WorldWideScience

Sample records for acid synthase fasii

  1. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    International Nuclear Information System (INIS)

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-01-01

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease

  2. 2-Hexadecynoic acid inhibits plasmodial FAS-II enzymes and arrests erythrocytic and liver stage Plasmodium infections.

    Science.gov (United States)

    Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M

    2010-11-01

    Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to

  3. 2-Hexadecynoic Acid Inhibits Plasmodial FAS-II Enzymes and Arrest Erythrocytic and Liver Stage Plasmodium Infections

    Science.gov (United States)

    Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.

    2010-01-01

    Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty

  4. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    Science.gov (United States)

    Croteau, Rodney Bruce [Pullman, WA; Burke, Charles Cullen [Moscow, ID

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  5. Engineering fatty acid synthases for directed polyketide production.

    Science.gov (United States)

    Gajewski, Jan; Buelens, Floris; Serdjukow, Sascha; Janßen, Melanie; Cortina, Niña; Grubmüller, Helmut; Grininger, Martin

    2017-04-01

    In this study, we engineered fatty acid synthases (FAS) for the biosynthesis of short-chain fatty acids and polyketides, guided by a combined in vitro and in silico approach. Along with exploring the synthetic capability of FAS, we aim to build a foundation for efficient protein engineering, with the specific goal of harnessing evolutionarily related megadalton-scale polyketide synthases (PKS) for the tailored production of bioactive natural compounds.

  6. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2010-05-31

    inhibitors into the clinic. fatty acid synthase, thioesterase, inhibitors, drug development U U U UU 44 USAMRMC Table of Contents ...targeting. Ursolic acid , a pentacyclic triterpenoid acid , as well as the tea polyphenols, epigallocatechin gallate (EGCG) and epicatechin gallate...2007,  6(7), 2120‐2126.  73.  Liu, Y., Tian, W., Ma, X., and Ding, W. Evaluation of  inhibition of  fatty  acid  synthase by  ursolic   acid : positive

  7. Potential of lichen secondary metabolites against Plasmodium liver stage parasites with FAS-II as the potential target.

    Science.gov (United States)

    Lauinger, Ina L; Vivas, Livia; Perozzo, Remo; Stairiker, Christopher; Tarun, Alice; Zloh, Mire; Zhang, Xujie; Xu, Hua; Tonge, Peter J; Franzblau, Scott G; Pham, Duc-Hung; Esguerra, Camila V; Crawford, Alexander D; Maes, Louis; Tasdemir, Deniz

    2013-06-28

    Chemicals targeting the liver stage (LS) of the malaria parasite are useful for causal prophylaxis of malaria. In this study, four lichen metabolites, evernic acid (1), vulpic acid (2), psoromic acid (3), and (+)-usnic acid (4), were evaluated against LS parasites of Plasmodium berghei. Inhibition of P. falciparum blood stage (BS) parasites was also assessed to determine stage specificity. Compound 4 displayed the highest LS activity and stage specificity (LS IC50 value 2.3 μM, BS IC50 value 47.3 μM). The compounds 1-3 inhibited one or more enzymes (PfFabI, PfFabG, and PfFabZ) from the plasmodial fatty acid biosynthesis (FAS-II) pathway, a potential drug target for LS activity. To determine species specificity and to clarify the mechanism of reported antibacterial effects, 1-4 were also evaluated against FabI homologues and whole cells of various pathogens (S. aureus, E. coli, M. tuberculosis). Molecular modeling studies suggest that lichen acids act indirectly via binding to allosteric sites on the protein surface of the FAS-II enzymes. Potential toxicity of compounds was assessed in human hepatocyte and cancer cells (in vitro) as well as in a zebrafish model (in vivo). This study indicates the therapeutic and prophylactic potential of lichen metabolites as antibacterial and antiplasmodial agents.

  8. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...

  9. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  10. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  11. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  12. Tomato linalool synthase is induced in trichomes by jasmonic acid

    Science.gov (United States)

    van Schie, Chris C. N.; Haring, Michel A.

    2007-01-01

    Tomato (Lycopersicon esculentum) plants emit a blend of volatile organic compounds, which mainly consists of terpenes. Upon herbivory or wounding, the emission of several terpenes increases. We have identified and characterized the first two tomato monoterpene synthases, LeMTS1 and LeMTS2. Although these proteins were highly homologous, recombinant LeMTS1 protein produced (R)-linalool from geranyl diphosphate (GPP) and (E)-nerolidol from farnesyl diphosphate (FPP), while recombinant LeMTS2 produced β-phellandrene, β-myrcene, and sabinene from GPP. In addition, these genes were expressed in different tissues: LeMTS1 was expressed in flowers, young leaves, stems, and petioles, while LeMTS2 was strongest expressed in stems and roots. LeMTS1 expression in leaves was induced by spider mite-infestation, wounding and jasmonic acid (JA)-treatment, while LeMTS2 did not respond to these stimuli. The expression of LeMTS1 in stems and petioles was predominantly detected in trichomes and could be induced by JA. Because JA treatment strongly induced emission of linalool and overexpression of LeMTS1 in tomato resulted in increased production of linalool, we propose that LeMTS1 is a genuine linalool synthase. Our results underline the importance of trichomes in JA-induced terpene emission in tomato. PMID:17440821

  13. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe Brandt; Von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  14. A photocrosslinking assay for reporting protein interactions in polyketide and fatty acid synthases.

    Science.gov (United States)

    Ye, Zhixia; Bair, Morgan; Desai, Hemant; Williams, Gavin J

    2011-11-01

    Understanding protein-protein interactions that occur between ACP and KS domains of polyketide synthases and fatty acid synthases is critical to improving the scope and efficiency of combinatorial biosynthesis efforts aimed at producing non-natural polyketides. Here, we report a facile strategy for rapidly reporting such ACP-KS interactions based on the incorporation of an amino acid with photocrosslinking functionality. Crucially, this photocrosslinking strategy can be applied to any polyketide or fatty acid synthase regardless of substrate specificity, and can be adapted to a high-throughput format for directed evolution studies. This journal is © The Royal Society of Chemistry 2011

  15. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  16. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  17. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    Science.gov (United States)

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  18. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    pathway for improving oil quality and increasing oil content of peanut through biotechnology-based approaches. Fatty acid biosynthesis is catalysed by two types of fatty acid synthase (FAS). Type I FAS, as found in vertebrates, yeast and some bacteria, contains all the active sites on one or two multidomain polypeptides.

  19. Fatty Acid Synthase Inhibitors Engage the Cell Death Program Through the Endoplasmic Reticulum

    Science.gov (United States)

    2007-12-01

    Saccharomyces cerevisiae , J Biol Chem 268 (1993) 27269-27276. Epstein, J. I., Carmichael, M. and Partin, A. W., OA-519 (fatty acid synthase) as an independent...547cholesterol lowering drugs is bile acid sequestrants , which 548prevent reabsorption of bile acids by the intestine and result 549in excretion through the...and measured for protein content using a standard copper reduction/bicinchoninic acid assay (BCA; Pierce Biotech- nology), with bovine serum albumin as

  20. Expanding the product portfolio of fungal type I fatty acid synthases

    DEFF Research Database (Denmark)

    Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia

    2017-01-01

    Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes...

  1. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  2. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi, E-mail: morimoto@phar.kyushu-u.ac.jp [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  3. Production of Medium Chain Fatty Acids by Yarrowia lipolytica: Combining Molecular Design and TALEN to Engineer the Fatty Acid Synthase.

    Science.gov (United States)

    Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence

    2017-10-20

    Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.

  4. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  5. Strategies in megasynthase engineering - fatty acid synthases (FAS) as model proteins.

    Science.gov (United States)

    Fischer, Manuel; Grininger, Martin

    2017-01-01

    Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS) are responsible for the production of a large spectrum of bioactive polyketides (PK), which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the "assembly-line synthetic concept" of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS) are and will be valuable objects for further developing this field.

  6. Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins

    Directory of Open Access Journals (Sweden)

    Manuel Fischer

    2017-06-01

    Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.

  7. Identification of the orsellinic acid synthase PKS63787 for the biosynthesis of antroquinonols in Antrodia cinnamomea.

    Science.gov (United States)

    Yu, Po-Wei; Cho, Ting-Yu; Liou, Ruey-Fen; Tzean, Shean-Shong; Lee, Tzong-Huei

    2017-06-01

    Antrodia cinnamomea, an endemic basidiomycete used as a health food in Taiwan, is known to synthesize antroquinonols, which were reported to have notable medicinal potential in oncology and immunology. However, the biosynthetic pathway of these compounds is currently unclear. Our previous study showed that a pks63787 knockout mutant of A. cinnamomea (∆pks63787) is deficient in the biosynthesis of several aromatic metabolites. In this study, we pointed by phylogenetic analysis that pks63787 likely encodes an orsellinic acid synthase. Moreover, amendment of the cultural medium with orsellinic acid not only restores the ability of ∆pks63787 to produce its major pigment and other deficient metabolites, e.g., antroquinonols, but also enhances the productivity of several antroquinonols, including two new compounds 2 and 3. These results provide direct evidence that the PKS63787 is involved in the biosynthesis of antroquinonols and confirmed our hypothesis that the 6-methylcyclohexenone moiety was synthesized via the PKS63787-mediated polyketide pathway. In conclusion, PKS63787 might function as orsellinic acid synthase and orsellinic acid is an important precursor indispensable for the biosynthesis of the major pigment and antroquinonols in A. cinnamomea. To facilitate further basic or applied study, a putative biosynthesis pathway map of antroquinonols is proposed.

  8. Alpha-mangostin inhibits intracellular fatty acid synthase and induces apoptosis in breast cancer cells

    OpenAIRE

    Li, Ping; Tian, Weixi; Ma, Xiaofeng

    2014-01-01

    Background Fatty acid synthase (FAS) has been proven over-expressed in human breast cancer cells and consequently, has been recognized as a target for breast cancer treatment. Alpha-mangostin, a natural xanthone found in mangosteen pericarp, has a variety of biological activities, including anti-cancer effect. In our previous study, alpha-mangostin had been found both fast-binding and slow-binding inhibitions to FAS in vitro. This study was designed to investigate the activity of alpha-mangos...

  9. Structure of a NADH-insensitive hexameric citrate synthase that resists acid inactivation.

    Science.gov (United States)

    Francois, Julie A; Starks, Courtney M; Sivanuntakorn, Sasitorn; Jiang, Hong; Ransome, Aaron E; Nam, Jeong-Won; Constantine, Charles Z; Kappock, T Joseph

    2006-11-14

    Acetobacter aceti converts ethanol to acetic acid, and strains highly resistant to both are used to make vinegar. A. aceti survives acetic acid exposure by tolerating cytoplasmic acidification, which implies an unusual adaptation of cytoplasmic components to acidic conditions. A. aceti citrate synthase (AaCS), a hexameric type II citrate synthase, is required for acetic acid resistance and, therefore, would be expected to function at low pH. Recombinant AaCS has intrinsic acid stability that may be a consequence of strong selective pressure to function at low pH, and unexpectedly high thermal stability for a protein that has evolved to function at approximately 30 degrees C. The crystal structure of AaCS, complexed with oxaloacetate (OAA) and the inhibitor carboxymethyldethia-coenzyme A (CMX), was determined to 1.85 A resolution using protein purified by a tandem affinity purification procedure. This is the first crystal structure of a "closed" type II CS, and its active site residues interact with OAA and CMX in the same manner observed in the corresponding type I chicken CS.OAA.CMX complex. While AaCS is not regulated by NADH, it retains many of the residues used by Escherichia coli CS (EcCS) for NADH binding. The surface of AaCS is abundantly decorated with basic side chains and has many fewer uncompensated acidic charges than EcCS; this constellation of charged residues is stable in varied pH environments and may be advantageous in the A. aceti cytoplasm.

  10. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    Science.gov (United States)

    Nanson, Jeffrey D; Forwood, Jade K

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

  11. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    Directory of Open Access Journals (Sweden)

    Jeffrey D Nanson

    Full Text Available Ketoacyl-acyl carrier protein reductases (FabG are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP linked thioesters within the bacterial type II fatty acid synthesis (FASII pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG, the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

  12. 7.5-Å cryo-em structure of the mycobacterial fatty acid synthase.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc

    2013-03-11

    The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Cooperative functioning between phenylalanine ammonia lyase and isochorishmate synthase activities contributes to salicylic acid biosynthesis in soybean

    Science.gov (United States)

    Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...

  15. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    Science.gov (United States)

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Structure of Quinolinate Synthase from Pyrococcus horikoshii in the Presence of Its Product, Quinolinic Acid.

    Science.gov (United States)

    Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J

    2016-06-15

    Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.

  17. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  18. Reconstitution of Staphylococcus aureus Lipoteichoic Acid Synthase Activity Identifies Congo Red as a Selective Inhibitor.

    Science.gov (United States)

    Vickery, Christopher R; Wood, B McKay; Morris, Heidi G; Losick, Richard; Walker, Suzanne

    2018-01-24

    Lipoteichoic acid (LTA) is an anionic surface polymer that is essential for normal growth of Staphylococcus aureus, making the LTA polymerase, LTA synthase (LtaS), a proposed drug target for combating Staphylococcal infections. LtaS is a polytopic membrane protein with five membrane-spanning helices and an extracellular domain, and it uses phosphatidylglycerol to assemble a glycerol phosphate chain on a glycosylated diacylglycerol membrane anchor. We report here the first reconstitution of LtaS polymerization activity and show that the azo dye Congo red inhibits this enzyme both in vitro and in cells. Related azo dyes and the previously reported LtaS inhibitor 1771 have weak or no in vitro inhibitory activity. Synthetic lethality with mutant strains known to be nonviable in the absence of LTA confirms selective inhibition by Congo red. As the only validated LtaS inhibitor, Congo red can serve as a probe to understand how inhibiting lipoteichoic acid biosynthesis affects cell physiology and may also guide the discovery of more potent inhibitors for use in treating S. aureus infections.

  19. Fatty acid synthase inhibitors from plants: isolation, structure elucidation, and SAR studies.

    Science.gov (United States)

    Li, Xing-Cong; Joshi, Alpana S; ElSohly, Hala N; Khan, Shabana I; Jacob, Melissa R; Zhang, Zhizheng; Khan, Ikhlas A; Ferreira, Daneel; Walker, Larry A; Broedel, Sheldon E; Raulli, Robert E; Cihlar, Ronald L

    2002-12-01

    Fatty acid synthase (FAS) has been identified as a potential antifungal target. FAS prepared from Saccharomyces cerevisiae was employed for bioactivity-guided fractionation of Chlorophora tinctoria,Paspalum conjugatum, Symphonia globulifera, Buchenavia parviflora, and Miconia pilgeriana. Thirteen compounds (1-13), including three new natural products (1, 4, 12), were isolated and their structures identified by spectroscopic interpretation. They represented five chemotypes, namely, isoflavones, flavones, biflavonoids, hydrolyzable tannin-related derivatives, and triterpenoids. 3'-Formylgenistein (1) and ellagic acid 4-O-alpha-l-rhamnopyranoside (9) were the most potent compounds against FAS, with IC(50) values of 2.3 and 7.5 microg/mL, respectively. Furthermore, 43 (14-56) analogues of the five chemotypes from our natural product repository and commercial sources were tested for their FAS inhibitory activity. Structure-activity relationships for some chemotypes were investigated. All these compounds were further evaluated for antifungal activity against Candida albicans and Cryptococcus neoformans. Although there were several antifungal compounds in the set, correlation between the FAS inhibitory activity and antifungal activity could not be defined.

  20. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD

    2015-10-26

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  1. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    Science.gov (United States)

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  2. Blockade of fatty acid synthase triggers significant apoptosis in mantle cell lymphoma.

    Directory of Open Access Journals (Sweden)

    Pascal Gelebart

    Full Text Available Fatty acid synthase (FASN, a key player in the de novo synthetic pathway of long-chain fatty acids, has been shown to contribute to the tumorigenesis in various types of solid tumors. We here report that FASN is highly and consistently expressed in mantle cell lymphoma (MCL, an aggressive form of B-cell lymphoid malignancy. Specifically, the expression of FASN was detectable in all four MCL cell lines and 15 tumors examined. In contrast, benign lymphoid tissues and peripheral blood mononuclear cells from normal donors were negative. Treatment of MCL cell lines with orlistat, a FASN inhibitor, resulted in significant apoptosis. Knockdown of FASN expression using siRNA, which also significantly decreased the growth of MCL cells, led to a dramatic decrease in the cyclin D1 level. β-catenin, which has been previously reported to be upregulated in a subset of MCL tumors, contributed to the high level of FASN in MCL cells, Interesting, siRNA knock-down of FASN in turn down-regulated β-catenin. In conclusion, our data supports the concept that FASN contributes to the pathogenesis of MCL, by collaborating with β-catenin. In view of its high and consistent expression in MCL, FASN inhibitors may hold promises for treating MCL.

  3. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode.

    Science.gov (United States)

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay

    2017-05-07

    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2

    Energy Technology Data Exchange (ETDEWEB)

    Petry, T.W.; Krauss, R.S.; Eling, T.E.

    1986-08-01

    We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.

  5. Manganese influences the expression of fatty acid synthase and malic enzyme in cultured primary chicken hepatocytes.

    Science.gov (United States)

    Lu, Lin; Wang, Meiling; Liao, Xiudong; Zhang, Liyang; Luo, Xugang

    2017-12-01

    Two experiments were designed to investigate the effects of Mn source and concentration on the mRNA expression and enzymatic activities of fatty acid synthase (FAS) and malic enzyme (ME) in cultured primary broiler hepatocytes. In Expt 1, primary broiler hepatocytes were treated with 0 (control), 0·25, 0·50 or 0·75 mmol/l of Mn as inorganic manganese chloride (MnCl2.4H2O) for 24 and 48 h. In Expt 2, primary broiler hepatocytes were incubated with 0 (control), 0·25 or 0·50 mmol/l of Mn as either manganese chloride or Mn-amino acid chelate for 48 h. The mRNA levels and activities of FAS and ME in the hepatocytes were measured in Expts 1 and 2. The results in Expt 1 showed that only at 48 h mRNA expression levels of FAS and ME in the hepatocytes decreased linearly (P0·33) on any of the measured cellular parameters. The results suggested that Mn might reduce cell damage and regulate FAS and ME expression at a transcriptional level in primary cultured broiler hepatocytes.

  6. Fatty acid synthase regulates the chemosensitivity of breast cancer cells to cisplatin-induced apoptosis.

    Science.gov (United States)

    Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther

    2017-06-01

    Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.

  7. Fatty acid synthase inhibitors from the hulls of Nephelium lappaceum L.

    Science.gov (United States)

    Zhao, You-Xing; Liang, Wen-Juan; Fan, Hui-Jin; Ma, Qing-Yun; Tian, Wei-Xi; Dai, Hao-Fu; Jiang, He-Zhong; Li, Ning; Ma, Xiao-Feng

    2011-08-16

    Natural products inhibiting fatty acid synthase (FAS) are appearing as potential therapeutic agents to treat cancer and obesity. The bioassay-guided chemical investigation of the hulls of Nephelium lappaceum L. resulted in the isolation of ten compounds (1-10) mainly including flavonoids and oleane-type triterpene oligoglycosides, in which all of the compounds were isolated from this plant for the first time. Additionally, compounds 8 and 9 were new hederagenin derivatives and were elucidated as hederagenin 3-O-(2,3-di-O-acetyl-α-l-arabinofuranosyl)-(1→3)-[α-l-rhamnopyranosyl(1→2)]-β-l-arabinopyranoside and hederagenin 3-O-(3-O-acetyl-α-l-arabinofuranosyl)-(1→3)-[α-l-rhamnopyranosyl-(1→2)]-β-l-arabinopyranoside, respectively. All these isolates were evaluated for inhibitory activities of FAS, which showed these isolates had inhibitory activity against FAS with IC(50) values ranging from 6.69 to 204.40 μM, comparable to the known FAS inhibitor EGCG (IC(50)=51.97 μM). The study indicates that the hulls of Nephelium lappaceum L. could be considered as potential sources of promising FAS inhibitors and the oleane-type triterpene oligoglycosides could be considered as another type of natural FAS inhibitors. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.

    Science.gov (United States)

    Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng

    2015-09-01

    Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.

  9. Mitochonic Acid 5 (MA-5 Facilitates ATP Synthase Oligomerization and Cell Survival in Various Mitochondrial Diseases

    Directory of Open Access Journals (Sweden)

    Tetsuro Matsuhashi

    2017-06-01

    Full Text Available Mitochondrial dysfunction increases oxidative stress and depletes ATP in a variety of disorders. Several antioxidant therapies and drugs affecting mitochondrial biogenesis are undergoing investigation, although not all of them have demonstrated favorable effects in the clinic. We recently reported a therapeutic mitochondrial drug mitochonic acid MA-5 (Tohoku J. Exp. Med., 2015. MA-5 increased ATP, rescued mitochondrial disease fibroblasts and prolonged the life span of the disease model “Mitomouse” (JASN, 2016. To investigate the potential of MA-5 on various mitochondrial diseases, we collected 25 cases of fibroblasts from various genetic mutations and cell protective effect of MA-5 and the ATP producing mechanism was examined. 24 out of the 25 patient fibroblasts (96% were responded to MA-5. Under oxidative stress condition, the GDF-15 was increased and this increase was significantly abrogated by MA-5. The serum GDF-15 elevated in Mitomouse was likewise reduced by MA-5. MA-5 facilitates mitochondrial ATP production and reduces ROS independent of ETC by facilitating ATP synthase oligomerization and supercomplex formation with mitofilin/Mic60. MA-5 reduced mitochondria fragmentation, restores crista shape and dynamics. MA-5 has potential as a drug for the treatment of various mitochondrial diseases. The diagnostic use of GDF-15 will be also useful in a forthcoming MA-5 clinical trial.

  10. α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    International Nuclear Information System (INIS)

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.

    2006-01-01

    α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity

  11. Extracellular Fatty Acid Synthase: A Possible Surrogate Biomarker of Insulin Resistance

    Science.gov (United States)

    Fernandez-Real, Jose Manuel; Menendez, Javier A.; Moreno-Navarrete, Jose Maria; Blüher, Matthias; Vazquez-Martin, Alejandro; Vázquez, María Jesús; Ortega, Francisco; Diéguez, Carlos; Frühbeck, Gema; Ricart, Wifredo; Vidal-Puig, Antonio

    2010-01-01

    CONTEXT Circulating fatty acid synthase (FASN) is a biomarker of metabolically demanding human diseases. The aim of this study was to determine whether circulating FASN could be a biomarker of overnutrition-induced metabolic stress and insulin resistance in common metabolic disorders. RESEARCH DESIGN AND METHODS Circulating FASN was evaluated in two cross-sectional studies in association with insulin sensitivity and in four longitudinal studies investigating the effect of diet- and surgery-induced weight loss, physical training, and adipose tissue expansion using peroxisome proliferator–activated receptor agonist rosiglitazone on circulating FASN. RESULTS Age- and BMI-adjusted FASN concentrations were significantly increased in association with obesity-induced insulin resistance in two independent cohorts. Both visceral and subcutaneous FASN expression and protein levels correlated inversely with extracellular circulating FASN (P = −0.63; P < 0.0001), suggesting that circulating FASN is linked to depletion of intracellular FASN. Improved insulin sensitivity induced by therapeutic strategies that decreased fat mass (diet induced, surgery induced, or physical training) all led to decreased FASN levels in blood (P values between 0.02 and 0.04). To discriminate whether this was an effect related to insulin sensitization, we also investigated the effects of rosiglitazone. Rosiglitazone did not lead to significant changes in circulating FASN concentration. CONCLUSIONS Our results suggest that circulating FASN is a biomarker of overnutrition-induced insulin resistance that could provide diagnostic and prognostic advantages by providing insights on the individualized metabolic stress. PMID:20299470

  12. Mechanism for cyclization reaction by clavaminic acid synthase. Insights from modeling studies.

    Science.gov (United States)

    Borowski, Tomasz; de Marothy, Sven; Broclawik, Ewa; Schofield, Christopher J; Siegbahn, Per E M

    2007-03-27

    The mechanism of the oxidative cyclization reaction catalyzed by clavaminic acid synthase (CAS) was studied in silico. First, a classical molecular dynamics (MD) simulation was performed to obtain a realistic structure of the CAS-Fe(IV)=O-succinate-substrate complex; then potential of mean force (PMF) was calculated to assess the feasibility of the beta-lactam ring, more specifically its C4' corner, approaching the oxo atom. Based on the MD structure, a relatively large model of the active site region was selected and used in the B3LYP investigation of the reaction mechanism. The computational results suggest that once the oxoferryl species is formed, the oxidative cyclization catalyzed by CAS most likely involves either a mechanism involving C4'(S)-H bond cleavage of the monocyclic beta-lactam ring, or a biosynthetically unprecedented mechanism comprising (1) oxidation of the hydroxyl group of PCA to an O-radical, (2) retro-aldol-like decomposition of the O-radical to an aldehyde and a C-centered radical, which is stabilized by the captodative effect, (3) abstraction of a hydrogen atom from the C4'(S) position of the C-centered radical by the Fe(III)-OH species yielding an azomethine ylide, and (4) 1,3-dipolar cycloaddition to the ylide with aldehyde acting as a dipolarophile. Precedent for the new proposed mechanism comes from the reported synthesis of oxapenams via 1,3-dipolar cycloaddition reactions of aldehydes and ketones.

  13. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  14. Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.

    Directory of Open Access Journals (Sweden)

    Anna Zdyb

    Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.

  15. Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.

    Science.gov (United States)

    Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George

    2017-09-01

    Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA

    Science.gov (United States)

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg

    2013-01-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  17. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases.

    Science.gov (United States)

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg

    2013-02-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.

  18. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    Science.gov (United States)

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  19. Alpha-mangostin inhibits intracellular fatty acid synthase and induces apoptosis in breast cancer cells.

    Science.gov (United States)

    Li, Ping; Tian, Weixi; Ma, Xiaofeng

    2014-06-03

    Fatty acid synthase (FAS) has been proven over-expressed in human breast cancer cells and consequently, has been recognized as a target for breast cancer treatment. Alpha-mangostin, a natural xanthone found in mangosteen pericarp, has a variety of biological activities, including anti-cancer effect. In our previous study, alpha-mangostin had been found both fast-binding and slow-binding inhibitions to FAS in vitro. This study was designed to investigate the activity of alpha-mangostin on intracellular FAS activity in FAS over-expressed human breast cancer cells, and to testify whether the anti-cancer activity of alpha-mangostin may be related to its inhibitory effect on FAS. We evaluated the cytotoxicity of alpha-mangostin in human breast cancer MCF-7 and MDA-MB-231 cells. Intracellular FAS activity was measured by a spectrophotometer at 340 nm of NADPH absorption. Cell Counting Kit assay was used to test the cell viability. Immunoblot analysis was performed to detect FAS expression level, intracellular fatty acid accumulation and cell signaling (FAK, ERK1/2 and AKT). Apoptotic effects were detected by flow cytometry and immunoblot analysis of PARP, Bax and Bcl-2. Small interfering RNA was used to down-regulate FAS expression and/or activity. Alpha-mangostin could effectively suppress FAS expression and inhibit intracellular FAS activity, and result in decrease of intracellular fatty acid accumulation. It could also reduce cell viability, induce apoptosis in human breast cancer cells, increase in the levels of the PARP cleavage product, and attenuate the balance between anti-apoptotic and pro-apoptotic proteins of the Bcl-2 family. Moreover, alpha-mangostin inhibited the phosphorylation of FAK. However, the active forms of AKT, and ERK1/2 proteins were not involved in the changes of FAS expression induced by alpha-mangostin. Alpha-mangostin induced breast cancer cell apoptosis by inhibiting FAS, which provide a basis for the development of xanthone as an agent for

  20. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  1. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    International Nuclear Information System (INIS)

    Chang, Soo-Ik; Hammes, G.G.

    1989-01-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  2. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  3. Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.

    Directory of Open Access Journals (Sweden)

    Damien Garrido

    2015-02-01

    Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell

  4. Cyclopropane fatty acid synthase mutants of probiotic human-derived Lactobacillus reuteri are defective in TNF inhibition.

    Science.gov (United States)

    Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A

    2011-01-01

    Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.

  5. Investigation of a 6-MSA Synthase Gene Cluster in Aspergillus aculeatus Reveals 6-MSA-derived Aculinic Acid, Aculins A-B and Epi-Aculin A

    DEFF Research Database (Denmark)

    Petersen, Lene Maj; Holm, Dorte Koefoed; Gotfredsen, Charlotte Held

    2015-01-01

    . In this study we identified a 6-methylsalicylic acid (6-MSA) synthase from A. aculeatus, and verified its functionality by episomal expression in A. aculeatus and heterologous expression in A. nidulans. Feeding studies with fully 13C-labeled 6-MSA revealed that 6-MSA is incorporated into aculinic acid, which...

  6. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    Energy Technology Data Exchange (ETDEWEB)

    Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  7. Campylobacter jejuni fatty acid synthase II: Structural and functional analysis of [beta]-hydroxyacyl-ACP dehydratase (FabZ)

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, Andrew S.; Yokoyama, Takeshi; Choi, Kyoung-Jae; Yeo, Hye-Jeong; (Houston)

    2009-08-14

    Fatty acid biosynthesis is crucial for all living cells. In contrast to higher organisms, bacteria use a type II fatty acid synthase (FAS II) composed of a series of individual proteins, making FAS II enzymes excellent targets for antibiotics discovery. The {beta}-hydroxyacyl-ACP dehydratase (FabZ) catalyzes an essential step in the FAS II pathway. Here, we report the structure of Campylobacter jejuni FabZ (CjFabZ), showing a hexamer both in crystals and solution, with each protomer adopting the characteristic hot dog fold. Together with biochemical analysis of CjFabZ, we define the first functional FAS II enzyme from this pathogen, and provide a framework for investigation on roles of FAS II in C. jejuni virulence

  8. Individualized supplementation of folic acid according to polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) reduced pregnant complications.

    Science.gov (United States)

    Li, Xiujuan; Jiang, Jing; Xu, Min; Xu, Mei; Yang, Yan; Lu, Wei; Yu, Xuemei; Ma, Jianlin; Pan, Jiakui

    2015-01-01

    This study aimed to detect the genotype distributions and allele frequencies of methylenetetrahydrofolate reductase (MTHFR) C677T, A1298C and methionine synthase reductase (MTRR) A66G polymorphisms of pregnant women in Jiaodong region in China, and to investigate whether folic acid supplementation affect the pregnancy complications. A total of 7,812 pregnant women from the Jiaodong region in Shandong province in China. By using Taqman-MGB, 2,928 pregnant women (case group) were tested for the genotype distributions and allele frequencies of MTHFR C677T, A1298C and MTRR A66G polymorphisms. Folic acid metabolism ability was ranked at four levels and then pregnant women in different rank group were supplemented with different doses of folic acid. Their pregnancy complications were followed up and compared with 4,884 pregnant women without folic acid supplementation (control group) in the same hospital. The allele frequencies of MTHFR C677T were 49.1 and 50.9%; those of MTHFR A1298C were 80.2 and 19.8%, and those of MTRR A66G were 74.1 and 25.9%. After supplemented with folic acid, the complication rates in different age groups were significantly reduced, especially for gestational diabetes mellitus and hypertension. Periconceptional folic acid supplementation and healthcare following gene polymorphism testing may be a powerful measure to decrease congenital malformations. © 2015 S. Karger AG, Basel.

