showing the subtly different drivers on these two aspects of ecosystem degradation. Our results demonstrate the effects of multiple interacting pollutants, which may collectively have a greater impact than any individual agent. - Highlights: > Ozone exposure, N and base cation deposition modify UK acid grassland composition. > Ozone influences community composition without reducing species richness. > Nitrogen and base cation deposition have interacting impacts. > Distinct species responses to pollutants suggest potential for bioindication. - Ozone exposure and nitrogen deposition have distinct but additive impacts on the plant communities of British acid grasslands.

  13. Impacts of atmospheric pollution on the plant communities of British acid grasslands

    International Nuclear Information System (INIS)

    Payne, Richard J.; Stevens, Carly J.; Dise, Nancy B.; Gowing, David J.; Pilkington, Michael G.; Phoenix, Gareth K.; Emmett, Bridget A.; Ashmore, Michael R.


    Air pollutants are recognised as important agents of ecosystem change but few studies consider the effects of multiple pollutants and their interactions. Here we use ordination, constrained cluster analysis and indicator value analyses to identify potential environmental controls on species composition, ecological groupings and indicator species in a gradient study of UK acid grasslands. The community composition of these grasslands is related to climate, grazing, ozone exposure and nitrogen deposition, with evidence for an interaction between the ecological impacts of base cation and nitrogen deposition. Ozone is a key agent in species compositional change but is not associated with a reduction in species richness or diversity indices, showing the subtly different drivers on these two aspects of ecosystem degradation. Our results demonstrate the effects of multiple interacting pollutants, which may collectively have a greater impact than any individual agent. - Highlights: → Ozone exposure, N and base cation deposition modify UK acid grassland composition. → Ozone influences community composition without reducing species richness. → Nitrogen and base cation deposition have interacting impacts. → Distinct species responses to pollutants suggest potential for bioindication. - Ozone exposure and nitrogen deposition have distinct but additive impacts on the plant communities of British acid grasslands.

  14. Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy

    DEFF Research Database (Denmark)

    Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte


    between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...

  15. The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives. (United States)

    Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra


    The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.

  16. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk


    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  17. Yeast Cells Lacking the CIT1-encoded Mitochondrial Citrate Synthase Are Hypersusceptible to Heat- or Aging-induced Apoptosis


    Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae


    In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...

  18. Exogenous thyroid hormones regulate the activity of citrate synthase and cytochrome c oxidase in warm- but not cold-acclimated lake whitefish (Coregonus clupeaformis) (United States)

    Zak, Megan A.; Regish, Amy M.; McCormick, Stephen; Manzon, Richard G.


    Thermal acclimation is known to elicit metabolic adjustments in ectotherms, but the cellular mechanisms and endocrine control of these shifts have not been fully elucidated. Here we examined the relationship between thermal acclimation, thyroid hormones and oxidative metabolism in juvenile lake whitefish. Impacts of thermal acclimation above (19 °C) or below (8 °C) the thermal optimum (13 °C) and exposure to exogenous thyroid hormone (60 µg T4/g body weight) were assessed by quantifying citrate synthase and cytochrome c oxidase activities in liver, red muscle, white muscle and heart. Warm acclimation decreased citrate synthase activity in liver and elevated both citrate synthase and cytochrome c oxidase activities in red muscle. In contrast, induction of hyperthyroidism in warm-acclimated fish stimulated a significant increase in liver citrate synthase and heart cytochrome c oxidase activities, and a decrease in the activity of both enzymes in red muscle. No change in citrate synthase or cytochrome c oxidase activities was observed following cold acclimation in either the presence or absence of exogenous thyroid hormones. Collectively, our results indicate that thyroid hormones influence the activity of oxidative enzymes more strongly in warm-acclimated than in cold-acclimated lake whitefish, and they may play a role in mediating metabolic adjustments observed during thermal acclimation.

  19. Exogenous thyroid hormones regulate the activity of citrate synthase and cytochrome c oxidase in warm- but not cold-acclimated lake whitefish (Coregonus clupeaformis). (United States)

    Zak, Megan A; Regish, Amy M; McCormick, Stephen D; Manzon, Richard G


    Thermal acclimation is known to elicit metabolic adjustments in ectotherms, but the cellular mechanisms and endocrine control of these shifts have not been fully elucidated. Here we examined the relationship between thermal acclimation, thyroid hormones and oxidative metabolism in juvenile lake whitefish. Impacts of thermal acclimation above (19°C) or below (8°C) the thermal optimum (13°C) and exposure to exogenous thyroid hormone (60µg T 4 /g body weight) were assessed by quantifying citrate synthase and cytochrome c oxidase activities in liver, red muscle, white muscle and heart. Warm acclimation decreased citrate synthase activity in liver and elevated both citrate synthase and cytochrome c oxidase activities in red muscle. In contrast, induction of hyperthyroidism in warm-acclimated fish stimulated a significant increase in liver citrate synthase and heart cytochrome c oxidase activities, and a decrease in the activity of both enzymes in red muscle. No change in citrate synthase or cytochrome c oxidase activities was observed following cold acclimation in either the presence or absence of exogenous thyroid hormones. Collectively, our results indicate that thyroid hormones influence the activity of oxidative enzymes more strongly in warm-acclimated than in cold-acclimated lake whitefish, and they may play a role in mediating metabolic adjustments observed during thermal acclimation. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Quantum Chemical Calculations and Molecular Docking Studies of Some NSAID Drugs (Aceclofenac, Salicylic Acid, and Piroxicam as 1PGE Inhibitors

    Directory of Open Access Journals (Sweden)

    S. Suresh


    Full Text Available The molecular structure of the three compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III has been determined using Gaussian 03W program with B3LYP method using 6-311++G (d,p basis set calculations. The molecular structures were fully optimized with atomic numbering scheme adopted in the study. To understand the mode of binding and molecular interaction, the docking studies of compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III have been carried out with prostaglandin H2 synthase-1 (1PGE as target using induced fit docking. The molecular docking results show that the interactions and energy for Aceclofenac, Salicylic Acid, and Piroxicam show the best results when docked with prostaglandin H2 synthase-1 (1PGE. The hydrogen bonding interactions of compound I (Aceclofenac are prominent with Arginine moiety, those of compound II (Salicylic Acid are prominent with Tyrosine and Serine moieties, and compound III (Piroxicam shows such interaction with Tyrosine and Arginine moieties. These interactions of prostaglandin H2 synthase-1 (1PGE with substrates are responsible for governing COX-1 inhibitor potency which in turn is a direct measure of the potency of the drug.

  1. Identification and Functional Characterization of Monofunctional ent-Copalyl Diphosphate and ent-Kaurene Synthases in White Spruce Reveal Different Patterns for Diterpene Synthase Evolution for Primary and Secondary Metabolism in Gymnosperms1[W][OA (United States)

    Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg


    The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448

  2. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.


    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  3. Cellulose synthases: new insights from crystallography and modeling. (United States)

    Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen


    Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase

    International Nuclear Information System (INIS)

    Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.


    The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)

  5. Expression of Genes Encoding Enzymes Involved in the One Carbon Cycle in Rat Placenta is Determined by Maternal Micronutrients (Folic Acid, Vitamin B12 and Omega-3 Fatty Acids

    Directory of Open Access Journals (Sweden)

    Vinita Khot


    Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.

  6. Priming of seeds with methyl jasmonate induced resistance to hemi-biotroph Fusarium oxysporum f.sp. lycopersici in tomato via 12-oxo-phytodienoic acid, salicylic acid, and flavonol accumulation. (United States)

    Król, P; Igielski, R; Pollmann, S; Kępczyńska, E


    Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici


    Directory of Open Access Journals (Sweden)



    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  8. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning


    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  9. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.). (United States)

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y


    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  10. Morphological alterations and NO-synthase expression in the heart after continuous light exposure of rats

    Czech Academy of Sciences Publication Activity Database

    Paulis, L.; Važan, R.; Šimko, F.; Pecháňová, Olga; Styk, J.; Babál, P.; Janega, P.


    Roč. 56, Suppl.2 (2007), S71-S76 ISSN 0862-8408 Grant - others:VEGA(SK) 1/3429/06; VEGA(SK) 2/6148/26; VEGA(SK) 2/5110/25; -(SK) 29/2007; -(SK) 30/2007; -(SK) SP51/0280900/0280901; -(SK) APVT-51-027404; -(SK) APVT51-018004 Institutional research plan: CEZ:AV0Z50110509 Keywords : myocardium * collagen I/III * nitric oxide synthase Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.505, year: 2007

  11. A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.

    Directory of Open Access Journals (Sweden)

    Sarah Schulz

    Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.

  12. The Fatty Acid Synthase Inhibitor Platensimycin Improves Insulin Resistance without Inducing Liver Steatosis in Mice and Monkeys.

    Directory of Open Access Journals (Sweden)

    Sheo B Singh

    Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.

  13. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.


    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  14. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  15. Metabolically engineered cells for the production of polyunsaturated fatty acids

    DEFF Research Database (Denmark)


    The present invention relates to the construction and engineering of cells, more particularly microorganisms for producing PUFAs with four or more double bonds from non-fatty acid substrates through heterologous expression of an oxygen requiring pathway. The invention especially involves...... improvement of the PUFA content in the host organism through fermentation optimization, e.g. decreasing the temperature and/or designing an optimal medium, or through improving the flux towards fatty acids by metabolic engineering, e.g. through over-expression of fatty acid synthases, over-expression of other...

  16. Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia). (United States)

    Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried


    The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.

  17. Triacetic acid lactone production in industrial Saccharomyces yeast strains (United States)

    Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

  18. Maintained activity of glycogen synthase kinase-3β despite of its phosphorylation at serine-9 in okadaic acid-induced neurodegenerative model

    International Nuclear Information System (INIS)

    Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou


    Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.

  19. The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET. (United States)

    Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard


    HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang


    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  1. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny


    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  2. Identification of a polyketide synthase required for alternariol (AOH and alternariol-9-methyl ether (AME formation in Alternaria alternata.

    Directory of Open Access Journals (Sweden)

    Debjani Saha

    Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.

  3. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    International Nuclear Information System (INIS)

    Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.


    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  4. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    Energy Technology Data Exchange (ETDEWEB)

    Kultti, Anne, E-mail: [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)


    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  5. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev


    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  6. Impact of laminar flow velocity of different acids on enamel calcium loss. (United States)

    Attin, T; Becker, K; Wiegand, A; Tauböck, T T; Wegehaupt, F J


    The aim of the study was to evaluate the impact of flow velocity under laminar flow conditions of different acidic solutions on enamel erosion. A total of 240 bovine enamel specimens were prepared and allocated to 30 groups (n = 8 each). Samples of 18 groups were superfused in a flow chamber system with laminar flow behavior using 1 ml of citric acid or hydrochloric acid (HCl) of pH 2.0, 2.6 or 3.0. Flow rates in the sample chamber were adjusted to 10, 60 or 100 μl/min. To simulate turbulent flow behavior, samples of six groups were immersed in 1 ml of the respective solution, which was vortexed (15 min, 600 rpm). For simulating non-agitated conditions, specimens of the remaining six groups were immersed in 1 ml of the respective solution without stirring. Calcium in the solutions, released from the enamel samples, was determined using Arsenazo III method. For acidic solutions of pH 2.6 and 3.0, erosive potential of citric acid was equivalent to that of HCl at a flow of 100 μl/min. The same observation was made for the samples subjected to turbulent conditions at pH 3. At all other conditions, citric acid induced a significantly higher calcium loss than HCl. It is concluded that under slow laminar flow conditions, flow rate variations lead to higher erosive impact of citric acid compared to hydrochloric acid at pH 2.0, but not at pH ≥ 2.6 and increasing laminar flow or turbulent conditions. Erosive enamel dissolution under laminar flow conditions is a complex issue influenced by flow rate and acidic substrate.