  9. Fatty acid synthase plays a role in cancer metabolism beyond providing fatty acids for phospholipid synthesis or sustaining elevations in glycolytic activity

    International Nuclear Information System (INIS)

    Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.

    2014-01-01

    Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of

  10. Fatty acid synthase plays a role in cancer metabolism beyond providing fatty acids for phospholipid synthesis or sustaining elevations in glycolytic activity

    Energy Technology Data Exchange (ETDEWEB)

    Hopperton, Kathryn E., E-mail: kathryn.hopperton@mail.utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: robin.duncan@uwaterloo.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: richard.bazinet@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: m.archer@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)

    2014-01-15

    Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare

  11. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  12. Functional replacement of the Saccharomyces cerevisiae fatty acid synthase with a bacterial type II system allows flexible product profiles.

    Science.gov (United States)

    Fernandez-Moya, Ruben; Leber, Christopher; Cardenas, Javier; Da Silva, Nancy A

    2015-12-01

    The native yeast type I fatty acid synthase (FAS) is a complex, rigid enzyme, and challenging to engineer for the production of medium- or short-chain fatty acids. Introduction of a type II FAS is a promising alternative as it allows expression control for each discrete enzyme and the addition of heterologous thioesterases. In this study, the native Saccharomyces cerevisiae FAS was functionally replaced by the Escherichia coli type II FAS (eFAS) system. The E. coli acpS + acpP (together), fabB, fabD, fabG, fabH, fabI, fabZ, and tesA were expressed in individual S. cerevisiae strains, and enzyme activity was confirmed by in vitro activity assays. Eight genes were then integrated into the yeast genome, while tesA or an alternate thioesterase gene, fatB from Ricinus communis or TEII from Rattus novergicus, was expressed from a multi-copy plasmid. Native FAS activity was eliminated by knocking out the yeast FAS2 gene. The strains expressing only the eFAS as de novo fatty acid source grew without fatty acid supplementation demonstrating that this type II FAS is able to functionally replace the native yeast FAS. The engineered strain expressing the R. communis fatB thioesterase increased total fatty acid titer 1.7-fold and shifted the fatty acid profile towards C14 production, increasing it from <1% in the native strain to more than 30% of total fatty acids, and reducing C18 production from 39% to 8%. © 2015 Wiley Periodicals, Inc.

  13. Overexpression of fatty acid synthase in SKBR3 breast cancer cell line is mediated via a transcriptional mechanism.

    Science.gov (United States)

    Oskouian, B

    2000-02-28

    Overexpression of fatty acid synthase (FAS) in certain breast, prostate and ovarian tumors has been correlated with aggressive cancer phenotype and poor prognosis. The objective of this study was to use a breast cancer-derived cell line, SKBR3, as a model to define the underlying mechanism for overexpression of FAS in cancer cells. Different stages of gene expression where overproduction of FAS could potentially be achieved were investigated. Whereas gross chromosomal rearrangement at the FAS locus, amplification of the FAS gene, increases in FAS message stability and longer half-life of the FAS protein were not detected, an increase in the rate of transcription of the FAS gene, and consequently a higher abundance of FAS-mRNA, was found to be primarily responsible for FAS overexpression in this cell line.

  14. Mitochondrial dysfunction is responsible for fatty acid synthase inhibition-induced apoptosis in breast cancer cells by PdpaMn.

    Science.gov (United States)

    Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing

    2017-12-01

    Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate

  15. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  16. In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum.

    Science.gov (United States)

    Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki

    2017-10-01

    For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase

  17. Fatty acid synthase as a factor required for exercise-induced cognitive enhancement and dentate gyrus cellular proliferation.

    Directory of Open Access Journals (Sweden)

    Nataliya E Chorna

    Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.

  18. Fatty acid synthase as a factor required for exercise-induced cognitive enhancement and dentate gyrus cellular proliferation.

    Science.gov (United States)

    Chorna, Nataliya E; Santos-Soto, Iván J; Carballeira, Nestor M; Morales, Joan L; de la Nuez, Janneliz; Cátala-Valentin, Alma; Chornyy, Anatoliy P; Vázquez-Montes, Adrinel; De Ortiz, Sandra Peña

    2013-01-01

    Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN), the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ) of the dentate gyrus (DG) and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v.) microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.

  19. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  20. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  1. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  2. Folic Acid Promotes Recycling of Tetrahydrobiopterin and Protects Against Hypoxia-Induced Pulmonary Hypertension by Recoupling Endothelial Nitric Oxide Synthase

    Science.gov (United States)

    Chalupsky, Karel; Kračun, Damir; Kanchev, Ivan; Bertram, Katharina

    2015-01-01

    Abstract Aims: Nitric oxide (NO) derived from endothelial NO synthase (eNOS) has been implicated in the adaptive response to hypoxia. An imbalance between 5,6,7,8-tetrahydrobiopterin (BH4) and 7,8-dihydrobiopterin (BH2) can result in eNOS uncoupling and the generation of superoxide instead of NO. Dihydrofolate reductase (DHFR) can recycle BH2 to BH4, leading to eNOS recoupling. However, the role of DHFR and eNOS recoupling in the response to hypoxia is not well understood. We hypothesized that increasing the capacity to recycle BH4 from BH2 would improve NO bioavailability as well as pulmonary vascular remodeling (PVR) and right ventricular hypertrophy (RVH) as indicators of pulmonary hypertension (PH) under hypoxic conditions. Results: In human pulmonary artery endothelial cells and murine pulmonary arteries exposed to hypoxia, eNOS was uncoupled as indicated by reduced superoxide production in the presence of the nitric oxide synthase inhibitor, L-(G)-nitro-L-arginine methyl ester (L-NAME). Concomitantly, NO levels, BH4 availability, and expression of DHFR were diminished under hypoxia. Application of folic acid (FA) restored DHFR levels, NO bioavailability, and BH4 levels under hypoxia. Importantly, FA prevented the development of hypoxia-induced PVR, right ventricular pressure increase, and RVH. Innovation: FA-induced upregulation of DHFR recouples eNOS under hypoxia by improving BH4 recycling, thus preventing hypoxia-induced PH. Conclusion: FA might serve as a novel therapeutic option combating PH. Antioxid. Redox Signal. 23, 1076–1091. PMID:26414244

  3. In Silico Structure Prediction of Human Fatty Acid Synthase-Dehydratase: A Plausible Model for Understanding Active Site Interactions.

    Science.gov (United States)

    John, Arun; Umashankar, Vetrivel; Samdani, A; Sangeetha, Manoharan; Krishnakumar, Subramanian; Deepa, Perinkulam Ravi

    2016-01-01

    Fatty acid synthase (FASN, UniProt ID: P49327) is a multienzyme dimer complex that plays a critical role in lipogenesis. Consequently, this lipogenic enzyme has gained tremendous biomedical importance. The role of FASN and its inhibition is being extensively researched in several clinical conditions, such as cancers, obesity, and diabetes. X-ray crystallographic structures of some of its domains, such as β-ketoacyl synthase, acetyl transacylase, malonyl transacylase, enoyl reductase, β-ketoacyl reductase, and thioesterase, (TE) are already reported. Here, we have attempted an in silico elucidation of the uncrystallized dehydratase (DH) catalytic domain of human FASN. This theoretical model for DH domain was predicted using comparative modeling methods. Different stand-alone tools and servers were used to validate and check the reliability of the predicted models, which suggested it to be a highly plausible model. The stereochemical analysis showed 92.0% residues in favorable region of Ramachandran plot. The initial physiological substrate β-hydroxybutyryl group was docked into active site of DH domain using Glide. The molecular dynamics simulations carried out for 20 ns in apo and holo states indicated the stability and accuracy of the predicted structure in solvated condition. The predicted model provided useful biochemical insights into the substrate-active site binding mechanisms. This model was then used for identifying potential FASN inhibitors using high-throughput virtual screening of the National Cancer Institute database of chemical ligands. The inhibitory efficacy of the top hit ligands was validated by performing molecular dynamics simulation for 20 ns, where in the ligand NSC71039 exhibited good enzyme inhibition characteristics and exhibited dose-dependent anticancer cytotoxicity in retinoblastoma cancer cells in vitro.

  4. Biosynthesis of the microtubule-destabilizing diterpene pseudolaric acid B from golden larch involves an unusual diterpene synthase

    Science.gov (United States)

    Mafu, Sibongile; Karunanithi, Prema Sambandaswami; Palazzo, Teresa Ann; Harrod, Bronwyn Lee; Rodriguez, Selina Marakana; Mollhoff, Iris Natalie; O’Brien, Terrence Edward; Tong, Shen; Fiehn, Oliver; Tantillo, Dean J.; Bohlmann, Jörg; Zerbe, Philipp

    2017-01-01

    The diversity of small molecules formed via plant diterpene metabolism offers a rich source of known and potentially new biopharmaceuticals. Among these, the microtubule-destabilizing activity of pseudolaric acid B (PAB) holds promise for new anticancer agents. PAB is found, perhaps uniquely, in the coniferous tree golden larch (Pseudolarix amabilis, Pxa). Here we describe the discovery and mechanistic analysis of golden larch terpene synthase 8 (PxaTPS8), an unusual diterpene synthase (diTPS) that catalyzes the first committed step in PAB biosynthesis. Mining of the golden larch root transcriptome revealed a large TPS family, including the monofunctional class I diTPS PxaTPS8, which converts geranylgeranyl diphosphate into a previously unknown 5,7-fused bicyclic diterpene, coined “pseudolaratriene.” Combined NMR and quantum chemical analysis verified the structure of pseudolaratriene, and co-occurrence with PxaTPS8 and PAB in P. amabilis tissues supports the intermediacy of pseudolaratriene in PAB metabolism. Although PxaTPS8 adopts the typical three-domain structure of diTPSs, sequence phylogeny places the enzyme with two-domain TPSs of mono- and sesqui-terpene biosynthesis. Site-directed mutagenesis of PxaTPS8 revealed several catalytic residues that, together with quantum chemical calculations, suggested a substantial divergence of PxaTPS8 from other TPSs leading to a distinct carbocation-driven reaction mechanism en route to the 5,7-trans-fused bicyclic pseudolaratriene scaffold. PxaTPS8 expression in microbial and plant hosts provided proof of concept for metabolic engineering of pseudolaratriene. PMID:28096378

  5. Crosstalk between osteoprotegerin (OPG), fatty acid synthase (FASN) and, cycloxygenase-2 (COX-2) in breast cancer: implications in carcinogenesis.

    Science.gov (United States)

    Goswami, Sudeshna; Sharma-Walia, Neelam

    2016-09-13

    The crosstalk between malignant and nonmalignant cells in the tumor microenvironment, as maneuvered by cytokines/chemokines, drives breast cancer progression. In our previous study, we discovered Osteoprotegerin (OPG) as one of the cytokines heavily secreted by breast cancer cells. We demonstrated that OPG is expressed and secreted at very high levels from the highly invasive breast cancer cell lines SUM149PT and SUM1315MO2 as compared to normal human mammary epithelial HMEC cells. OPG was involved in modulating aneuploidy, cell proliferation, and angiogenesis in breast cancer. Mass spectrometry analysis performed in this study revealed OPG interacts with fatty acid synthase (FASN), which is a key enzyme of the fatty acid biosynthetic pathway in breast cancer cells. Further, electron microscopy, immunofluorescence, and fluorescence quantitation assays highlighted the presence of a large number of lipid bodies (lipid droplets) in SUM149PT and SUM1315MO2 cells in comparison to HMEC. We recently showed upregulation of the COX-2 inflammatory pathway and its metabolite PGE2 secretion in SUM149PT and SUM1315MO2 breast cancer cells. Interestingly, human breast cancer tissue samples displayed high expression of OPG, PGE2 and fatty acid synthase (FASN). FASN is a multifunctional enzyme involved in lipid biosynthesis. Immunofluorescence staining revealed the co-existence of COX-2 and FASN in the lipid bodies of breast cancer cells. We reasoned that there might be crosstalk between OPG, FASN, and COX-2 that sustains the inflammatory pathways in breast cancer. Interestingly, knocking down OPG by CRISPR/Cas9 gene editing in breast cancer cells decreased FASN expression at the protein level. Here, we identified cis-acting elements involved in the transcriptional regulation of COX-2 and FASN by recombinant human OPG (rhOPG). Treatment with FASN inhibitor C75 and COX-2 inhibitor celecoxib individually decreased the number of lipid bodies/cell, downregulated phosphorylation of ERK

  6. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    Science.gov (United States)

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  7. Biosynthesis of the microtubule-destabilizing diterpene pseudolaric acid B from golden larch involves an unusual diterpene synthase

    OpenAIRE

    Mafu, Sibongile; Karunanithi, Prema Sambandaswami; Palazzo, Teresa Ann; Harrod, Bronwyn Lee; Rodriguez, Selina Marakana; Mollhoff, Iris Natalie; O’Brien, Terrence Edward; Tong, Shen; Fiehn, Oliver; Tantillo, Dean J.; Bohlmann, Jörg; Zerbe, Philipp

    2017-01-01

    Diterpenes play important roles in plant biology and serve as industrial bioproducts and therapeutics, including the anticancer drug Taxol. Enzymes of the diterpene synthase family produce the many core structural scaffolds that form the foundation of the large diversity of biologically active diterpenes. This paper describes the identification and the mechanism of a distinct diterpene synthase, pseudolaratriene synthase, from the golden larch tree, Pseudolarix amabilis. The enzyme catalyzes ...

  8. Oleic acid increases mitochondrial reactive oxygen species production and decreases endothelial nitric oxide synthase activity in cultured endothelial cells.

    Science.gov (United States)

    Gremmels, Hendrik; Bevers, Lonneke M; Fledderus, Joost O; Braam, Branko; van Zonneveld, Anton Jan; Verhaar, Marianne C; Joles, Jaap A

    2015-03-15

    Elevated plasma levels of free fatty acids (FFA) are associated with increased cardiovascular risk. This may be related to FFA-induced elevation of oxidative stress in endothelial cells. We hypothesized that, in addition to mitochondrial production of reactive oxygen species, endothelial nitric oxide synthase (eNOS)-mediated reactive oxygen species production contributes to oleic acid (OA)-induced oxidative stress in endothelial cells, due to eNOS uncoupling. We measured reactive oxygen species production and eNOS activity in cultured endothelial cells (bEnd.3) in the presence of OA bound to bovine serum albumin, using the CM-H2DCFDA assay and the L-arginine/citrulline conversion assay, respectively. OA induced a concentration-dependent increase in reactive oxygen species production, which was inhibited by the mitochondrial complex II inhibitor thenoyltrifluoroacetone (TTFA). OA had little effect on eNOS activity when stimulated by a calcium-ionophore, but decreased both basal and insulin-induced eNOS activity, which was restored by TTFA. Pretreatment of bEnd.3 cells with tetrahydrobiopterin (BH4) prevented OA-induced reactive oxygen species production and restored inhibition of eNOS activity by OA. Elevation of OA levels leads to both impairment in receptor-mediated stimulation of eNOS and to production of mitochondrial-derived reactive oxygen species and hence endothelial dysfunction. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Regulation of Expression of Citrate Synthase by the Retinoic Acid Receptor-Related Orphan Receptor α (RORα)

    Science.gov (United States)

    Crumbley, Christine; Wang, Yongjun; Banerjee, Subhashis; Burris, Thomas P.

    2012-01-01

    The retinoic acid receptor-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily of transcription factors that plays an important role in regulation of the circadian rhythm and metabolism. Mice lacking a functional RORα display a range of metabolic abnormalities including decreased serum cholesterol and plasma triglycerides. Citrate synthase (CS) is a key enzyme of the citric acid cycle that provides energy for cellular function. Additionally, CS plays a critical role in providing citrate derived acetyl-CoA for lipogenesis and cholesterologenesis. Here, we identified a functional RORα response element (RORE) in the promoter of the CS gene. ChIP analysis demonstrates RORα occupancy of the CS promoter and a putative RORE binds to RORα effectively in an electrophoretic mobility shift assay and confers RORα responsiveness to a reporter gene in a cotransfection assay. We also observed a decrease in CS gene expression and CS enzymatic activity in the staggerer mouse, which has a mutation of in the Rora gene resulting in nonfunctional RORα protein. Furthermore, we found that SR1001 a RORα inverse agonist eliminated the circadian pattern of expression of CS mRNA in mice. These data suggest that CS is a direct RORα target gene and one mechanism by which RORα regulates lipid metabolism is via regulation of CS expression. PMID:22485150

  10. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase.

    Science.gov (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke

    2016-05-15

    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Improvement of Glyphosate Resistance through Concurrent Mutations in Three Amino Acids of the Ochrobactrum 5-Enopyruvylshikimate-3-Phosphate Synthase

    Science.gov (United States)

    Tian, Yong-Sheng; Xu, Jing; Xiong, Ai-Sheng; Zhao, Wei; Fu, Xiao-Yan; Peng, Ri-He; Yao, Quan-Hong

    2011-01-01

    A mutant of 5-enopyruvylshikimate-3-phosphate synthase from Ochrobactrum anthropi was identified after four rounds of DNA shuffling and screening. Its ability to restore the growth of the mutant ER2799 cell on an M9 minimal medium containing 300 mM glyphosate led to its identification. The mutant had mutations in seven amino acids: E145G, N163H, N267S, P318R, M377V, M425T, and P438L. Among these mutations, N267S, P318R, and M425T have never been previously reported as important residues for glyphosate resistance. However, in the present study they were found by site-directed mutagenesis to collectively contribute to the improvement of glyphosate tolerance. Kinetic analyses of these three mutants demonstrated that the effectiveness of these three individual amino acid alterations on glyphosate tolerance was in the order P318R > M425T > N267S. The results of the kinetic analyses combined with a three-dimensional structure modeling of the location of P318R and M425T demonstrate that the lower hemisphere's upper surface is possibly another important region for glyphosate resistance. Furthermore, the transgenic Arabidopsis was obtained to confirm the potential of the mutant in developing glyphosate-resistant crops. PMID:21948846

  12. Discovery and characterization of [(cyclopentyl)ethyl]benzoic acid inhibitors of microsomal prostaglandin E synthase-1.

    Science.gov (United States)

    Partridge, Katherine M; Antonysamy, Stephen; Bhattachar, Shobha N; Chandrasekhar, Srinivasan; Fisher, Matthew J; Fretland, Adrian; Gooding, Karen; Harvey, Anita; Hughes, Norman E; Kuklish, Steven L; Luz, John G; Manninen, Peter R; McGee, James E; Mudra, Daniel R; Navarro, Antonio; Norman, Bryan H; Quimby, Steven J; Schiffler, Matthew A; Sloan, Ashley V; Warshawsky, Alan M; Weller, Jennifer M; York, Jeremy S; Yu, Xiao-Peng

    2017-03-15

    We describe a novel class of acidic mPGES-1 inhibitors with nanomolar enzymatic and human whole blood (HWB) potency. Rational design in conjunction with structure-based design led initially to the identification of anthranilic acid 5, an mPGES-1 inhibitor with micromolar HWB potency. Structural modifications of 5 improved HWB potency by over 1000×, reduced CYP2C9 single point inhibition, and improved rat clearance, which led to the selection of [(cyclopentyl)ethyl]benzoic acid compound 16 for clinical studies. Compound 16 showed an IC 80 of 24nM for inhibition of PGE 2 formation in vitro in LPS-stimulated HWB. A single oral dose resulted in plasma concentrations of 16 that exceeded its HWB IC 80 in both rat (5mg/kg) and dog (3mg/kg) for over twelve hours. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Inhibition of Fatty Acid Synthase in Prostate Cancer by Orlistat, a Novel Therapeutic

    Science.gov (United States)

    2007-11-01

    altering phospholipid metabolism by manipulation of phospholipase activity amplifies the ER stress response in h-cells Figure 6. Pharmacologic FAS...Nutrition 2000;16:202–8. 8. Kuhajda FP, Jenner K, Wood FD, et al. Fatty acid synthesis: a potential selective target for antineoplastic therapy. Proc Natl...New players, novel targets. Current Opinion in Clinical Nutrition and Metabolic Care , 9, 358–365. 28. Swinnen, J. V., & Verhoeven, G. (1998

  14. Up-regulation of fatty acid synthase induced by EGFR/ERK activation promotes tumor growth in pancreatic cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)

    2015-08-07

    Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.

  15. Key Role of the Carboxyl Terminus of Hyaluronan Synthase in Processive Synthesis and Size Control of Hyaluronic Acid Polymers.

    Science.gov (United States)

    Yang, Ji; Cheng, Fangyu; Yu, Huimin; Wang, Junting; Guo, Zhigang; Stephanopoulos, Gregory

    2017-04-10

    The essential pathophysiological roles of hyaluronic acid (HA) strongly depend on HA binding and HA size. Here we deployed the atomic vision of molecular dynamics (MD) simulation to experimentally investigate the influence of C-terminal mutations of Streptococcus equisimilis hyaluronan synthase (SeHAS) on HA product synthesis in Escherichia coli. R413 was vital for HA production, as the removal or mutation of R413 led to inactivation of SeHAS. MD simulations indicated that R406-R413 constituted an HA-binding pattern that stabilized the HA-SeHAS complex. We further increased HA product size via site-directed mutation of the SeHAS C-terminal residues 414-417 based on the hypothesis that higher binding affinity between the SeHAS C-terminus and HA would lead to larger HA size, underlying the important role of the HA-SeHAS interaction in HA size control. W410A and T412A mutations also completely deactivated SeHAS. Moreover, a catalysis-transformation-translocation model was proposed for the HA synthesis and translocation processes.

  16. Up-regulation of fatty acid synthase induced by EGFR/ERK activation promotes tumor growth in pancreatic cancer

    International Nuclear Information System (INIS)

    Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin

    2015-01-01

    Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression

  17. Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase.

    Science.gov (United States)

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W; Covello, Patrick S

    2007-02-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a beta-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria.

  18. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3.

    Science.gov (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina

    2010-06-01

    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  19. Triterpenoic Acids from Apple Pomace Enhance the Activity of the Endothelial Nitric Oxide Synthase (eNOS).

    Science.gov (United States)

    Waldbauer, Katharina; Seiringer, Günter; Nguyen, Dieu Linh; Winkler, Johannes; Blaschke, Michael; McKinnon, Ruxandra; Urban, Ernst; Ladurner, Angela; Dirsch, Verena M; Zehl, Martin; Kopp, Brigitte

    2016-01-13

    Pomace is an easy-accessible raw material for the isolation of fruit-derived compounds. Fruit consumption is associated with health-promoting effects, such as the prevention of cardiovascular disease. Increased vascular nitric oxide (NO) bioavailability, for example, due to an enhanced endothelial nitric oxide synthase (eNOS) activity, could be one molecular mechanism mediating this effect. To identify compounds from apple (Malus domestica Borkh.) pomace that have the potential to amplify NO bioavailability via eNOS activation, a bioassay-guided fractionation of the methanol/water (70:30) extract has been performed using the (14)C-L-arginine to (14)C-L-citrulline conversion assay (ACCA) in the human endothelium-derived cell line EA.hy926. Phytochemical characterization of the active fractions was performed using the spectrophotometric assessment of the total phenolic content, as well as TLC, HPLC-DAD-ELSD, and HPLC-MS analyses. Eleven triterpenoic acids, of which one is a newly discovered compound, were identified as the main constituents in the most active fraction, accompanied by only minor contents of phenolic compounds. When tested individually, none of the tested compounds exhibited significant eNOS activation. Nevertheless, cell stimulation with the reconstituted compound mixture restored eNOS activation, validating the potential of apple pomace as a source of bioactive components.

  20. One amino acid makes the difference: the formation of ent-kaurene and 16α-hydroxy-ent-kaurane by diterpene synthases in poplar.

    Science.gov (United States)

    Irmisch, Sandra; Müller, Andrea T; Schmidt, Lydia; Günther, Jan; Gershenzon, Jonathan; Köllner, Tobias G

    2015-10-28

    Labdane-related diterpenoids form the largest group among the diterpenes. They fulfill important functions in primary metabolism as essential plant growth hormones and are known to function in secondary metabolism as, for example, phytoalexins. The biosynthesis of labdane-related diterpenes is mediated by the action of class II and class I diterpene synthases. Although terpene synthases have been well investigated in poplar, little is known about diterpene formation in this woody perennial plant species. The recently sequenced genome of Populus trichocarpa possesses two putative copalyl diphosphate synthase genes (CPS, class II) and two putative kaurene synthase genes (KS, class I), which most likely arose through a genome duplication and a recent tandem gene duplication, respectively. We showed that the CPS-like gene PtTPS17 encodes an ent-copalyl diphosphate synthase (ent-CPS), while the protein encoded by the putative CPS gene PtTPS18 showed no enzymatic activity. The putative kaurene synthases PtTPS19 and PtTPS20 both accepted ent-copalyl diphosphate (ent-CPP) as substrate. However, despite their high sequence similarity, they produced different diterpene products. While PtTPS19 formed exclusively ent-kaurene, PtTPS20 generated mainly the diterpene alcohol, 16α-hydroxy-ent-kaurane. Using homology-based structure modeling and site-directed mutagenesis, we demonstrated that one amino acid residue determines the different product specificity of PtTPS19 and PtTPS20. A reciprocal exchange of methionine 607 and threonine 607 in the active sites of PtTPS19 and PtTPS20, respectively, led to a complete interconversion of the enzyme product profiles. Gene expression analysis revealed that the diterpene synthase genes characterized showed organ-specific expression with the highest abundance of PtTPS17 and PtTPS20 transcripts in poplar roots. The poplar diterpene synthases PtTPS17, PtTPS19, and PtTPS20 contribute to the production of ent-kaurene and 16

  1. Sterol regulation of human fatty acid synthase promoter I requires nuclear factor-Y- and Sp-1-binding sites.

    Science.gov (United States)

    Xiong, S; Chirala, S S; Wakil, S J

    2000-04-11

    To understand cholesterol-mediated regulation of human fatty acid synthase promoter I, we tested various 5'-deletion constructs of promoter I-luciferase reporter gene constructs in HepG2 cells. The reporter gene constructs that contained only the Sp-1-binding site (nucleotides -82 to -74) and the two tandem sterol regulatory elements (SREs; nucleotides -63 to -46) did not respond to cholesterol. Only the reporter gene constructs containing a nuclear factor-Y (NF-Y) sequence, the CCAAT sequence (nucleotides -90 to -86), an Sp-1 sequence, and the two tandem SREs responded to cholesterol. The NF-Y-binding site, therefore, is essential for cholesterol response. Mutating the SREs or the NF-Y site and inserting 4 bp between the Sp-1- and NF-Y-binding sites both resulted in a minimal cholesterol response of the reporter genes. Electrophoretic mobility-shift assays using anti-SRE-binding protein (SREBP) and anti-NF-Ya antibodies confirmed that these SREs and the NF-Y site bind the respective factors. We also identified a second Sp-1 site located between nucleotides -40 and -30 that can substitute for the mutated Sp-1 site located between nucleotides -82 and -74. The reporter gene expression of the wild-type promoter and the Sp-1 site (nucleotides -82 to -74) mutant promoter was similar when SREBP1a [the N-terminal domain of SREBP (amino acids 1-520)] was constitutively overexpressed, suggesting that Sp-1 recruits SREBP to the SREs. Under the same conditions, an NF-Y site mutation resulted in significant loss of reporter gene expression, suggesting that NF-Y is required to activate the cholesterol response.

  2. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  3. Comparative Amino Acids Studies on Phac Synthases and Proteases as Well as Establishing a New Trend in Experimental Design

    Directory of Open Access Journals (Sweden)

    Amro Abd al fattah Amara

    2012-04-01

    Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In

  4. The Fatty Acid Synthase Inhibitor Platensimycin Improves Insulin Resistance without Inducing Liver Steatosis in Mice and Monkeys.

    Directory of Open Access Journals (Sweden)

    Sheo B Singh

    Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.

  5. In silico investigation of lavandulyl flavonoids for the development of potent fatty acid synthase-inhibitory prototypes.

    Science.gov (United States)

    Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun

    2017-01-01

    Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Indole-3-butyric acid promotes adventitious rooting in Arabidopsis thaliana thin cell layers by conversion into indole-3-acetic acid and stimulation of anthranilate synthase activity.

    Science.gov (United States)

    Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M

    2017-07-11

    Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced

  7. Synthesis and evaluation of small libraries of triazolylmethoxy chalcones, flavanones and 2-aminopyrimidines as inhibitors of mycobacterial FAS-II and PknG.

    Science.gov (United States)

    Anand, Namrata; Singh, Priyanka; Sharma, Anindra; Tiwari, Sameer; Singh, Vandana; Singh, Diwakar K; Srivastava, Kishore K; Singh, B N; Tripathi, Rama Pati

    2012-09-01

    A synthetic strategy to access small libraries of triazolylmethoxy chalcones 4{1-20}, triazolylmethoxy flavanones 5{1-10} and triazolylmethoxy aminopyrimidines 6{1-17} from a common substrate 4-propargyloxy-2-hydroxy acetophenone using a set of different reactions has been developed. The chalcones and flavanones were screened against mycobacterial FAS-II pathway using a recombinant mycobacterial strain, against which the most potent compound showed ∼88% inhibition in bacterial growth and substantially induction of reporter gene activity at 100 μM concentration. The triazolylmethoxy aminopyrimdines were screened against PknG of Mycobaceterium tuberculosis displaying moderate to good activity (23-53% inhibition at 100 μM), comparable to the action of a standard inhibitor. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  9. [Expression of fatty acid synthase and adipocyte fatty acid-binding protein and the relationship with the clinicopathological characteristics in human infiltrating ductal breast cancer].

    Science.gov (United States)

    Zhou, Lan; Zhao, Yu-hua; Wang, Xiao-dong; Jiang, Su-fang; Li, Hua

    2015-03-01

    To study the expression of fatty acid synthase (FASN) and adipocyte fatty acid-binding protein (A-FABP) in human infiltrating ductal breast cancer (IDC) tissues and hunman breast cancer cells and the relationship with the clinicopathogical characteristics. To further explore the relationship between FASN and A-FABP, and the relevance of the invasion in cancer cell. The expression of FASN and A-FABP was detected in 58 cases of human infiltrating ductal breast cancer and 12 cases of human normal breast tissues by immunohistochemistry technique, calculated positive expression percentage according to the number of positive cells percentage and the staining degree of positive sediment. The cell wound-healing assay was applied to detect the invasion of SKBR3 and MCF-7 cells. Western blot was used to detect the expression of FASN and A-FABP in MCF-7 and SKBR3 cells. The positive rates of FASN and A-FABP were 8.3% (1/12) and 16.7% (1/6) respectively in 12 cases of normal breast tissues by immunohistochemistry. In 58 cases of IDC tissues, the positive rates of FASN and A-FABP were 72.4% (42/58) and 79.3% (46/58) respectively. The differences of the positive rates of FASN and A-FABP in normal breast and IDC tissues were statistically significant (P2 cm) when compared with lymph node metastasis negative group or the diameter SKBR3 was significantly higher than MCF-7 cell at 12, 24 h (PSKBR3 was higher than that in MCF-7. FASN and A-FABP might associated with the lymph node metastasis and tumor size, and there was correlation between FASN and A-FABP in human IDC tissues. FASN may associated with the invasion and metastasis in breast cancer cells.

  10. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues.