  7. A comparison of an ATPase from the archaebacterium Halobacterium saccharovorum with the F1 moiety from the Escherichia coli ATP Synthase (United States)

    Stan-Lotter, Helga; Hochstein, Lawrence I.


    A purified ATPase associated with membranes from Halobacterium saccharovorum was compared with the F sub 1 moiety from the Escherichia coli ATP Synthase. The halobacterial enzyme was composed of two major (I and II) and two minor subunits (III and IV), whose molecular masses were 87 kDa, 60 kDa, 29 kDa, and 20 kDa, respectively. The isoelectric points of these subunits ranged from 4.1 to 4.8, which in the case of the subunits I and II was consistent with the presence of an excess of acidic amino acids (20 to 22 Mol percent). Peptide mapping of sodium dodecylsulfate-denatured subunits I and II showed no relationship between the primary structures of the individual halobacterial subunits or similarities to the subunits of the F sub 1 ATPase (EC from E. coli. Trypsin inactivation of the halobacterial ATPase was accompanied by the partial degradation of the major subunits. This observation, taken in conjunction with molecular masses of the subunits and the native enzyme, was consistent with the previously proposed stoichiometry of 2:2:1:1. These results suggest that H. saccharovorum, and possibly, Halobacteria in general, possess an ATPase which is unlike the ubiquitous F sub o F sub 1 - ATP Synthase.

  8. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

    Directory of Open Access Journals (Sweden)

    Saito Koji


    Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

  9. Regulation of the Docosapentaenoic Acid/Docosahexaenoic Acid Ratio (DPA/DHA Ratio) in Schizochytrium limacinum B4D1. (United States)

    Zhang, Ke; Li, Huidong; Chen, Wuxi; Zhao, Minli; Cui, Haiyang; Min, Qingsong; Wang, Haijun; Chen, Shulin; Li, Demao


    Docosapentaenoic acid/docosahexaenoic acid ratio (DPA/DHA ratio) in Schizochytrium was relatively stable. But ideally the ratio of DPA/DHA will vary according to the desired end use. This study reports several ways of modulating the DPA/DHA ratio. Incubation times changed the DPA/DHA ratio, and changes in this ratio were associated with the variations in the saturated fatty acid (SFAs) content. Propionic acid sharply increased the SFAs content in lipids, dramatically decreased the even-chain SFAs content, and reduced the DPA/DHA ratio. Pentanoic acid (C5:0) and heptanoic acid (C7:0) had similar effects as propionic acid, whereas butyric acid (C4:0), hexanoic acid (C6:0), and octanoic acid (C8:0) did not change the fatty acid profile and the DPA/DHA ratio. Transcription analyses show that β-oxidation might be responsible for this phenomenon. Iodoacetamide upregulated polyunsaturated fatty acid (PUFA) synthase genes, reduced the DHA content, and improved the DPA content, causing the DPA/DHA ratio to increase. These results present new insights into the regulation of the DPA/DHA ratio.

  10. Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex

    Energy Technology Data Exchange (ETDEWEB)

    Marcella, Aaron M.; Culbertson, Sannie J.; Shogren-Knaak, Michael A.; Barb, Adam W.


    The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05 and 4.10 Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a KD = 62 ± 13 nM, followed by the binding of two more equivalents of holo-ACPP with KD = 1.2 ± 0.2 μM. Cooperativity was not observed for apo-ACPP which bound with KD = 2.4 ± 0.1 μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis.

  11. Purification and site-directed mutagenesis of linoleate 9S-dioxygenase-allene oxide synthase of Fusarium oxysporum confirms the oxygenation mechanism. (United States)

    Chen, Yang; Jernerén, Fredrik; Oliw, Ernst H


    Plants and fungi form jasmonic acid from α-linolenic acid. The first two steps of biosynthesis in plants occur by sequential transformation by 13S-lipoxygenase and allene oxide synthase (AOS). The biosynthesis in fungi may follow this classical scheme, but the only fungal AOS discovered so far are cytochromes P450 (CYP) fused to 8- and 9-dioxygenases (DOX). In the present report, we purified recombinant 9S-DOX-AOS of Fusarium oxysporum from cell lysate by cobalt affinity chromatography to near homogeneity and studied key residues by site-directed mutagenesis. Sequence homology with 8R-DOX-linoleate diol synthases (8R-DOX-LDS) suggested that Tyr414 catalyzes hydrogen abstraction and that Cys1051 forms the heme thiolate ligand. Site-directed mutagenesis (Tyr414Phe; Cys1051Ser) led to loss of 9S-DOX and 9S-AOS activities, respectively, but other important residues in the CYP parts of 5,8- and 7,8-LDS or 9R-AOS were not conserved. The UV-visible spectrum of 9S-DOX-AOS showed a Soret band at 409 nm, which shifted to 413 nm in the Cys1051Ser mutant. The 9S-AOS of the Tyr414Phe mutant transformed 9S-hydroperoxides of α-linolenic and linoleic acids to allene oxides/α-ketols, but it did not transform 13-hydroperoxides. We conclude that 9S- and 8R-DOX catalyze hydrogen abstraction at C-11 and C-8, respectively, by homologous Tyr residues. Copyright © 2017 Elsevier Inc. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Sudachkova N.E.


    Full Text Available The free amino acid content in the needles and the inner bark of stems and roots of 8-13-ages self-sawn trees of Pinus sylvestris L. in Central Siberia in experimental and natural conditions was compared. The experiments imitated an influence of long-seasonal or permafrost, soil drought and root hypoxia, concomitant flooding. The aim of the investigation was to expose the adaptive changes of these metabolites composition under stress impact. All of types of stress influences changed the total free amino acid content in the tissues of different morphological tree parts: the cooling of root system caused a deposit of free amino acids in overground tree part, the water deficit stimulated an accumulation of free amino acids in root inner bark, the flooding decreased the amino acid content in all tissues. The ratio in a group of amino acids with glutamic acid as metabolic precursor (-aminobutyric (GABA, proline, arginine, citrulline and ornithine changed under different stress impact. The cold stress in rhizosphere caused GABA accumulation in the needles and stem but not in the roots in the period of soil thawing. The moderate moisture deficit had not an influence on GABA content, the flooding caused GABA accumulation only in new needles. The maximal exceeding above control were marked for the sum of arginine and its metabolic precursors citrulline and ornithine. The group of these compounds may be considered as stress metabolites for scots pine, but specificity of depositing of these amino acids at water stress requires additional proofs. Since the proline accumulation was showed in separate times in the different tissues under all of investigated stressors impact, the specificity of proline as indicator of water stress in scots pine tissues is debatable. The disturbance of donor-acceptor connections in experiment with cooling resulted to the amino acid accumulation in stem inner bark, in experiment with drought – in root inner bark.

  13. Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelley, M.J.; Carman, G.M.


    The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism

  14. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. (United States)

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe


    Glucosamine-6-phosphate synthase (GlmS, EC catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Chondroitin sulfate synthase-2 is necessary for chain extension of chondroitin sulfate but not critical for skeletal development. (United States)

    Ogawa, Hiroyasu; Hatano, Sonoko; Sugiura, Nobuo; Nagai, Naoko; Sato, Takashi; Shimizu, Katsuji; Kimata, Koji; Narimatsu, Hisashi; Watanabe, Hideto


    Chondroitin sulfate (CS) is a linear polysaccharide consisting of repeating disaccharide units of N-acetyl-D-galactosamine and D-glucuronic acid residues, modified with sulfated residues at various positions. Based on its structural diversity in chain length and sulfation patterns, CS provides specific biological functions in cell adhesion, morphogenesis, neural network formation, and cell division. To date, six glycosyltransferases are known to be involved in the biosynthesis of chondroitin saccharide chains, and a hetero-oligomer complex of chondroitin sulfate synthase-1 (CSS1)/chondroitin synthase-1 and chondroitin sulfate synthase-2 (CSS2)/chondroitin polymerizing factor is known to have the strongest polymerizing activity. Here, we generated and analyzed CSS2(-/-) mice. Although they were viable and fertile, exhibiting no overt morphological abnormalities or osteoarthritis, their cartilage contained CS chains with a shorter length and at a similar number to wild type. Further analysis using CSS2(-/-) chondrocyte culture systems, together with siRNA of CSS1, revealed the presence of two CS chain species in length, suggesting two steps of CS chain polymerization; i.e., elongation from the linkage region up to Mr ∼10,000, and further extension. There, CSS2 mainly participated in the extension, whereas CSS1 participated in both the extension and the initiation. Our study demonstrates the distinct function of CSS1 and CSS2, providing a clue in the elucidation of the mechanism of CS biosynthesis.

  16. Impact of acid precipitation on recreation and tourism in Ontario: an overview

    Energy Technology Data Exchange (ETDEWEB)


    The impacts of acid precipitation on fishing opportunities, waterfowl and moose hunting, water contact activities, and the perception of the environment in Ontario are analyzed. Economic effects and future research needs are also estimated and discussed. These questions have been examined by identifying the likely links between acidic precipitation and recreation and tourism, by developing estimates of the importance of aquatic-based recreation and tourism, by describing the current and estimated future effects of acid precipitation. 101 references, 9 figures, 19 tables.

  17. Crystallization and preliminary X-ray crystallographic analysis of Aquifex aeolicus SelA, a bacterial selenocysteine synthase

    International Nuclear Information System (INIS)

    Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki


    The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN

  18. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)



    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  19. The impact of lactic acid bacteria on sourdough fermentation

    Directory of Open Access Journals (Sweden)

    Savić Dragiša S.


    Full Text Available The baking of sourdough breads represents one of the oldest biotechnological processes. Despite traditionality, sourdough bread has great potential because of its benefits. Sourdough is a mixture of flour and water that is dominated by a complex microflora composed of yeasts and lactic acid bacteria that are crucial in the preparation of bread dough. Lactic acid bacteria cause acidification by producing lactic acid that increases the shelf life of bread by preventing the growth of undesirable microorganisms and affects the nutritional value of bread by increasing the availability of minerals. In addition to these advantages, the use of sourdough fermentation also improves dough machinability, breadcrumb structure and the characteristic flavour of bread. Lactic acid bacteria in sourdough fermentation are well known representing both homofermentative and heterofermentative bacteria. They may originate from selected natural contaminants in the flour or from a starter culture containing one or more known species of lactic acid bacteria. Sourdough can be cultivated in bakeries or obtained from commercial suppliers. However, many bakeries in Europe still use spontaneously fermented sourdoughs, which have been kept metabolically active for decades by the addition of flour and water at regular intervals. The impact of lactic acid bacteria on sourdough fermentation and their influence on dough and bread quality was discussed on the basis of research and literature data.

  20. New role for L-arginine in regulation of inducible nitric-oxide-synthase-derived superoxide anion production in Raw 264.7 macrophages

    Czech Academy of Sciences Publication Activity Database

    Pekarová, Michaela; Lojek, Antonín; Martíšková, Hana; Vašíček, Ondřej; Binó, Lucia; Klinke, A.; Lau, D.; Kuchta, R.; Kadlec, J.; Vrba, R.; Kubala, Lukáš


    Roč. 11, - (2011), s. 2443-2457 ISSN 1537-744X R&D Projects: GA ČR(CZ) GA524/08/1753 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : macrophage s * L-arginine * inducible nitric oxide synthase Subject RIV: BO - Biophysics Impact factor: 1.524, year: 2010

  1. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.


    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  2. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli. (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.


    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  3. Hydrogeological assessment of Acid mine Drainage impacts in the West Rand Basin, Gauteng Province

    CSIR Research Space (South Africa)

    Hobbs, PJ


    Full Text Available HYDROGEOLOGICAL ASSESSMENT OF ACID MINE DRAINAGE IMPACTS IN THE WEST RAND BASIN, GAUTENG PROVINCE Principal Author PJ Hobbs (Pr.Sci.Nat.) Co-author JE Cobbing (Pr.Sci.Nat.) August 2007 Report prepared for CSIR / THRIP Document... it is published. A Hydrogeological Assessment of Acid Mine Drainage Report No. Impacts in the West Rand Basin, Gauteng Province CSIR/NRE/WR/ER/2007/0097/C CSIR Natural Resources and the Environment (i) The “Lodge” spring rising...

  4. An allene oxide and 12-oxophytodienoic acid are key intermediates in jasmonic acid biosynthesis by Fusarium oxysporum. (United States)

    Oliw, Ernst H; Hamberg, Mats


    Fungi can produce jasmonic acid (JA) and its isoleucine conjugate in large quantities, but little is known about the biosynthesis. Plants form JA from 18:3 n -3 by 13 S -lipoxygenase (LOX), allene oxide synthase, and allene oxide cyclase. Shaking cultures of Fusarium oxysporum f. sp. tulipae released over 200 mg of jasmonates per liter. Nitrogen powder of the mycelia expressed 10 R -dioxygenase-epoxy alcohol synthase activities, which was confirmed by comparison with the recombinant enzyme. The 13 S -LOX of F. oxysporum could not be detected in the cell-free preparations. Incubation of mycelia in phosphate buffer with [17,17,18,18,18- 2 H 5 ]18:3 n -3 led to biosynthesis of a [ 2 H 5 ]12-oxo-13-hydroxy-9 Z ,15 Z -octadecadienoic acid (α-ketol), [ 2 H 5 ]12-oxo-10,15 Z -phytodienoic acid (12-OPDA), and [ 2 H 5 ]13-keto- and [ 2 H 5 ]13 S -hydroxyoctadecatrienoic acids. The α-ketol consisted of 90% of the 13 R stereoisomer, suggesting its formation by nonenzymatic hydrolysis of an allene oxide with 13 S configuration. Labeled and unlabeled 12-OPDA were observed following incubation with 0.1 mM [ 2 H 5 ]18:3 n -3 in a ratio from 0.4:1 up to 47:1 by mycelia of liquid cultures of different ages, whereas 10 times higher concentration of [ 2 H 5 ]13 S -hydroperoxyoctadecatrienoic acid was required to detect biosynthesis of [ 2 H 5 ]12-OPDA. The allene oxide is likely formed by a cytochrome P450 or catalase-related hydroperoxidase. We conclude that F. oxysporum , like plants, forms jasmonates with an allene oxide and 12-OPDA as intermediates. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  5. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.


    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  6. One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid. (United States)

    Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef


    Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Microbial exoenzymes as bioindicators of acid rock drainage impacts in the Finniss River

    International Nuclear Information System (INIS)

    Hammerton, K.M.


    Sediment samples were collected from several sites along the East Branch of the Finniss River during the dry season (June, 1999), when the East Branch is drying into a series of ponds. The sites included those upstream from the Rum Jungle mine site (EB8A, EB8B, FCA, FCB), a site receiving acid leachate from the waste rock (WO), sites downstream from the mine that are impacted by acid and metal contamination (EB6, TCP, EB5D, EB4U, EB2) and reference sites not subject to acid rock drainage (HS, EB4S, LFRB). Exoenzyme activities were measured with a spectrofluorometric technique that involved measuring the increase in fluorescence when an artificial fluorogenic substrate (that mimics the natural substrate) is hydrolysed to a highly fluorescent product. The present findings indicate that the acid rock drainage impacted sediments contain acidophilic, heterotrophic microorganisms, bacteria and/or fungi, producing extracellular enzymes adapted to the acid conditions. This study has demonstrated that measurements of extracellular enzyme activities in river sediments provide a rapid, sensitive technique for determining microbial activity and productivity. In aquatic ecosystems some exoenzymes, particularly leucine-aminopeptidase, could be used as bioindicators of pollution from acid rock drainage

  8. Changes in membrane lipid composition in ethanol- and acid-adapted Oenococcus oeni cells: characterization of the cfa gene by heterologous complementation. (United States)

    Grandvalet, Cosette; Assad-García, Juan Simón; Chu-Ky, Son; Tollot, Marie; Guzzo, Jean; Gresti, Joseph; Tourdot-Maréchal, Raphaëlle


    Cyclopropane fatty acid (CFA) synthesis was investigated in Oenococcus oeni. The data obtained demonstrated that acid-grown cells or cells harvested in the stationary growth phase showed changes in fatty acid composition similar to those of ethanol-grown cells. An increase of the CFA content and a decrease of the oleic acid content were observed. The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases. Quantitative real-time-PCR experiments were performed on the cfa gene of O. oeni, which encodes a putative CFA synthase. The level of cfa transcripts increased when cells were harvested in stationary phase and when cells were grown in the presence of ethanol or at low pH, suggesting transcriptional regulation of the cfa gene under different stress conditions. In contrast to Escherichia coli, only one functional promoter was identified upstream of the cfa gene of O. oeni. The function of the cfa gene was confirmed by complementation of a cfa-deficient E. coli strain. Nevertheless, the complementation remained partial because the conversion percentage of unsaturated fatty acids into CFA of the complemented strain was much lower than that of the wild-type strain. Moreover, a prevalence of cycC19 : 0 was observed in the membrane of the complemented strain. This could be due to a specific affinity of the CFA synthase from O. oeni. In spite of this partial complementation, the complemented strain of E. coli totally recovered its viability after ethanol shock (10 %, v/v) whereas its viability was only partly recovered after an acid shock at pH 3.0.

  9. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞ (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook


    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402


    Directory of Open Access Journals (Sweden)

    Aditya Dev


    Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.

  11. A Functional Tricarboxylic Acid Cycle Operates during Growth of Bordetella pertussis on Amino Acid Mixtures as Sole Carbon Substrates.

    Directory of Open Access Journals (Sweden)

    Marie Izac

    Full Text Available It has been claimed that citrate synthase, aconitase and isocitrate dehydrogenase activities are non-functional in Bordetella pertussis and that this might explain why this bacterium's growth is sometimes associated with accumulation of polyhydroxybutyrate (PHB and/or free fatty acids. However, the sequenced genome includes the entire citric acid pathway genes. Furthermore, these genes were expressed and the corresponding enzyme activities detected at high levels for the pathway when grown on a defined medium imitating the amino acid content of complex media often used for growth of this pathogenic microorganism. In addition, no significant PHB or fatty acids could be detected. Analysis of the carbon balance and stoichiometric flux analysis based on specific rates of amino acid consumption, and estimated biomass requirements coherent with the observed growth rate, clearly indicate that a fully functional tricarboxylic acid cycle operates in contrast to previous reports.

  12. [Overexpression of four fatty acid synthase genes elevated the efficiency of long-chain polyunsaturated fatty acids biosynthesis in mammalian cells]. (United States)

    Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie


    Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.

  13. ATP Synthase, a Target for Dementia and Aging? (United States)

    Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R


    Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.

  14. Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen. (United States)

    Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji


    Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. Quick and sensitive determination of gene expression of fatty acid ...

    African Journals Online (AJOL)



    May 16, 2011 ... from fatty acid synthase (FAS) with a different glucose level in ... By using the following formula, this study was able to quantify the mRNA expression of ... hypertension, heart disease and diabetes. ... regulation of gene expression has emerged in recent ... stages of adipocyte meta-bolism are relatively well.

  16. Structural and functional annotation of citrate synthase from Aspergillus niger ANJ-120. (United States)

    Mustafa, Ghulam; Arif, Rawaba; Bukhari, Shazia Anwer; Ali, Muhammad; Sharif, Sumaira; Atta, Asia


    Citrate synthase (CS) is involved in citric acid biosynthesis which is a well-established metabolic pathway. The condensation of acetyl-CoA with oxaloacetate is catalyzed by CS. Citric acid (CA) has a number of applications in pharmaceutical industry. CA in combination with bicarbonates is used as an effervescent in the preparations of tablets and powders. It has also been used as an anticoagulant and acidulant to form mild astringent. In current study, detailed structural and functional analyses of CS protein were carried out using various bioinformatics tools. Structural modeling was also done by building 3D model of CS from Aspergillus niger ANJ-120 using Modeller 9.16 software. The 3D Model was then evaluated using different online approaches. Furthermore, superimposition of query and template structures, Root Mean Squared Deviation and visualization of generated model were done through UCSF Chimera 1.5.3. Even though various roles of CS protein were already known and verified experimentally, here we presented a structural analysis of CS protein. The structural investigation of CS protein will be helpful for protein engineering strategies and understanding the interactions among proteins. Due to large number of applications, the production of citric acid by A. niger and its bioinformatics studies will offer substantial improvement in commercial scale intensification of this useful product.

  17. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    International Nuclear Information System (INIS)

    Różycki, Bartosz; Cieplak, Marek


    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme

  18. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica


    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  19. Ceramide synthases expression and role of ceramide synthase-2 in the lung: insight from human lung cells and mouse models.

    Directory of Open Access Journals (Sweden)

    Irina Petrache

    Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.

  20. Kinetics and equilibria of cyanide binding to prostaglandin H synthase. (United States)

    MacDonald, I D; Dunford, H B


    Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

  1. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia. (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W


    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  2. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS. (United States)

    von Wettstein-Knowles, Penny


    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  3. Impact of botanical oils on polyunsaturated fatty acid metabolism and leukotriene generation in mild asthmatics (United States)


    Background Dietary supplementation with botanical oils that contain n-6 and n-3 eighteen carbon chain (18C)-PUFA such as γ linolenic acid (GLA, 18:3n-6), stearidonic acid (SDA, 18:4n-3) and α linolenic acid (ALA, 18:3n-3) have been shown to impact PUFA metabolism, alter inflammatory processes including arachidonic acid (AA) metabolism and improve inflammatory disorders. Methods The diet of mild asthmatics patients was supplemented for three weeks with varying doses of two botanical seed oils (borage oil [Borago officinalis, BO] and echium seed oil [Echium plantagineum; EO]) that contain SDA, ALA and GLA. A three week wash out period followed. The impact of these dietary manipulations was evaluated for several biochemical endpoints, including in vivo PUFA metabolism and ex vivo leukotriene generation from stimulated leukocytes. Results Supplementation with several EO/BO combinations increased circulating 20–22 carbon (20–22C) PUFAs, including eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and dihommo-gammalinolenic acid (DGLA), which have been shown to inhibit AA metabolism and inflammation without impacting circulating AA levels. BO/EO combinations also inhibited ex vivo leukotriene generation with some combinations attenuating cysteinyl leukotriene generation in stimulated basophils by >50% and in stimulated neutrophils by >35%. Conclusions This study shows that dietary supplementation with BO/EO alters 20–22C PUFA levels and attenuates leukotriene production in a manner consistent with a reduction in inflammation. PMID:24088297

  4. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN (United States)

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq


    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  5. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer (United States)

    Abu-Soud, Husam M.; Stuehr, Dennis J.


    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  6. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice. (United States)

    Gauba, Esha; Guo, Lan; Du, Heng


    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  7. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    International Nuclear Information System (INIS)

    Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako


    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl- 14 C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with

  8. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    Energy Technology Data Exchange (ETDEWEB)

    Mizuno, Kouichi, E-mail: [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)


    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

  9. Structure, High Affinity, and Negative Cooperativity of the Escherichia coli Holo-(Acyl Carrier Protein):Holo-(Acyl Carrier Protein) Synthase Complex. (United States)

    Marcella, Aaron M; Culbertson, Sannie J; Shogren-Knaak, Michael A; Barb, Adam W


    The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05and 4.10Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a K D =62±13nM, followed by the binding of two more equivalents of holo-ACPP with K D =1.2±0.2μM. Cooperativity was not observed for apo-ACPP which bound with K D =2.4±0.1μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun


    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  11. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.


    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  12. Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae). (United States)

    Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A


    Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  13. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme (United States)

    Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg


    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  14. Evolution of flavone synthase I from parsley flavanone 3beta-hydroxylase by site-directed mutagenesis. (United States)

    Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan


    Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).