    Science.gov (United States)

    Myers, Jennifer S; von Lersner, Ariana K; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  11. Production of 7,8-Dihydroxy Unsaturated Fatty Acids from Plant Oils by Whole Recombinant Cells Expressing 7,8-Linoleate Diol Synthase from Glomerella cingulata.

    Science.gov (United States)

    Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun

    2016-11-16

    The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.

  12. Solution structure of the tandem acyl carrier protein domains from a polyunsaturated fatty acid synthase reveals beads-on-a-string configuration.

    Directory of Open Access Journals (Sweden)

    Uldaeliz Trujillo

    Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of

  13. Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

    KAUST Repository

    Trujillo, Uldaeliz

    2013-02-28

    The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

  14. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    Science.gov (United States)

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-02-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  15. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  16. Sulfur amino acid metabolism in the developing rhesus monkey brain: subcellular studies of the methylation cycle and cystathionine beta-synthase.

    Science.gov (United States)

    Rassin, D K; Sturman, J A; Gaull, G E

    1981-03-01

    The subcellular distributions of the enzymes associated with the methylation and cystathionine-synthesizing portion of the sulfur amino acid metabolic pathway have been determined in the occipital lobe of the rhesus monkey. 5-Methyltetrahydrofolate-homocysteine methyltransferase and 5, 10-methylenetetrahydrofolate reductase activities are located mainly in the soluble compartment. Serine hydroxymethyltransferase activity is located primarily in mitochondria. Cystathionine beta-synthase is a soluble enzyme with a significant component occluded within the nerve endings. Glycine, serine, and cystathionine increase per gram of tissue during development. Glycine and serine are approximately 30% occluded within the nerve endings. These data are consistent with a localization of sulfur amino acid metabolism that supports a differential compartmentation of potential neurotransmitter function and methylation function in the primate.

  17. Ferulic acid and its water-soluble derivatives inhibit nitric oxide production and inducible nitric oxide synthase expression in rat primary astrocytes.

    Science.gov (United States)

    Kikugawa, Masaki; Ida, Tomoaki; Ihara, Hideshi; Sakamoto, Tatsuji

    2017-08-01

    We recently reported that two water-soluble derivatives of ferulic acid (1-feruloyl glycerol, 1-feruloyl diglycerol) previously developed by our group exhibited protective effects against amyloid-β-induced neurodegeneration in vitro and in vivo. In the current study, we aimed to further understand this process by examining the derivatives' ability to suppress abnormal activation of astrocytes, the key event of neurodegeneration. We investigated the effects of ferulic acid (FA) derivatives on nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) expression in rat primary astrocytes. The results showed that these compounds inhibited NO production and iNOS expression in a concentration-dependent manner and that the mechanism underlying these effects was the suppression of the nuclear factor-κB pathway. This evidence suggests that FA and its derivatives may be effective neuroprotective agents and could be useful in the treatment of neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease.

  18. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  19. Structural basis for cyclization specificity of two Azotobacter type III polyketide synthases: a single amino acid substitution reverses their cyclization specificity.

    Science.gov (United States)

    Satou, Ryutaro; Miyanaga, Akimasa; Ozawa, Hiroki; Funa, Nobutaka; Katsuyama, Yohei; Miyazono, Ken-ichi; Tanokura, Masaru; Ohnishi, Yasuo; Horinouchi, Sueharu

    2013-11-22

    Type III polyketide synthases (PKSs) show diverse cyclization specificity. We previously characterized two Azotobacter type III PKSs (ArsB and ArsC) with different cyclization specificity. ArsB and ArsC, which share a high sequence identity (71%), produce alkylresorcinols and alkylpyrones through aldol condensation and lactonization of the same polyketomethylene intermediate, respectively. Here we identified a key amino acid residue for the cyclization specificity of each enzyme by site-directed mutagenesis. Trp-281 of ArsB corresponded to Gly-284 of ArsC in the amino acid sequence alignment. The ArsB W281G mutant synthesized alkylpyrone but not alkylresorcinol. In contrast, the ArsC G284W mutant synthesized alkylresorcinol with a small amount of alkylpyrone. These results indicate that this amino acid residue (Trp-281 of ArsB or Gly-284 of ArsC) should occupy a critical position for the cyclization specificity of each enzyme. We then determined crystal structures of the wild-type and G284W ArsC proteins at resolutions of 1.76 and 1.99 Å, respectively. Comparison of these two ArsC structures indicates that the G284W substitution brings a steric wall to the active site cavity, resulting in a significant reduction of the cavity volume. We postulate that the polyketomethylene intermediate can be folded to a suitable form for aldol condensation only in such a relatively narrow cavity of ArsC G284W (and presumably ArsB). This is the first report on the alteration of cyclization specificity from lactonization to aldol condensation for a type III PKS. The ArsC G284W structure is significant as it is the first reported structure of a microbial resorcinol synthase.

  20. A new amino acid substitution (Ala-205-Phe) in acetolactate synthase (ALS) confers broad spectrum resistance to ALS-inhibiting herbicides.

    Science.gov (United States)

    Brosnan, James T; Vargas, Jose J; Breeden, Gregory K; Grier, Logan; Aponte, Raphael A; Tresch, Stefan; Laforest, Martin

    2016-01-01

    This is a first report of an Ala-205-Phe substitution in acetolactate synthase conferring resistance to imidazolinone, sulfonylurea, triazolopyrimidines, sulfonylamino-carbonyl-triazolinones, and pyrimidinyl (thio) benzoate herbicides. Resistance to acetolactate synthase (ALS) and photosystem II inhibiting herbicides was confirmed in a population of allotetraploid annual bluegrass (Poa annua L.; POAAN-R3) selected from golf course turf in Tennessee. Genetic sequencing revealed that seven of eight POAAN-R3 plants had a point mutation in the psbA gene resulting in a known Ser-264-Gly substitution on the D1 protein. Whole plant testing confirmed that this substitution conferred resistance to simazine in POAAN-R3. Two homeologous forms of the ALS gene (ALSa and ALSb) were detected and expressed in all POAAN-R3 plants sequenced. The seven plants possessing the Ser-264-Gly mutation conferring resistance to simazine also had a homozygous Ala-205-Phe substitution on ALSb, caused by two nucleic acid substitutions in one codon. In vitro ALS activity assays with recombinant protein and whole plant testing confirmed that this Ala-205-Phe substitution conferred resistance to imidazolinone, sulfonylurea, triazolopyrimidines, sulfonylamino-carbonyl- triazolinones, and pyrimidinyl (thio) benzoate herbicides. This is the first report of Ala-205-Phe mutation conferring wide spectrum resistance to ALS inhibiting herbicides.

  1. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros ketoacyl-ACP synthase

    Directory of Open Access Journals (Sweden)

    Huiya eGu

    2016-05-01

    Full Text Available The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis is photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%, with the majority of C14 fatty acids (~2/3 allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes lacking bacteria evolutionary control mechanisms could be used to improve MCFA production in this promising production strains. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to five fold. The level of increase is dependent on promoter strength and culturing conditions.

  2. Quinazoline antifolates inhibiting thymidylate synthase: synthesis of four oligo(L-gamma-glutamyl) conjugates of N10-propargyl-5,8-dideazafolic acid and their enzyme inhibition.

    Science.gov (United States)

    Pawelczak, K; Jones, T R; Kempny, M; Jackman, A L; Newell, D R; Krzyzanowski, L; Rzeszotarska, B

    1989-01-01

    The synthesis is described of four oligo(gamma-glutamyl) conjugates of N10-propargyl-5,8-dideazafolic acid containing a total of two, three, four, and five L-glutamic acid residues. The tert-butyl group was chosen as the carboxyl protecting group in order to obviate the use of alkali and thus the possibility of gamma----alpha transpeptidation. The starting material, di-tert-butyl glutamate, was coupled to N-(benzyloxycarbonyl)-L-glutamic acid alpha-tert-butyl ester via a mixed anhydride with isobutyl chloroformate. Hydrogenolysis of the benzyloxycarbonyl group in the product gave a carboxyl-protected diglutamate, which either was acylated with 4-[(benzyloxycarbonyl)amino] benzoyl chloride to give a protected aminobenzamide or was cycled further by using the above mixed anhydride/hydrogenolysis sequence into tri-, tetra-, and pentaglutamates. Each of the last named was also acylated, as above, to give a benzamide. The benzyloxycarbonyl group in the benzamides was removed by hydrogenolysis and the amino groups thus exposed were N-alkylated with propargyl bromide. The resulting proparglyamines were further alkylated with 2-amino-6-(bromomethyl)-4-hydroxyquinazoline hydrobromide to give the antifolate poly(t-Bu) esters. Deprotection with trifluoroacetic acid in the final step delivered the desired antifolates as their trifluoroacetate salts. The di- to pentaglutamates were, respectively, 31-, 97-, 171-, and 167-fold more inhibitory to WI-L2 human thymidylate synthase than the parent compound.

  3. The Botrytis cinerea phytotoxin botcinic acid requires two polyketide synthases for production and has a redundant role in virulence with botrydial.

    Science.gov (United States)

    Dalmais, Bérengère; Schumacher, Julia; Moraga, Javier; LE Pêcheur, Pascal; Tudzynski, Bettina; Collado, Isidro Gonzalez; Viaud, Muriel

    2011-08-01

    The grey mould fungus Botrytis cinerea produces two major phytotoxins, the sesquiterpene botrydial, for which the biosynthesis gene cluster has been characterized previously, and the polyketide botcinic acid. We have identified two polyketide synthase (PKS) encoding genes, BcPKS6 and BcPKS9, that are up-regulated during tomato leaf infection. Gene inactivation and analysis of the secondary metabolite spectra of several independent mutants demonstrated that both BcPKS6 and BcPKS9 are key enzymes for botcinic acid biosynthesis. We showed that BcPKS6 and BcPKS9 genes, renamed BcBOA6 and BcBO9 (for B. cinerea botcinic acid biosynthesis), are located at different genomic loci, each being adjacent to other putative botcinic acid biosynthetic genes, named BcBOA1 to BcBOA17. Putative orthologues of BcBOA genes are present in the closely related fungus Sclerotinia sclerotiorum, but the cluster organization is not conserved between the two species. As for the botrydial biosynthesis genes, the expression of BcBOA genes is co-regulated by the Gα subunit BCG1 during both in vitro and in planta growth. The loss of botcinic acid production does not affect virulence on bean and tomato leaves. However, double mutants that do not produce botcinic acid or botrydial (bcpks6Δbcbot2Δ) exhibit markedly reduced virulence. Hence, a redundant role of botrydial and botcinic acid in the virulence of B. cinerea has been demonstrated. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd. No Claim to Original US Government Works.

  4. Modulation of fatty acid synthase degradation by concerted action of p38 MAP kinase, E3 ligase COP1, and SH2-tyrosine phosphatase Shp2.

    Science.gov (United States)

    Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng

    2013-02-08

    The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.

  5. Modulation of Fatty Acid Synthase Degradation by Concerted Action of p38 MAP Kinase, E3 Ligase COP1, and SH2-Tyrosine Phosphatase Shp2*

    Science.gov (United States)

    Yu, Jianxiu; Deng, Rong; Zhu, Helen H.; Zhang, Sharon S.; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng

    2013-01-01

    The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism. PMID:23269672

  6. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  7. Inhibition of G-protein-coupled Receptor Kinase 2 Prevents the Dysfunctional Cardiac Substrate Metabolism in Fatty Acid Synthase Transgenic Mice*♦

    Science.gov (United States)

    Abd Alla, Joshua; Graemer, Muriel; Fu, Xuebin; Quitterer, Ursula

    2016-01-01

    Impairment of myocardial fatty acid substrate metabolism is characteristic of late-stage heart failure and has limited treatment options. Here, we investigated whether inhibition of G-protein-coupled receptor kinase 2 (GRK2) could counteract the disturbed substrate metabolism of late-stage heart failure. The heart failure-like substrate metabolism was reproduced in a novel transgenic model of myocardium-specific expression of fatty acid synthase (FASN), the major palmitate-synthesizing enzyme. The increased fatty acid utilization of FASN transgenic neonatal cardiomyocytes rapidly switched to a heart failure phenotype in an adult-like lipogenic milieu. Similarly, adult FASN transgenic mice developed signs of heart failure. The development of disturbed substrate utilization of FASN transgenic cardiomyocytes and signs of heart failure were retarded by the transgenic expression of GRKInh, a peptide inhibitor of GRK2. Cardioprotective GRK2 inhibition required an intact ERK axis, which blunted the induction of cardiotoxic transcripts, in part by enhanced serine 273 phosphorylation of Pparg (peroxisome proliferator-activated receptor γ). Conversely, the dual-specific GRK2 and ERK cascade inhibitor, RKIP (Raf kinase inhibitor protein), triggered dysfunctional cardiomyocyte energetics and the expression of heart failure-promoting Pparg-regulated genes. Thus, GRK2 inhibition is a novel approach that targets the dysfunctional substrate metabolism of the failing heart. PMID:26670611

  8. Inhibition of G-protein-coupled Receptor Kinase 2 Prevents the Dysfunctional Cardiac Substrate Metabolism in Fatty Acid Synthase Transgenic Mice.

    Science.gov (United States)

    Abd Alla, Joshua; Graemer, Muriel; Fu, Xuebin; Quitterer, Ursula

    2016-02-05

    Impairment of myocardial fatty acid substrate metabolism is characteristic of late-stage heart failure and has limited treatment options. Here, we investigated whether inhibition of G-protein-coupled receptor kinase 2 (GRK2) could counteract the disturbed substrate metabolism of late-stage heart failure. The heart failure-like substrate metabolism was reproduced in a novel transgenic model of myocardium-specific expression of fatty acid synthase (FASN), the major palmitate-synthesizing enzyme. The increased fatty acid utilization of FASN transgenic neonatal cardiomyocytes rapidly switched to a heart failure phenotype in an adult-like lipogenic milieu. Similarly, adult FASN transgenic mice developed signs of heart failure. The development of disturbed substrate utilization of FASN transgenic cardiomyocytes and signs of heart failure were retarded by the transgenic expression of GRKInh, a peptide inhibitor of GRK2. Cardioprotective GRK2 inhibition required an intact ERK axis, which blunted the induction of cardiotoxic transcripts, in part by enhanced serine 273 phosphorylation of Pparg (peroxisome proliferator-activated receptor γ). Conversely, the dual-specific GRK2 and ERK cascade inhibitor, RKIP (Raf kinase inhibitor protein), triggered dysfunctional cardiomyocyte energetics and the expression of heart failure-promoting Pparg-regulated genes. Thus, GRK2 inhibition is a novel approach that targets the dysfunctional substrate metabolism of the failing heart. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  10. STRUCTURAL ENZYMOLOGY OF POLYKETIDE SYNTHASES

    OpenAIRE

    Tsai, Shiou-Chuan (Sheryl); Ames, Brian Douglas

    2009-01-01

    This chapter describes structural and associated enzymological studies of polyketide synthases, including isolated single domains and multidomain fragments. The sequence–structure–function relationship of polyketide biosynthesis, compared with homologous fatty acid synthesis, is discussed in detail. Structural enzymology sheds light on sequence and structural motifs that are important for the precise timing, substrate recognition, enzyme catalysis, and protein–protein interactions leading to ...

  11. Effects of rare earth and acid rain pollution on plant chloroplast ATP synthase and element contents at different growth stages.

    Science.gov (United States)

    Zhang, Fan; Hu, Huiqing; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2018-03-01

    Combined rare earth and acid rain pollution has become a new environmental problem, seriously affecting plant survival. The effects of these two kinds of pollutants on plant photosynthesis have been reported, but the micro mechanisms are not very clear. In this research, we studied the effects of lanthanum [La(III), 0.08, 1.20 and 2.40 mM] and acid rain (pH value = 2.5, 3.5 and 4.5) on the ATPase activity and gene transcription level and the functional element contents in rice leaf chloroplasts. The results showed that the combined 0.08 mM La(III) and pH 4.5 acid rain increased the ATPase activity and gene transcription level as well as contents of some functional elements. But other combined treatments of acid rain and La(III) reduced the ATPase activity and gene transcription level as well as functional element contents. The change magnitude of the above indexes at rice booting stage was greater than that in seedling stage or grain filling stage. These results reveal that effects of La(III) and acid rain on ATPase activity and functional element contents in rice leaf chloroplasts are related to the combination of La(III) dose and acid rain intensity and the plant growth stage. In addition, the changes in the ATPase activity were related to ATPase gene transcription level. This study would provide a reference for understanding the microcosmic mechanism of rare earth and acid rain pollution on plant photosynthesis and contribute to evaluate the possible environmental risks associated with combined La(III) and acid rain pollution. The effects of La(III) and acid rain on activity and gene transcription level of rice chloroplast ATPase and contents of functional elements were different at different growth stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. The role of ß-ketoacyl-acyl carrier protein synthase III in the condensation steps of fatty acid biosynthesis in sunflower

    DEFF Research Database (Denmark)

    González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael

    2010-01-01

    seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous......The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...

  13. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

    Science.gov (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

    2015-05-01

    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Saturated free fatty acid sodium palmitate-induced lipoapoptosis by targeting glycogen synthase kinase-3β activation in human liver cells.

    Science.gov (United States)

    Cao, Jie; Feng, Xiao-Xia; Yao, Long; Ning, Bo; Yang, Zhao-Xia; Fang, Dian-Liang; Shen, Wei

    2014-02-01

    Elevated serum saturated fatty acid levels and hepatocyte lipoapoptosis are features of nonalcoholic fatty liver disease (NAFLD). The purpose of this study was to investigate saturated fatty acid induction of lipoapoptosis in human liver cells and the underlying mechanisms. Human liver L02 and HepG2 cells were treated with sodium palmitate, a saturated fatty acid, for up to 48 h with or without lithium chloride, a glycogen synthase kinase-3β (GSK-3β) inhibitor, or GSK-3β shRNA transfection. Transmission electron microscopy was used to detect morphological changes, flow cytometry was used to detect apoptosis, a colorimetric assay was used to detect caspase-3 activity, and western blot analysis was used to detect protein expression. The data showed that sodium palmitate was able to induce lipoapoptosis in L02 and HepG2 cells. Western blot analysis showed that sodium palmitate activated GSK-3β protein, which was indicated by dephosphorylation of GSK-3β at Ser-9. However, inhibition of GSK-3β activity with lithium chloride treatment or knockdown of GSK-3β expression with shRNA suppressed sodium palmitate-induced lipoapoptosis in L02 and HepG2 cells. On a molecular level, inhibition of GSK-3β expression or activity suppressed sodium palmitate-induced c-Jun-N-terminal kinase (JNK) phosphorylation and Bax upregulation, whereas GSK-3β inhibition did not affect endoplasmic reticulum stress-induced activation of unfolded protein response. The present data demonstrated that saturated fatty acid sodium palmitate-induced lipoapoptosis in human liver L02 and HepG2 cells was regulated by GSK-3β activation, which led to JNK activation and Bax upregulation. This finding indicates that GSK-3β inhibition may be a potential therapeutic target to control NAFLD.

  15. Safflor yellow B reduces hypoxia-mediated vasoconstriction by regulating endothelial micro ribonucleic acid/nitric oxide synthase signaling.

    Science.gov (United States)

    Wang, Chaoyun; Yang, Ying; Li, Miao; Liu, Xin; Wang, Qiaoyun; Xin, Wenyu; Sun, Hongliu; Zheng, Qingyin

    2017-11-07

    Hypoxia-induced generation of vasoconstrictors reduces cerebral blood flow (CBF) while nitric oxide (NO) synthase (NOS) and microRNAs (miRNA) in endothelial cells (ECs) suppress vasoconstriction. Safflor yellow B (SYB), a natural plant compound, previously attenuated angiotensin II-mediated injury of ECs and maintained endothelial function. This study investigated the putative involvement of NOS and miRNAs in SYB-mediated resistance to hypoxia-induced vasoconstriction. In vivo , chronic hypoxia was induced in rats, and SYB was administered intravenously. In vitro , rat primary aortic ECs were cultured under oxygen and glucose deprivation. After treatment with anti-microR-199a, as well as the NOS inhibitor, N(G)-nitro-L-arginine methyl ester, SYB, or both, cell viability, NO and peroxynitrite (ONOO-) levels, NOS expression, and miRNA levels were evaluated. SYB significantly alleviated hypoxia-mediated vasoconstriction and increased CBF endothelium-dependently. SYB upregulated miR-199a, increased EC viability, decreased endothelin-1 (ET-1) levels, inhibited protein kinase C (PKC) activity, and suppressed hypoxia inducible factor-1α (HIF-1α) expression. Furthermore, the SYB-mediated reduction of inducible NOS reduced ONOO- levels. In addition, SYB downregulated miR-138 and, thereby, enhanced S100A1 and endothelial NOS activity. Hypoxia-mediated regulation of miR-138 and miR-199a inhibited endothelial NOS expression and activation, which triggered ET-1 release and vasoconstriction. Therefore, SYB treatment reduced hypoxia-induced vasoconstriction through miR-199a/endothelial NOS signaling.

  16. The Formation of Pyrroline and Tetrahydropyridine Rings in Amino Acids Catalyzed by Pyrrolysine Synthase (PylD)

    KAUST Repository

    Quitterer, Felix

    2014-06-10

    The dehydrogenase PylD catalyzes the ultimate step of the pyrrolysine pathway by converting the isopeptide L-lysine-Nε-3R-methyl-D-ornithine to the 22nd proteinogenic amino acid. In this study, we demonstrate how PylD can be harnessed to oxidize various isopeptides to novel amino acids by combining chemical synthesis with enzyme kinetics and X-ray crystallography. The data enable a detailed description of the PylD reaction trajectory for the biosynthesis of pyrroline and tetrahydropyridine rings as constituents of pyrrolysine analogues. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Overexpression of fatty acid synthase in human gliomas correlates with the WHO tumor grade and inhibition with Orlistat reduces cell viability and triggers apoptosis.

    Science.gov (United States)

    Grube, Susanne; Dünisch, Pedro; Freitag, Diana; Klausnitzer, Maren; Sakr, Yasser; Walter, Jan; Kalff, Rolf; Ewald, Christian

    2014-06-01

    Fatty acid synthase (FASN), catalyzing the de novo synthesis of fatty acids, is known to be deregulated in several cancers. Inhibition of this enzyme reduces tumor cell proliferation. Unfortunately, adverse effects and chemical instability prevent the in vivo use of the best-known inhibitors, Cerulenin and C75. Orlistat, a drug used for obesity treatment, is also considered as a potential FASN inhibitor, but its impact on glioma cell biology has not yet been described. In this study, we analyzed FASN expression in human glioma samples and primary glioblastoma cell cultures and the effects of FASN inhibition with Orlistat, Cerulenin and C75. Immunohistochemistry followed by densitometric analysis of 20 glioma samples revealed overexpression of FASN that correlated with the WHO tumor grade. Treatment of glioblastoma cells with these inhibitors resulted in a significant, dose-dependent reduction in tumor cell viability and fatty acid synthesis. Compared to Cerulenin and C75, Orlistat was a more potent inhibitor in cell cultures and cell lines. In LN229, cell-growth was reduced by 63.9 ± 8.7 % after 48 h and 200 µM Orlistat compared to controls; in LT68, the reduction in cell growth was 76.3 ± 23.7 %. Nuclear fragmentation assay and Western blotting analysis after targeting FASN with Orlistat demonstrated autophagy and apoptosis. Organotypic slice cultures treated with Orlistat showed reduced proliferation after Ki67 staining and increased caspase-3 cleavage. Our results suggest that FASN may be a therapeutic target in malignant gliomas and identify Orlistat as a possible anti-tumor drug in this setting.

  18. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

    Science.gov (United States)

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

    2016-10-01

    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. Deregulation of acetohydroxy-acid synthase: loss of allosteric inhibition conferred by mutations in the catalytic subunit

    Czech Academy of Sciences Publication Activity Database

    Kopecký, Jan; Kyselková, Martina; Šigutová, Lucie; Pospíšil, Stanislav; Felsberg, Jürgen; Spížek, Jaroslav; Janata, Jiří

    2008-01-01

    Roč. 53, č. 6 (2008), s. 467-471 ISSN 0015-5632 R&D Projects: GA ČR GA204/01/1001; GA ČR GA204/05/0616 Institutional research plan: CEZ:AV0Z50200510 Keywords : acetohydroxy acid * ilvb genes * sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  20. Fatty acid synthase inhibition by amentoflavone suppresses HER2/neu (erbB2) oncogene in SKBR3 human breast cancer cells.

    Science.gov (United States)

    Lee, Jin Sun; Sul, Ji Young; Park, Jun Beom; Lee, Myung Sun; Cha, Eun Young; Song, In Sang; Kim, Je Ryong; Chang, Eil Sung

    2013-05-01

    Fatty acid synthase (FASN) is a potential therapeutic target for treatment of cancer and obesity, and is highly elevated in 30% of HER2-overexpressing breast cancers. Considerable interest has developed in searching for novel FASN inhibitors as therapeutic agents in treatment of HER2-overexpressing breast cancers. Amentoflavone was found to be effective in suppressing FASN expression in HER2-positive SKBR3 cells. Pharmacological inhibition of FASN by amentoflavone specifically down-regulated HER2 protein and mRNA, and caused an up-regulation of PEA3, a transcriptional repressor of HER2. In addition, pharmacological blockade of FASN by amentoflavone preferentially decreased cell viability and induced cell death in SKBR3 cells. Palmitate reduced the cytotoxic effect of amentoflavone, as the percentage of viable cells was increased after the addition of exogenous palmitate. Amentoflavone-induced FASN inhibition inhibited the translocation of SREBP-1 in SKBR3 cells. Amentoflavone inhibited phosphorylation of AKT, mTOR, and JNK. The use of pharmacological inhibitors revealed that the modulation of AKT, mTOR, and JNK phosphorylation required synergistic amentoflavone-induced FASN inhibition and HER2 activation in SKBR3 cells. These results suggest that amentoflavone modulated FASN expression by regulation of HER2-pathways, and induced cell death to enhance chemopreventive or chemotherapeutic activity in HER2-positive breast cancers. Copyright © 2012 John Wiley & Sons, Ltd.

  1. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    Energy Technology Data Exchange (ETDEWEB)

    Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)

    2009-07-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  2. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    Science.gov (United States)

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  3. The effects of folic acid and nitric oxide synthase inhibition on coronary flow and oxidative stress markers in isolated rat heart.

    Science.gov (United States)

    Djurić, Dragan; Vusanović, Ana; Jakovljević, Vladimir

    2007-06-01

    The aim of this study was to assess the effects of folic acid on coronary flow and oxidative stress markers with or without non-specific inhibition of nitric oxide synthase by L-NAME in isolated rat hearts. The hearts of male Wistar albino rats (n = 12, age 8 weeks, body mass 180-200 g) were retrograde perfused according to the Langendorff technique at gradually increased constant perfusion pressure (40-120 cmH2O). Coronary flow and markers of oxidative stress: nitrite outflow, superoxide anion production, and index of lipid peroxidation (by measuring thiobarbituric acid reactive substances) in coronary effluent were calculated. The experiments were performed during control conditions and in presence of folic acid (100 microM) alone or folic acid (100 microM) plus L-NAME (30 microM). Control values of coronary flow varied in range from 4.37 +/- 0.10 ml/min/g wt at 40 cmH2O to 12.05 +/- 0.42 ml/min/g wt at 120 cmH2O. Nitrite outflow varied from 1.68 +/- 0.17 nmol/min/g wt at 40 cmH2O to 3.56 +/- 0.17 nmol/min/g wt at 120 cmH2O and was parallel with coronary perfusion pressure-coronary flow curve. Folic acid significantly increased coronary flow (40-120 cmH2O, 5.63 +/- 0.10 ml/min/g wt and 15.2 +/- 0.42 ml/min/g wt, respectively) and was accompanied by significant increase in nitrite outflow (2.28 +/- 0.29 nmol/min/g wt at 40 cmH2O to 6.66 +/- 0.50 nmol/min/g wt at 120 cmH2O). In addition, folic acid significantly decreased superoxide anion production especially at upper coronary perfusion pressure values (60% at 120 cmH2O) and increased index of lipid peroxidation (37.16% at 120 cmH2O), respectively. Folic acid plus L-NAME did not change control values of coronary flow significantly. However, folic acid plus L-NAME increased nitrite outflow especially at upper coronary perfusion pressure values (43.05% at 120 cmH2O) and did not change significantly superoxide anion production or index of lipid peroxidation versus control values, respectively. The results clearly

  4. Production of 8,11-dihydroxy and 8-hydroxy unsaturated fatty acids from unsaturated fatty acids by recombinant Escherichia coli expressing 8,11-linoleate diol synthase from Penicillium chrysogenum.

    Science.gov (United States)

    Kim, Min-Ji; Seo, Min-Ju; Shin, Kyung-Chul; Oh, Deok-Kun

    2017-03-01

    Hydroxy unsaturated fatty acids can be used as antimicrobial surfactants. 8,11-Linoleate diol synthase (8,11-LDS) catalyzes the conversion of unsaturated fatty acid to 8-hydroperoxy unsaturated fatty acid, and it is subsequently isomerized to 8,11-dihydroxy unsaturated fatty acid by the enzyme. The optimal reaction conditions of recombinant Escherichia coli expressing Penicillium chrysogenum 8,11-LDS for the production of 8,11-dihydroxy-9,12(Z,Z)-octadecadienoic acid (8,11-DiHODE), 8,11-dihydroxy-9,12,15(Z,Z,Z)-octadecatrienoic acid (8,11-DiHOTrE), 8-hydroxy-9(Z)-hexadecenoic acid (8-HHME), and 8-hydroxy-9(Z)-octadecenoic acid (8-HOME) were pH 7.0, 25°C, 10 g/L linoleic acid, and 20 g/L cells; pH 6.0, 25°C, 6 g/L α-linolenic acid, and 60 g/L cells; pH 7.0, 25°C, 8 g/L palmitoleic acid, and 25 g/L cells; and pH 8.5, 30°C, 6 g/L oleic acid, and 25 g/L cells, respectively. Under these optimized conditions, the recombinant cells produced 6.0 g/L 8,11-DiHODE for 60 min, with a conversion of 60% (w/w) and a productivity of 6.0 g/L/h; 4.3 g/L 8,11-DiHOTrE for 60 min, with a conversion of 72% (w/w) and a productivity of 4.3 g/L/h; 4.3 g/L 8-HHME acid for 60 min, with a conversion of 54% (w/w) and a productivity of 4.3 g/L/h; and 0.9 g/L 8-HOME for 30 min, with a conversion of 15% (w/w) and a productivity of 1.8 g/L/h. To best of our knowledge, this is the first report on the biotechnological production of 8,11-DiHODE, 8,11-DiHOTrE, 8-HHME, and 8-HOME. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:390-396, 2017. © 2017 American Institute of Chemical Engineers.

  5. Involvement of Salicylic Acid on Antioxidant and Anticancer Properties, Anthocyanin Production and Chalcone Synthase Activity in Ginger (Zingiber officinale Roscoe Varieties

    Directory of Open Access Journals (Sweden)

    Ehsan Karimi

    2012-11-01

    Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of

  6. Effect modification by delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase gene polymorphisms on associations between patella lead and renal function in lead workers.