  15. Inhibition of rotavirus replication by downregulation of fatty acid synthesis. (United States)

    Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich


    Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.

  16. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression. (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M


    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  17. The basal kinetic parameters of glycogen synthase in human myotube cultures are not affected by chronic high insulin exposure

    DEFF Research Database (Denmark)

    Gaster, M; Schrøder, H D; Handberg, A


    results show that chronic exposure of human myotubes to high insulin with or without high glucose did not affect the basal kinetic parameters but abolished the reactivity of GS to acute insulin stimulation. We suggest that insulin induced insulin resistance of GS is caused by a failure of acute insulin......There is no consensus regarding the results from in vivo and in vitro studies on the impact of chronic high insulin and/or high glucose exposure on acute insulin stimulation of glycogen synthase (GS) kinetic parameters in human skeletal muscle. The aim of this study was to evaluate the kinetic...... parameters of glycogen synthase activity in human myotube cultures at conditions of chronic high insulin combined or not with high glucose exposure, before and after a subsequent acute insulin stimulation. Acute insulin stimulation significantly increased the fractional activity (FV(0.1)) of GS, increased...

  18. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis. (United States)

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A


    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  19. Multi-substrate terpene synthases: their occurrence and physiological significance

    Directory of Open Access Journals (Sweden)

    Leila Pazouki


    Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

  20. Longevity in vivo of primary cell wall cellulose synthases. (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming


    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  1. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening (United States)

    Kuzmanoff, K. M.


    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  2. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family. (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew


    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes. (United States)

    Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg


    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

  4. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD


    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  5. Isolation and characterization of farnesyl diphosphate synthase from the cotton boll weevil, Anthonomus grandis. (United States)

    Taban, A Huma; Tittiger, Claus; Blomquist, Gary J; Welch, William H


    Farnesyl diphosphate synthase (FPPS) catalyzes the consecutive condensation of two molecules of isopentenyl diphosphate with dimethylallyl diphosphate to form farnesyl diphosphate (FPP). In insects, FPP is used for the synthesis of ubiquinones, dolicols, protein prenyl groups, and juvenile hormone. A full-length cDNA of FPPS was cloned from the cotton boll weevil, Anthonomus grandis (AgFPPS). AgFPPS cDNA consists of 1,835 nucleotides and encodes a protein of 438 amino acids. The deduced amino acid sequence has high similarity to previously isolated insect FPPSs and other known FPPSs. Recombinant AgFPPS expressed in E. coli converted labeled isopentenyl diphosphate in the presence of dimethylallyl diphosphate to FPP. Southern blot analysis indicated the presence of a single copy gene. Using molecular modeling, the three-dimensional structure of coleopteran FPPS was determined and compared to the X-ray crystal structure of avian FPPS. The alpha-helical fold is conserved in AgFPPS and the size of the active site cavity is consistent with the enzyme being a FPPS. (c) 2009 Wiley Periodicals, Inc.

  6. Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

    Directory of Open Access Journals (Sweden)

    S. Saeidnia


    Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

  7. Isoeugenin, a Novel Nitric Oxide Synthase Inhibitor Isolated from the Rhizomes of Imperata cylindrica

    Directory of Open Access Journals (Sweden)

    Hyo-Jin An


    Full Text Available Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae were performed using high-performance liquid chromatography (HPLC. We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO formation in lipopolysaccharide (LPS-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL. In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (COX-2, and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.

  8. Isoeugenin, a Novel Nitric Oxide Synthase Inhibitor Isolated from the Rhizomes of Imperata cylindrica. (United States)

    An, Hyo-Jin; Nugroho, Agung; Song, Byong-Min; Park, Hee-Juhn


    Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae) were performed using high-performance liquid chromatography (HPLC). We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO) formation in lipopolysaccharide (LPS)-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL). In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.

  9. Impact of metabolism and growth phase on the hydrogen isotopic composition of microbial fatty acids (United States)

    Heinzelmann, Sandra M.; Villanueva, Laura; Sinke-Schoen, Danielle; Sinninghe Damsté, Jaap S.; Schouten, Stefan; van der Meer, Marcel T. J.


    Microorganisms are involved in all elemental cycles and therefore it is important to study their metabolism in the natural environment. A recent technique to investigate this is the hydrogen isotopic composition of microbial fatty acids, i.e., heterotrophic microorganisms produce fatty acids enriched in deuterium (D) while photoautotrophic and chemoautotrophic microorganisms produce fatty acids depleted in D compared to the water in the culture medium (growth water). However, the impact of factors other than metabolism have not been investigated. Here, we evaluate the impact of growth phase compared to metabolism on the hydrogen isotopic composition of fatty acids of different environmentally relevant microorganisms with heterotrophic, photoautotrophic and chemoautotrophic metabolisms. Fatty acids produced by heterotrophs are enriched in D compared to growth water with εlipid/water between 82 and 359‰ when grown on glucose or acetate, respectively. Photoautotrophs (εlipid/water between −149 and −264‰) and chemoautotrophs (εlipid/water between −217 and −275‰) produce fatty acids depleted in D. Fatty acids become, in general, enriched by between 4 and 46‰ with growth phase which is minor compared to the influence of metabolisms. Therefore, the D/H ratio of fatty acids is a promising tool to investigate community metabolisms in nature. PMID:26005437

  10. Impact of Sampling and Cellular Separation on Amino Acid Determinations in Drosophila Hemolymph. (United States)

    Cabay, Marissa R; Harris, Jasmine C; Shippy, Scott A


    The fruit fly is a frequently used model system with a high degree of human disease-related genetic homology. The quantitative chemical analysis of fruit fly tissues and hemolymph uniquely brings chemical signaling and compositional information to fly experimentation. The work here explores the impact of measured chemical content of hemolymph with three aspects of sample collection and preparation. Cellular content of hemolymph was quantitated and removed to determine hemolymph composition changes for seven primary amine analytes. Hemolymph sampling methods were adapted to determine differences in primary amine composition of hemolymph collected from the head, antenna, and abdomen. Also, three types of anesthesia were employed with hemolymph collection to quantitate effects on measured amino acid content. Cell content was found to be 45.4 ± 22.1 cells/nL of hemolymph collected from both adult and larvae flies. Cell-concentrated fractions of adult, but not larvae, hemolymph were found to have higher and more variable amine content. There were amino acid content differences found between all three areas indicating a robust method to characterize chemical markers from specific regions of a fly, and these appear related to physiological activity. Methods of anesthesia have an impact on hemolymph amino acid composition related to overall physiological impact to fly including higher amino acid content variability and oxygen deprivation effects. Together, these analyses identify potential complications with Drosophila hemolymph analysis and opportunities for future studies to relate hemolymph content with model physiological activity.

  11. Impact of oral vancomycin on gut microbiota, bile acid metabolism, and insulin sensitivity

    DEFF Research Database (Denmark)

    Vrieze, Anne; Out, Carolien; Fuentes, Susana


    .i.d. At baseline and after 1 week of therapy, fecal microbiota composition (Human Intestinal Tract Chip phylogenetic microarray), fecal and plasma bile acid concentrations as well as insulin sensitivity (hyperinsulinemic euglycemic clamp using [6,6-(2)H2]-glucose tracer) were measured. RESULTS: Vancomycin reduced...... (pinsulin sensitivity (p... of vancomycin significantly impacts host physiology by decreasing intestinal microbiota diversity, bile acid dehydroxylation and peripheral insulin sensitivity in subjects with metabolic syndrome. These data show that intestinal microbiota, particularly of the Firmicutes phylum contributes to bile acid...

  12. Training affects muscle phospholipid fatty acid composition in humans

    DEFF Research Database (Denmark)

    Helge, Jørn Wulff; Wu, B J; Willer, Mette


    on the muscle membrane phospholipid fatty acid composition in humans. Seven male subjects performed endurance training of the knee extensors of one leg for 4 wk. The other leg served as a control. Before, after 4 days, and after 4 wk, muscle biopsies were obtained from the vastus lateralis. After 4 wk......, the phospholipid fatty acid contents of oleic acid 18:1(n-9) and docosahexaenoic acid 22:6(n-3) were significantly higher in the trained (10.9 +/- 0.5% and 3.2 +/- 0.4% of total fatty acids, respectively) than the untrained leg (8.8 +/- 0.5% and 2.6 +/- 0.4%, P fatty acids...... was significantly lower in the trained (11.1 +/- 0.9) than the untrained leg (13.1 +/- 1.2, P fatty acid composition. Citrate synthase activity was increased by 17% in the trained compared with the untrained leg (P

  13. Structure-function mapping of key determinants for hydrocarbon biosynthesis by squalene and squalene synthase-like enzymes from the green alga Botryococcus braunii race B. (United States)

    Bell, Stephen A; Niehaus, Thomas D; Nybo, S Eric; Chappell, Joseph


    Squalene and botryococcene are branched-chain, triterpene compounds that arise from the head-to-head condensation of two molecules of farnesyl diphosphate to yield 1'-1 and 1'-3 linkages, respectively. The enzymes that catalyze their formation have attracted considerable interest from the medical field as potential drug targets and the renewable energy sector for metabolic engineering efforts. Recently, the enzymes responsible for botryococcene and squalene biosynthesis in the green alga Botryococcus braunii race B were characterized. To better understand how the specificity for the 1'-1 and 1'-3 linkages was controlled, we attempted to identify the functional residues and/or domains responsible for this step in the catalytic cascade. Existing crystal structures for the mammalian squalene synthase and Staphylococcus dehydrosqualene synthase enzymes were exploited to develop molecular models for the B. braunii botryococcene and squalene synthase enzymes. Residues within the active sites that could mediate catalytic specificity were identified, and reciprocal mutants were created in an attempt to interconvert the reaction product specificity of the enzymes. We report here the identification of several amino acid positions contributing to the rearrangement of the cyclopropyl intermediate to squalene, but these same positions do not appear to be sufficient to account for the cyclopropyl rearrangement to give botryococcene.

  14. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases. (United States)

    Cheng, Jiujun; Charles, Trevor C


    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  15. Double-Mutated 5-Enol Pyruvylshikimate-3-phosphate Synthase Protein Expressed in MZHG0JG Corn (Zea mays L.) Has No Impact on Toxicological Safety and Nutritional Composition. (United States)

    Matthews, Bethany A; Launis, Karen L; Bauman, Patricia A; Juba, Nicole C


    MZHG0JG corn will offer growers the flexibility to alternate between herbicides with two different modes of action in their weed-management programs, helping to mitigate and manage the evolution of herbicide resistance in weed populations. The proteins conferring herbicide tolerence in MZHG0JG corn, double-mutated 5-enol pyruvylshikimate-3-phosphate synthase protein (mEPSPS) and phosphinothricin acetyltransferase (PAT), as well as the MZHG0JG corn event, have been assessed by regulatory authorities globally and have been determined to be safe for humans, animals, and the environment. In addition to the safety data available for these proteins, further studies were conducted on MZHG0JG corn to assess levels of mEPSPS as compared to previously registered genetically modified (GM) corn. The results support the conclusion of no impact on toxicological safety or nutritional composition.

  16. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  17. Knockout of Tmem70 alters biogenesis of ATP synthase and leads to embryonal lethality in mice

    Czech Academy of Sciences Publication Activity Database

    Vrbacký, Marek; Kovalčíková, Jana; Chawengsaksophak, Kallayanee; Beck, Inken; Mráček, Tomáš; Nůsková, Hana; Sedmera, David; Papoušek, František; Kolář, František; Sobol, Margaryta; Hozák, Pavel; Sedláček, Radislav; Houštěk, Josef


    Roč. 25, č. 21 (2016), s. 4674-4685 ISSN 0964-6906 R&D Projects: GA ČR(CZ) GB14-36804G; GA MŠk(CZ) LL1204; GA MŠk(CZ) ED1.1.00/02.0109; GA TA ČR(CZ) TE01020118; GA MŠk(CZ) LM2015062; GA MZd(CZ) NV16-33018A; GA MŠk(CZ) LM2015040 Institutional support: RVO:67985823 ; RVO:68378050 Keywords : mouse knockout * mitochondria * ATP synthase * TMEM70 * biogenesis * mitochondrial diseases Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.340, year: 2016

  18. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    International Nuclear Information System (INIS)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.


    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M  = 1.111 μM (±0.113), v max  = 0.3245 μM min −1 (±0.0035), k cat  = 2.95 min −1 , as well as a catalytic efficiency k cat /K M  = 4.43 × 10 4  M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction

  19. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail:


    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned

  20. Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells. (United States)

    Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru


    5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

  1. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Roman eGangl


    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  2. Impact of visual inspection with acetic acid plus cryotherapy “see ...

    African Journals Online (AJOL)


    May 18, 2016 ... Objective: The aim of this study is to determine the impact of visual inspection with acetic acid (VIA) plus immediate .... the “see and treat” model, women who test positive to ... or divorced, and the mean parity was 4.3 ± 1.4.

  3. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar


    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  4. wALADin benzimidazoles differentially modulate the function of porphobilinogen synthase orthologs. (United States)

    Lentz, Christian S; Halls, Victoria S; Hannam, Jeffrey S; Strassel, Silke; Lawrence, Sarah H; Jaffe, Eileen K; Famulok, Michael; Hoerauf, Achim; Pfarr, Kenneth M


    The heme biosynthesis enzyme porphobilinogen synthase (PBGS) is a potential drug target in several human pathogens. wALADin1 benzimidazoles have emerged as species-selective PBGS inhibitors against Wolbachia endobacteria of filarial worms. In the present study, we have systematically tested wALADins against PBGS orthologs from bacteria, protozoa, metazoa, and plants to elucidate the inhibitory spectrum. However, the effect of wALADin1 on different PBGS orthologs was not limited to inhibition: several orthologs were stimulated by wALADin1; others remained unaffected. We demonstrate that wALADins allosterically modulate the PBGS homooligomeric equilibrium with inhibition mediated by favoring low-activity oligomers, while 5-aminolevulinic acid, Mg(2+), or K(+) stabilized high-activity oligomers. Pseudomonas aeruginosa PBGS could be inhibited or stimulated by wALADin1 depending on these factors and pH. We have defined the wALADin chemotypes responsible for either inhibition or stimulation, facilitating the design of tailored PBGS modulators for potential application as antimicrobial agents, herbicides, or drugs for porphyric disorders.

  5. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

  6. Isolation and characterization of three new monoterpene synthases from Artemisia annua


    Ju-Xin eRuan; Jian-Xu eLi; Xin eFang; Ling-Jian eWang; Wen-Li eHu; Xiao-Ya eChen; Changqing eYang


    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with...

  7. Systematic analysis of rat 12/15-lipoxygenase enzymes reveals critical role for spinal eLOX3 hepoxilin synthase activity in inflammatory hyperalgesia


    Gregus, Ann M.; Dumlao, Darren S.; Wei, Spencer C.; Norris, Paul C.; Catella, Laura C.; Meyerstein, Flore G.; Buczynski, Matthew W.; Steinauer, Joanne J.; Fitzsimmons, Bethany L.; Yaksh, Tony L.; Dennis, Edward A.


    Previously, we observed significant increases in spinal 12-lipoxygenase (LOX) metabolites, in particular, hepoxilins, which contribute to peripheral inflammation-induced tactile allodynia. However, the enzymatic sources of hepoxilin synthase (HXS) activity in rats remain elusive. Therefore, we overexpressed each of the 6 rat 12/15-LOX enzymes in HEK-293T cells and measured by LC-MS/MS the formation of HXB3, 12-HETE, 8-HETE, and 15-HETE from arachidonic acid (AA) at baseline and in the presenc...

  8. Aspergillus fumigatus Trehalose-Regulatory Subunit Homolog Moonlights To Mediate Cell Wall Homeostasis through Modulation of Chitin Synthase Activity

    Directory of Open Access Journals (Sweden)

    Arsa Thammahong


    Full Text Available Trehalose biosynthesis is found in fungi but not humans. Proteins involved in trehalose biosynthesis are essential for fungal pathogen virulence in humans and plants through multiple mechanisms. Loss of canonical trehalose biosynthesis genes in the human pathogen Aspergillus fumigatus significantly alters cell wall structure and integrity, though the mechanistic link between these virulence-associated pathways remains enigmatic. Here we characterize genes, called tslA and tslB, which encode proteins that contain domains similar to those corresponding to trehalose-6-phosphate phosphatase but lack critical catalytic residues for phosphatase activity. Loss of tslA reduces trehalose content in both conidia and mycelia, impairs cell wall integrity, and significantly alters cell wall structure. To gain mechanistic insights into the role that TslA plays in cell wall homeostasis, immunoprecipitation assays coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS were used to reveal a direct interaction between TslA and CsmA, a type V chitin synthase enzyme. TslA regulates not only chitin synthase activity but also CsmA sub-cellular localization. Loss of TslA impacts the immunopathogenesis of murine invasive pulmonary aspergillosis through altering cytokine production and immune cell recruitment. In conclusion, our data provide a novel model whereby proteins in the trehalose pathway play a direct role in fungal cell wall homeostasis and consequently impact fungus-host interactions.

  9. Impact of simulated acid rain on trace metals and aluminum leaching in latosol from Guangdong Province, China (United States)

    Jia-En Zhang; Jiayu Yu; Ying Ouyang; Huaqin. Xu


    Acid rain is one of the most serious ecological and environmental problems worldwide. This study investigated the impacts of simulated acid rain (SAR) upon leaching of trace metals and aluminum (Al) from a soil. Soil pot leaching experiments were performed to investigate the impacts of SAR at five different pH levels (or treatments) over a 34-day period upon the...

  10. Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes.

    Directory of Open Access Journals (Sweden)

    Scott B Crown

    Full Text Available The branched chain amino acids (BCAA valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0 and odd chain length (C15:0 and C17:0 fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.

  11. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis. (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B


    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of

  12. Crosstalk between Bile Acids and Gut Microbiota and Its Impact on Farnesoid X Receptor Signalling

    DEFF Research Database (Denmark)

    Wahlström, Annika; Kovatcheva-Datchary, Petia; Ståhlman, Marcus


    Background: The gut microbiota has a substantial impact on health and disease. The human gut microbiota influences the development and progression of metabolic diseases; however, the underlying mechanisms are not fully understood. The nuclear farnesoid X receptor (FXR), which regulates bile acid...... homeostasis and glucose and lipid metabolism, is activated by primary human and murine bile acids, chenodeoxycholic acid and cholic acid, while rodent specific primary bile acids tauromuricholic acids antagonise FXR activation. The gut microbiota deconjugates and subsequently metabolises primary bile acids...... into secondary bile acids in the gut and thereby changes FXR activation and signalling. Key Message: Mouse models have been used to study the crosstalk between bile acids and the gut microbiota, but the substantial differences in bile acid composition between humans and mice need to be considered when...

  13. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph


    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  14. Conserved residues of the human mitochondrial holocytochrome c synthase mediate interactions with heme. (United States)

    Babbitt, Shalon E; San Francisco, Brian; Bretsnyder, Eric C; Kranz, Robert G


    C-type cytochromes are distinguished by the covalent attachment of a heme cofactor, a modification that is typically required for its subsequent folding, stability, and function. Heme attachment takes place in the mitochondrial intermembrane space and, in most eukaryotes, is mediated by holocytochrome c synthase (HCCS). HCCS is the primary component of the eukaryotic cytochrome c biogenesis pathway, known as System III. The catalytic function of HCCS depends on its ability to coordinate interactions between its substrates: heme and cytochrome c. Recent advancements in the recombinant expression and purification of HCCS have facilitated comprehensive analyses of the roles of conserved residues in HCCS, as demonstrated in this study. Previously, we proposed a four-step model describing HCCS-mediated cytochrome c assembly, identifying a conserved histidine residue (His154) as an axial ligand to the heme iron. In this study, we performed a systematic mutational analysis of 17 conserved residues in HCCS, and we provide evidence that the enzyme contains two heme-binding domains. Our data indicate that heme contacts mediated by residues within these domains modulate the dynamics of heme binding and contribute to the stability of the HCCS-heme-cytochrome c steady state ternary complex. While some residues are essential for initial heme binding (step 1), others impact the subsequent release of the holocytochrome c product (step 4). Certain HCCS mutants that were defective in heme binding were corrected for function by exogenous aminolevulinic acid (ALA, the precursor to heme). This chemical "correction" supports the proposed role of heme binding for the corresponding residues.

  15. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    Energy Technology Data Exchange (ETDEWEB)

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield


    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  16. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease. (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul


    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)


    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  18. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    International Nuclear Information System (INIS)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A.; Braden, B.C.


    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  19. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene. (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk


    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli


    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.


    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  1. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure


    no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC, which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  2. Homocysteine threshold value based on cystathionine beta synthase and paraoxonase 1 activities in mice. (United States)

    Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N


    Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.

  3. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants. (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako


    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  4. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum). (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian


    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Metformin impacts cecal bile acid profiles in mice. (United States)

    Sillner, Nina; Walker, Alesia; Koch, Wendelin; Witting, Michael; Schmitt-Kopplin, Philippe


    Bile acids (BAs) are major components of bile synthesized from cholesterol and take part in the digestion of dietary lipids, as well as having signaling functions. They undergo extensive microbial metabolism inside the gastrointestinal tract. Here, we present a method of ultra-high pressure liquid chromatography coupled to ion trap mass spectrometry for quantification of 45 BAs in mouse cecum. The system was validated in regard to sensitivity with limits of detection and quantification (0.6-24.9 nM), interday accuracy (102.4%), interday precision (15.2%), recovery rate (74.7%), matrix effect (98.2%) and carry-over effect (mice were treated with metformin for 1 day or 14 days. One day of treatment resulted in a significant increase of total BA concentration (2.7-fold increase; db/db metformin 5.32 μmol/g, db/db control mice 1.95 μmol/g), most notable in levels of 7-oxodeoxycholic, 3-dehydrocholic and cholic acid. We observed only minor impact on BA metabolism after 14 days of metformin treatment, compared to the single treatment. Furthermore, healthy wild type mice had elevated concentrations of allocholic and ω-muricholic acid compared to diabetic mice. Our method proved the applicability of profiling BAs in cecum to investigate intestinal BA metabolism in diabetes and pharmacological applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    International Nuclear Information System (INIS)

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.


    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  7. Characterization of a 1,4-{beta}-D-glucan synthase from Dictyostelium discoideum. Progress report, May 1990--January 1992

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.


    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  8. Soybean seeds expressing feedback-insensitive cystathionine γ-synthase exhibit a higher content of methionine. (United States)

    Song, Shikui; Hou, Wensheng; Godo, Itamar; Wu, Cunxiang; Yu, Yang; Matityahu, Ifat; Hacham, Yael; Sun, Shi; Han, Tianfu; Amir, Rachel


    Soybean seeds provide an excellent source of protein for human and livestock nutrition. However, their nutritional quality is hampered by a low concentration of the essential sulfur amino acid, methionine (Met). In order to study factors that regulate Met synthesis in soybean seeds, this study used the Met-insensitive form of Arabidopsis cystathionine γ-synthase (AtD-CGS), which is the first committed enzyme of Met biosynthesis. This gene was expressed under the control of a seed-specific promoter, legumin B4, and used to transform the soybean cultivar Zigongdongdou (ZD). In three transgenic lines that exhibited the highest expression level of AtD-CGS, the level of soluble Met increased significantly in developing green seeds (3.8-7-fold). These seeds also showed high levels of other amino acids. This phenomenon was more prominent in two transgenic lines, ZD24 and ZD91. The total Met content, which including Met incorporated into proteins, significantly increased in the mature dry seeds of these two transgenic lines by 1.8- and 2.3-fold, respectively. This elevation was accompanied by a higher content of other protein-incorporated amino acids, which led to significantly higher total protein content in the seeds of these two lines. However, in a third transgenic line, ZD01, the level of total Met and the level of other amino acids did not increase significantly in the mature dry seeds. This line also showed no significant change in protein levels. This suggests a positive connection between high Met content and the synthesis of other amino acids that enable the synthesis of more seed proteins.