    Science.gov (United States)

    Weaver, Virginia M; Lee, Byung-Kook; Todd, Andrew C; Ahn, Kyu-Dong; Shi, Weiping; Jaar, Bernard G; Kelsey, Karl T; Lustberg, Mark E; Silbergeld, Ellen K; Parsons, Patrick J; Wen, Jiayu; Schwartz, Brian S

    2006-09-01

    Genetic polymorphisms that affect lead toxicokinetics or toxicodynamics may be important modifiers of risk for adverse outcomes in lead-exposed populations. We recently reported associations between higher patella lead, which is hypothesized to represent a lead pool that is both bioavailable and cumulative, and adverse renal outcomes in current and former Korean lead workers. In the present study, we assessed effect modification by polymorphisms in the genes encoding for delta-aminolevulinic acid dehydratase (ALAD), the vitamin D receptor (VDR), and endothelial nitric oxide synthase on those associations. Similar analyses were conducted with three other lead biomarkers. Renal function was assessed via blood urea nitrogen, serum creatinine, measured and calculated creatinine clearances, urinary N-acetyl-beta-D-glucosaminidase, and retinol-binding protein. Mean (SD) blood, patella, tibia, and dimercaptosuccinic acid-chelatable lead values were 30.9 (16.7) microg/dl, 75.1 (101.1)and 33.6 (43.4) microg Pb/g bone mineral, and 0.63 (0.75) microg Pb/mg creatinine, respectively, in 647 lead workers. Little evidence of effect modification by genotype on associations between patella lead and renal outcomes was observed. The VDR polymorphism did modify associations between the other lead biomarkers and the serum creatinine and calculated creatinine clearance. Higher lead dose was associated with worse renal function in participants with the variant B allele. Models in two groups, dichotomized by median age, showed that this effect was present in the younger half of the population. Limited evidence of effect modification by ALAD genotype was observed; higher blood lead levels were associated with higher calculated creatinine clearance among participants with the ALAD(1-2) genotype. In conclusion, VDR and/or ALAD genotypes modified associations between all the lead biomarkers, except patella lead, and the renal outcomes.

  7. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-12-01

    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  8. Detection of superior genotype of fatty acid synthase in Korean native cattle by an environment-adjusted statistical model

    Directory of Open Access Journals (Sweden)

    Jea-Young Lee

    2017-06-01

    Full Text Available Objective This study examines the genetic factors influencing the phenotypes (four economic traits:oleic acid [C18:1], monounsaturated fatty acids, carcass weight, and marbling score of Hanwoo. Methods To enhance the accuracy of the genetic analysis, the study proposes a new statistical model that excludes environmental factors. A statistically adjusted, analysis of covariance model of environmental and genetic factors was developed, and estimated environmental effects (covariate effects of age and effects of calving farms were excluded from the model. Results The accuracy was compared before and after adjustment. The accuracy of the best single nucleotide polymorphism (SNP in C18:1 increased from 60.16% to 74.26%, and that of the two-factor interaction increased from 58.69% to 87.19%. Also, superior SNPs and SNP interactions were identified using the multifactor dimensionality reduction method in Table 1 to 4. Finally, high- and low-risk genotypes were compared based on their mean scores for each trait. Conclusion The proposed method significantly improved the analysis accuracy and identified superior gene-gene interactions and genotypes for each of the four economic traits of Hanwoo.

  9. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  10. Serous tubal intraepithelial carcinoma upregulates markers associated with high-grade serous carcinomas including Rsf-1 (HBXAP), cyclin E and fatty acid synthase.

    Science.gov (United States)

    Sehdev, Ann Smith; Kurman, Robert J; Kuhn, Elisabetta; Shih, Ie-Ming

    2010-06-01

    Serous tubal intraepithelial carcinoma (STIC) has been proposed as a precursor for many pelvic high-grade serous carcinomas. Our previous analysis of the ovarian cancer genome identified several genes with oncogenic potential that are amplified and/or overexpressed in the majority of high-grade serous carcinomas. Determining whether these genes are upregulated in STICs is important in further elucidating the relationship of STICs to high-grade serous carcinomas and is fundamental in understanding the molecular pathogenesis of high-grade serous carcinomas. In this study, 37 morphologically defined STICs were obtained from 23 patients with stage IIIC/IV high-grade serous carcinomas. Both STICs and the high-grade serous carcinomas were analyzed for expression of Rsf-1 (HBXAP), cyclin E, fatty acid synthase (FASN) and mucin-4. In addition, they were examined for expression of established markers including p53, Ki-67 and p16. We found that diffuse nuclear p53 and p16 immunoreactivity was observed in 27 (75%) of 36 and 18 (55%) of 33 STICs, respectively, whereas an elevated Ki-67 labeling index (>or=10%) was detected in 29 (78%) of 37 STICs. Cyclin E nuclear staining was seen in 24 (77%) of 35 STICs, whereas normal tubal epithelial cells were all negative. Increased Rsf-1 and FASN immunoreactivity occurred in 63%, and 62% of STICs, respectively, compared with adjacent normal-appearing tubal epithelium. Interestingly, only one STIC showed increased mucin-4 immunoreactivity. Carcinomas, when compared with STICs, overexpressed p16, Rsf-1, cyclin E and FASN in a higher proportion of cases. In conclusion, STICs express several markers including Rsf-1, cyclin E and FASN in high-grade serous carcinomas. In contrast, mucin-4 immunoreactivity either did not change or was reduced in most STICs. These results suggest that overexpression of Rsf-1, cyclin E and FASN occurs early in tumor progression.

  11. Fetal and neonatal exposure to nicotine leads to augmented hepatic and circulating triglycerides in adult male offspring due to increased expression of fatty acid synthase

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Noelle [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada); Nicholson, Catherine J. [Department of Obstetrics and Gynecology, McMaster University (Canada); Wong, Michael [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada); Holloway, Alison C. [Department of Obstetrics and Gynecology, McMaster University (Canada); Hardy, Daniel B., E-mail: Daniel.Hardy@schulich.uwo.ca [Department of Physiology and Pharmacology, The University of Western Ontario (Canada); Department of Obstetrics and Gynecology, The University of Western Ontario (Canada); The Children' s Health Research Institute, The University of Western Ontario (Canada); The Lawson Health Research Institute, The University of Western Ontario (Canada)

    2014-02-15

    While nicotine replacement therapy is assumed to be a safer alternative to smoking during pregnancy, the long-term consequences for the offspring remain elusive. Animal studies now suggest that maternal nicotine exposure during perinatal life leads to a wide range of adverse outcomes for the offspring including increased adiposity. The focus of this study was to investigate if nicotine exposure during pregnancy and lactation leads to alterations in hepatic triglyceride synthesis. Female Wistar rats were randomly assigned to receive daily subcutaneous injections of saline (vehicle) or nicotine bitartrate (1 mg/kg/day) for two weeks prior to mating until weaning. At postnatal day 180 (PND 180), nicotine exposed offspring exhibited significantly elevated levels of circulating and hepatic triglycerides in the male offspring. This was concomitant with increased expression of fatty acid synthase (FAS), the critical hepatic enzyme in de novo triglyceride synthesis. Given that FAS is regulated by the nuclear receptor Liver X receptor (LXRα), we measured LXRα expression in both control and nicotine-exposed offspring. Nicotine exposure during pregnancy and lactation led to an increase in hepatic LXRα protein expression and enriched binding to the putative LXRE element on the FAS promoter in PND 180 male offspring. This was also associated with significantly enhanced acetylation of histone H3 [K9,14] surrounding the FAS promoter, a hallmark of chromatin activation. Collectively, these findings suggest that nicotine exposure during pregnancy and lactation leads to an increase in circulating and hepatic triglycerides long-term via changes in the transcriptional and epigenetic regulation of the hepatic lipogenic pathway. - Highlights: • Our data reveals the links nicotine exposure in utero and long-term hypertriglyceridemia. • It is due to nicotine-induced augmented expression of hepatic FAS and LXRα activity. • Moreover, this involves nicotine-induced enhanced

  12. Analysis of lysophosphatidic acid (LPA) receptor and LPA-induced endometrial prostaglandin-endoperoxide synthase 2 expression in the porcine uterus.

    Science.gov (United States)

    Seo, Heewon; Kim, Mingoo; Choi, Yohan; Lee, Chang-Kyu; Ka, Hakhyun

    2008-12-01

    Lysophosphatidic acid (LPA), a simple phospholipid-derived mediator with diverse biological actions, acts through the specific G protein-coupled receptors endothelial differentiation gene (EDG) 2, EDG4, EDG7, and GPR23. Recent studies indicate a critical role for LPA receptor signaling in embryo implantation. To understand how LPA acts in the uterus during pregnancy in pigs, we evaluated: 1) spatial and temporal expression of LPA receptors in the uterine endometrium during the estrous cycle and pregnancy and in early-stage concepti, 2) LPA levels in uterine luminal fluids from d 12 of the estrous cycle and pregnancy, 3) effects of steroid hormones on EDG7 mRNA levels, and 4) effects of LPA on prostaglandin-endoperoxide synthase 2 (PTGS2) mRNA levels in the uterine endometrium using explant cultures. Of the four receptors, EDG7 was dominant, and its expression was regulated by pregnancy stage and status. EDG7 expression was highest on d 12 pregnancy, and localized to the luminal and glandular epithelium, and EDG7 mRNA levels were elevated by estrogen in the endometrium. EDG7 expression was also detected in concepti of d 12 and 15. LPA with various fatty acyl groups was present in the uterine lumen on d 12 of both the estrous cycle and pregnancy. LPA increased PTGS2 mRNA abundance in the uterine endometrium. These results indicate that LPA produced in the uterine endometrium may play a critical role in uterine endometrial function and conceptus development through EDG7-mediated PTGS2 expression during implantation and establishment of pregnancy in pigs.

  13. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening.

    Science.gov (United States)

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2012-08-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) catalyzes the rate-limiting step in ethylene biosynthesis during ripening. ACS isozymes are regulated both transcriptionally and post-translationally. However, in banana, an important climacteric fruit, little is known about post-translational regulation of ACS. Here, we report the post-translational modification of MA-ACS1 (Musa acuminata ACS1), a ripening inducible isozyme in the ACS family, which plays a key role in ethylene biosynthesis during banana fruit ripening. Immunoprecipitation analyses of phospholabeled protein extracts from banana fruit using affinity-purified anti-MA-ACS1 antibody have revealed phosphorylation of MA-ACS1, particularly in ripe fruit tissue. We have identified the induction of a 41-kDa protein kinase activity in pulp at the onset of ripening. The 41-kDa protein kinase has been identified as a putative protein kinase by MALDI-TOF/MS analysis. Biochemical analyses using partially purified protein kinase fraction from banana fruit have identified the protein kinase as a Ser/Thr family of protein kinase and its possible involvement in MA-ACS1 phosphorylation during ripening. In vitro phosphorylation analyses using synthetic peptides and site-directed mutagenized recombinant MA-ACS1 have revealed that serine 476 and 479 residues at the C-terminal region of MA-ACS1 are phosphorylated. Overall, this study provides important novel evidence for in vivo phosphorylation of MA-ACS1 at the molecular level as a possible mechanism of post-translational regulation of this key regulatory protein in ethylene signaling pathway in banana fruit during ripening.

  14. Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

    2015-01-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

  15. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    Science.gov (United States)

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  16. Interaction with the small subunit of geranyl diphosphate synthase modifies the chain length specificity of geranylgeranyl diphosphate synthase to produce geranyl diphosphate.

    Science.gov (United States)

    Burke, Charles; Croteau, Rodney

    2002-02-01

    Geranyl diphosphate synthase belongs to a subgroup of prenyltransferases, including farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, that catalyzes the specific formation, from C(5) units, of the respective C(10), C(15), and C(20) precursors of monoterpenes, sesquiterpenes, and diterpenes. Unlike farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, which are homodimers, geranyl diphosphate synthase from Mentha is a heterotetramer in which the large subunit shares functional motifs and a high level of amino acid sequence identity (56-75%) with geranylgeranyl diphosphate synthases of plant origin. The small subunit, however, shares little sequence identity with other isoprenyl diphosphate synthases; yet it is absolutely required for geranyl diphosphate synthase catalysis. Coexpression in Escherichia coli of the Mentha geranyl diphosphate synthase small subunit with the phylogenetically distant geranylgeranyl diphosphate synthases from Taxus canadensis and Abies grandis yielded a functional hybrid heterodimer that generated geranyl diphosphate as product in each case. These results indicate that the geranyl diphosphate synthase small subunit is capable of modifying the chain length specificity of geranylgeranyl diphosphate synthase (but not, apparently, farnesyl diphosphate synthase) to favor the production of C(10) chains. Comparison of the kinetic behavior of the parent prenyltransferases with that of the hybrid enzyme revealed that the hybrid possesses characteristics of both geranyl diphosphate synthase and geranylgeranyl diphosphate synthase.

  17. Fatty acid synthase is a key target in multiple essential tumor functions of prostate cancer: uptake of radiolabeled acetate as a predictor of the targeted therapy outcome.

    Directory of Open Access Journals (Sweden)

    Yukie Yoshii

    Full Text Available Fatty acid synthase (FASN expression is elevated in several cancers, and this over-expression is associated with poor prognosis. Inhibitors of FASN, such as orlistat, reportedly show antitumor effects against cancers that over-express FASN, making FASN a promising therapeutic target. However, large variations in FASN expression levels in individual tumors have been observed, and methods to predict FASN-targeted therapy outcome before treatment are required to avoid unnecessary treatment. In addition, how FASN inhibition affects tumor progression remains unclear. Here, we showed the method to predict FASN-targeted therapy outcome using radiolabeled acetate uptake and presented mechanisms of FASN inhibition with human prostate cancer cell lines, to provide the treatment strategy of FASN-targeted therapy. We revealed that tumor uptake of radiolabeled acetate reflected the FASN expression levels and sensitivity to FASN-targeted therapy with orlistat in vitro and in vivo. FASN-targeted therapy was noticeably effective against tumors with high FASN expression, which was indicated by high acetate uptake. To examine mechanisms, we established FASN knockdown prostate cancer cells by transduction of short-hairpin RNA against FASN and investigated the characteristics by analyses on morphology and cell behavior and microarray-based gene expression profiling. FASN inhibition not only suppressed cell proliferation but prevented pseudopodia formation and suppressed cell adhesion, migration, and invasion. FASN inhibition also suppressed genes involved in production of intracellular second messenger arachidonic acid and androgen hormones, both of which promote tumor progression. Collectively, our data demonstrated that uptake of radiolabeled acetate is a useful predictor of FASN-targeted therapy outcome. This suggests that [1-(11C]acetate positron emission tomography (PET could be a powerful tool to accomplish personalized FASN-targeted therapy by non

  18. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  19. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...

  20. Diterpene resin acid biosynthesis in loblolly pine (Pinus taeda): functional characterization of abietadiene/levopimaradiene synthase (PtTPS-LAS) cDNA and subcellular targeting of PtTPS-LAS and abietadienol/abietadienal oxidase (PtAO, CYP720B1).

    Science.gov (United States)

    Ro, Dae-Kyun; Bohlmann, Jörg

    2006-08-01

    Diterpene resin acids are prominent defense compounds against insect pests and pathogens in conifers. Biochemical and molecular analyses in grand fir (Abies grandis), Norway spruce (Picea abies), and loblolly pine (Pinus taeda) have identified two classes of genes and enzymes that generate much of the structural diversity of terpenoid defense compounds: The terpenoid synthases (TPS) and cytochrome P450 monooxgenases (P450). Using a single substrate, geranylgeranyl diphosphate, families of single-product and multi-product diterpene synthases generate an array of cyclic diterpene olefins. These diterpenes are converted to diterpene resin acids by activity of one or more P450 enzymes. A few conifer diterpene synthases have previously been cloned and characterized in grand fir and in Norway spruce. We have also previously shown that the loblolly pine P450 abietadienol/abietadienal oxidase (PtAO) catalyzes multiple oxidations of several diterpene alcohols and aldehydes. Conifer diterpene synthases are thought to function in plastids while P450s can also be localized to plastids or to the endoplasmic reticulum (ER). Here, we show that a loblolly pine cDNA (PtTPS-LAS) encodes a typical multi-product conifer diterpene synthase that forms levopimaradiene, abietadiene, palustradiene, and neoabietadiene similar to the grand fir abietadiene synthase and Norway spruce levopimaradiene/abietadiene synthase. Subcellular targeting of PtTPS-LAS and PtAO to plastids and ER, respectively, was shown with green fluorescent fusion protein expression in tobacco cells. These data suggest that enzymes for conifer diterpene resin acid biosynthesis are localized to at least two different subcellular compartments, plastids and ER, requiring efficient transport of intermediates and secretion of diterpene resin acids into the extracelluar space.

  1. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  2. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  3. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  4. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  5. Characterization of Enzymes Involved in Fatty Acid Elongation

    Science.gov (United States)

    2007-04-11

    synthases have been studied including the soluble fatty acid synthases , those involved in polyketide synthesis, and the FAE1-like 3-keto-CoA synthases ...condensation, including the soluble fatty acid synthases and the FAE1-like 3-ketoacyl-CoA synthases (FAE-KCSs) possess a catalytic triad of Cys, His...1 Fatty acid synthase required for de novo FA synthesis .................................................. 2 A. Type I FAS

  6. Farnesyl pyrophosphate synthase enantiospecificity with a chiral risedronate analog, [6,7-dihydro-5H-cyclopenta[c]pyridin-7-yl(hydroxy)methylene]bis(phosphonic acid) (NE-10501): Synthetic, structural, and modeling studies

    Energy Technology Data Exchange (ETDEWEB)

    Deprele, Sylvine; Kashemirov, Boris A.; Hogan, James M.; Ebetino, Frank H.; Barnett, Bobby L.; Evdokimov, Artem; McKenna, Charles E. (USC); (UCIN); (PG)

    2008-08-19

    The complex formed from crystallization of human farnesyl pyrophosphate synthase (hFPPS) from a solution of racemic [6,7-dihydro-5H-cyclopenta[c]pyridin-7-yl(hydroxy)methylene]bis(phosphonic acid) (NE-10501, 8), a chiral analog of the anti-osteoporotic drug risedronate, contained the R enantiomer in the enzyme active site. This enantiospecificity was assessed by computer modeling of inhibitor-active site interactions using Autodock 3, which was also evaluated for predictive ability in calculations of the known configurations of risedronate, zoledronate, and minodronate complexed in the active site of hFPPS. In comparison with these structures, the 8 complex exhibited certain differences, including the presence of only one Mg{sup 2+}, which could contribute to its 100-fold higher IC{sub 50}. An improved synthesis of 8 is described, which decreases the number of steps from 12 to 8 and increases the overall yield by 17-fold.

  7. Polyketide synthase from Fusarium

    DEFF Research Database (Denmark)

    Kvesel, Kasper; Wimmer, Reinhard; Sørensen, Jens Laurids

    Fungi produce a wide array of secondary metabolites, with interesting bioactivities by help of a number of enzyme complexes. Polyketide synthases (PKS) are a class of multidomain enzymes, producing a class of secondary metabolites called polyketides1,2. Only few structures of PKS’s have been...

  8. A novel amino acid substitution Trp574Arg in acetolactate synthase (ALS) confers broad resistance to ALS-inhibiting herbicides in crabgrass (Digitaria sanguinalis).

    Science.gov (United States)

    Li, Jian; Li, Mei; Gao, Xingxiang; Fang, Feng

    2017-12-01

    Crabgrass (Digitaria sanguinalis) is an annual monocotyledonous weed. In recent years, field applications of nicosulfuron have been ineffective in controlling crabgrass populations in Shandong Province, China. To investigate the mechanisms of resistance to nicosulfuron in crabgrass populations, the acetolactate synthase (ALS) gene fragment covering known resistance-confering mutation sites was amplified and sequenced. Dose-response experiments suggested that the resistant population SD13 (R) was highly resistant to nicosulfuron (resistance index R/S = 43.7) compared with the sensitive population SD22 (S). ALS gene sequencing revealed a Trp574Arg substitution in the SD13 population, and no other known resistance-conferring mutations were found. In vitro ALS enzyme assays further confirmed that the SD13 population was resistant to all tested ALS-inhibiting herbicides. The resistance pattern experiments revealed that, compared with SD22, the SD13 population exhibited broad-spectrum resistance to nicosulfuron (43.7-fold), imazethapyr (11.4-fold) and flumetsulam (16.1-fold); however, it did not develop resistance to atrazine, mesotrione and topramezone. This study demonstrated that Trp574Arg substitution was the main reason for crabgrass resistance to ALS-inhibiting herbicides. To our knowledge, this is the first report of Trp574Arg substitution in a weed species, and is the first report of target-site mechanisms of herbicide resistance for crabgrass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. Cleaning up polyketide synthases.

    Science.gov (United States)

    Kwan, Jason C; Schmidt, Eric W

    2012-03-23

    Complex biosynthetic enzymes such as polyketide synthases make mistakes. In this issue of Chemistry & Biology, Jensen et al. report that a discrete family of acyltransferases is responsible for error correction, hydrolyzing key biosynthetic intermediates from a multi-enzyme complex. This activity might find use in understanding polyketide biosynthesis, particularly in uncultivated organisms and in tailoring the synthesis of small molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Acetolactate Synthase Activity in Developing Maize (Zea mays L.) Kernels

    Science.gov (United States)

    Muhitch, Michael J.

    1988-01-01

    Acetolactate synthase (EC 4.1.3.18) activity was examined in maize (Zea mays L.) endosperm and embryos as a function of kernel development. When assayed using unpurified homogenates, embryo acetolactate synthase activity appeared less sensitive to inhibition by leucine + valine and by the imidazolinone herbicide imazapyr than endosperm acetolactate synthase activity. Evidence is presented to show that pyruvate decarboxylase contributes to apparent acetolactate synthase activity in crude embryo extracts and a modification of the acetolactate synthase assay is proposed to correct for the presence of pyruvate decarboxylase in unpurified plant homogenates. Endosperm acetolactate synthase activity increased rapidly during early kernel development, reaching a maximum of 3 micromoles acetoin per hour per endosperm at 25 days after pollination. In contrast, embryo activity was low in young kernels and steadily increased throughout development to a maximum activity of 0.24 micromole per hour per embryo by 45 days after pollination. The sensitivity of both endosperm and embryo acetolactate synthase activities to feedback inhibition by leucine + valine did not change during kernel development. The results are compared to those found for other enzymes of nitrogen metabolism and discussed with respect to the potential roles of the embryo and endosperm in providing amino acids for storage protein synthesis. PMID:16665871

  11. Synergism in the effect of prior jasmonic acid application on herbivore-induced volatile emission by Lima bean plants: transcription of a monoterpene synthase gene and volatile emission

    NARCIS (Netherlands)

    Menzel, T.R.; Weldegergis, B.T.; David, A.; Boland, W.; Gols, R.; Loon, van J.J.A.; Dicke, M.

    2014-01-01

    Jasmonic acid (JA) plays a central role in induced plant defence e.g. by regulating the biosynthesis of herbivore-induced plant volatiles that mediate the attraction of natural enemies of herbivores. Moreover, exogenous application of JA can be used to elicit plant defence responses similar to those

  12. [Advances in isoprene synthase research].

    Science.gov (United States)

    Gou, Yan; Liu, Zhongchuan; Wang, Ganggang

    2017-11-25

    Isoprene emission can lead to significant consequence for atmospheric chemistry. In addition, isoprene is a chemical compound for various industrial applications. In the organisms, isoprene is produced by isoprene synthase that eliminates the pyrophosphate from the dimethylallyl diphosphate. As a key enzyme of isoprene formation, isoprene synthase plays an important role in the process of natural emission and artificial synthesis of isoprene. So far, isoprene synthase has been found in various plants. Isoprene synthases from different sources are of conservative structural and similar biochemical properties. In this review, the biochemical and structural characteristics of isoprene synthases from different sources were compared, the catalytic mechanism of isoprene synthase was discussed, and the perspective application of the enzyme in bioengineering was proposed.

  13. Structural and functional characterization of the Helicobacter pylori cytidine 5'-monophosphate-pseudaminic acid synthase PseF: molecular insight into substrate recognition and catalysis mechanism

    Directory of Open Access Journals (Sweden)

    Wahid SUH

    2017-10-01

    Full Text Available Syeda Umme Habiba Wahid Department of Microbiology, University of Chittagong, Chittagong, Bangladesh Abstract: The bacterium Helicobacter pylori is a human gastric pathogen that can cause a wide range of diseases, including chronic gastritis, peptic ulcer and gastric carcinoma. It is classified as a definitive (class I human carcinogen by the International Agency for Research on Cancer. Flagella-mediated motility is essential for H. pylori to initiate colonization and for the development of infection in human beings. Glycosylation of the H. pylori flagellum with pseudaminic acid (Pse; 5,7-diacetamido-3,5,7,9-tetradeoxy-l-glycero-l-manno-nonulosonic acid is essential for flagella assembly and function. The sixth step in the Pse biosynthesis pathway, activation of Pse by addition of a cytidine 5′-monophosphate (CMP to generate CMP-Pse, is catalyzed by a metal-dependent enzyme pseudaminic acid biosynthesis protein F (PseF using cytidine 5′-triphosphate (CTP as a cofactor. No crystal–structural information for PseF is available. This study describes the first three-dimensional model of H. pylori PseF obtained using biocomputational tools. PseF harbors an α/β-type hydrolase fold with a β-hairpin (HP dimerization domain. Comparison of PseF with other structural homologs allowed identification of crucial residues for substrate recognition and the catalytic mechanism. This structural information would pave the way to design novel therapeutics to combat bacterial infection. Keywords: H. pylori, motility, glycosylation, homology modeling, pseudaminic acid

  14. Diverse mechanisms of growth inhibition by luteolin, resveratrol, and quercetin in MIA PaCa-2 cells: a comparative glucose tracer study with the fatty acid synthase inhibitor C75.

    Science.gov (United States)

    Harris, Diane M; Li, Luyi; Chen, Monica; Lagunero, F Tracy; Go, Vay Liang W; Boros, Laszlo G

    2012-04-01

    The rationale of this dose matching/dose escalating study was to compare a panel of flavonoids-luteolin, resveratrol, and quercetin-against the metabolite flux-controlling properties of a synthetic targeted fatty acid synthase inhibitor drug C75 on multiple macromolecule synthesis pathways in pancreatic tumor cells using [1,2-(13)C(2)]-d-glucose as the single precursor metabolic tracer. MIA PaCa-2 pancreatic adenocarcinoma cells were cultured for 48 h in the presence of 0.1% DMSO (control), or 50 or 100 μM of each test compound, while intracellular glycogen, RNA ribose, palmitate and cholesterol as well as extra cellular (13)CO(2), lactate and glutamate production patterns were measured using gas chromatography/mass spectrometry (GC/MS) and stable isotope-based dynamic metabolic profiling (SiDMAP). The use of 50% [1,2-(13)C(2)]-d-glucose as tracer resulted in an average of 24 excess (13)CO(2) molecules for each 1,000 CO(2) molecule in the culture media, which was decreased by 29 and 33% (P tracer glucose-derived (13)C-labeled lactate fractions (Σm) were between 45.52 and 47.49% in all cultures with a molar ratio of 2.47% M + 1/Σm lactate produced indirectly by direct oxidation of glucose in the pentose cycle in control cultures; treatment with 100 μM C75 and luteolin decreased this figure to 1.80 and 1.67%. The tracer glucose-derived (13)C labeled fraction (Σm) of ribonucleotide ribose was 34.73% in controls, which was decreased to 20.58 and 8.45% with C75, 16.15 and 6.86% with luteolin, 27.66 and 19.25% with resveratrol, and 30.09 and 25.67% with quercetin, respectively. Luteolin effectively decreased nucleotide precursor synthesis pentose cycle flux primarily via the oxidative branch, where we observed a 41.74% flux (M + 1/Σm) in control cells, in comparison with only a 37.19%, 32.74%, or a 26.57%, 25.47% M + 1/Σm flux (P tracer glucose-derived (13)C-labeled fractions, respectively. On the other hand there was a significant 192 and 159% (P tracer glucose

  15. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    Science.gov (United States)

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  16. β-N-Oxalyl-l-α,β-diaminopropionic Acid (β-ODAP Content in Lathyrus sativus: The Integration of Nitrogen and Sulfur Metabolism through β-Cyanoalanine Synthase

    Directory of Open Access Journals (Sweden)

    Quanle Xu

    2017-02-01

    Full Text Available Grass pea (Lathyrus sativus L. is an important legume crop grown mainly in South Asia and Sub-Saharan Africa. This underutilized legume can withstand harsh environmental conditions including drought and flooding. During drought-induced famines, this protein-rich legume serves as a food source for poor farmers when other crops fail under harsh environmental conditions; however, its use is limited because of the presence of an endogenous neurotoxic nonprotein amino acid β-N-oxalyl-l-α,β-diaminopropionic acid (β-ODAP. Long-term consumption of Lathyrus and β-ODAP is linked to lathyrism, which is a degenerative motor neuron syndrome. Pharmacological studies indicate that nutritional deficiencies in methionine and cysteine may aggravate the neurotoxicity of β-ODAP. The biosynthetic pathway leading to the production of β-ODAP is poorly understood, but is linked to sulfur metabolism. To date, only a limited number of studies have been conducted in grass pea on the sulfur assimilatory enzymes and how these enzymes regulate the biosynthesis of β-ODAP. Here, we review the current knowledge on the role of sulfur metabolism in grass pea and its contribution to β-ODAP biosynthesis. Unraveling the fundamental steps and regulation of β-ODAP biosynthesis in grass pea will be vital for the development of improved varieties of this underutilized legume.

  17. β-N-Oxalyl-l-α,β-diaminopropionic Acid (β-ODAP) Content in Lathyrus sativus: The Integration of Nitrogen and Sulfur Metabolism through β-Cyanoalanine Synthase.

    Science.gov (United States)

    Xu, Quanle; Liu, Fengjuan; Chen, Peng; Jez, Joseph M; Krishnan, Hari B

    2017-02-28

    Grass pea ( Lathyrus sativus L.) is an important legume crop grown mainly in South Asia and Sub-Saharan Africa. This underutilized legume can withstand harsh environmental conditions including drought and flooding. During drought-induced famines, this protein-rich legume serves as a food source for poor farmers when other crops fail under harsh environmental conditions; however, its use is limited because of the presence of an endogenous neurotoxic nonprotein amino acid β- N -oxalyl-l-α,β-diaminopropionic acid (β-ODAP). Long-term consumption of Lathyrus and β-ODAP is linked to lathyrism, which is a degenerative motor neuron syndrome. Pharmacological studies indicate that nutritional deficiencies in methionine and cysteine may aggravate the neurotoxicity of β-ODAP. The biosynthetic pathway leading to the production of β-ODAP is poorly understood, but is linked to sulfur metabolism. To date, only a limited number of studies have been conducted in grass pea on the sulfur assimilatory enzymes and how these enzymes regulate the biosynthesis of β-ODAP. Here, we review the current knowledge on the role of sulfur metabolism in grass pea and its contribution to β-ODAP biosynthesis. Unraveling the fundamental steps and regulation of β-ODAP biosynthesis in grass pea will be vital for the development of improved varieties of this underutilized legume.

  18. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  19. Use of linalool synthase in genetic engineering of scent production

    Energy Technology Data Exchange (ETDEWEB)

    Pichersky, E.

    1998-12-15

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed. 5 figs.

  20. Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1999-01-01

    ) required inorganic phosphate for activity, whereas the others were phosphate independent. PRPP synthase isozymes 2 and 3 contained 76 and 87 amino acid extensions, respectively, at their N-terminal ends in comparison with other PRPP synthases. Isozyme 2 was synthesized in vitro and shown to be imported...

  1. Non-enzymatic modifications of prostaglandin H synthase 1 affect bifunctional enzyme activity - Implications for the sensitivity of blood platelets to acetylsalicylic acid.

    Science.gov (United States)

    Kassassir, Hassan; Siewiera, Karolina; Talar, Marcin; Stec-Martyna, Emilia; Pawlowska, Zofia; Watala, Cezary

    2016-06-25

    Due to its ability to inhibit the blood platelet PGHS-1, acetylsalicylic acid (ASA, Aspirin(®)) is widely used as a preventive agent in atherothrombotic diseases. However, its beneficial effects seem to be lower in diabetic patients, suggesting that protein glycation may impair effective ASA-mediated acetylation process. On the other hand, it is proposed that ASA can prevent some of the late complications of diabetes by lowering the extent of glycation at protein free amino groups. The aim of this work was to evaluate the extents of non-enzymatic N-glycosylation (glycation) and acetylation of blood platelet PGHS-1 (COX-1) and the competition between glycation and acetylation was investigated in order to demonstrate how these two reactions may compete against platelet PGHS-1. When PGHS-1 was incubated with glycating/acetylating agents (glucose, Glu; 1,6-bisphosphofructose, 1,6-BPF; methylglyoxal, MGO, acetylsalicylic acid, ASA), the enzyme was modified in 13.4 ± 1.6, 5.3 ± 0.5, 10.7 ± 1.2 and 6.4 ± 1.1 mol/mol protein, respectively, and its activity was significantly reduced. The prior glycation/carbonylation of PGHS-1 with Glu, 1,6-BPF or MGO decreased the extent of acetylation from 6.4 ± 1.1 down to 2.5 ± 0.2, 3.6 ± 0.3 and 5.2 ± 0.2 mol/mol protein, respectively, but the enzyme still remained susceptible to the subsequent inhibition of its activity with ASA. When PGHS-1 was first acetylated with ASA and then incubated with glycating/carbonylating agents, we observed the following reductions in the enzyme modifications: from 13.4 ± 1.6 to 8.7 ± 0.6 mol/mol protein for Glu, from 5.3 ± 0.5 to 3.9 ± 0.3 mol/mol protein for 1,6-BPF and from 10.7 ± 1.2 to 7.5 ± 0.5 mol/mol protein for MGO, however subsequent glycation/carbonylation did not significantly affect PGHS-1 function. Overall, our outcomes allow to better understand the structural aspects of the chemical competition between glycation and acetylation of PGHS-1

  2. A Therapeutic Connection between Dietary Phytochemicals and ATP Synthase.

    Science.gov (United States)

    Ahmad, Zulfiqar; Hassan, Sherif S; Azim, Sofiya

    2017-11-20

    For centuries, phytochemicals have been used to prevent and cure multiple health ailments. Phytochemicals have been reported to have antioxidant, antidiabetic, antitussive, antiparasitic, anticancer, and antimicrobial properties. Generally, the therapeutic use of phytochemicals is based on tradition or word of mouth with few evidence-based studies. Moreover, molecular level interactions or molecular targets for the majority of phytochemicals are unknown. In recent years, antibiotic resistance by microbes has become a major healthcare concern. As such, the use of phytochemicals with antimicrobial properties has become pertinent. Natural compounds from plants, vegetables, herbs, and spices with strong antimicrobial properties present an excellent opportunity for preventing and combating antibiotic resistant microbial infections. ATP synthase is the fundamental means of cellular energy. Inhibition of ATP synthase may deprive cells of required energy leading to cell death, and a variety of dietary phytochemicals are known to inhibit ATP synthase. Structural modifications of phytochemicals have been shown to increase the inhibitory potency and extent of inhibition. Sitedirected mutagenic analysis has elucidated the binding site(s) for some phytochemicals on ATP synthase. Amino acid variations in and around the phytochemical binding sites can result in selective binding and inhibition of microbial ATP synthase. In this review, the therapeutic connection between dietary phytochemicals and ATP synthase is summarized based on the inhibition of ATP synthase by dietary phytochemicals. Research suggests selective targeting of ATP synthase is a valuable alternative molecular level approach to combat antibiotic resistant microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Reconstitution of T Cell Proliferation under Arginine Limitation: Activated Human T Cells Take Up Citrulline via L-Type Amino Acid Transporter 1 and Use It to Regenerate Arginine after Induction of Argininosuccinate Synthase Expression

    Directory of Open Access Journals (Sweden)

    Anke Werner

    2017-07-01

    Full Text Available In the tumor microenvironment, arginine is metabolized by arginase-expressing myeloid cells. This arginine depletion profoundly inhibits T cell functions and is crucially involved in tumor-induced immunosuppression. Reconstitution of adaptive immune functions in the context of arginase-mediated tumor immune escape is a promising therapeutic strategy to boost the immunological antitumor response. Arginine can be recycled in certain mammalian tissues from citrulline via argininosuccinate (ASA in a two-step enzymatic process involving the enzymes argininosuccinate synthase (ASS and argininosuccinate lyase (ASL. Here, we demonstrate that anti-CD3/anti-CD28-activated human primary CD4+ and CD8+ T cells upregulate ASS expression in response to low extracellular arginine concentrations, while ASL is expressed constitutively. ASS expression peaked under moderate arginine restriction (20 µM, but no relevant induction was detectable in the complete absence of extracellular arginine. The upregulated ASS correlated with a reconstitution of T cell proliferation upon supplementation of citrulline, while the suppressed production of IFN-γ was refractory to citrulline substitution. In contrast, ASA reconstituted proliferation and cytokine synthesis even in the complete absence of arginine. By direct quantification of intracellular metabolites we show that activated primary human T cells import citrulline but only metabolize it further to ASA and arginine when ASS is expressed in the context of low amounts of extracellular arginine. We then clarify that citrulline transport is largely mediated by the L-type amino acid transporter 1 (LAT1, induced upon human T cell activation. Upon siRNA-mediated knockdown of LAT1, activated T cells lost the ability to import citrulline. These data underline the potential of citrulline substitution as a promising pharmacological way to treat immunosuppression in settings of arginine deprivation.

  4. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    Directory of Open Access Journals (Sweden)

    Kamran Jawed

    Full Text Available Short-chain fatty acids (SCFAs, such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product.

  5. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  6. Environmental DNA-encoded antibiotics fasamycins A and B inhibit FabF in type II fatty acid biosynthesis.

    Science.gov (United States)

    Feng, Zhiyang; Chakraborty, Debjani; Dewell, Scott B; Reddy, Boojala Vijay B; Brady, Sean F

    2012-02-15

    In a recent study of polyketide biosynthetic gene clusters cloned directly from soil, we isolated two antibiotics, fasamycins A and B, which showed activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. To identify the target of the fasamycins, mutants with elevated fasamycin A minimum inhibitory concentrations were selected from a wild-type culture of E. faecalis OG1RF. Next-generation sequencing of these mutants, in conjunction with in vitro biochemical assays, showed that the fasamycins inhibit FabF of type II fatty acid biosynthesis (FASII). Candidate gene overexpression studies also showed that fasamycin resistance is conferred by fabF overexpression. On the basis of comparisons with known FASII inhibitors and in silico docking studies, the chloro-gem-dimethyl-anthracenone substructure seen in the fasamycins is predicted to represent a naturally occurring FabF-specific antibiotic pharmacophore. Optimization of this pharmacophore should yield FabF-specific antibiotics with increased potencies and differing spectra of activity. This study demonstrates that culture-independent antibiotic discovery methods have the potential to provide access to novel metabolites with modes of action that differ from those of antibiotics currently in clinical use.

  7. Functional plasticity of paralogous diterpene synthases involved in conifer defense.

    Science.gov (United States)

    Keeling, Christopher I; Weisshaar, Sabrina; Lin, Roy P C; Bohlmann, Jörg

    2008-01-22

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant-herbivore, plant-pollinator, and plant-pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin acids found in the defensive oleoresin of conifers. Although these paralogous enzymes are 91% identical at the amino acid level, one is a single-product enzyme, whereas the other is a multiproduct enzyme that forms completely different products. We used a rational approach of homology modeling, protein sequence comparison, domain swapping, and a series of reciprocal site-directed mutagenesis to identify the specific residues that direct the different product outcomes. A one-amino acid mutation switched the levopimaradiene/abietadiene synthase into producing isopimaradiene and sandaracopimaradiene and none of its normal products. Four mutations were sufficient to reciprocally reverse the product profiles for both of these paralogous enzymes while maintaining catalytic efficiencies similar to the wild-type enzymes. This study illustrates how neofunctionalization can result from relatively minor changes in protein sequence, increasing the diversity of secondary metabolites important for conifer defense.

  8. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  9. Pharmacological blockade of fatty acid synthase (FASN) reverses acquired autoresistance to trastuzumab (Herceptin by transcriptionally inhibiting 'HER2 super-expression' occurring in high-dose trastuzumab-conditioned SKBR3/Tzb100 breast cancer cells.

    Science.gov (United States)

    Vazquez-Martin, Alejandro; Colomer, Ramon; Brunet, Joan; Menendez, Javier A

    2007-10-01

    Elucidating the mechanisms underlying resistance to the human epidermal growth factor receptor 2 (HER2)-targeted antibody trastuzumab (Tzb; Herceptin) is a major challenge that is beginning to be addressed. This dilemma is becoming increasingly important as recent studies strongly support a role for Tzb in the adjuvant setting for HER2-overexpressing early-stage breast cancers. We previously reported that pharmacological and RNA interference-induced inhibition of tumor-associated fatty acid synthase (FASN; Oncogenic antigen-519), a key metabolic enzyme catalyzing the synthesis of long-chain saturated fatty acids, drastically down-regulates HER2 expression in human breast cancer cells bearing HER2 gene amplification. Given that FASN blockade was found to suppress HER2 overexpression by attenuating the promoter activity of the HER2 gene, we here envisioned that this mechanism of action may represent a valuable strategy in breast cancers that have progressed while under Tzb. We created a preclinical model of Tzb resistance by continuously growing HER2-overexpressing SKBR3 breast cancer cells in the presence of clinically relevant concentrations of Tzb (20-185 microg/ml Tzb). This pool of Tzb-conditioned SKBR3 cells, which optimally grows now in the presence of 100 microg/ml trastuzumab (SKBR3/Tzb100 cells), exhibited HER2 levels notably higher (approximately 2-fold) than those found in SKBR3 parental cells. Real-time polymerase chain reaction studies showed that up-regulation of HER2 mRNA levels closely correlated with HER2 protein up-regulation in SKBR3/Tzb100 cells, thus suggesting that 'HER2 super-expression' upon acquisition of autoresistance to Tzb resulted, at least in part, from up-regulatory effects in the transcriptional rate of the HER2 gene. SKBR3/Tzb100 cells did not exhibit cross-resistance to C75, a small-compound specifically inhibiting FASN activity. On the contrary, SKBR3/Tzb100 cells showed a remarkably increased sensitivity (approximately 3-fold) to

  10. Uncovering the structures of modular polyketide synthases.

    Science.gov (United States)

    Weissman, Kira J

    2015-03-01

    The modular polyketide synthases (PKSs) are multienzyme proteins responsible for the assembly of diverse secondary metabolites of high economic and therapeutic importance. These molecular 'assembly lines' consist of repeated functional units called 'modules' organized into gigantic polypeptides. For several decades, concerted efforts have been made to understand in detail the structure and function of PKSs in order to facilitate genetic engineering of the systems towards the production of polyketide analogues for evaluation as drug leads. Despite this intense activity, it has not yet been possible to solve the crystal structure of a single module, let alone a multimodular subunit. Nonetheless, on the basis of analysis of the structures of modular fragments and the study of the related multienzyme of animal fatty acid synthase (FAS), several models of modular PKS architecture have been proposed. This year, however, the situation has changed - three modular structures have been characterized, not by X-ray crystallography, but by the complementary methods of single-particle cryo-electron microscopy and small-angle X-ray scattering. This review aims to compare the cryo-EM structures and SAXS-derived structural models, and to interpret them in the context of previously obtained data and existing architectural proposals. The consequences for genetic engineering of the systems will also be discussed, as well as unresolved questions and future directions.

  11. Identification and characterization of a chondroitin synthase from Avibacterium paragallinarum.

    Science.gov (United States)

    Wang, Ting-Ting; Zhu, Chen-Ye; Zheng, Shuang; Meng, Cai-Cai; Wang, Tian-Tian; Meng, Dan-Hua; Li, Yi-Jun; Zhu, Hao-Miao; Wang, Feng-Shan; Sheng, Ju-Zheng

    2018-04-03

    Avibacterium paragallinarum is a Gram-negative bacterium that causes infectious coryza in chicken. It was reported that the capsule polysaccharides extracted from Av. paragallinarum genotype A contained chondroitin. Chondroitin synthase of Av. paragallinarum (ApCS) encoded by one gene within the presumed capsule biosynthesis gene cluster exhibited considerable homology to identified bacterial chondroitin synthases. Herein, we report the identification and characterization of ApCS. This enzyme indeed displays chondroitin synthase activity involved in the biosynthesis of the capsule. ApCS is a bifunctional protein catalyzing the elongation of the chondroitin chain by alternatively transferring the glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc) residues from their nucleotide forms to the non-reducing ends of the saccharide chains. GlcA with a para-nitrophenyl group (pNP) could serve as the acceptor for ApCS; this enzyme shows a stringent donor tolerance when the acceptor is as small as this monosaccharide. Then, UDP-GalNAc and GlcA-pNP were injected sequentially through the chip-immobilized chondroitin synthases, and the surface plasmon resonance data demonstrated that the up-regulated extent caused by the binding of the donor is one possibly essential factor in successful polymerization reaction. This conclusion will, therefore, enhance the understanding of the mode of action of glycosyltransferase. Surprisingly, high activity at near-zero temperature as well as weak temperature dependence of this novel bacterial chondroitin synthase indicate that ApCS was a cold-active enzyme. From all accounts, ApCS becomes the fourth known bacterial chondroitin synthase, and the potential applications in artificial chondroitin sulfate and glycosaminoglycan synthetic approaches make it an attractive glycosyltransferase for further investigation.

  12. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...

  13. Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.

    1999-01-01

    cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison...

  14. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. cDNA isolation, functional expression, and characterization of (+)-alpha-pinene synthase and (-)-alpha-pinene synthase from loblolly pine (Pinus taeda): stereocontrol in pinene biosynthesis.

    Science.gov (United States)

    Phillips, Michael A; Wildung, Mark R; Williams, David C; Hyatt, David C; Croteau, Rodney

    2003-03-15

    The complex mixture of monoterpenes, sesquiterpenes, and diterpenes that comprises oleoresin provides the primary defense of conifers against bark beetles and their associated fungal pathogens. Monoterpene synthases produce the turpentine fraction of oleoresin, which allows mobilization of the diterpene resin acid component (rosin) and is also toxic toward invading insects; this is particularly the case for alpha-pinene, a prominent bicyclic monoterpene of pine turpentine. The stereochemistry of alpha-pinene is a critical determinant of host defense capability and has implications for host selection, insect pheromone biosynthesis, and tritrophic-level interactions. Pines produce both enantiomers of alpha-pinene, which appear to arise through antipodal reaction mechanisms by distinct enzymes. Using a cDNA library constructed with mRNA from flushing needles of loblolly pine (Pinus taeda), we employed a homology-based cloning strategy to isolate, and confirm by functional expression, the genes encoding (+)-(3R:5R)-alpha-pinene synthase, (-)-(3S:5S)-alpha-pinene synthase, and several other terpene synthases. The pinene synthases, which produce mirror-image products, share only 66% amino acid identity (72% similarity) but are similar in general properties to other monoterpene synthases of gymnosperms. The stereochemical control of monoterpene cyclization reactions, the evolution of "antipodal" enzymes, and the implications of turpentine composition in ecological interactions are discussed.

  16. Dihydrodipicolinate synthase in opaque and floury maize mutants

    NARCIS (Netherlands)

    Varisi, V.A.; Medici, L.O.; Meer, van der I.M.; Lea, P.J.; Azevedo, J.L.

    2007-01-01

    Dihydrodipicolinate synthase (DHDPS, EC 4.2.1.52) was isolated and studied in four high-lysine maize mutants (Oh43o1, Oh43o2, Oh43fl1 and Oh43fl2). The activity of DHDPS was analyzed at 16, 20, and 24 DAP and characterized in the presence of the amino acids, lysine, S-(2-aminoethyl)-l-cysteine

  17. A domain swapping approach to elucidate differential regiospecific hydroxylation by geraniol and linalool synthases from perilla.

    Science.gov (United States)

    Sato-Masumoto, Naoko; Ito, Michiho

    2014-06-01

    Geraniol and linalool are acyclic monoterpenes found in plant essential oils that have attracted much attention for their commercial use and in pharmaceutical studies. They are synthesized from geranyl diphosphate (GDP) by geraniol and linalool synthases, respectively. Both synthases are very similar at the amino acid level and share the same substrate; however, the position of the GDP to which they introduce hydroxyl groups is different. In this study, the mechanisms underlying the regiospecific hydroxylation of geraniol and linalool synthases were investigated using a domain swapping approach and site-directed mutagenesis in perilla. Sequences of the synthases were divided into ten domains (domains I to IV-4), and each corresponding domain was exchanged between both enzymes. It was shown that different regions were important for the formation of geraniol and linalool, namely, domains IV-1 and -4 for geraniol, and domains III-b, III-d, and IV-4 for linalool. These results suggested that the conformation of carbocation intermediates and their electron localization were seemingly to be different between geraniol and linalool synthases. Further, five amino acids in domain IV-4 were apparently indispensable for the formation of geraniol and linalool. According to three-dimensional structural models of the synthases, these five residues seemed to be responsible for the different spatial arrangement of the amino acid at H524 in the case of geraniol synthase, while N526 is the corresponding residue in linalool synthase. These results suggested that the side-chains of these five amino acids, in combination with several relevant domains, localized the positive charge in the carbocation intermediate to determine the position of the introduced hydroxyl group. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  19. Radiolabeling of a wound-inducible pyridoxal phosphate utilizing protein from tomato: evidence for its identification as ACC synthase

    International Nuclear Information System (INIS)

    Privalle, L.S.; Graham, J.S.; Caughey, P.A.

    1986-01-01

    Aminocyclopropane 1-carboxylic acid (ACC) synthase, a pyridoxal phosphate utilizing enzyme, catalyzes the conversion of S-adenosylmethionine to ACC, the rate limiting step in the biosynthesis of the plant hormone, ethylene. Ethylene, besides being involved in normal plant growth processes, is also produced in response to stress, e.g. wounding, pathogen infection, etc. The authors report the partial purification (400 fold) of ACC synthase from wounded pink tomato pericarp by classical techniques including ammonium sulfate precipitation, ion exchange and phenyl sepharose chromatography. Further purification results in a decrease in specific activity apparently due to the instability of the enzyme and the low levels present in plant tissue. Radiolabeling of a pyridoxal phosphate-utilizing protein in the ACC synthase enriched fraction was achieved. Evidence that this radiolabeled protein is ACC synthase will be presented. Amino acid sequence determination of putative ACC synthase-derived peptides is underway

  20. Understanding plant cellulose synthases through a comprehensive investigation of the cellulose synthase family sequences.

    Directory of Open Access Journals (Sweden)

    Andrew eCarroll

    2011-03-01

    Full Text Available The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized subfamilies and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair cellulose synthase function, and compare these sites to those observed in the closest cellulose synthase-like (Csl families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  1. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Khatkar, Anurag; Sharma, Sunil

    2018-03-29

    affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  3. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  4. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  5. Transcriptional regulation of mitochondrial HMG-CoA synthase in the control of ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1998-10-01

    Mitochondrial and cytosolic HMG-CoA synthases are encoded by two different genes. Control of ketogenesis is exerted by transcriptional regulation of mitochondrial HMG-CoA synthase. Fasting, cAMP, and fatty acids increase its transcriptional rate, while refeeding and insulin repress it. Fatty acids increase transcription through peroxisomal proliferator regulatory element (PPRE), to which peroxisome proliferator activated receptor (PPAR) can bind. Other transcription factors such as chicken ovalbumin upstream promoter transcription factor (COUP-TF) and hepatocyte nuclear factor 4 (HNF-4) compete for the PPRE site, modulating the response of PPAR.

  6. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  7. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  8. Mechanism of Germacradien-4-ol Synthase-Controlled Water Capture

    Science.gov (United States)

    2016-01-01

    The sesquiterpene synthase germacradiene-4-ol synthase (GdolS) from Streptomyces citricolor is one of only a few known high-fidelity terpene synthases that convert farnesyl diphosphate (FDP) into a single hydroxylated product. Crystals of unliganded GdolS-E248A diffracted to 1.50 Å and revealed a typical class 1 sesquiterpene synthase fold with the active site in an open conformation. The metal binding motifs were identified as D80DQFD and N218DVRSFAQE. Some bound water molecules were evident in the X-ray crystal structure, but none were obviously positioned to quench a putative final carbocation intermediate. Incubations in H218O generated labeled product, confirming that the alcohol functionality arises from nucleophilic capture of the final carbocation by water originating from solution. Site-directed mutagenesis of amino acid residues from both within the metal binding motifs and without identified by sequence alignment with aristolochene synthase from Aspergillus terreus generated mostly functional germacradien-4-ol synthases. Only GdolS-N218Q generated radically different products (∼50% germacrene A), but no direct evidence of the mechanism of incorporation of water into the active site was obtained. Fluorinated FDP analogues 2F-FDP and 15,15,15-F3-FDP were potent noncompetitive inhibitors of GdolS. 12,13-DiF-FDP generated 12,13-(E)-β-farnesene upon being incubated with GdolS, suggesting stepwise formation of the germacryl cation during the catalytic cycle. Incubation of GdolS with [1-2H2]FDP and (R)-[1-2H]FDP demonstrated that following germacryl cation formation a [1,3]-hydride shift generates the final carbocation prior to nucleophilic capture. The stereochemistry of this shift is not defined, and the deuteron in the final product was scrambled. Because no clear candidate residue for binding of a nucleophilic water molecule in the active site and no significant perturbation of product distribution from the replacement of active site residues were

  9. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  10. Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.

    1999-01-01

    cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison...

  11. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  12. Analysis of the Thiocapsa pfennigii polyhydroxyalkanoate synthase: subcloning, molecular characterization and generation of hybrid synthases with the corresponding Chromatium vinosum enzyme.

    Science.gov (United States)

    Liebergesell, M; Rahalkar, S; Steinbüchel, A

    2000-08-01

    The PHA synthase structural gene of Thiocapsa pfennigii was identified and subcloned on a 2.8-kbp BamHI restriction fragment, which was cloned recently from a genomic 15.6-kbp EcoRI restriction fragment. Nucleotide sequence analysis of this fragment revealed three open reading frames (ORFs), representing coding regions. Two ORFs encoded for the PhaE (Mr 40,950) and PhaC (Mr 40,190) subunits of the PHA synthase from T. pfennigii and exhibited high homology with the corresponding proteins of the Chromatium vinosum (52.8% and 85.2% amino acid identity) and the Thiocystis violacea (52.5% and 82.4%) PHA synthases, respectively. This confirmed that the T. pfennigii PHA synthase was composed of two different subunits. Also, with respect to the molecular organization of phaE and phaC, this region of the T. pfennigii genome resembled very much the corresponding regions of C. vinosum and of Thiocystis violacea. A recombinant strain of Pseudomonas putida, which overexpressed phaE and phaC from T. pfennigii, was used to isolate the PHA synthase by a two-step procedure including chromatography on Procion Blue H-ERD and hydroxyapatite. The isolated PHA synthase consisted of two proteins exhibiting the molecular weights predicted for PhaE and PhaC. Hybrid PHA synthases composed of PhaE from T. pfennigii and PhaC from C. vinosum and vice versa were constructed and functionally expressed in a PHA-negative mutant of P. putida; and the resulting PHAs were analyzed.

  13. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  14. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  15. Functional identification of valerena-1,10-diene synthase, a terpene synthase catalyzing a unique chemical cascade in the biosynthesis of biologically active sesquiterpenes in Valeriana officinalis.

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S Eric; Chittiboyina, Amar G; Weerasooriya, Aruna D; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A; Coates, Robert M; Watt, David S; Chappell, Joe

    2013-02-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [(13)C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes.

  16. Functional Identification of Valerena-1,10-diene Synthase, a Terpene Synthase Catalyzing a Unique Chemical Cascade in the Biosynthesis of Biologically Active Sesquiterpenes in Valeriana officinalis*

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S. Eric; Chittiboyina, Amar G.; Weerasooriya, Aruna D.; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C. Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A. Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A.; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A.; Coates, Robert M.; Watt, David S.; Chappell, Joe

    2013-01-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [13C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes. PMID:23243312

  17. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  18. Understanding Plant Cellulose Synthases through a Comprehensive Investigation of the Cellulose Synthase Family Sequences.

    Science.gov (United States)

    Carroll, Andrew; Specht, Chelsea D

    2011-01-01

    The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA) family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized clades and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair CesA function, and compare these sites to those observed in the closest cellulose synthase-like (Csl) families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  19. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    Science.gov (United States)

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS), and we show that these are active biocatalysts for monoterpene production using biocatalysis and metabolic engineering platforms. In metabolically engineered monoterpene-producing E. coli strains, use of bLinS leads to 300-fold higher linalool production compared with the corresponding plant monoterpene synthase. With bCinS, 1,8-cineole is produced with 96% purity compared to 67% from plant species. Structures of bLinS and bCinS, and their complexes with fluorinated substrate analogues, show that these bacterial monoterpene synthases are similar to previously characterized sesquiterpene synthases. Molecular dynamics simulations suggest that these monoterpene synthases do not undergo large-scale conformational changes during the reaction cycle, making them attractive targets for structured-based protein engineering to expand the catalytic scope of these enzymes toward alternative monoterpene scaffolds. Comparison of the bLinS and bCinS structures indicates how their active sites steer reactive carbocation intermediates to the desired acyclic linalool (bLinS) or bicyclic 1,8-cineole (bCinS) products. The work reported here provides the analysis of structures for this important class of monoterpene synthase. This should now guide exploitation of the bacterial enzymes as gateway biocatalysts for the production of other monoterpenes and monoterpenoids. PMID:28966840

  20. Growth, sucrose synthase, and invertase activities of developing Phaseolus vulgaris L. fruits

    Science.gov (United States)

    Shi-Jean S. Sung; W.J. Sheih; D.R. Geiger; C.C. Black

    1994-01-01

    Activities of sucrose-cleaving enzymes, acid and neutral invertase and sucrose synthase, were measured in pods and seeds of developing snap bean (Phaseolus vulgaris L.) fruits, and compared with 14C-import, elongation and dry weight accumulation. The data supports the association of specific sucrose-cleaving enzymes with the specific processes that occur in the...

  1. Isolation of an ATP synthase cDNA from Sinonovacula constricta ...

    African Journals Online (AJOL)

    Yomi

    2012-01-24

    Jan 24, 2012 ... Complete cDNA sequence of ScATPase and its deduced amino acid sequence. Nucleotides were numbered from the first base at the 5'end. The canonical polyadenylation signal-sequence was italic and underlined. The asterisk indicated the stop codon. The domain for ATP synthase C was underlined.

  2. Fungal type III polyketide synthases.

    Science.gov (United States)

    Hashimoto, Makoto; Nonaka, Takamasa; Fujii, Isao

    2014-10-01

    This article covers the literature on fungal type III polyketide synthases (PKSs) published from 2005 to 2014. Since the first discovery of fungal type III PKS genes in Aspergillus oryzae, reported in 2005, putative genes for type III PKSs have been discovered in fungal genomes. Compared with type I PKSs, type III PKSs are much less abundant in fungi. However, type III PKSs could have some critical roles in fungi. This article summarizes the studies on fungal type III PKS functional analysis, including Neurospora crassa ORAS, Aspergillus niger AnPKS, Botrytis cinerea BPKS and Aspergillus oryzae CsyA and CsyB. It is mostly in vitro analysis using their recombinant enzymes that has revealed their starter and product specificities. Of these, CsyB was found to be a new kind of type III PKS that catalyses the coupling of two β-keto fatty acyl CoAs. Homology modelling reported in this article supports the importance of the capacity of the acyl binding tunnel and active site cavity in fungal type III PKSs.

  3. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  4. Analysis of the role of the Aspergillus niger aminolevulinic acid synthase (hemA) gene illustrates the difference between regulation of yeast and fungal haem- and sirohaem-dependent pathways

    NARCIS (Netherlands)

    Franken, A.C.; Christien Lokman, B.; Ram, A.F.; Hondel, C.A. van den; Weert, S. de; Punt, P.J.

    2012-01-01

    To increase knowledge on haem biosynthesis in filamentous fungi like Aspergillus niger, pathway-specific gene expression in response to haem and haem intermediates was analysed. This analysis showed that iron, 5′-aminolevulinic acid (ALA) and possibly haem control haem biosynthesis mostly via

  5. Analysis of the role of the A. niger aminolevulinic acid synthase (hemA) gene illustrates the difference between regulation of yeast and fungal heme and siroheme dependent pathways

    NARCIS (Netherlands)

    A.F. Ram; C.A. van den Hondel; Christien Lokman; P.J. Punt; S. de Weert; A. Franken

    2012-01-01

    To increase knowledge on haem biosynthesis in filamentous fungi like Aspergillus niger, pathway-specific gene expression in response to haem and haem intermediates was analysed. This analysis showed that iron, 5'-aminolevulinic acid (ALA) and possibly haem control haem biosynthesis mostly via

  6. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Science.gov (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A transcriptomic analysis for identifying the unintended effects of introducing a heterologous glyphosate-tolerant EPSP synthase into Escherichia coli.

    Science.gov (United States)

    Li, Liang; Zhou, Zhengfu; Jin, Wujun; Wan, Yusong; Lu, Wei

    2015-03-01

    Glyphosate is one of the most commonly used broad-spectrum herbicides with little to no hazard to animals, human beings, or the environment. Some microbial 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase variants are not inhibited by glyphosate, and they provide a powerful tool to engineer glyphosate-tolerant plants. However, the unintended effects of EPSP synthase expression patterns on microbes are not yet clear. Here, we use an Affymetrix GeneChip analysis to study how introduction of a heterologous glyphosate-tolerant EPSP synthase into a model microorganism Escherichia coli (E. coli) affects the global gene expression profile. The profile showed that 161 of 4071 genes were differentially expressed after the introduction of the synthase: 19 (0.47%) were up-regulated and 143 (3.49%) were down-regulated. The microarray results, in combination with BiOLOG substrate utilization and amino acid composition assays, suggested that heterologous EPSP synthase expression had very minor effects on E. coli. Although a small number of genes and metabolites were affected by EPSP synthase expression, no functional correlations were identified among the dataset. This study may shed light on the effect of EPSP synthase expression on microbes, which should help in the assessment of environmental safety.

  8. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Crock, John E. (Moscow, ID)

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  9. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  10. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  11. Progress challenges and opportunities for the re-engineering of trans-AT polyketide synthases.