  9. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content


    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.


    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  10. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species. (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing


    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Phosphorylation of sites 3 and 2 in rabbit skeletal muscle glycogen synthase by a multifunctional protein kinase (ATP-citrate lyase kinase)

    International Nuclear Information System (INIS)

    Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.


    A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro

  12. From bacterial to human dihydrouridine synthase: automated structure determination

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, Fiona, E-mail:; Jenkins, Huw T., E-mail: [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: [The University of York, Heslington, York YO10 5DD (United Kingdom)


    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  13. From bacterial to human dihydrouridine synthase: automated structure determination

    International Nuclear Information System (INIS)

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.


    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  14. Induction of a leaf specific geranylgeranyl pyrophosphate synthase and emission of (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene in tomato are dependent on both jasmonic acid and salicylic acid signaling pathways

    NARCIS (Netherlands)

    Ament, K.; Schie, C.C.; Bouwmeester, H.J.; Haring, M.A.; Schuurink, R.C.


    Two cDNAs encoding geranylgeranyl pyrophosphate (GGPP) synthases from tomato (Lycopersicon esculentum) have been cloned and functionally expressed in Escherichia coli. LeGGPS1 was predominantly expressed in leaf tissue and LeGGPS2 in ripening fruit and flower tissue. LeGGPS1 expression was induced

  15. 13C Metabolic Flux Analysis for systematic metabolic engineering of S. cerevisiae for overproduction of fatty acids.

    Directory of Open Access Journals (Sweden)

    Amit Ghosh


    Full Text Available Efficient redirection of microbial metabolism into the abundant production of desired bioproducts remains non-trivial. Here we used flux-based modeling approaches to improve yields of fatty acids in S. cerevisiae. We combined 13C labeling data with comprehensive genome-scale models to shed light onto microbial metabolism and improve metabolic engineering efforts. We concentrated on studying the balance of acetyl-CoA, a precursor metabolite for the biosynthesis of fatty acids. A genome-wide acetyl-CoA balance study showed ATP citrate lyase from Y. lipolytica as a robust source of cytoplasmic acetyl-CoA and malate synthase as a desirable target for down-regulation in terms of acetyl-CoA consumption. These genetic modifications were applied to S. cerevisiae WRY2, a strain that is capable of producing 460 mg L of free fatty acids. With the addition of ATP citrate lyase and down-regulation of malate synthase the engineered strain produced 26 per cent more free fatty acids. Further increases in free fatty acid production of 33 per cent were obtained by knocking out the cytoplasmic glycerol-3-phosphate dehydrogenase, which flux analysis had shown was competing for carbon flux upstream with the carbon flux through the acetyl-CoA production pathway in the cytoplasm. In total, the genetic interventions applied in this work increased fatty acid production by 70 per cent.

  16. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening. (United States)

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) catalyzes the rate-limiting step in ethylene biosynthesis during ripening. ACS isozymes are regulated both transcriptionally and post-translationally. However, in banana, an important climacteric fruit, little is known about post-translational regulation of ACS. Here, we report the post-translational modification of MA-ACS1 (Musa acuminata ACS1), a ripening inducible isozyme in the ACS family, which plays a key role in ethylene biosynthesis during banana fruit ripening. Immunoprecipitation analyses of phospholabeled protein extracts from banana fruit using affinity-purified anti-MA-ACS1 antibody have revealed phosphorylation of MA-ACS1, particularly in ripe fruit tissue. We have identified the induction of a 41-kDa protein kinase activity in pulp at the onset of ripening. The 41-kDa protein kinase has been identified as a putative protein kinase by MALDI-TOF/MS analysis. Biochemical analyses using partially purified protein kinase fraction from banana fruit have identified the protein kinase as a Ser/Thr family of protein kinase and its possible involvement in MA-ACS1 phosphorylation during ripening. In vitro phosphorylation analyses using synthetic peptides and site-directed mutagenized recombinant MA-ACS1 have revealed that serine 476 and 479 residues at the C-terminal region of MA-ACS1 are phosphorylated. Overall, this study provides important novel evidence for in vivo phosphorylation of MA-ACS1 at the molecular level as a possible mechanism of post-translational regulation of this key regulatory protein in ethylene signaling pathway in banana fruit during ripening.

  17. Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth. (United States)

    Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien


    The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

  18. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)


    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  19. Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic arabidopsis. (United States)

    Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W


    Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.

  20. Rewiring a secondary metabolite pathway towards itaconic acid production in Aspergillus niger. (United States)

    Hossain, Abeer H; Li, An; Brickwedde, Anja; Wilms, Lars; Caspers, Martien; Overkamp, Karin; Punt, Peter J


    The industrially relevant filamentous fungus Aspergillus niger is widely used in industry for its secretion capabilities of enzymes and organic acids. Biotechnologically produced organic acids promise to be an attractive alternative for the chemical industry to replace petrochemicals. Itaconic acid (IA) has been identified as one of the top twelve building block chemicals which have high potential to be produced by biotechnological means. The IA biosynthesis cluster (cadA, mttA and mfsA) has been elucidated in its natural producer Aspergillus terreus and transferred to A. niger to enable IA production. Here we report the rewiring of a secondary metabolite pathway towards further improved IA production through the overexpression of a putative cytosolic citrate synthase citB in a A. niger strain carrying the IA biosynthesis cluster. We have previously shown that expression of cadA from A. terreus results in itaconic acid production in A. niger AB1.13, albeit at low levels. This low-level production is boosted fivefold by the overexpression of mttA and mfsA in itaconic acid producing AB1.13 CAD background strains. Controlled batch cultivations with AB1.13 CAD + MFS + MTT strains showed increased production of itaconic acid compared with AB1.13 CAD strain. Moreover, preliminary RNA-Seq analysis of an itaconic acid producing AB1.13 CAD strain has led to the identification of the putative cytosolic citrate synthase citB which was induced in an IA producing strain. We have overexpressed citB in a AB1.13 CAD + MFS + MTT strain and by doing so hypothesize to have targeted itaconic acid production to the cytosolic compartment. By overexpressing citB in AB1.13 CAD + MFS + MTT strains in controlled batch cultivations we have achieved highly increased titers of up to 26.2 g/L IA with a productivity of 0.35 g/L/h while no CA was produced. Expression of the IA biosynthesis cluster in Aspergillus niger AB1.13 strain enables IA production. Moreover, in the AB1.13 CAD

  1. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase. (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N


    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Initial studies on temperature impact of humic acid

    International Nuclear Information System (INIS)

    Pashalidis, I.; Colocassidou, C.; Costa, C.N.; Efstathiou, A.M.; Buckau, G.


    The impact of temperature on the stability of the humic acid Gohy-573(HA) is studied. The studies are made both in order to add general knowledge about humic acid but also in order to provide the basis for experimental setup of studies, and judgment of published data, on the metal ion humate complexation as a function of temperature. Methods applied are mass spectroscopy as a function of temperature elevation up to 240 C, and UV/Vis spectroscopy. Mass spectroscopy is conducted under inertgas atmosphere in order to avoid burning with air oxygen. UV/Vis spectra are measured after storage of humic acid solution (pH=6.0, I=0.1 M NaClO 4 ) at temperatures up to 95 C. The reversibility of changes is also studied by UV/Vis spectroscopy after subsequent storage at room temperature. Already at 50 C release of water is observed from dried humic acid with a peak around 60 C. A second large water release is found with the maximum around 100 C. Above 100 C also carbon dioxide is released, followed by release of carbon monoxide above 130 C. The carbon monoxide and dioxide releases show two distinct maxima at around 180 and 210 C. The UV/Vis spectra show an increase in the absorption towards short wavelengths with increasing temperature and storage time. Already at 60 C, considerable changes occur after storage for one week. At 95 C the change in the spectral feature after 24 h is in the order of that found for 1 week storage at 80 C. After storage at elevated temperatures, the changes in the spectra remain even after 1 week of storage at room temperature. Release of water, carbon monoxide and carbon dioxide at high temperature is certainly related to oxidation with the high oxygen inventory in humic acid. The nature of the water release and changes in the UV/Vis spectra at lower temperature is not fully clear. Further experiments, including complexation properties, fluorescence spectroscopy and IR-reflection spectroscopy at elevated temperature are under consideration. (orig.)

  3. Structure of the ent-Copalyl Diphosphate Synthase PtmT2 from Streptomyces platensis CB00739, a Bacterial Type II Diterpene Synthase. (United States)

    Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben


    Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.

  4. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    Energy Technology Data Exchange (ETDEWEB)

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA


    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  5. Tailored fatty acid synthesis via dynamic control of fatty acid elongation (United States)

    Torella, Joseph P.; Ford, Tyler J.; Kim, Scott N.; Chen, Amanda M.; Way, Jeffrey C.; Silver, Pamela A.


    Medium-chain fatty acids (MCFAs, 4–12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain–length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  6. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L. (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang


    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus. (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T


    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  8. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges. (United States)

    Yuzawa, Satoshi; Keasling, Jay D; Katz, Leonard


    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. We have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  9. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, Satoshi [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Keasling, Jay D. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Univ. of California, Berkeley, CA (United States). QB3 Inst.; Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States). Dept. of Bioengineering; Univ. of California, Berkeley, CA (United States). Dept. of Chemical and Biomolecular Engineering; Technical Univ. of Denmark, Horsholm (Denmark). Novo Nordisk Foundation Center for Biosustainability; Katz, Leonard [Univ. of California, Berkeley, CA (United States). QB3 Inst.