    Science.gov (United States)

    Till, M; Race, P R

    2014-05-01

    Polyketides are a structurally and functionally diverse family of bioactive natural products that are used extensively as pharmaceuticals and agrochemicals. In bacteria these molecules are biosynthesized by giant, multi-functional enzymatic complexes, termed modular polyketide synthases (PKSs), that function in assembly-line like fashion to fuse and tailor simple carboxylic acid monomers into a vast array of elaborate chemical scaffolds. Modifying PKSs through targeted synthase re-engineering is a promising approach for accessing functionally-optimized polyketides. Due to their highly mosaic architectures the recently identified trans-AT family of modular synthases appear inherently more amenable to re-engineering than their well studied cis-AT counterparts. Here, we review recent progress in the re-engineering of trans-AT PKSs, summarize opportunities for harnessing the biosynthetic potential of these systems, and highlight challenges that such re-engineering approaches present.

  12. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

    Science.gov (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-06-01

    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  13. Proposed mechanism for diterpene synthases in the formation of phomactatriene and taxadiene.

    Science.gov (United States)

    Tokiwano, Tetsuo; Endo, Taeko; Tsukagoshi, Tae; Goto, Hitoshi; Fukushi, Eri; Oikawa, Hideaki

    2005-08-07

    To obtain insight into how the cyclization pathway is controlled, the mechanism of diterpene synthase reactions (the putative phomactatriene synthase and taxadiene synthases) involving the same intermediate was investigated in detail. The mechanism of the initial transformation of GGDP to verticillen-12-yl cation (A+) was proposed based on the labelling pattern of phomactatriene (9a) obtained in the feeding experiments with 13C-labelled acetates. To obtain information on the reaction pathway of A+ to 9a and taxadiene, reactions of verticillol with various acids were conducted. Structural determination of products allowed us to propose a reaction pathway via cations A+, D+, E+, F+ and G+. Identification of hydrocarbons in mycelial extracts of phomactin-producing fungus supported the proposed reaction mechanism. Based on the results of ab initio calculations for highly flexible cation intermediates, a mechanism is proposed.

  14. Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase: a control enzyme in ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1999-03-15

    Cytosolic and mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthases were first recognized as different chemical entities in 1975, when they were purified and characterized by Lane's group. Since then, the two enzymes have been studied extensively, one as a control site of the cholesterol biosynthetic pathway and the other as an important control site of ketogenesis. This review describes some key developments over the last 25 years that have led to our current understanding of the physiology of mitochondrial HMG-CoA synthase in the HMG-CoA pathway and in ketogenesis in the liver and small intestine of suckling animals. The enzyme is regulated by two systems: succinylation and desuccinylation in the short term, and transcriptional regulation in the long term. Both control mechanisms are influenced by nutritional and hormonal factors, which explains the incidence of ketogenesis in diabetes and starvation, during intense lipolysis, and in the foetal-neonatal and suckling-weaning transitions. The DNA-binding properties of the peroxisome-proliferator-activated receptor and other transcription factors on the nuclear-receptor-responsive element of the mitochondrial HMG-CoA synthase promoter have revealed how ketogenesis can be regulated by fatty acids. Finally, the expression of mitochondrial HMG-CoA synthase in the gonads and the correction of auxotrophy for mevalonate in cells deficient in cytosolic HMG-CoA synthase suggest that the mitochondrial enzyme may play a role in cholesterogenesis in gonadal and other tissues.

  15. Aromatic Polyketide Synthases (Purification, Characterization, and Antibody Development to Benzalacetone Synthase from Raspberry Fruits).

    Science.gov (United States)

    Borejsza-Wysocki, W.; Hrazdina, G.

    1996-03-01

    p-Hydroxyphenylbutan-2-one, the characteristic aroma compound of raspberries (Rubus idaeus L.), is synthesized from p-coumaryl-coenzyme A and malonyl-coenzyme A in a two-step reaction sequence that is catalyzed by benzalacetone synthase and benzalacetone reductase (W. Borejsza-Wysocki and G. Hrazdina [1994] Phytochemistry 35: 623-628). Benzalacetone synthase condenses one malonate with p-coumarate to form the pathway intermediate p-hydroxyphenylbut-3-ene-2-one (p-hydroxybenzalacetone) in a reaction that is similar to those catalyzed by chalcone and stilbene synthases. We have obtained an enzyme preparation from ripe raspberries that was preferentially enriched in benzalacetone synthase (approximately 170-fold) over chalcone synthase (approximately 14-fold) activity. This preparation was used to characterize benzalacetone synthase and to develop polyclonal antibodies in rabbits. Benzalacetone synthase showed similarity in its molecular properties to chalcone synthase but differed distinctly in its substrate specificity, response to 2-mercaptoethanol and ethylene glycol, and induction in cell-suspension cultures. The product of the enzyme, p-hydroxybenzalacetone, inhibited mycelial growth of the raspberry pathogen Phytophthora fragariae var rubi at 250 [mu]M. We do not know whether the dual activity in the benzalacetone synthase preparation is the result of a bifunctional enzyme or is caused by contamination with chalcone synthase that was also present. The rapid induction of the enzyme in cell-suspension cultures upon addition of yeast extract and the toxicity of its product, p-hydroxybenzalacetone, to phytopathogenic fungi also suggest that the pathway may be part of a plant defense response.

  16. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  17. Bacterial Cell Growth Inhibitors Targeting Undecaprenyl Diphosphate Synthase and Undecaprenyl Diphosphate Phosphatase.

    Science.gov (United States)

    Wang, Yang; Desai, Janish; Zhang, Yonghui; Malwal, Satish R; Shin, Christopher J; Feng, Xinxin; Sun, Hong; Liu, Guizhi; Guo, Rey-Ting; Oldfield, Eric

    2016-10-19

    We synthesized a series of benzoic acids and phenylphosphonic acids and investigated their effects on the growth of Staphylococcus aureus and Bacillus subtilis. One of the most active compounds, 5-fluoro-2-(3-(octyloxy)benzamido)benzoic acid (7, ED 50 ∼0.15 μg mL -1 ) acted synergistically with seven antibiotics known to target bacterial cell-wall biosynthesis (a fractional inhibitory concentration index (FICI) of ∼0.35, on average) but had indifferent effects in combinations with six non-cell-wall biosynthesis inhibitors (average FICI∼1.45). The most active compounds were found to inhibit two enzymes involved in isoprenoid/bacterial cell-wall biosynthesis: undecaprenyl diphosphate synthase (UPPS) and undecaprenyl diphosphate phosphatase (UPPP), but not farnesyl diphosphate synthase, and there were good correlations between bacterial cell growth inhibition, UPPS inhibition, and UPPP inhibition. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Triclosan inhibition of mycobacterial InhA in Saccharomyces cerevisiae: yeast mitochondria as a novel platform for in vivo antimycolate assays.

    Science.gov (United States)

    Gurvitz, A

    2010-04-01

    To demonstrate the suitability of yeast to act as a novel biotechnological platform for conducting in vivo inhibition assays using drugs with low efficacies towards their mycobacterial targets, such as occurs in the situation with triclosan and InhA. A surrogate yeast host represented by Saccharomyces cerevisiae etr1Delta cells lacking Etr1p, the 2-trans-enoyl-thioester reductase of mitochondrial type 2 fatty acid synthase (FASII), was designed to rely on the Mycobacterium tuberculosis FASII enzyme InhA. Although InhA is 10,000 times less sensitive to the antimicrobial drug triclosan than is bacterial FabI, the respiratory growth of yeast cells depending on InhA was severely affected on glycerol medium containing triclosan. The yeast system could detect enzyme inhibition despite the use of a drug with only low efficacy. Tuberculosis affects a third of the human population, and InhA is a major drug target for combating this disease. InhA is inhibited by isoniazid, but triclosan-derived compounds are presently being developed as antimycolates. A demonstration of triclosan inhibition of InhA in yeast represents a meaningful variation in studying this effect in mycobacteria, because it occurred without the potentially confusing aspects of perturbing protein-protein interactions which are presumed vital to mycobacterial FASII, inactivating other important enzymes or eliciting a dedicated transcriptional response in Myco. tuberculosis.

  19. Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium.

    Science.gov (United States)

    Waclawik, Agnieszka; Rivero-Muller, Adolfo; Blitek, Agnieszka; Kaczmarek, Monika M; Brokken, Leon J S; Watanabe, Kikuko; Rahman, Nafis A; Ziecik, Adam J

    2006-01-01

    Endometrial prostaglandins (PGs) and the PGE2/PGF2alpha ratio play an important role in regulating the estrous cycle and establishment of pregnancy. The enzymes downstream of cyclooxygenase-2 may determine the PGE2/PGF2alpha ratio in the porcine uterus. Thus, we have cloned porcine PGF synthase (PGFS) and microsomal PGE synthase-1 (mPGES-1) and characterized their expression in porcine endometrium during the estrous cycle and early pregnancy. PGFS and mPGES-1 amino acid sequences possessed a high degree (>67% and >77%, respectively) of identity with the other mammalian homologs. There was little modulation of mPGES-1 throughout the estrous cycle; however, PGFS expression was highly up-regulated in endometrium around the time of luteolysis. During early pregnancy, PGFS at the protein level showed a time-dependent increase (low on d 10-13, intermediate on d 14-23, and high on d 24-25). In pregnancy, expression of mPGES-1 was intermediate on d 10-11 and low on d 14-17 and then increased after d 22, reaching the maximum on d 24-25. Immunohistochemistry showed localization of PGFS and mPGES-1 proteins mainly in luminal and glandular epithelium. Concluding, the spatiotemporal expression of PGFS throughout the estrous cycle indicates an involvement of PGFS in regulating luteolysis in the pig. The comparison of endometrial PGFS and mPGES-1 expression on d 10-13 of the estrous cycle and pregnancy suggest a supportive role of these enzymes in determining the increase of uterine PGE2/PGF2alpha ratio during maternal recognition of pregnancy. Moreover, high expression of both PG synthases after initiation of implantation may indicate their significant role in placentation.

  20. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    Science.gov (United States)

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris

    2015-01-01

    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  1. The intracellular parasite Toxoplasma gondii depends on the synthesis of long-chain and very long-chain unsaturated fatty acids not supplied by the host cell.

    Science.gov (United States)

    Ramakrishnan, Srinivasan; Docampo, Melissa D; MacRae, James I; Ralton, Julie E; Rupasinghe, Thusitha; McConville, Malcolm J; Striepen, Boris

    2015-07-01

    Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In Toxoplasma gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here, we demonstrate that the ER-localized fatty acid elongation (ELO) complexes are essential for parasite growth. Conditional knockdown of the nonredundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. (13) C-glucose and (13) C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long-chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was bypassed by supplementing the media with specific fatty acids, indicating active but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. © 2015 John Wiley & Sons Ltd.

  2. Cloning, expression, purification and characterization of recombinant (+)-germacrene D synthase from Zingiber officinale.

    Science.gov (United States)

    Picaud, Sarah; Olsson, Mikael E; Brodelius, Maria; Brodelius, Peter E

    2006-08-01

    A cDNA clone encoding a sesquiterpene synthase, (+)-germacrene D synthase, has been isolated from ginger (Zingiber officinale). The full-length cDNA (AY860846) contains a 1650-bp open reading frame coding for 550 amino acids (63.8kDa) with a theoretical pI=5.59. The deduced amino acid sequence is 30-46% identical with sequences of other sesquiterpene synthases from angiosperms. The recombinant enzyme, produced in Escherichia coli, catalyzed the formation of a major product, (+)-germacrene D (50.2% of total sesquiterpenoids produced) and a co-product, germacrene B (17.1%) and a number of minor by-products. The optimal pH for the recombinant enzyme is around 7.5. Substantial (+)-germacrene D synthase activity is observed in the presence of Mg2+, Mn2+, Ni2+ or Co2+, while the enzyme is inactive when Cu2+ or Zn2+ is used. The Km- and kcat-values are 0.88 microM and 3.34 x 10(-3) s(-1), respectively. A reaction mechanism involving a double 1,2-hydride shift has been established using deuterium labeled substrates in combination with GC-MS analysis.

  3. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  4. An unusual plant triterpene synthase with predominant α-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus × domestica.

    Science.gov (United States)

    Brendolise, Cyril; Yauk, Yar-Khing; Eberhard, Ellen D; Wang, Mindy; Chagne, David; Andre, Christelle; Greenwood, David R; Beuning, Lesley L

    2011-07-01

    The pentacyclic triterpenes, in particular ursolic acid and oleanolic acid and their derivatives, exist abundantly in the plant kingdom, where they are well known for their anti-inflammatory, antitumour and antimicrobial properties. α-Amyrin and β-amyrin are the precursors of ursolic and oleanolic acids, respectively, formed by concerted cyclization of squalene epoxide by a complex synthase reaction. We identified three full-length expressed sequence tag sequences in cDNA libraries constructed from apple (Malus × domestica 'Royal Gala') that were likely to encode triterpene synthases. Two of these expressed sequence tag sequences were essentially identical (> 99% amino acid similarity; MdOSC1 and MdOSC3). MdOSC1 and MdOSC2 were expressed by transient expression in Nicotiana benthamiana leaves and by expression in the yeast Pichia methanolica. The resulting products were analysed by GC and GC-MS. MdOSC1 was shown to be a mixed amyrin synthase (a 5 : 1 ratio of α-amyrin to β-amyrin). MdOSC1 is the only triterpene synthase so far identified in which the level of α-amyrin produced is > 80% of the total product and is, therefore, primarily an α-amyrin synthase. No product was evident for MdOSC2 when expressed either transiently or in yeast, suggesting that this putative triterpene synthase is either encoded by a pseudogene or does not express well in these systems. Transcript expression analysis in Royal Gala indicated that the genes are mostly expressed in apple peel, and that the MdOSC2 expression level was much lower than that of MdOSC1 and MdOSC3 in all the tissues tested. Amyrin content analysis was undertaken by LC-MS, and demonstrated that levels and ratios differ between tissues, but that the true consequence of synthase activity is reflected in the ursolic/oleanolic acid content and in further triterpenoids derived from them. Phylogenetic analysis placed the three triterpene synthase sequences with other triterpene synthases that encoded either

  5. Isolation and sequence analysis of a chalcone synthase cDNA of Matthiola incana R. Br. (Brassicaceae).

    Science.gov (United States)

    Epping, B; Kittel, M; Ruhnau, B; Hemleben, V

    1990-06-01

    A cDNA clone (pcM12) of the chalcone synthase (CHS) of Matthiola incana R. Br. (Brassicaceae) was isolated from a cDNA library, sequenced and analysed. It comprises the complete coding sequence for the CHS and 5' and 3' untranslated regions. The deduced amino acid sequence shows that the Matthiola incana CHS consists of 394 amino acid residues. Comparison with CHS amino acid sequences of other plants indicates more than 82% homology.

  6. Pharmacokinetics, safety, and efficacy of a liposome encapsulated thymidylate synthase inhibitor, OSI-7904L [(S)-2-[5-[(1,2-dihydro-3-methyl-1-oxobenzo[f]quinazolin-9-yl)methyl]amino-1-oxo-2-isoindolynl]-glutaric acid] in mice.

    Science.gov (United States)

    Desjardins, John; Emerson, David L; Colagiovanni, Dorothy B; Abbott, Elizabeth; Brown, Eric N; Drolet, Daniel W

    2004-06-01

    OSI-7904L [(S)-2-[5-[(1,2-dihydro-3-methyl-1-oxobenzo[f]quinazolin-9-yl)methyl]amino-1-oxo-2-isoindolynl]-glutaric acid] is a liposomal formulation of the highly specific, noncompetitive, thymidylate synthase inhibitor OSI-7904 (also known as GW1843, 1843U89, and GS7904). The liposome formulation was developed to enhance the therapeutic index and dose schedule convenience of this potent antifolate compound. The studies presented here were conducted to determine the antitumor efficacy, distribution, pharmacokinetics, and safety of OSI-7904L in mice. In a human colon adenocarcinoma xenograft model in mice, OSI-7904L demonstrated superior antitumor efficacy compared with OSI-7904 or 5-fluorouracil. Furthermore, OSI-7904L could be administered less frequently than OSI-7904 although still generating greater tumor growth inhibition. Distribution studies confirmed that OSI-7904L-treated animals had much greater plasma, tissue, and tumor exposure than did OSI-7904-treated animals. Tumor exposures, based on area under the curve, in OSI-7904L-treated mice were increased over 100-fold compared with tumor exposures in OSI-7904-treated mice. Plasma exposures following OSI-7904L administration were greater than dose proportional consistent with saturation of plasma clearance mechanisms. OSI-7904L was much more toxic than OSI-7904 in the mouse with primary toxicities to the intestines, bone marrow, and thymus. Minimal toxicity to the lungs and liver was noted. These data clearly demonstrated that in mice, OSI-7904L has an increased plasma residence time as well as increased tissue and tumor exposure compared with OSI-7904, thus resulting in increased potency and toxicity. Potential benefits of OSI-7904L include improved efficacy and a more convenient schedule of administration.

  7. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  8. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...

  9. Evolutionary and mechanistic insights from the reconstruction of (+)-humulene synthases from a modern (+)-Germacrene A Synthase

    OpenAIRE

    Gonzalez Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J.; Faraldos, Juan A.; Allemann, Rudolf Konrad

    2014-01-01

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and

  10. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  11. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  12. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  13. Producing alpha-olefins using polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Katz, Leonard; Steen, Eric J.; Keasling, Jay D.

    2018-01-02

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an .alpha.-olefin, such as 1-hexene or butadiene. The present invention also provides for a host cell comprising the PKS and when cultured produces the .alpha.-olefin.

  14. Catalysis and Sulfa Drug Resistance in Dihydropteroate Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Mi-Kyung; Wu, Yinan; Li, Zhenmei; Zhao, Ying; Waddell, M. Brett; Ferreira, Antonio M.; Lee, Richard E.; Bashford, Donald; White, Stephen W. (SJCH)

    2013-04-08

    The sulfonamide antibiotics inhibit dihydropteroate synthase (DHPS), a key enzyme in the folate pathway of bacteria and primitive eukaryotes. However, resistance mutations have severely compromised the usefulness of these drugs. We report structural, computational, and mutagenesis studies on the catalytic and resistance mechanisms of DHPS. By performing the enzyme-catalyzed reaction in crystalline DHPS, we have structurally characterized key intermediates along the reaction pathway. Results support an S{sub N}1 reaction mechanism via formation of a novel cationic pterin intermediate. We also show that two conserved loops generate a substructure during catalysis that creates a specific binding pocket for p-aminobenzoic acid, one of the two DHPS substrates. This substructure, together with the pterin-binding pocket, explains the roles of the conserved active-site residues and reveals how sulfonamide resistance arises.

  15. Plant diterpene synthases: exploring modularity and metabolic diversity for bioengineering.

    Science.gov (United States)

    Zerbe, Philipp; Bohlmann, Jörg

    2015-07-01

    Plants produce thousands of diterpenoid natural products; some of which are of significant industrial value as biobased pharmaceuticals (taxol), fragrances (sclareol), food additives (steviosides), and commodity chemicals (diterpene resin acids). In nature, diterpene synthase (diTPS) enzymes are essential for generating diverse diterpene hydrocarbon scaffolds. While some diTPSs also form oxygenated compounds, more commonly, oxygenation is achieved by cytochrome P450-dependent mono-oxygenases. Recent genome-, transcriptome-, and metabolome-guided gene discovery and enzyme characterization identified novel diTPS functions that form the core of complex modular pathway systems. Insights into diterpene metabolism may translate into the development of new bioengineered microbial and plant-based production systems. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. The primary diterpene synthase products of Picea abies levopimaradiene/abietadiene synthase (PaLAS) are epimers of a thermally unstable diterpenol.

    Science.gov (United States)

    Keeling, Christopher I; Madilao, Lina L; Zerbe, Philipp; Dullat, Harpreet K; Bohlmann, Jörg

    2011-06-17

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay products but are rather the products of dehydration of an unstable alcohol. We have identified epimers of the thermally unstable allylic tertiary alcohol 13-hydroxy-8(14)-abietene as the products of PaLAS. The identification of these compounds, not previously described in conifers, as the initial products of PaLAS has considerable implications for our understanding of the complexity of the biosynthetic pathway of the structurally diverse diterpene resin acids of conifer defense.

  17. Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers.

    OpenAIRE

    Landschütze, V; Willmitzer, L; Müller-Röber, B

    1995-01-01

    The tricarboxylic acid (TCA) cycle constitutes a major component of the mitochondrial metabolism of eucaryotes, including higher plants. To analyze the importance of this pathway, we down-regulated mitochondrial citrate synthase (mCS; EC 4.1.3.7), the first enzyme of the TCA cycle, in transgenic potato plants using an antisense RNA approach. Several transformants were identified with reduced citrate synthase activity (down to approximately 6% of wild-type activity). These plants were indistin...

  18. Heme A synthase in bacteria depends on one pair of cysteinyls for activity.

    Science.gov (United States)

    Lewin, Anna; Hederstedt, Lars

    2016-02-01

    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Mechanistic Insight with HBCH2CoA as a Probe to Polyhydroxybutyrate (PHB) Synthases

    Science.gov (United States)

    2015-01-01

    Polyhydroxybutyrate (PHB) synthases catalyze the polymerization of 3-(R)-hydroxybutyrate coenzyme A (HBCoA) to produce polyoxoesters of 1–2 MDa. A substrate analogue HBCH2CoA, in which the S in HBCoA is replaced with a CH2 group, was synthesized in 13 steps using a chemoenzymatic approach in a 7.5% overall yield. Kinetic studies reveal it is a competitive inhibitor of a class I and a class III PHB synthases, with Kis of 40 and 14 μM, respectively. To probe the elongation steps of the polymerization, HBCH2CoA was incubated with a synthase acylated with a [3H]-saturated trimer-CoA ([3H]-sTCoA). The products of the reaction were shown to be the methylene analogue of [3H]-sTCoA ([3H]-sT-CH2-CoA), saturated dimer-([3H]-sD-CO2H), and trimer-acid ([3H]-sT-CO2H), distinct from the expected methylene analogue of [3H]-saturated tetramer-CoA ([3H]-sTet-CH2-CoA). Detection of [3H]-sT-CH2-CoA and its slow rate of formation suggest that HBCH2CoA may be reporting on the termination and repriming process of the synthases, rather than elongation. PMID:24896226

  20. Random mutagenesis of 1-aminocyclopropane-1-carboxylate synthase: a key enzyme in ethylene biosynthesis.

    Science.gov (United States)

    Tarun, A S; Lee, J S; Theologis, A

    1998-08-18

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase, EC 4.4.1. 14) catalyzes the rate-limiting step in the ethylene biosynthetic pathway in plants. To determine the amino acid residues critical for the structure and function of this enzyme, the tomato Le-ACS2 isoenzyme has been subjected to both site-directed and PCR random mutagenesis. Mutant ACC synthases with reduced enzyme activity have been selected by using a genetic screen based on the functional complementation of an Escherichia coli Ile auxotroph that has been engineered to express ACC deaminase from Pseudomonas sp. The DNA sequence of almost 1,000 clones has been determined, and 334 single missense mutations have been selected for analysis. We have identified three classes of mutants based on their activity and expression in E. coli. Class I and II mutants have the same level of protein expression as the wild type, but their enzyme activity is reduced to 0-5% and 5-50%, respectively. Class III mutants have neither activity nor detectable protein expression. The inactive mutations are clustered in regions that are highly conserved among various ACC synthases. This library of mutants will facilitate the elucidation of structure-function relationships of this regulatory enzyme.

  1. Acyl carrier protein (ACP) inhibition and other differences between b-ketoacyl synthase (KAS) I and II

    DEFF Research Database (Denmark)

    McGuire, Kirsten Arnvig; McGuire, J.N.; Wettstein-Knowles, Penny von

    2000-01-01

    Escherichia coli b-ketoacyl synthases (KAS) I and II carry out the elongation steps in fatty acid synthesis. Analyses using the cross-linker BS3 [bis(sulphosuccinimidyl) suberate] and surface-enhanced laser desorption/ionization–time-of-flight MS disclosed only monomeric and dimeric forms of KAS ...

  2. The α-Terpineol to 1,8-Cineole Cyclization Reaction of Tobacco Terpene Synthases1

    Science.gov (United States)

    Piechulla, Birgit; Bartelt, Richard; Brosemann, Anne; Bouwmeester, Harro; Hippauf, Frank

    2016-01-01

    Flowers of Nicotiana species emit a characteristic blend including the cineole cassette monoterpenes. This set of terpenes is synthesized by multiproduct enzymes, with either 1,8-cineole or α-terpineol contributing most to the volatile spectrum, thus referring to cineole or terpineol synthase, respectively. To understand the molecular and structural requirements of the enzymes that favor the biochemical formation of α-terpineol and 1,8-cineole, site-directed mutagenesis, in silico modeling, and semiempiric calculations were performed. Our results indicate the formation of α-terpineol by a nucleophilic attack of water. During this attack, the α-terpinyl cation is stabilized by π-stacking with a tryptophan side chain (tryptophan-253). The hypothesized catalytic mechanism of α-terpineol-to-1,8-cineole conversion is initiated by a catalytic dyad (histidine-502 and glutamate-249), acting as a base, and a threonine (threonine-278) providing the subsequent rearrangement from terpineol to cineol by catalyzing the autoprotonation of (S)-(−)-α-terpineol, which is the favored enantiomer product of the recombinant enzymes. Furthermore, by site-directed mutagenesis, we were able to identify amino acids at positions 147, 148, and 266 that determine the different terpineol-cineole ratios in Nicotiana suaveolens cineole synthase and Nicotiana langsdorffii terpineol synthase. Since amino acid 266 is more than 10 Å away from the active site, an indirect effect of this amino acid exchange on the catalysis is discussed. PMID:27729471

  3. The α-Terpineol to 1,8-Cineole Cyclization Reaction of Tobacco Terpene Synthases.

    Science.gov (United States)

    Piechulla, Birgit; Bartelt, Richard; Brosemann, Anne; Effmert, Uta; Bouwmeester, Harro; Hippauf, Frank; Brandt, Wolfgang

    2016-12-01

    Flowers of Nicotiana species emit a characteristic blend including the cineole cassette monoterpenes. This set of terpenes is synthesized by multiproduct enzymes, with either 1,8-cineole or α-terpineol contributing most to the volatile spectrum, thus referring to cineole or terpineol synthase, respectively. To understand the molecular and structural requirements of the enzymes that favor the biochemical formation of α-terpineol and 1,8-cineole, site-directed mutagenesis, in silico modeling, and semiempiric calculations were performed. Our results indicate the formation of α-terpineol by a nucleophilic attack of water. During this attack, the α-terpinyl cation is stabilized by π-stacking with a tryptophan side chain (tryptophan-253). The hypothesized catalytic mechanism of α-terpineol-to-1,8-cineole conversion is initiated by a catalytic dyad (histidine-502 and glutamate-249), acting as a base, and a threonine (threonine-278) providing the subsequent rearrangement from terpineol to cineol by catalyzing the autoprotonation of (S)-(-)-α-terpineol, which is the favored enantiomer product of the recombinant enzymes. Furthermore, by site-directed mutagenesis, we were able to identify amino acids at positions 147, 148, and 266 that determine the different terpineol-cineole ratios in Nicotiana suaveolens cineole synthase and Nicotiana langsdorffii terpineol synthase. Since amino acid 266 is more than 10 Å away from the active site, an indirect effect of this amino acid exchange on the catalysis is discussed. © 2016 American Society of Plant Biologists. All Rights Reserved.

  4. Engineering of plant type III polyketide synthases.

    Science.gov (United States)

    Wakimoto, Toshiyuki; Morita, Hiroyuki; Abe, Ikuro

    2012-01-01

    Members of the chalcone synthase superfamily of type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkable structural diversity and biological activities. The homodimeric type III PKSs share a common three-dimensional overall fold with a conserved Cys-His-Asn catalytic triad; notably, only a slight modification of the active site dramatically expands the catalytic repertoire of the enzymes. In addition, the enzymes exhibit extremely promiscuous substrate specificities, and accept a variety of nonphysiological substrates, making the type III PKSs an excellent platform for the further production of unnatural, novel polyketide scaffolds with promising biological activities. This chapter summarizes recent advances in the engineering of plant type III PKS enzymes in our laboratories, using approaches combining structure-based enzyme engineering and precursor-directed biosynthesis with rationally designed substrate analogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Engineering Isoprene Synthase Expression and Activity in Cyanobacteria.

    Science.gov (United States)

    Chaves, Julie E; Rueda-Romero, Paloma; Kirst, Henning; Melis, Anastasios

    2017-12-15

    Efforts to heterologously produce quantities of isoprene hydrocarbons (C 5 H 8 ) renewably from CO 2 and H 2 O through the photosynthesis of cyanobacteria face barriers, including low levels of recombinant enzyme accumulation compounded by their slow innate catalytic activity. The present work sought to alleviate the "expression level" barrier upon placing the isoprene synthase (IspS) enzyme in different fusion configurations with the cpcB protein, the highly expressed β-subunit of phycocyanin. Different cpcB*IspS fusion constructs were made, distinguished by the absence or presence of linker amino acids between the two proteins. Composition of linker amino acids was variable with lengths of 7, 10, 16, and 65 amino acids designed to test for optimal activity of the IspS through spatial positioning between the cpcB and IspS. Results showed that fusion constructs with the highly expressed cpcB gene, as the leader sequence, improved transgene expression in the range of 61 to 275-fold over what was measured with the unfused IspS control. However, the specific activity of the IspS enzyme was attenuated in all fusion transformants, possibly because of allosteric effects exerted by the leader cpcB fusion protein. This inhibition varied depending on the nature of the linker amino acids between the cpcB and IspS proteins. In terms of isoprene production, the results further showed a trade-off between specific activity and transgenic enzyme accumulation. For example, the cpcB*L7*IspS strain showed only about 10% the isoprene synthase specific-activity of the unfused cpcB-IspS control, but it accumulated 254-fold more IspS enzyme. The latter more than countered the slower specific activity and made the cpcB*L7*IspS transformant the best isoprene producing strain in this work. Isoprene to biomass yield ratios improved from 0.2 mg g -1 in the unfused cpcB-IspS control to 5.4 mg g -1 in the cpcB*L7*IspS strain, a 27-fold improvement.

  6. Engineering cotton (+)-delta-cadinene synthase to an altered function: germacrene D-4-ol synthase.

    Science.gov (United States)

    Yoshikuni, Yasuo; Martin, Vincent J J; Ferrin, Thomas E; Keasling, Jay D

    2006-01-01

    The combined approaches of rational design and random mutagenesis were applied to generate a sesquiterpene synthase with an altered activity. Due to the lack of a convenient screen for sesquiterpene synthase activity, a high-throughput dual-activity screen was used by fusing (+)-delta-cadinene synthase to chloramphenicol acetyltransferase (CAT). The gene encoding (+)-delta-cadinene synthase was mutagenized using error-prone PCR. The resulting mutant fusion proteins were screened for CAT activity and altered sesquiterpene selectivity. Twenty-one clones producing (+)-delta-cadinene and germacrene D-4-ol in different ratios were isolated from the library. Analysis using a homology model of (+)-delta-cadinene synthase suggested that the G helix plays a very important role in (+)-delta-cadinene formation. Reconstruction of the G helix using site-directed, saturation mutagenesis yielded a mutant, N403P/L405H, that maintained its specific activity and showed higher selectivity to germacrene D-4-ol in vivo (up to 93%).

  7. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  8. Synthesis of isoprenoid bisphosphonate ethers through C–P bond formations: Potential inhibitors of geranylgeranyl diphosphate synthase

    Directory of Open Access Journals (Sweden)

    Xiang Zhou

    2014-07-01

    Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.

  9. Isolation and Characterization of Two Germacrene A Synthase cDNA Clones from Chicory1

    Science.gov (United States)

    Bouwmeester, Harro J.; Kodde, Jan; Verstappen, Francel W.A.; Altug, Iris G.; de Kraker, Jan-Willem; Wallaart, T. Eelco

    2002-01-01

    Chicory (Cichorium intybus) sesquiterpene lactones were recently shown to be derived from a common sesquiterpene intermediate, (+)-germacrene A. Germacrene A is of interest because of its key role in sesquiterpene lactone biosynthesis and because it is an enzyme-bound intermediate in the biosynthesis of a number of phytoalexins. Using polymerase chain reaction with degenerate primers, we have isolated two sesquiterpene synthases from chicory that exhibited 72% amino acid identity. Heterologous expression of the genes in Escherichia coli has shown that they both catalyze exclusively the formation of (+)-germacrene A, making this the first report, to our knowledge, on the isolation of (+)-germacrene A synthase (GAS)-encoding genes. Northern analysis demonstrated that both genes were expressed in all chicory tissues tested albeit at varying levels. Protein isolation and partial purification from chicory heads demonstrated the presence of two GAS proteins. On MonoQ, these proteins co-eluted with the two heterologously produced proteins. The Km value, pH optimum, and MonoQ elution volume of one of the proteins produced in E. coli were similar to the values reported for the GAS protein that was recently purified from chicory roots. Finally, the two deduced amino acid sequences were modeled, and the resulting protein models were compared with the crystal structure of tobacco (Nicotiana tabacum) 5-epi-aristolochene synthase, which forms germacrene A as an enzyme-bound intermediate en route to 5-epi-aristolochene. The possible involvement of a number of amino acids in sesquiterpene synthase product specificity is discussed. PMID:12011345

  10. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Science.gov (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Physcomitrella PpORS, basal to plant type III polyketide synthases in phylogenetic trees, is a very long chain 2'-oxoalkylresorcinol synthase.

    Science.gov (United States)

    Kim, Sun Young; Colpitts, Che C; Wiedemann, Gertrud; Jepson, Christina; Rahimi, Mehrieh; Rothwell, Jordan R; McInnes, Adam D; Hasebe, Mitsuyasu; Reski, Ralf; Sterenberg, Brian T; Suh, Dae-Yeon

    2013-01-25

    The plant type III polyketide synthases (PKSs), which produce diverse secondary metabolites with different biological activities, have successfully co-evolved with land plants. To gain insight into the roles that ancestral type III PKSs played during the early evolution of land plants, we cloned and characterized PpORS from the moss Physcomitrella. PpORS has been proposed to closely resemble the most recent common ancestor of the plant type III PKSs. PpORS condenses a very long chain fatty acyl-CoA with four molecules of malonyl-CoA and catalyzes decarboxylative aldol cyclization to yield the pentaketide 2'-oxoalkylresorcinol. Therefore, PpORS is a 2'-oxoalkylresorcinol synthase. Structure modeling and sequence alignments identified a unique set of amino acid residues (Gln(218), Val(277), and Ala(286)) at the putative PpORS active site. Substitution of the Ala(286) to Phe apparently constricted the active site cavity, and the A286F mutant instead produced triketide alkylpyrones from fatty acyl-CoA substrates with shorter chain lengths. Phylogenetic analysis and comparison of the active sites of PpORS and alkylresorcinol synthases from sorghum and rice suggested that the gramineous enzymes evolved independently from PpORS to have similar functions but with distinct active site architecture. Microarray analysis revealed that PpORS is exclusively expressed in nonprotonemal moss cells. The in planta function of PpORS, therefore, is probably related to a nonprotonemal structure, such as the cuticle.

  12. The C-terminal peptide of Aquifex aeolicus riboflavin synthase directs encapsulation of native and foreign guests by a cage-forming lumazine synthase.

    Science.gov (United States)

    Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald

    2017-06-23

    Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes.

    Science.gov (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J

    1997-10-01

    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  14. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...... in the sarcolemma as well as the cytoplasm of type I muscle fibres. NADPH diaphorase activity confirmed a higher level of NO synthase activity in the sarcolemma as well as the cytoplasm of type I muscle fibers. Histochemical staining for cytochrome oxidase showed a staining pattern similar to that observed for type...... I NO synthase immunoreactivity and NADPH diaphorase activity. Type III NO synthase immunoreactivity was observed both in the endothelium of larger vessels and of microvessels. The results establish that human skeletal muscle expresses two different constitutive isoforms of NO synthase in different...

  15. Functional plasticity of paralogous diterpene synthases involved in conifer defense

    OpenAIRE

    Keeling, Christopher I.; Weisshaar, Sabrina; Lin, Roy P. C.; Bohlmann, Jörg

    2008-01-01

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant–herbivore, plant–pollinator, and plant–pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin...

  16. Expression, purification and characterization of recombinant (E)-beta-farnesene synthase from Artemisia annua.

    Science.gov (United States)

    Picaud, Sarah; Brodelius, Maria; Brodelius, Peter E

    2005-05-01

    A cDNA clone (GenBank Accession No. AY835398) encoding a sesquiterpene synthase, (E)-beta-farnesene synthase, has been isolated from Artemisia annua L. It contains a 1746-bp open reading frame coding for 574 amino acids (66.9 kDa) with a calculated pI=5.03. The deduced amino acid sequence is 30-50% identical with sequences of other sesquiterpene synthases from angiosperms. The recombinant enzyme, produced in Escherichia coli, catalyzed the formation of a single product, beta-farnesene, from farnesyl diphosphate. The pH optimum for the recombinant enzyme is around 6.5 and the K(m)- and k(cat)-values for farnesyl diphosphate, is 2.1 microM and 9.5 x 10(-3) s(-1), respectively resulting in the efficiency 4.5 x 10(-3) M(-1)s(-1). The enzyme exhibits substantial activity in the presence of Mg(2+), Mn(2+) or Co(2+) but essentially no activity when Zn(2+), Ni(2+) or Cu(2+) is used as cofactor. The concentration required for maximum activity are estimated to 5 mM, 0.5 mM and <10 microM for Mg(2+), Co(2+) or Mn(2+), respectively. Geranyl diphosphate is not a substrate for the recombinant enzyme.

  17. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  18. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  19. The Stereochemistry of Complex Polyketide Biosynthesis by Modular Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    David H. Kwan

    2011-07-01

    Full Text Available Polyketides are a diverse class of medically important natural products whose biosynthesis is catalysed by polyketide synthases (PKSs, in a fashion highly analogous to fatty acid biosynthesis. In modular PKSs, the polyketide chain is assembled by the successive condensation of activated carboxylic acid-derived units, where chain extension occurs with the intermediates remaining covalently bound to the enzyme, with the growing polyketide tethered to an acyl carrier domain (ACP. Carboxylated acyl-CoA precursors serve as activated donors that are selected by the acyltransferase domain (AT providing extender units that are added to the growing chain by condensation catalysed by the ketosynthase domain (KS. The action of ketoreductase (KR, dehydratase (DH, and enoylreductase (ER activities can result in unreduced, partially reduced, or fully reduced centres within the polyketide chain depending on which of these enzymes are present and active. The PKS-catalysed assembly process generates stereochemical diversity, because carbon–carbon double bonds may have either cis- or trans- geometry, and because of the chirality of centres bearing hydroxyl groups (where they are retained and branching methyl groups (the latter arising from use of propionate extender units. This review shall cover the studies that have determined the stereochemistry in many of the reactions involved in polyketide biosynthesis by modular PKSs.

  20. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  1. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  2. Vitis vinifera terpenoid cyclases: functional identification of two sesquiterpene synthase cDNAs encoding (+)-valencene synthase and (-)-germacrene D synthase and expression of mono- and sesquiterpene synthases in grapevine flowers and berries.

    Science.gov (United States)

    Lücker, Joost; Bowen, Pat; Bohlmann, Jörg

    2004-10-01

    Valencene is a volatile sesquiterpene emitted from flowers of grapevine, Vitis vinifera L. A full-length cDNA from the cultivar Gewürztraminer was functionally expressed in Escherichia coli and found to encode valencene synthase (VvVal). The two major products formed by recombinant VvVal enzyme activity with farnesyl diphosphate (FPP) as substrate are (+)-valencene and (-)-7-epi-alpha-selinene. Grapevine valencene synthase is closely related to a second sesquiterpene synthase from this species, (-)-germacrene D synthase (VvGerD). VvVal and VvGerD cDNA probes revealed strong signals in Northern hybridizations with RNA isolated from grapevine flower buds. Transcript levels were lower in open pre-anthesis flowers, flowers after anthesis, or at early onset of fruit development. Similar results were obtained using a third probe, (-)-alpha-terpineol synthase, a monoterpenol synthase. Sesquiterpene synthase and monoterpene synthase transcripts were not detected in the mesocarp and exocarp during early stages of fruit development, but transcripts hybridizing with VvVal appeared during late ripening of the berries. Sesquiterpene synthase transcripts were also detected in young seeds.

  3. Alkyldihydropyrones, new polyketides synthesized by a type III polyketide synthase from Streptomyces reveromyceticus.

    Science.gov (United States)

    Aizawa, Teruki; Kim, Seung-Young; Takahashi, Shunji; Koshita, Masahiko; Tani, Mioka; Futamura, Yushi; Osada, Hiroyuki; Funa, Nobutaka

    2014-12-01

    Genome sequencing allows a rapid and efficient identification of novel catalysts that produce novel secondary metabolites. Here we describe the catalytic properties of dihydropyrone synthase A (DpyA), a novel type III polyketide synthase encoded in a linear plasmid of Streptomyces reveromyceticus. Heterologous expression of dpyA led to the accumulation of alkyldihydropyrones A (1), B (2), C (3) and D (4), which are novel dihydropyran compounds that exhibit weak cytotoxicity against the leukemia cell line HL-60. DpyA catalyzes the condensation of β-hydroxyl acid thioester and methylmalonyl-CoA to yield a triketide intermediate that then undergoes lactonization of a secondary alcohol and a thioester to give alkyldihydropyrone.

  4. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  5. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  6. Functional analysis of (4S)-limonene synthase mutants reveals determinants of catalytic outcome in a model monoterpene synthase

    Science.gov (United States)

    Srividya, Narayanan; Davis, Edward M.; Croteau, Rodney B.; Lange, B. Markus

    2015-01-01

    Crystal structural data for (4S)-limonene synthase [(4S)-LS] of spearmint (Mentha spicata L.) were used to infer which amino acid residues are in close proximity to the substrate and carbocation intermediates of the enzymatic reaction. Alanine-scanning mutagenesis of 48 amino acids combined with enzyme fidelity analysis [percentage of (−)-limonene produced] indicated which residues are most likely to constitute the active site. Mutation of residues W324 and H579 caused a significant drop in enzyme activity and formation of products (myrcene, linalool, and terpineol) characteristic of a premature termination of the reaction. A double mutant (W324A/H579A) had no detectable enzyme activity, indicating that either substrate binding or the terminating reaction was impaired. Exchanges to other aromatic residues (W324H, W324F, W324Y, H579F, H579Y, and H579W) resulted in enzyme catalysts with significantly reduced activity. Sequence comparisons across the angiosperm lineage provided evidence that W324 is a conserved residue, whereas the position equivalent to H579 is occupied by aromatic residues (H, F, or Y). These results are consistent with a critical role of W324 and H579 in the stabilization of carbocation intermediates. The potential of these residues to serve as the catalytic base facilitating the terminal deprotonation reaction is discussed. PMID:25733883

  7. Glutamic acid as anticancer agent: An overview

    OpenAIRE

    Dutta, Satyajit; Ray, Supratim; Nagarajan, K.

    2013-01-01

    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...

  8. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Science.gov (United States)

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  9. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  10. Characteristics of inositol phosphorylceramide synthase and effects of aureobasidin A on growth and pathogenicity of Botrytis cinerea.

    Science.gov (United States)

    Wang, Xin-hui; Guo, Xing-Jun; Li, Hong-Ye; Gou, Ping

    2015-01-01

    Inositol phosphorylceramide (IPC) synthase is the key enzyme with highly conserved sequences, which is involved in fungal sphingolipid biosynthesis. The antibiotic aureobasidin A (AbA) induces the death of fungi through inhibiting IPC synthase activity. The mutations of AUR1 gene coding IPC synthase in fungi and protozoa causes a resistance to AbA. However, the mechanism of AbA resistance is still elusive. In this paper, we generated two mutants of Botrytis cinerea with AbA-resistance, BcAUR1a and BcAUR1b, through UV irradiation. BcAUR1a lost an intron and BcAUR1b had three amino acid mutations (L197P, F288S and T323A) in the AUR1 gene. AbA strongly inhibits the activity of IPC synthase in wild-type B. cinerea, which leads to distinct changes in cell morphology, including the delay in conidial germination, excessive branching near the tip of the germ tube and mycelium, and the inhibition of the mycelium growth. Further, AbA prevents the infection of wild-type B. cinerea in tomato fruits via reducing oxalic acid secretion and the activity of cellulase and pectinase. On the contrary, AbA has no effect on the growth and pathogenicity of the two mutants. Although both mutants show a similar AbA resistance, the molecular mechanisms might be different between the two mutants.

  11. Predicted cycloartenol synthase protein from Kandelia obovata and Rhizophora stylosa using online software of Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.

  12. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, K

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  13. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed ...

  14. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  15. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    and endothelial nitric oxide synthase (NOS)], and enzymatic NO synthase activity. MRI guided biopsies documented more active plaques than macroscopic examination, and histological examination revealed further lesions. Inducible NOS (iNOS) was the dominant IR isoform, while reactive astrocytes were the dominant i...

  16. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi

    2007-09-30

    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  17. Distinct Structural Elements Dictate the Specificity of the Type III Pentaketide Synthase from Neurospora crassa

    Energy Technology Data Exchange (ETDEWEB)

    Rubin-Pitel, Sheryl B.; Zhang, Houjin; Vu, Trang; Brunzelle, Joseph S.; Zhao, Huimin; Nair, Satish K. (UIUC); (NWU)

    2009-01-15

    The fungal type III polyketide synthase 2'-oxoalkylresorcyclic acid synthase (ORAS) primes with a range of acyl-Coenzyme A thioesters (C{sub 4}--C{sub 20}) and extends using malonyl-Coenzyme A to produce pyrones, resorcinols, and resorcylic acids. To gain insight into this unusual substrate specificity and product profile, we have determined the crystal structures of ORAS to 1.75 {angstrom} resolution, the Phe-252{yields}Gly site-directed mutant to 2.1 {angstrom} resolution, and a binary conplex of ORAS with eicosanoic acid to 2.0 {angstrom} resolution. The structures reveal a distinct rearrangement of structural elements near the active site that allows accomodation of long-chain fatty acid esters and a reorientation of the gating mechanism that controls cyclization and polyketide chain length. The roles of these structural elements are further elucidated by characterization of various structure-based site-directed variants. These studies establish an unexpected plasticity to the PKS fold, unanticipated from structural studies of other members of this enzyme family.

  18. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  19. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  20. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  1. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  2. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  3. Phosphorylation Regulates myo-Inositol-3-phosphate Synthase

    Science.gov (United States)

    Deranieh, Rania M.; He, Quan; Caruso, Joseph A.; Greenberg, Miriam L.

    2013-01-01

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using 32Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS. PMID:23902760

  4. Novel applications of plant polyketide synthases.

    Science.gov (United States)

    Abe, Ikuro

    2012-04-01

    The structurally and mechanistically simple type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkably diverse structures and biological activities. By exploiting the enzymes, we combined precursor-directed biosynthesis with nitrogen-containing substrates and structure-based enzyme engineering and generated unnatural, novel polyketide-alkaloid scaffolds with promising biological activities. The nucleophilic nitrogen atom and the engineered enzymes thus facilitated the formation of additional CC and CN bonds during the enzymatic transformations. The methodology will contribute to the further production of chemically and structurally divergent, unnatural natural products, as well as the rational design of novel biocatalysts with unprecedented catalytic functions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Tyrosine nitration affects thymidylate synthase properties.

    Science.gov (United States)

    Dąbrowska-Maś, Elżbieta; Frączyk, Tomasz; Ruman, Tomasz; Radziszewska, Karolina; Wilk, Piotr; Cieśla, Joanna; Zieliński, Zbigniew; Jurkiewicz, Agata; Gołos, Barbara; Wińska, Patrycja; Wałajtys-Rode, Elżbieta; Leś, Andrzej; Nizioł, Joanna; Jarmuła, Adam; Stefanowicz, Piotr; Szewczuk, Zbigniew; Rode, Wojciech

    2012-01-14

    Highly purified preparations of thymidylate synthase, isolated from calf thymus, and L1210 parental and FdUrd-resistant cells, were found to be nitrated, as indicated by a specific reaction with anti-nitro-tyrosine antibodies, suggesting this modification to appear endogenously in normal and tumor tissues. Each human, mouse and Ceanorhabditis elegans recombinant TS preparation, incubated in vitro in the presence of NaHCO(3), NaNO(2) and H(2)O(2) at pH 7.5, underwent tyrosine nitration, leading to a V(max)(app) 2-fold lower following nitration of 1 (with human or C. elegans TS) or 2 (with mouse TS) tyrosine residues per monomer. Enzyme interactions with dUMP, meTHF or 5-fluoro-dUMP were not distinctly influenced. Nitration under the same conditions of model tripeptides of a general formula H(2)N-Gly-X-Gly-COOH (X = Phe, Tyr, Trp, Lys, Arg, His, Ser, Thr, Cys, Gly), monitored by NMR spectroscopy, showed formation of nitro-species only for H-Gly-Tyr-Gly-OH and H-Gly-Phe-Gly-OH peptides, the chemical shifts for nitrated H-Gly-Tyr-Gly-OH peptide being in a very good agreement with the strongest peak found in (15)N-(1)H HMBC spectrum of nitrated protein. MS analysis of nitrated human and C. elegans proteins revealed several thymidylate synthase-derived peptides containing nitro-tyrosine (at positions 33, 65, 135, 213, 230, 258 and 301 in the human enzyme) and oxidized cysteine (human protein Cys(210), with catalytically critical Cys(195) remaining apparently unmodified) residues.

  6. CLYBL is a polymorphic human enzyme with malate synthase and β-methylmalate synthase activity

    Science.gov (United States)

    Strittmatter, Laura; Li, Yang; Nakatsuka, Nathan J.; Calvo, Sarah E.; Grabarek, Zenon; Mootha, Vamsi K.

    2014-01-01

    CLYBL is a human mitochondrial enzyme of unknown function that is found in multiple eukaryotic taxa and conserved to bacteria. The protein is expressed in the mitochondria of all mammalian organs, with highest expression in brown fat and kidney. Approximately 5% of all humans harbor a premature stop polymorphism in CLYBL that has been associated with reduced levels of circulating vitamin B12. Using comparative genomics, we now show that CLYBL is strongly co-expressed with and co-evolved specifically with other components of the mitochondrial B12 pathway. We confirm that the premature stop polymorphism in CLYBL leads to a loss of protein expression. To elucidate the molecular function of CLYBL, we used comparative operon analysis, structural modeling and enzyme kinetics. We report that CLYBL encodes a malate/β-methylmalate synthase, converting glyoxylate and acetyl-CoA to malate, or glyoxylate and propionyl-CoA to β-methylmalate. Malate synthases are best known for their established role in the glyoxylate shunt of plants and lower organisms and are traditionally described as not occurring in humans. The broader role of a malate/β-methylmalate synthase in human physiology and its mechanistic link to vitamin B12 metabolism remain unknown. PMID:24334609

  7. Human hematopoietic prostaglandin D synthase inhibitor complex structures.

    Science.gov (United States)

    Kado, Yuji; Aritake, Kosuke; Uodome, Nobuko; Okano, Yousuke; Okazaki, Nobuo; Matsumura, Hiroyoshi; Urade, Yoshihiro; Inoue, Tsuyoshi

    2012-04-01

    In mast and Th2 cells, hematopoietic prostaglandin (PG) D synthase (H-PGDS) catalyses the isomerization of PGH(2) in the presence of glutathione (GSH) to produce the allergic and inflammatory mediator PGD(2). We determined the X-ray structures of human H-PGDS inhibitor complexes with 1-amino-4-{4-[4-chloro-6-(2-sulpho-phenylamino)-[1,3,5]triazin-2-ylmethyl]-3-sulpho-phenylamino}-9,10-dioxo-9,10-dihydro-anthracene-2-sulphonic acid (Cibacron Blue) and 1-amino-4-(4-aminosulphonyl) phenyl-anthraquinone-2-sulphonic acid (APAS) at 2.0 Å resolution. When complexed with H-PGDS, Cibacron Blue had an IC(50) value of 40 nM and APAS 2.1 μM. The Cibacron Blue molecule was stabilized by four hydrogen bonds and π-π stacking between the anthraquinone ring and Trp104, the ceiling of the active site H-PGDS pocket. Among the four hydrogen bonds, the Cibacron Blue terminal sulphonic group directly interacted with conserved residues Lys112 and Lys198, which recognize the PGH(2) substrate α-chain. In contrast, the APAS anthraquinone ring was inverted to interact with Trp104, while its benzenesulphonic group penetrated the GSH-bound region at the bottom of the active site. Due to the lack of extended aromatic rings, APAS could not directly hydrogen bond with the two conserved lysine residues, thus decreasing the total number of hydrogen bond from four to one. These factors may contribute to the 50-fold difference in the IC(50) values obtained for the two inhibitors.

  8. Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.

    1992-01-15

    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  9. Biochemistry and Crystal Structure of Ectoine Synthase: A Metal-Containing Member of the Cupin Superfamily.

    Directory of Open Access Journals (Sweden)

    Nils Widderich

    Full Text Available Ectoine is a compatible solute and chemical chaperone widely used by members of the Bacteria and a few Archaea to fend-off the detrimental effects of high external osmolarity on cellular physiology and growth. Ectoine synthase (EctC catalyzes the last step in ectoine production and mediates the ring closure of the substrate N-gamma-acetyl-L-2,4-diaminobutyric acid through a water elimination reaction. However, the crystal structure of ectoine synthase is not known and a clear understanding of how its fold contributes to enzyme activity is thus lacking. Using the ectoine synthase from the cold-adapted marine bacterium Sphingopyxis alaskensis (Sa, we report here both a detailed biochemical characterization of the EctC enzyme and the high-resolution crystal structure of its apo-form. Structural analysis classified the (SaEctC protein as a member of the cupin superfamily. EctC forms a dimer with a head-to-tail arrangement, both in solution and in the crystal structure. The interface of the dimer assembly is shaped through backbone-contacts and weak hydrophobic interactions mediated by two beta-sheets within each monomer. We show for the first time that ectoine synthase harbors a catalytically important metal co-factor; metal depletion and reconstitution experiments suggest that EctC is probably an iron-dependent enzyme. We found that EctC not only effectively converts its natural substrate N-gamma-acetyl-L-2,4-diaminobutyric acid into ectoine through a cyclocondensation reaction, but that it can also use the isomer N-alpha-acetyl-L-2,4-diaminobutyric acid as its substrate, albeit with substantially reduced catalytic efficiency. Structure-guided site-directed mutagenesis experiments targeting amino acid residues that are evolutionarily highly conserved among the extended EctC protein family, including those forming the presumptive iron-binding site, were conducted to functionally analyze the properties of the resulting EctC variants. An assessment of

  10. THE POLYMORPHISM OF THE SUS4 SUCROSE SYNTHASE DOMAIN SEQUENCES IN RUSSIAN, BELORUSSIAN AND KAZAKH POTATO CULTIVARS

    Directory of Open Access Journals (Sweden)

    M. A. Slugina

    2016-01-01

    Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

  11. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    Science.gov (United States)

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  12. Bioengineering of the plant culture of Capsicum frutescens with vanillin synthase gene for the production of vanillin

    OpenAIRE

    Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan

    2016-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...

  13. Yeast Cells Lacking the CIT1-encoded Mitochondrial Citrate Synthase Are Hypersusceptible to Heat- or Aging-induced Apoptosis

    OpenAIRE

    Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae

    2007-01-01

    In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...

  14. Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity

    DEFF Research Database (Denmark)

    Willemoës, Martin; Mølgaard, Anne; Johansson, Eva

    2005-01-01

    GTP is an allosteric activator of CTP synthase and acts to increase the k(cat) for the glutamine-dependent CTP synthesis reaction. GTP is suggested, in part, to optimally orient the oxy-anion hole for hydrolysis of glutamine that takes place in the glutamine amidotransferase class I (GATase) doma...... with lid L11 and indicate that the GTP activation of glutamine dependent CTP synthesis may be explained by structural rearrangements around the oxy-anion hole of the GATase domain......GTP is an allosteric activator of CTP synthase and acts to increase the k(cat) for the glutamine-dependent CTP synthesis reaction. GTP is suggested, in part, to optimally orient the oxy-anion hole for hydrolysis of glutamine that takes place in the glutamine amidotransferase class I (GATase) domain...... of CTP synthase. In the GATase domain of the recently published structures of the Escherichia coli and Thermus thermophilus CTP synthases a loop region immediately proceeding amino acid residues forming the oxy-anion hole and named lid L11 is shown for the latter enzyme to be flexible and change position...

  15. Crystallization and Preliminary X-ray Analysis of Allene Oxide Synthase, Cytochrome P450 CYP74A2, from Parthenium argentatum

    Science.gov (United States)

    Oxylipins are oxygenated derivatives of fatty acids and pivotal signaling molecules in plants and animals. Allene oxide synthase (AOS) is a key cytochrome P450 CYP74 enzyme involved in the biosynthesis of plant oxylipin jasmonates to convert 13(S)-hydroperoxide to allene oxide. Guayule (Parthenium a...

  16. Distribution of vasoactive intestinal peptide, pituitary adenylate cyclase-activating peptide, nitric oxide synthase, and their receptors in human and rat sphenopalatine ganglion

    DEFF Research Database (Denmark)

    Csati, A; Tajti, J; Kuris, A

    2012-01-01

    for the demonstration of vasoactive intestinal peptide (VIP), pituitary adenylate cyclase-activating peptide (PACAP), nitric oxide synthase (NOS), glutamine synthetase (GS), glial fibrillary acidic protein (GFAP), VIP and PACAP common receptors (VPAC1, VPAC2), and PACAP receptor (PAC1). In addition, double labeling...

  17. Functional and evolutionary relationships between terpene synthases from Australian Myrtaceae.

    Science.gov (United States)

    Keszei, Andras; Brubaker, Curt L; Carter, Richard; Köllner, Tobias; Degenhardt, Jörg; Foley, William J

    2010-06-01

    Myrtaceae is one of the chemically most variable and most significant essential oil yielding plant families. Despite an abundance of chemical information, very little work has focussed on the biochemistry of terpene production in these plants. We describe 70 unique partial terpene synthase transcripts and eight full-length cDNA clones from 21 myrtaceous species, and compare phylogenetic relationships and leaf oil composition to reveal clades defined by common function. We provide further support for the correlation between function and phylogenetic relationships by the first functional characterisation of terpene synthases from Myrtaceae: a 1,8-cineole synthase from Eucalyptus sideroxylon and a caryophyllene synthase from Eucalyptusdives. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. Regulation of CDP-diacylglycerol synthase activity in Saccharomyces cerevisiae.

    OpenAIRE

    Homann, M J; Henry, S A; Carman, G M

    1985-01-01

    The addition of ethanolamine or choline to inositol-containing growth medium resulted in a reduction of CTP:phosphatidate cytidylyltransferase (CDP-diacylglycerol synthase; EC 2.7.7.41) activity in Saccharomyces cerevisiae. The reduction of activity did not occur in the absence of inositol. CDP-diacylglycerol synthase activity was not regulated in a S. cerevisiae mutant strain (opi1; an inositol biosynthesis regulatory mutant) by the addition of phospholipid precursors to the growth medium.

  19. Enantiospecific (+)- and (-)-germacrene D synthases, cloned from goldenrod, reveal a functionally active variant of the universal isoprenoid-biosynthesis aspartate-rich motif.

    Science.gov (United States)

    Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H

    2004-12-15

    The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.

  20. Homocystinuria due to cystathionine beta synthase deficiency

    Directory of Open Access Journals (Sweden)

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  1. Type III polyketide synthases in microorganisms.

    Science.gov (United States)

    Katsuyama, Yohei; Ohnishi, Yasuo

    2012-01-01

    Type III polyketide synthases (PKSs) are simple homodimers of ketosynthases which catalyze the condensation of one to several molecules of extender substrate onto a starter substrate through iterative decarboxylative Claisen condensation reactions. Type III PKSs have been found in bacteria and fungi, as well as plants. Microbial type III PKSs, which are involved in the biosynthesis of some lipidic compounds and various secondary metabolites, have several interesting characteristics that are not shared by plant type III PKSs. Further, many compounds produced by microbial type III PKSs have significant biological functions and/or important pharmaceutical activities. Thus, studies on this class of enzymes will expand our knowledge of the biosynthetic machineries that generate natural products and generate new findings about microbial physiology. The recent development of next-generation DNA sequencing has allowed for an increase in the number of microbial genomes sequenced and the discovery of many microbial type III PKS genes. Here, we describe basic methods to study microbial type III PKSs whose genes are easy to clone. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Undecaprenyl diphosphate synthase inhibitors: antibacterial drug leads.

    Science.gov (United States)

    Sinko, William; Wang, Yang; Zhu, Wei; Zhang, Yonghui; Feixas, Ferran; Cox, Courtney L; Mitchell, Douglas A; Oldfield, Eric; McCammon, J Andrew

    2014-07-10

    There is a significant need for new antibiotics due to the rise in drug resistance. Drugs such as methicillin and vancomycin target bacterial cell wall biosynthesis, but methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococci (VRE) have now arisen and are of major concern. Inhibitors acting on new targets in cell wall biosynthesis are thus of particular interest since they might also restore sensitivity to existing drugs, and the cis-prenyl transferase undecaprenyl diphosphate synthase (UPPS), essential for lipid I, lipid II, and thus, peptidoglycan biosynthesis, is one such target. We used 12 UPPS crystal structures to validate virtual screening models and then assayed 100 virtual hits (from 450,000 compounds) against UPPS from S. aureus and Escherichia coli. The most promising inhibitors (IC50 ∼2 μM, Ki ∼300 nM) had activity against MRSA, Listeria monocytogenes, Bacillus anthracis, and a vancomycin-resistant Enterococcus sp. with MIC or IC50 values in the 0.25-4 μg/mL range. Moreover, one compound (1), a rhodanine with close structural similarity to the commercial diabetes drug epalrestat, exhibited good activity as well as a fractional inhibitory concentration index (FICI) of 0.1 with methicillin against the community-acquired MRSA USA300 strain, indicating strong synergism.

  3. Nitric oxide synthase in ferret brain: localization and characterization.

    Science.gov (United States)

    Matsumoto, T.; Mitchell, J. A.; Schmidt, H. H.; Kohlhaas, K. L.; Warner, T. D.; Förstermann, U.; Murad, F.