    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. Finally, we have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  10. Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana. (United States)

    Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert


    The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative ( to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

  11. Antiproliferative and apoptotic effects of selective phenolic acids on T47D human breast cancer cells: potential mechanisms of action

    International Nuclear Information System (INIS)

    Kampa, Marilena; Boskou, Dimitrios; Gravanis, Achille; Castanas, Elias; Alexaki, Vassilia-Ismini; Notas, George; Nifli, Artemissia-Phoebe; Nistikaki, Anastassia; Hatzoglou, Anastassia; Bakogeorgou, Efstathia; Kouimtzoglou, Elena; Blekas, George


    The oncoprotective role of food-derived polyphenol antioxidants has been described but the implicated mechanisms are not yet clear. In addition to polyphenols, phenolic acids, found at high concentrations in a number of plants, possess antioxidant action. The main phenolic acids found in foods are derivatives of 4-hydroxybenzoic acid and 4-hydroxycinnamic acid. This work concentrates on the antiproliferative action of caffeic acid, syringic acid, sinapic acid, protocatechuic acid, ferulic acid and 3,4-dihydroxy-phenylacetic acid (PAA) on T47D human breast cancer cells, testing their antioxidant activity and a number of possible mechanisms involved (interaction with membrane and intracellular receptors, nitric oxide production). The tested compounds showed a time-dependent and dose-dependent inhibitory effect on cell growth with the following potency: caffeic acid > ferulic acid = protocatechuic acid = PAA > sinapic acid = syringic acid. Caffeic acid and PAA were chosen for further analysis. The antioxidative activity of these phenolic acids in T47D cells does not coincide with their inhibitory effect on tumoral proliferation. No interaction was found with steroid and adrenergic receptors. PAA induced an inhibition of nitric oxide synthase, while caffeic acid competes for binding and results in an inhibition of aryl hydrocarbon receptor-induced CYP1A1 enzyme. Both agents induce apoptosis via the Fas/FasL system. Phenolic acids exert a direct antiproliferative action, evident at low concentrations, comparable with those found in biological fluids after ingestion of foods rich in phenolic acids. Furthermore, the direct interaction with the aryl hydrocarbon receptor, the nitric oxide synthase inhibition and their pro-apoptotic effect provide some insights into their biological mode of action

  12. Non-bilayer structures in mitochondrial membranes regulate ATP synthase activity. (United States)

    Gasanov, Sardar E; Kim, Aleksandr A; Yaguzhinsky, Lev S; Dagda, Ruben K


    Cardiolipin (CL) is an anionic phospholipid at the inner mitochondrial membrane (IMM) that facilitates the formation of transient non-bilayer (non-lamellar) structures to maintain mitochondrial integrity. CL modulates mitochondrial functions including ATP synthesis. However, the biophysical mechanisms by which CL generates non-lamellar structures and the extent to which these structures contribute to ATP synthesis remain unknown. We hypothesized that CL and ATP synthase facilitate the formation of non-bilayer structures at the IMM to stimulate ATP synthesis. By using 1 H NMR and 31 P NMR techniques, we observed that increasing the temperature (8°C to 37°C), lowering the pH (3.0), or incubating intact mitochondria with CTII - an IMM-targeted toxin that increases the formation of immobilized non-bilayer structures - elevated the formation of non-bilayer structures to stimulate ATP synthesis. The F 0 sector of the ATP synthase complex can facilitate the formation of non-bilayer structures as incubating model membranes enriched with IMM-specific phospholipids with exogenous DCCD-binding protein of the F 0 sector (DCCD-BPF) elevated the formation of immobilized non-bilayer structures to a similar manner as CTII. Native PAGE assays revealed that CL, but not other anionic phospholipids, specifically binds to DCCD-BPF to promote the formation of stable lipid-protein complexes. Mechanistically, molecular docking studies identified two lipid binding sites for CL in DCCD-BPF. We propose a new model of ATP synthase regulation in which CL mediates the formation of non-bilayer structures that serve to cluster protons and ATP synthase complexes as a mechanism to enhance proton translocation to the F 0 sector, and thereby increase ATP synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Engineering of thermotolerant Bacillus coagulans for production of D(-)-lactic acid (United States)

    Wang, Qingzhao; Shanmugam, Keelnatham T; Ingram, Lonnie O


    Genetically modified microorganisms having the ability to produce D(-)-lactic acid at temperatures between C. and C. are provided. In various embodiments, the microorganisms may have the chromosomal lactate dehydrogenase (ldh) gene and/or the chromosomal acetolactate synthase (alsS) gene inactivated. Exemplary microorganisms for use in the disclosed methods are Bacillus spp., such as Bacillus coagulans.

  14. OAS proteins and cGAS: unifying concepts in sensing and responding to cytosolic nucleic acids. (United States)

    Hornung, Veit; Hartmann, Rune; Ablasser, Andrea; Hopfner, Karl-Peter


    Recent discoveries in the field of innate immunity have highlighted the existence of a family of nucleic acid-sensing proteins that have similar structural and functional properties. These include the well-known oligoadenylate synthase (OAS) family proteins and the recently identified OAS homologue cyclic GMP-AMP (cGAMP) synthase (cGAS). The OAS proteins and cGAS are template-independent nucleotidyltransferases that, once activated by double-stranded nucleic acids in the cytosol, produce unique classes of 2'-5'-linked second messenger molecules, which - through distinct mechanisms - have crucial antiviral functions. 2'-5'-linked oligoadenylates limit viral propagation through the activation of the enzyme RNase L, which degrades host and viral RNA, and 2'-5'-linked cGAMP activates downstream signalling pathways to induce de novo antiviral gene expression. In this Progress article, we describe the striking functional and structural similarities between OAS proteins and cGAS, and highlight their roles in antiviral immunity.

  15. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants. (United States)

    Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai


    Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  16. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.


    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  17. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata) (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru


    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  18. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat. (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T


    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.


    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  20. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients. (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh


    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  1. New developments in the treatment of hyperammonemia: emerging use of carglumic acid

    Directory of Open Access Journals (Sweden)

    Marta Daniotti


    Full Text Available Marta Daniotti1, Giancarlo la Marca2, Patrizio Fiorini1, Luca Filippi11Neonatal Intensive Care Unit, Department of Perinatal Medicine, “A. Meyer” University Children’s Hospital, Florence, Italy; 2Mass Spectrometry, Clinical Chemistry and Pharmacology Laboratory, Neuroscience Department, “A. Meyer” University Children’s Hospital, Florence, ItalyAbstract: Hyperammonemia is a true neonatal emergency with high toxicity for the central nervous system and developmental delay. The causes of neonatal hyperammonemia are genetic defects of urea cycle enzymes, organic acidemias, lysinuric protein intolerance, hyperammonemia–hyperornithinemia–homocitrullinemia syndrome, transient hyperammonemia of the newborn, and congenital hyperinsulinism with hyperammonemia. In some of these conditions the high blood ammonia levels are due to the reduction of N-acetylglutamate, an essential cofactor necessary for the function of the urea cycle, or to the reduction of carbamoyl-phosphate synthase-I activity. In these cases, N-carbamylglutamate (carglumic acid can be administered together with the conventional therapy. Carglumic acid is an analog of N-acetylglutamate that has a direct action on carbamoyl-phosphate synthase-I. Its effects are reactivation of the urea cycle and reduction of plasma ammonia levels. As a consequence it improves the traditional treatment, avoiding the need of hemodialysis and peritoneal dialysis. In this review we evaluate the possible field of application of carglumic acid and its effectiveness and safety.Keywords: hyperammonemia, N-carbamylglutamate, carglumic acid, urea cycle disorder, metabolic disorders

  2. Premotor nitric oxide synthase immunoreactive pathway connecting lumbar segments with the ventral motor nucleus of the cervical enlargement in the dog. (United States)

    Marsala, Jozef; Lukácová, Nadezda; Cízková, Dása; Lukác, Imrich; Kuchárová, Karolína; Marsala, Martin


    In this study we investigate the occurrence and origin of punctate nitric oxide synthase immunoreactivity in the neuropil of the ventral motor nucleus in C7-Th1 segments of the dog spine, which are supposed to be the terminal field of an ascending premotor propriospinal nitric oxide synthase-immunoreactive pathway. As the first step, nitric oxide synthase immunohistochemistry was used to distinguish nitric oxide synthase-immunoreactive staining of the ventral motor nucleus. Dense, punctate nitric oxide synthase immunoreactivity was found on control sections in the neuropil of the ventral motor nucleus. After hemisection at Th10-11, axotomy-induced retrograde changes consisting in a strong upregulation of nitric oxide synthase-containing neurons were found mostly unilaterally in lamina VIII, the medial part of lamina VII and in the pericentral region in all segments of the lumbosacral enlargement. Concurrently, a strong depletion of the punctate nitric oxide synthase immunopositivity in the neuropil of the ventral motor nucleus ipsilaterally with the hemisection was detected, thus revealing that an uncrossed ascending premotor propriospinal pathway containing a fairly high number of nitric oxide synthase-immunoreactive fibers terminates in the ventral motor nucleus. Application of the retrograde fluorescent tracer Fluorogold injected into the ventral motor nucleus and analysis of alternate sections processed for nitric oxide synthase immunocytochemistry revealed the presence of Fluorogold-labeled and nitric oxide synthase-immunoreactive axons in the ventrolateral funiculus and in the lateral and medial portions of the ventral column throughout the thoracic and upper lumbar segments. A noticeable number of Fluorogold-labeled and nitric oxide synthase-immunoreactive somata detected on consecutive sections were found in the lumbosacral enlargement, mainly in laminae VIII-IX, the medial part of lamina VII and in the pericentral region (lamina X), ipsilaterally with the

  3. Nitric oxide donors prevent while the nitric oxide synthase inhibitor L-NAME increases arachidonic acid plus CYP2E1-dependent toxicity

    International Nuclear Information System (INIS)

    Wu Defeng; Cederbaum, Arthur


    Polyunsaturated fatty acids such as arachidonic acid (AA) play an important role in alcohol-induced liver injury. AA promotes toxicity in rat hepatocytes with high levels of cytochrome P4502E1 and in HepG2 E47 cells which express CYP2E1. Nitric oxide (NO) participates in the regulation of various cell activities as well as in cytotoxic events. NO may act as a protectant against cytotoxic stress or may enhance cytotoxicity when produced at elevated concentrations. The goal of the current study was to evaluate the effect of endogenously or exogenously produced NO on AA toxicity in liver cells with high expression of CYP2E1 and assess possible mechanisms for its actions. Pyrazole-induced rat hepatocytes or HepG2 cells expressing CYP2E1 were treated with AA in the presence or absence of an inhibitor of nitric oxide synthase L-N G -Nitroarginine Methylester (L-NAME) or the NO donors S-nitroso-N-acetylpenicillamine (SNAP), and (Z)-1-[-(2-aminoethyl)-N-(2-aminoethyl)]diazen-1-ium-1,2-diolate (DETA-NONO). AA decreased cell viability from 100% to 48 ± 6% after treatment for 48 h. In the presence of L-NAME, viability was further lowered to 23 ± 5%, while, SNAP or DETA-NONO increased viability to 66 ± 8 or 71 ± 6%. The L-NAME potentiated toxicity was primarily necrotic in nature. L-NAME did not affect CYP2E1 activity or CYP2E1 content. SNAP significantly lowered CYP2E1 activity but not protein. AA treatment increased lipid peroxidation and lowered GSH levels. L-NAME potentiated while SNAP prevented these changes. Thus, L-NAME increased, while NO donors decreased AA-induced oxidative stress. Antioxidants prevented the L-NAME potentiation of AA toxicity. Damage to mitochondria by AA was shown by a decline in the mitochondrial membrane potential (MMP). L-NAME potentiated this decline in MMP in association with its increase in AA-induced oxidative stress and toxicity. NO donors decreased this decline in MMP in association with their decrease in AA-induced oxidative stress and

  4. N-acetylglutamate synthase deficiency: an insight into the genetics, epidemiology, pathophysiology, and treatment

    Directory of Open Access Journals (Sweden)

    Caldovic L


    Full Text Available Nicholas Ah Mew, Ljubica CaldovicCenter for Genetic Medicine Research, Children’s Research Institute, Children’s National Medical Center, Washington DC, USAAbstract: The conversion of ammonia into urea by the human liver requires the coordinated function of the 6 enzymes and 2 transporters of the urea cycle. The initial and rate-limiting enzyme of the urea cycle, carbamylphosphate synthetase 1 (CPS1, requires an allosteric activator, N-acetylglutamate (NAG. The formation of this unique cofactor from glutamate and acetyl Coenzyme-A is catalyzed by N-acetylglutamate synthase (NAGS. An absence of NAG as a consequence of NAGS deficiency may compromise flux through CPS1 and result in hyperammonemia. The NAGS gene encodes a 528-amino acid protein, consisting of a C-terminal catalytic domain, a variable segment, and an N-terminal mitochondrial targeting signal. Only 22 mutations in the NAGS gene have been reported to date, mostly in the catalytic domain. NAGS is primarily expressed in the liver and intestine. However, it is also surprisingly expressed in testis, stomach and spleen, and during early embryonic development at levels not concordant with the expression of other urea cycle enzymes, CPS1, or ornithine transcarbamylase. The purpose of NAGS expression in these tissues, and its significance to NAGS deficiency is as yet unknown. Inherited NAGS deficiency is the rarest of the urea cycle disorders, and we review the currently reported 34 cases. Treatment of NAGS deficiency with N-carbamyglutamate, a stable analog of NAG, can restore deficient urea cycle function and normalize blood ammonia in affected patients.Keywords: urea cycle, urea cycle disorder, N-acetyl-L-glutamate, N-acetylglutamate synthase, hyperammonemia, N-carbamyl-L-glutamate

  5. Fatty acid synthesis in Xylella fastidiosa: correlations between genome studies, 13C NMR data, and molecular models

    International Nuclear Information System (INIS)

    Osiro, Denise; Muniz, Joao Renato C.; Coleta Filho, Helvecio Della; Alves de Sousa, Alessandra; Machado, Marcos Antonio; Garratt, Richard C.; Colnago, Luiz Alberto


    Xylella fastidiosa was the first plant pathogen to have its complete genome sequence elucidated. Routine database analyses suggested that two enzymes essential for fatty acid synthesis were missing, one of these is the holo-acyl-carrier-protein synthase. However, here we demonstrate, using 13 C NMR spectroscopy, that X. fastidiosa is indeed able to synthesize fatty acids from acetate via an apparently conventional metabolic pathway. We further identify a gene product HetI, an alternative phosphopantetheinyl transferase, which we propose to fill the missing link. Homology modeling of HetI shows conservation of the Coenzyme A binding site suggesting it to be an active enzyme and reveals several interesting structural features when compared with the surfactin synthase-activating enzyme, on which the model was built. These include a simplified topology due to N- and C-terminal deletions and the observation of a novel serine ladder

  6. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis1[OPEN (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin


    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882

  7. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.


    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  8. Sevoflurane-induced Preconditioning Impact of Protocol and Aprotinin Administration on Infarct Size and Endothelial Nitric-Oxide Synthase Phosphorylation in the Rat Heart In Vivo

    NARCIS (Netherlands)

    Fräßdorf, Jan; Huhn, Ragnar; Weber, Nina C.; Ebel, Dirk; Wingert, Nadja; Preckel, Benedikt; Toma, Octavian; Schlack, Wolfgang; Hollmann, Markus W.


    Background Sevoflurane induces preconditioning (SevoPC) 1 he effect of aprotinin and the involvement of endothelial nitric-oxide synthase (NOS) on SevoPC are unknown We investigated (1) whether SevoPC is strengthened by multiple preconditioning cycles (2) whether SevoPC is blocked by aprotinin, and

  9. First insights into the mode of action of a "lachrymatory factor synthase"--implications for the mechanism of lachrymator formation in Petiveria alliacea, Allium cepa and Nectaroscordum species. (United States)

    He, Quan; Kubec, Roman; Jadhav, Abhijit P; Musah, Rabi A


    A study of an enzyme that reacts with the sulfenic acid produced by the alliinase in Petiveria alliacea L. (Phytolaccaceae) to yield the P. alliacea lachrymator (phenylmethanethial S-oxide) showed the protein to be a dehydrogenase. It functions by abstracting hydride from sulfenic acids of appropriate structure to form their corresponding sulfines. Successful hydride abstraction is dependent upon the presence of a benzyl group on the sulfur to stabilize the intermediate formed on abstraction of hydride. This dehydrogenase activity contrasts with that of the lachrymatory factor synthase (LFS) found in onion, which catalyzes the rearrangement of 1-propenesulfenic acid to (Z)-propanethial S-oxide, the onion lachrymator. Based on the type of reaction it catalyzes, the onion LFS should be classified as an isomerase and would be called a "sulfenic acid isomerase", whereas the P. alliacea LFS would be termed a "sulfenic acid dehydrogenase". Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Phytochelatin synthase activity as a marker of metal pollution

    Energy Technology Data Exchange (ETDEWEB)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)


    Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.

  11. Phytochelatin synthase activity as a marker of metal pollution

    International Nuclear Information System (INIS)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene


    Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.

  12. Oligomycin frames a common drug-binding site in the ATP synthase

    Energy Technology Data Exchange (ETDEWEB)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric; Mueller, David M. (Rosalind)


    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100% conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.

  13. The Staphylococcus aureus α-Acetolactate Synthase ALS Confers Resistance to Nitrosative Stress

    Directory of Open Access Journals (Sweden)

    Sandra M. Carvalho


    Full Text Available Staphylococcus aureus is a worldwide pathogen that colonizes the human nasal cavity and is a major cause of respiratory and cutaneous infections. In the nasal cavity, S. aureus thrives with high concentrations of nitric oxide (NO produced by the innate immune effectors and has available for growth slow-metabolizing free hexoses, such as galactose. Here, we have used deep sequencing transcriptomic analysis (RNA-Seq and 1H-NMR to uncover how S. aureus grown on galactose, a major carbon source present in the nasopharynx, survives the deleterious action of NO. We observed that, like on glucose, S. aureus withstands high concentrations of NO when using galactose. Data indicate that this resistance is, most likely, achieved through a distinct metabolism that relies on the increased production of amino acids, such as glutamate, threonine, and branched-chain amino acids (BCAAs. Moreover, we found that under NO stress the S. aureus α-acetolactate synthase (ALS enzyme, which converts pyruvate into α-acetolactate, plays an important role. ALS is proposed to prevent intracellular acidification, to promote the production of BCAAs and the activation of the TCA cycle. Additionally, ALS is shown to contribute to the successful infection of murine macrophages. Furthermore, ALS contributes to the resistance of S. aureus to beta-lactam antibiotics such as methicillin and oxacillin.

  14. Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase.

    Directory of Open Access Journals (Sweden)

    Anne eJunker


    Full Text Available Putrescine N-methyltransferases (PMTs are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-L-methionine (SAM as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs, which are ubiquitous enzymes of polyamine metabolism. SPDS use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in Datura stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom.

  15. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Jia Fang


    Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  16. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants. (United States)

    Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong


    Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  17. Evolution of Flavone Synthase I from Parsley Flavanone 3β-Hydroxylase by Site-Directed Mutagenesis1[W][OA (United States)

    Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan


    Flavanone 3β-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the β-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction). PMID:17535823

  18. Sulfur amino acid metabolism in doxorubicin-resistant breast cancer cells

    International Nuclear Information System (INIS)

    Ryu, Chang Seon; Kwak, Hui Chan; Lee, Kye Sook; Kang, Keon Wook; Oh, Soo Jin; Lee, Ki Ho; Kim, Hwan Mook; Ma, Jin Yeul; Kim, Sang Kyum


    Although methionine dependency is a phenotypic characteristic of tumor cells, it remains to be determined whether changes in sulfur amino acid metabolism occur in cancer cells resistant to chemotherapeutic medications. We compared expression/activity of sulfur amino acid metabolizing enzymes and cellular levels of sulfur amino acids and their metabolites between normal MCF-7 cells and doxorubicin-resistant MCF-7 (MCF-7/Adr) cells. The S-adenosylmethionine/S-adenosylhomocysteine ratio, an index of transmethylation potential, in MCF-7/Adr cells decreased to ∼ 10% relative to that in MCF-7 cells, which may have resulted from down-regulation of S-adenosylhomocysteine hydrolase. Expression of homocysteine-clearing enzymes, such as cystathionine beta-synthase, methionine synthase/methylene tetrahydrofolate reductase, and betaine homocysteine methyltransferase, was up-regulated in MCF-7/Adr cells, suggesting that acquiring doxorubicin resistance attenuated methionine-dependence and activated transsulfuration from methionine to cysteine. Homocysteine was similar, which is associated with a balance between the increased expressions of homocysteine-clearing enzymes and decreased extracellular homocysteine. Despite an elevation in cysteine, cellular GSH decreased in MCF-7/Adr cells, which was attributed to over-efflux of GSH into the medium and down-regulation of the GSH synthesis enzyme. Consequently, MCF-7/Adr cells were more sensitive to the oxidative stress induced by bleomycin and menadione than MCF-7 cells. In conclusion, our results suggest that regulating sulfur amino acid metabolism may be a possible therapeutic target for chemoresistant cancer cells. These results warrant further investigations to determine the role of sulfur amino acid metabolism in acquiring anticancer drug resistance in cancer cells using chemical and biological regulators involved in sulfur amino acid metabolism. - Research highlights: → MCF-7/Adr cells showed decreases in cellular GSH

  19. Compensatory upregulation of respiratory chain complexes III and IV in isolated deficiency of ATP synthase due to TMEM70 mutation

    Czech Academy of Sciences Publication Activity Database

    Karbanová-Havlíčková, Vendula; Vrbacká-Čížková, Alena; Hejzlarová, Kateřina; Nůsková, Hana; Stránecký, V.; Potocká, Andrea; Kmoch, S.; Houštěk, Josef


    Roč. 1817, č. 7 (2012), s. 1037-1043 ISSN 0005-2728 R&D Projects: GA MZd(CZ) NS9759; GA ČR(CZ) GAP303/11/0970; GA ČR(CZ) GD303/03/H065; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 370411 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP synthase * TMEM70 * disease * gene expression profiling * oxidative phosphorylation * mitochondrial biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.624, year: 2012

  20. Carglumic acid enhances rapid ammonia detoxification in classical organic acidurias with a favourable risk-benefit profile : a retrospective observational study

    NARCIS (Netherlands)

    Valayannopoulos, Vassili; Baruteau, Julien; Delgado, Maria Bueno; Cano, Aline; Couce, Maria L; Del Toro, Mireia; Donati, Maria Alice; Garcia-Cazorla, Angeles; Gil-Ortega, David; Gomez-de Quero, Pedro; Guffon, Nathalie; Hofstede, Floris C; Kalkan-Ucar, Sema; Coker, Mahmut; Lama-More, Rosa; Martinez-Pardo Casanova, Mercedes; Molina, Agustin; Pichard, Samia; Papadia, Francesco; Rosello, Patricia; Plisson, Celine; Le Mouhaer, Jeannie; Chakrapani, Anupam


    BACKGROUND: Isovaleric aciduria (IVA), propionic aciduria (PA) and methylmalonic aciduria (MMA) are inherited organic acidurias (OAs) in which impaired organic acid metabolism induces hyperammonaemia arising partly from secondary deficiency of N-acetylglutamate (NAG) synthase. Rapid reduction in

  1. Phenylacetic acid and arterial vascular properties in patients with chronic kidney disease stage 5 on hemodialysis therapy

    DEFF Research Database (Denmark)

    Scholze, Alexandra; Jankowski, Vera; Henning, Lars


    Phenylacetic acid (PAA) is a recently described uremic toxin that inhibits inducible nitric oxide synthase expression and plasma membrane calcium ATPase and may therefore also be involved in remodeling of arteries. Such vascular effects have not been evaluated yet in patients with chronic kidney...

  2. 2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols. (United States)

    Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak


    Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

  3. [Characteristics and the impact factors of acid rain in Fuzhou and Xiamen 1992-2012]. (United States)

    Zheng, Qiu-Ping; Wang, Hong; Chen, Bin-Bin; Sui, Ping; Lin, Wen


    Based on the observed acid rain data, synoptic situations and mass concentrations of atmospheric pollutants data from 1992 to 2012, the temporal variation characteristics and the impact factors of acid rain were analyzed in Fuzhou and Xiamen. The results showed that acid rain and non-acid rain accounted for 38.1% and 61.9% respectively in Fuzhou, 40.6% and 59.4% respectively in Xiamen. The annual average pH was 4.1-5.5 in Fuzhou. Acid rain pollution alleviated after 2007 in Fuzhou, and alleviated after 2006 in Xiamen. Acid rain was more serious in winter and spring than in summer and autumn. Precipitation intensity could affect the acidity of rain. Acid rain was observed more serious in southeast, southwest, west and northwest wind in Fuzhou, and more serious in northeast, southwest, west and northwest wind in Xiamen. Acid rain was most severe under the condition of transformed surface cold high, while most light under the conditions of typhoon (intertropical convergence zone) and outside of typhoon (intertropical convergence zone). There was a negative correlation between the mass concentrations of atmospheric pollutants, such as SO2, N