    1992-01-01

    1. In the present study, we have investigated the distribution of nitric oxide synthase in the ferret brain. Nitric oxide synthase was determined biochemically and immunochemically. 2. In the rat brain, the highest nitric oxide synthase activity has been detected in the cerebellum. However, in the ferret brain, the highest activity was found in the striatum and the lowest in the cerebellum and cerebral cortex. The enzymatic activity was localized predominantly in the cytosolic fractions, it was dependent on NADPH and Ca2+, and inhibited by NG-nitro-L-arginine or NG-methyl-L-arginine. 3. Western blot analysis revealed that all regions of the ferret brain contained a 160 kD protein crossreacting with an antibody to nitric oxide synthase purified from the rat cerebellum, and the levels of relative intensity of staining by the antibody correlated with the distribution of nitric oxide synthase activity. 4. These results indicate that the ferret brain contains a nitric oxide synthase similar to the rat brain, but the distribution of enzymatic activity in the ferret brain differs markedly from the rat brain. Images Figure 1 PMID:1282076

  4. Riboflavin synthase of Schizosaccharomyces pombe. Protein dynamics revealed by 19F NMR protein perturbation experiments

    Directory of Open Access Journals (Sweden)

    Cushman Mark

    2003-12-01

    Full Text Available Abstract Background Riboflavin synthase catalyzes the transformation of 6,7-dimethyl-8-ribityllumazine into riboflavin in the last step of the riboflavin biosynthetic pathway. Gram-negative bacteria and certain yeasts are unable to incorporate riboflavin from the environment and are therefore absolutely dependent on endogenous synthesis of the vitamin. Riboflavin synthase is therefore a potential target for the development of antiinfective drugs. Results A cDNA sequence from Schizosaccharomyces pombe comprising a hypothetical open reading frame with similarity to riboflavin synthase of Escherichia coli was expressed in a recombinant E. coli strain. The recombinant protein is a homotrimer of 23 kDa subunits as shown by sedimentation equilibrium centrifugation. The protein sediments at an apparent velocity of 4.1 S at 20°C. The amino acid sequence is characterized by internal sequence similarity indicating two similar folding domains per subunit. The enzyme catalyzes the formation of riboflavin from 6,7-dimethyl-8-ribityllumazine at a rate of 158 nmol mg-1 min-1 with an apparent KM of 5.7 microM. 19F NMR protein perturbation experiments using fluorine-substituted intermediate analogs show multiple signals indicating that a given ligand can be bound in at least 4 different states. 19F NMR signals of enzyme-bound intermediate analogs were assigned to ligands bound by the N-terminal respectively C-terminal folding domain on basis of NMR studies with mutant proteins. Conclusion Riboflavin synthase of Schizosaccharomyces pombe is a trimer of identical 23-kDa subunits. The primary structure is characterized by considerable similarity of the C-terminal and N-terminal parts. Riboflavin synthase catalyzes a mechanistically complex dismutation of 6,7-dimethyl-8-ribityllumazine affording riboflavin and 5-amino-6-ribitylamino-2,4(1H,3H-pyrimidinedione. The 19F NMR data suggest large scale dynamic mobility in the trimeric protein which may play an important

  5. Abietadiene synthase from grand fir (Abies grandis): characterization and mechanism of action of the "pseudomature" recombinant enzyme.

    Science.gov (United States)

    Peters, R J; Flory, J E; Jetter, R; Ravn, M M; Lee, H J; Coates, R M; Croteau, R B

    2000-12-19

    The oleoresin secreted by grand fir (Abies grandis) is composed of resin acids derived largely from the abietane family of diterpene olefins as precursors which undergo subsequent oxidation of the C18-methyl group to a carboxyl function, for example, in the conversion of abieta-7,13-diene to abietic acid. A cDNA encoding abietadiene synthase has been isolated from grand fir and the heterologously expressed bifunctional enzyme shown to catalyze both the protonation-initiated cyclization of geranylgeranyl diphosphate to the intermediate (+)-copalyl diphosphate and the ionization-dependent cyclization of (+)-copalyl diphosphate, via a pimarenyl intermediate, to the olefin end products. Abietadiene synthase is translated as a preprotein bearing an N-terminal plastidial targeting sequence, and this form of the recombinant protein expressed in Escherichia coli proved to be unsuitable for detailed structure-function studies. Since the transit peptide-mature protein cleavage site could not be determined directly, a truncation series was constructed to delete the targeting sequence and prepare a "pseudomature" form of the enzyme that resembled the native abietadiene synthase in kinetic properties. Both the native synthase and the pseudomature synthase having 84 residues deleted from the preprotein converted geranylgeranyl diphosphate and the intermediate (+)-copalyl diphosphate to a nearly equal mixture of abietadiene, levopimaradiene, and neoabietadiene, as well as to three minor products, indicating that this single enzyme accounts for production of all of the resin acid precursors of grand fir. Kinetic evaluation of abietadiene synthase with geranylgeranyl diphosphate and (+)-copalyl diphosphate provided evidence for two functionally distinct active sites, the first for the cyclization of geranylgeranyl diphosphate to (+)-copalyl diphosphate and the second for the cyclization of (+)-copalyl diphosphate to diterpene end products, and demonstrated that the rate

  6. Pro-lipogenic Action of Lysophosphatidic Acid in Ovarian Cancer

    Science.gov (United States)

    2014-04-01

    synthetic progestins used in oral contraceptives enhances fatty acid synthase-dependent breast cancer cell proliferation and survival. Int. J. Oncol. 26...acid in ovarian cancer PRINCIPAL INVESTIGATOR: Xianjun Fang CONTRACTING ORGANIZATION: Virginia Commonwealth University Richmond...2011-30 December 2013 4. TITLE AND SUBTITLE Pro-lipogenic action of lysophosphatidic acid in ovarian cancer 5a. CONTRACT NUMBER 5b. GRANT

  7. Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens

    Directory of Open Access Journals (Sweden)

    Mahiran Basri

    2012-08-01

    Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.

  8. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.).

    Science.gov (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir

    2013-07-01

    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  9. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Platensimycin activity against mycobacterial beta-ketoacyl-ACP synthases.

    Directory of Open Access Journals (Sweden)

    Alistair K Brown

    2009-07-01

    Full Text Available There is an urgent need for the discovery and development of new drugs against Mycobacterium tuberculosis, the causative agent of tuberculosis, especially due to the recent emergence of multi-drug and extensively-drug resistant strains. Herein, we have examined the susceptibility of mycobacteria to the natural product platensimycin.We have demonstrated that platensimycin has bacteriostatic activity against the fast growing Mycobacterium smegmatis (MIC = 14 microg/ml and against Mycobacterium tuberculosis (MIC = 12 microg/ml. Growth in the presence of paltensimycin specifically inhibited the biosynthesis of mycolic acids suggesting that the antibiotic targeted the components of the mycolate biosynthesis complex. Given the inhibitory activity of platensimycin against beta-ketoacyl-ACP synthases from Staphylococcus aureus, M. tuberculosis KasA, KasB or FabH were overexpressed in M. smegmatis to establish whether these mycobacterial KAS enzymes were targets of platensimycin. In M. smegmatis overexpression of kasA or kasB increased the MIC of the strains from 14 microg/ml, to 30 and 124 microg/ml respectively. However, overexpression of fabH on did not affect the MIC. Additionally, consistent with the overexpression data, in vitro assays using purified proteins demonstrated that platensimycin inhibited Mt-KasA and Mt-KasB, but not Mt-FabH.Our results have shown that platensimycin is active against mycobacterial KasA and KasB and is thus an exciting lead compound against M. tuberculosis and the development of new synthetic analogues.

  11. Identification of a novel hedycaryol synthase gene isolated from Camellia brevistyla flowers and floral scent of Camellia cultivars.

    Science.gov (United States)

    Hattan, Jun-ichiro; Shindo, Kazutoshi; Ito, Tomoko; Shibuya, Yurica; Watanabe, Arisa; Tagaki, Chie; Ohno, Fumina; Sasaki, Tetsuya; Ishii, Jun; Kondo, Akihiko; Misawa, Norihiko

    2016-04-01

    A novel terpene synthase (Tps) gene isolated from Camellia brevistyla was identified as hedycaryol synthase, which was shown to be expressed specifically in flowers. Camellia plants are very popular because they bloom in winter when other plants seldom flower. Many ornamental cultivars of Camellia have been bred mainly in Japan, although the fragrance of their flowers has not been studied extensively. We analyzed floral scents of several Camellia cultivars by gas chromatography-mass spectrometry (GC-MS) and found that Camellia brevistyla produced various sesquiterpenes in addition to monoterpenes, whereas Camellia japonica and its cross-lines produced only monoterpenes, including linalool as the main product. From a flower of C. brevistyla, we isolated one cDNA encoding a terpene synthase (TPS) comprised of 554 amino acids, which was phylogenetically positioned to a sole gene clade. The cDNA, designated CbTps1, was expressed in mevalonate-pathway-engineered Escherichia coli, which carried the Streptomyces mevalonate-pathway gene cluster in addition to the acetoacetate-CoA ligase gene. A terpene product was purified from recombinant E. coli cultured with lithium acetoacetate, and analyzed by (1)H-nulcear magnetic resonance spectroscopy ((1)H-NMR) and GC-MS. It was shown that a sesquiterpene hedycaryol was produced, because (1)H-NMR signals of the purified product were very broad, and elemol, a thermal rearrangement product from hedycaryol, was identified by GC-MS analysis. Spectroscopic data of elemol were also determined. These results indicated that the CbTps1 gene encodes hedycaryol synthase. Expression analysis of CbTps1 showed that it was expressed specifically in flowers, and hedycaryol is likely to be one of the terpenes that attract insects for pollination of C. brevistyla. A linalool synthase gene, which was isolated from a flower of Camellia saluenensis, is also described.

  12. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  13. Catalytic residues Lys197 and Arg199 of Bacillus subtilis phosphoribosyl diphosphate synthase. Alanine-scanning mutagenesis of the flexible catalytic loop

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W

    2005-01-01

    Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...... enzyme. Kinetic characterization showed that the V(max) values of the K197A and R199A mutant enzymes were more than 30 000- and more than 24 000-fold reduced, respectively, compared to the wildtype enzyme. The K(m) values for ATP and ribose 5-phosphate of the two mutant enzymes were essentially unchanged...

  14. Unusual 4-hydroxybenzaldehyde synthase activity from tissue cultures of the vanilla orchid Vanilla planifolia.

    Science.gov (United States)

    Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A

    2002-11-01

    Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.

  15. Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

    Science.gov (United States)

    Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

    2016-05-01

    Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Cloning, expression, and characterization of epi-cedrol synthase, a sesquiterpene cyclase from Artemisia annua L.

    Science.gov (United States)

    Mercke, P; Crock, J; Croteau, R; Brodelius, P E

    1999-09-15

    Sesquiterpene cyclases (synthases) catalyze the conversion of the isoprenoid intermediate farnesyl diphosphate to various sesquiterpene structural types. In plants, many sesquiterpenes are produced as defensive chemicals (phytoalexins) or mediators of chemical communication (i.e., pollinator attractants). A number of sesquiterpene synthases are present in Artemisia annua L. (annual wormwood). We have isolated a cDNA clone encoding one of these, epi-cedrol synthase. This clone contains a 1641-bp open reading frame coding for 547 amino acids (63.5 kDa), a 38-bp 5'-untranslated end, and a 272-bp 3'-untranslated sequence. The deduced amino acid sequence was 32 to 43% identical with the sequences of other known sesquiterpene cyclases from angiosperms. When expressed in Escherichia coli, the recombinant enzyme catalyzed the formation of both olefinic (3%) and oxygenated (97%) sesquiterpenes from farnesyl diphosphate. GC-MS analysis identified the olefins as alpha-cedrene (57% of the olefins), beta-cedrene (13%), (E)-beta-farnesene (5%), alpha-acoradiene (1%), (E)-alpha-bisabolene (8%), and three unknown olefins (16%) and the oxygenated sesquiterpenes (97% of total sesquiterpene generated, exclusive of farnesol and nerolidol) as cedrol (4%) and epi-cedrol (96%). epi-Cedrol synthase was not active with geranylgeranyl diphosphate as substrate, whereas geranyl diphosphate was converted to monoterpenes by the recombinant enzyme at a rate of about 15% of that observed with farnesyl diphosphate as substrate. The monoterpene olefin products are limonene (45%), terpinolene (42%), gamma-terpinene (8%), myrcene (5%), and alpha-terpinene (2%); a small amount of the monoterpene alcohol terpinen-4-ol is also produced. The pH optimum for the recombinant enzyme is 8.5-9.0 (with farnesyl diphosphate as substrate) and the K(m) values for farnesyl diphosphate are 0.4 and 1.3 microM at pH 7. 0 and 9.0, respectively. The K(m) for Mg(2+) is 80 microM at pH 7.0 and 9.0.

  17. Homology of 1-aminocyclopropane-1-carboxylate synthase, 8-amino-7-oxononanoate synthase, 2-amino-6-caprolactam racemase, 2,2-dialkylglycine decarboxylase, glutamate-1-semialdehyde 2,1-aminomutase and isopenicillin-N-epimerase with aminotransferases.

    Science.gov (United States)

    Mehta, P K; Christen, P

    1994-01-14

    Profile analysis showed the title enzymes to be homologous with the aminotransferases. 1-Aminocyclopropane-1-carboxylate synthase is closely related to subgroup I of aminotransferases which includes aspartate, alanine, histidinol-phosphate, tyrosine and phenylalanine aminotransferase. 2,2-Dialkylglycine decarboxylase, glutamate-1-semialdehyde 2,1-aminomutase and 2-amino-6-caprolactam racemase are most similar to subgroup II which comprises aminotransferases with omega-amino acids as substrates. 8-Amino-7-oxononanoate synthase is closely related to both subgroup I and II, and isopenicillin-N-epimerase to subgroup IV with serine and phosphoserine aminotransferase. Aminotransferases and the title enzymes belong to a regio-specific family of evolutionarily related pyridoxal-5'-phosphate-dependent enzymes.

  18. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  20. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  1. A Comparative Analysis of Acyl-Homoserine Lactone Synthase Assays.

    Science.gov (United States)

    Shin, Daniel; Frane, Nicole D; Brecht, Ryan M; Keeler, Jesse; Nagarajan, Rajesh

    2015-12-01

    Quorum sensing is cell-to-cell communication that allows bacteria to coordinate attacks on their hosts by inducing virulent gene expression, biofilm production, and other cellular functions, including antibiotic resistance. AHL synthase enzymes synthesize N-acyl-l-homoserine lactones, commonly referred to as autoinducers, to facilitate quorum sensing in Gram-negative bacteria. Studying the synthases, however, has proven to be a difficult road. Two assays, including a radiolabeled assay and a colorimetric (DCPIP) assay are well-documented in literature to study AHL synthases. In this paper, we describe additional methods that include an HPLC-based, C-S bond cleavage and coupled assays to investigate this class of enzymes. In addition, we compare and contrast each assay for both acyl-CoA- and acyl-ACP-utilizing synthases. The expanded toolkit described in this study should facilitate mechanistic studies on quorum sensing signal synthases and expedite discovery of antivirulent compounds. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Heterologous expression of an active chitin synthase from Rhizopus oryzae.

    Science.gov (United States)

    Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José

    2016-12-01

    Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly. Copyright © 2016. Published by Elsevier Inc.

  3. Starter unit flexibility for engineered product synthesis by the nonreducing polyketide synthase PksA.

    Science.gov (United States)

    Huitt-Roehl, Callie R; Hill, Eric A; Adams, Martina M; Vagstad, Anna L; Li, Jesse W; Townsend, Craig A

    2015-06-19

    Nonreducing polyketide synthases (NR-PKSs) are unique among PKSs in their domain structure, notably including a starter unit:acyl-carrier protein (ACP) transacylase (SAT) domain that selects an acyl group as the primer for biosynthesis, most commonly acetyl-CoA from central metabolism. This clan of mega-enzymes resembles fatty acid synthases (FASs) by sharing both their central chain elongation steps and their capacity for iterative catalysis. In this mode of synthesis, catalytic domains involved in chain extension exhibit substrate plasticity to accommodate growing chains as small as two carbons to 20 or more. PksA is the NR-PKS central to the biosynthesis of the mycotoxin aflatoxin B1 whose SAT domain accepts an unusual hexanoyl starter from a dedicated yeast-like FAS. Explored in this paper is the ability of PksA to utilize a selection of potential starter units as substrates to initiate and sustain extension and cyclization to on-target, programmed polyketide synthesis. Most of these starter units were successfully accepted and properly processed by PksA to achieve biosynthesis of the predicted naphthopyrone product. Analysis of the on-target and derailment products revealed trends of tolerance by individual PksA domains to alternative starter units. In addition, natural and un-natural variants of the active site cysteine were examined and found to be capable of biosynthesis, suggesting possible direct loading of starter units onto the β-ketoacyl synthase (KS) domain. In light of the data assembled here, the predictable synthesis of unnatural products by NR-PKSs is more fully defined.

  4. Impact of nutrient excess and endothelial nitric oxide synthase on the plasma metabolite profile in mice

    Directory of Open Access Journals (Sweden)

    Brian E Sansbury

    2014-11-01

    Full Text Available An increase in calorie consumption is associated with the recent rise in obesity prevalence. However, our current understanding of the effects of nutrient excess on major metabolic pathways appears insufficient to develop safe and effective metabolic interventions to prevent obesity. Hence, we sought to identify systemic metabolic changes caused by nutrient excess and to determine how endothelial nitric oxide synthase (eNOS—which has anti-obesogenic properties—affects systemic metabolism by measuring plasma metabolites. Wild-type (WT and eNOS transgenic (eNOS-TG mice were placed on low fat or high fat diets for six weeks, and plasma metabolites were measured using an unbiased metabolomic approach. High fat feeding in WT mice led to significant increases in fat mass, which was associated with significantly lower plasma levels of 1,5-anhydroglucitol, lysophospholipids, 3-dehydrocarnitine, and bile acids, as well as branched chain amino acids (BCAAs and their metabolites. Plasma levels of several lipids including sphingomyelins, stearoylcarnitine, dihomo-linoleate and metabolites associated with oxidative stress were increased by high fat diet. In comparison with low fat-fed WT mice, eNOS-TG mice showed lower levels of several free fatty acids, but in contrast, the levels of bile acids, amino acids, and BCAA catabolites were increased. When placed on a high fat diet, eNOS overexpressing mice showed remarkably higher levels of plasma bile acids and elevated levels of plasma BCAAs and their catabolites compared with WT mice. Treatment with GW4064, an inhibitor of bile acid synthesis, decreased plasma bile acid levels but was not sufficient to reverse the anti-obesogenic effects of eNOS overexpression. These findings reveal unique metabolic changes in response to high fat diet and eNOS overexpression and suggest that the anti-obesity effects of eNOS are likely independent of changes in the bile acid pool.

  5. Enzymatic Assays to Investigate Acyl-Homoserine Lactone Autoinducer Synthases.

    Science.gov (United States)

    Shin, Daniel; Nagarajan, Rajesh

    2018-01-01

    Bacteria use chemical molecules called autoinducers as votes to poll their numerical strength in a colony. This polling mechanism, commonly referred to as quorum sensing, enables bacteria to build a social network and provide a collective response for fighting off common threats. In Gram-negative bacteria, AHL synthases synthesize acyl-homoserine lactone (AHL) autoinducers to turn on the expression of several virulent genes including biofilm formation, protease secretion, and toxin production. Therefore, inhibiting AHL signal synthase would limit quorum sensing and virulence. In this chapter, we describe four enzymatic methods that could be adopted to investigate a broad array of AHL synthases. The enzymatic assays described here should accelerate our mechanistic understanding of quorum-sensing signal synthesis that could pave the way for discovery of potent antivirulence compounds.

  6. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  7. Epoxyalcohol synthase of Ectocarpus siliculosus. First CYP74-related enzyme of oxylipin biosynthesis in brown algae.

    Science.gov (United States)

    Toporkova, Yana Y; Fatykhova, Valeria S; Gogolev, Yuri V; Khairutdinov, Bulat I; Mukhtarova, Lucia S; Grechkin, Alexander N

    2017-02-01

    Enzymes of CYP74 family play the central role in the biosynthesis of physiologically important oxylipins in land plants. Although a broad diversity of oxylipins is known in the algae, no CYP74s or related enzymes have been detected in brown algae yet. Cloning of the first CYP74-related gene CYP5164B1 of brown alga Ectocarpus siliculosus is reported in present work. The recombinant protein was incubated with several fatty acid hydroperoxides. Linoleic acid 9-hydroperoxide (9-HPOD) was the preferred substrate, while linoleate 13-hydroperoxide (13-HPOD) was less efficient. α-Linolenic acid 9- and 13-hydroperoxides, as well as eicosapentaenoic acid 15-hydroperoxide were inefficient substrates. Both 9-HPOD and 13-HPOD were converted into epoxyalcohols. For instance, 9-HPOD was turned primarily into (9S,10S,11S,12Z)-9,10-epoxy-11-hydroxy-12-octadecenoic acid. Both epoxide and hydroxyl oxygen atoms of the epoxyalcohol were incorporated mostly from [ 18 O 2 ]9-HPOD. Thus, the enzyme exhibits the activity of epoxyalcohol synthase (EsEAS). The results show that the EsEAS isomerizes the hydroperoxides into epoxyalcohols via epoxyallylic radical, a common intermediate of different CYP74s and related enzymes. EsEAS can be considered as an archaic prototype of CYP74 family enzymes. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B Encode Hydroxyalkyl α-Pyrone Synthases Required for Pollen Development and Sporopollenin Biosynthesis in Arabidopsis thaliana[C][W][OA

    Science.gov (United States)

    Kim, Sung Soo; Grienenberger, Etienne; Lallemand, Benjamin; Colpitts, Che C.; Kim, Sun Young; Souza, Clarice de Azevedo; Geoffroy, Pierrette; Heintz, Dimitri; Krahn, Daniel; Kaiser, Markus; Kombrink, Erich; Heitz, Thierry; Suh, Dae-Yeon; Legrand, Michel; Douglas, Carl J.

    2010-01-01

    Plant type III polyketide synthases (PKSs) catalyze the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products. The fatty acyl-CoA esters synthesized by Arabidopsis thaliana ACYL-COA SYNTHETASE5 (ACOS5) are key intermediates in the biosynthesis of sporopollenin, the major constituent of exine in the outer pollen wall. By coexpression analysis, we identified two Arabidopsis PKS genes, POLYKETIDE SYNTHASE A (PKSA) and PKSB (also known as LAP6 and LAP5, respectively) that are tightly coexpressed with ACOS5. Recombinant PKSA and PKSB proteins generated tri-and tetraketide α-pyrone compounds in vitro from a broad range of potential ACOS5-generated fatty acyl-CoA starter substrates by condensation with malonyl-CoA. Furthermore, substrate preference profile and kinetic analyses strongly suggested that in planta substrates for both enzymes are midchain- and ω-hydroxylated fatty acyl-CoAs (e.g., 12-hydroxyoctadecanoyl-CoA and 16-hydroxyhexadecanoyl-CoA), which are the products of sequential actions of anther-specific fatty acid hydroxylases and acyl-CoA synthetase. PKSA and PKSB are specifically and transiently expressed in tapetal cells during microspore development in Arabidopsis anthers. Mutants compromised in expression of the PKS genes displayed pollen exine layer defects, and a double pksa pksb mutant was completely male sterile, with no apparent exine. These results show that hydroxylated α-pyrone polyketide compounds generated by the sequential action of ACOS5 and PKSA/B are potential and previously unknown sporopollenin precursors. PMID:21193570

  9. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Yan Ping Lim

    2016-06-01

    Full Text Available Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalcone synthase in plants to novel PKSs in bacteria and fungi. To date, at least 15 families of type III PKSs have been characterized, highlighting the utility of PKSs in the development of natural product libraries for therapeutic development.

  10. Structural Basis for Cyclization Specificity of Two Azotobacter Type III Polyketide Synthases

    Science.gov (United States)

    Satou, Ryutaro; Miyanaga, Akimasa; Ozawa, Hiroki; Funa, Nobutaka; Katsuyama, Yohei; Miyazono, Ken-ichi; Tanokura, Masaru; Ohnishi, Yasuo; Horinouchi, Sueharu

    2013-01-01

    Type III polyketide synthases (PKSs) show diverse cyclization specificity. We previously characterized two Azotobacter type III PKSs (ArsB and ArsC) with different cyclization specificity. ArsB and ArsC, which share a high sequence identity (71%), produce alkylresorcinols and alkylpyrones through aldol condensation and lactonization of the same polyketomethylene intermediate, respectively. Here we identified a key amino acid residue for the cyclization specificity of each enzyme by site-directed mutagenesis. Trp-281 of ArsB corresponded to Gly-284 of ArsC in the amino acid sequence alignment. The ArsB W281G mutant synthesized alkylpyrone but not alkylresorcinol. In contrast, the ArsC G284W mutant synthesized alkylresorcinol with a small amount of alkylpyrone. These results indicate that this amino acid residue (Trp-281 of ArsB or Gly-284 of ArsC) should occupy a critical position for the cyclization specificity of each enzyme. We then determined crystal structures of the wild-type and G284W ArsC proteins at resolutions of 1.76 and 1.99 Å, respectively. Comparison of these two ArsC structures indicates that the G284W substitution brings a steric wall to the active site cavity, resulting in a significant reduction of the cavity volume. We postulate that the polyketomethylene intermediate can be folded to a suitable form for aldol condensation only in such a relatively narrow cavity of ArsC G284W (and presumably ArsB). This is the first report on the alteration of cyclization specificity from lactonization to aldol condensation for a type III PKS. The ArsC G284W structure is significant as it is the first reported structure of a microbial resorcinol synthase. PMID:24100027

  11. Molecular Cloning and Functional Analysis of Squalene Synthase 2(SQS2 in Salvia miltiorrhiza Bunge

    Directory of Open Access Journals (Sweden)

    Qixian Rong

    2016-08-01

    Full Text Available Salvia miltiorrhiza Bunge,which is also known as a traditional Chinese herbal medicine,is widely studied for its ability to accumulate the diterpene quinone Tanshinones. In addition to producing a variety of diterpene quinone, S. miltiorrhiza Bunge also accumulates sterol, brassinosteroid and triterpenoids. During their biosynthesis, squalene synthase (SQS, EC 2.5.1.21 converts two molecules of the hydrophilic substrate farnesyl diphosphate into a hydrophobic product, squalene. In the present study, cloning and characterization of S. miltiorrhiza Bunge squalene synthase 2 (SmSQS2, Genbank Accession Number: KM408605 cDNA was investigated subsequently followed by its recombinant expression and preliminary enzyme activity. The full-length cDNA of SmSQS2 was 1 597 bp in length, with an open reading frame (ORF of 1 245 bp encoding 414 amino acids. The deduced amino acid sequence of SmSQS2 shared high similarity with those of SQSs from other plants. To obtain soluble recombinant enzymes, the truncated SmSQS2 in which 28 amino acids were deleted from the carboxy terminus was expressed as GST-Tag fusion protein in Escherichia coli BL21 (DE3 and confirmed by SDS-PAGE and Western Blot analysis, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. The gene expression level was analyzed through Quantitative real-time PCR, and was found to be higher in roots as compared to the leaves, and was up-regulated upon YE+ Ag+ treatment. These results could serve as an important to understand the function of the SQS family. In addition, the identification of SmSQS2 is important for further studies of terpenoid and sterol biosynthesis in S. miltiorrhiza Bunge.

  12. Molecular Cloning and Functional Analysis of Squalene Synthase 2(SQS2) in Salvia miltiorrhiza Bunge.

    Science.gov (United States)

    Rong, Qixian; Jiang, Dan; Chen, Yijun; Shen, Ye; Yuan, Qingjun; Lin, Huixin; Zha, Liangping; Zhang, Yan; Huang, Luqi

    2016-01-01

    Salvia miltiorrhiza Bunge, which is also known as a traditional Chinese herbal medicine, is widely studied for its ability to accumulate the diterpene quinone Tanshinones. In addition to producing a variety of diterpene quinone, S. miltiorrhiza Bunge also accumulates sterol, brassinosteroid and triterpenoids. During their biosynthesis, squalene synthase (SQS, EC 2.5.1.21) converts two molecules of the hydrophilic substrate farnesyl diphosphate (FPP) into a hydrophobic product, squalene. In the present study, cloning and characterization of S. miltiorrhiza Bunge squalene synthase 2 (SmSQS2, Genbank Accession Number: KM408605) cDNA was investigated subsequently followed by its recombinant expression and preliminary enzyme activity. The full-length cDNA of SmSQS2 was 1 597 bp in length, with an open reading frame of 1 245 bp encoding 414 amino acids. The deduced amino acid sequence of SmSQS2 shared high similarity with those of SQSs from other plants. To obtain soluble recombinant enzymes, the truncated SmSQS2 in which 28 amino acids were deleted from the carboxy terminus was expressed as GST-Tag fusion protein in Escherichia coli BL21 (DE3) and confirmed by SDS-PAGE and Western Blot analysis, and the resultant bacterial crude extract was incubated with FPP and NADPH. Gas chromatograph-mass spectrometer analysis showed that squalene was detected in the in vitro reaction mixture. The gene expression level was analyzed through Quantitative real-time PCR, and was found to be higher in roots as compared to the leaves, and was up-regulated upon YE+ Ag(+) treatment. These results could serve as an important to understand the function of the SQS family. In addition, the identification of SmSQS2 is important for further studies of terpenoid and sterol biosynthesis in S. miltiorrhiza Bunge.

  13. Germacrene C synthase from Lycopersicon esculentum cv. VFNT cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase.

    Science.gov (United States)

    Colby, S M; Crock, J; Dowdle-Rizzo, B; Lemaux, P G; Croteau, R

    1998-03-03

    Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, beta-caryophyllene, alpha-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton delta-cadinene synthase (50% identity).

  14. Mitochondrial 3-hydroxy-3-methylglutaryl coenzyme A synthase and carnitine palmitoyltransferase II as potential control sites for ketogenesis during mitochondrion and peroxisome proliferation.

    Science.gov (United States)

    Madsen, L; Garras, A; Asins, G; Serra, D; Hegardt, F G; Berge, R K

    1999-05-01

    3-Thia fatty acids are potent hypolipidemic fatty acid derivatives and mitochondrion and peroxisome proliferators. Administration of 3-thia fatty acids to rats was followed by significantly increased levels of plasma ketone bodies, whereas the levels of plasma non-esterified fatty acids decreased. The hepatic mRNA levels of fatty acid binding protein and formation of acid-soluble products, using both palmitoyl-CoA and palmitoyl-L-carnitine as substrates, were increased. Hepatic mitochondrial carnitine palmitoyltransferase (CPT) -II and 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase activities, immunodetectable proteins, and mRNA levels increased in parallel. In contrast, the mitochondrial CPT-I mRNA levels were unchanged and CPT-I enzyme activity was slightly reduced in the liver. The CoA ester of the monocarboxylic 3-thia fatty acid, tetradecylthioacetic acid, which accumulates in the liver after administration, inhibited the CPT-I activity in vitro, but not that of CPT-II. Acetoacetyl-CoA thiolase and HMG-CoA lyase activities involved in ketogenesis were increased, whereas the citrate synthase activity was decreased. The present data suggest that 3-thia fatty acids increase both the transport of fatty acids into the mitochondria and the capacity of the beta-oxidation process. Under these conditions, the regulation of ketogenesis may be shifted to step(s) beyond CPT-I. This opens the possibility that mitochondrial HMG-CoA synthase and CPT-II retain some control of ketone body formation.

  15. Specificity of Ocimum basilicum geraniol synthase modified by its expression in different heterologous systems.

    Science.gov (United States)

    Fischer, Marc J C; Meyer, Sophie; Claudel, Patricia; Perrin, Mireille; Ginglinger, Jean François; Gertz, Claude; Masson, Jean E; Werck-Reinhardt, Danièle; Hugueney, Philippe; Karst, Francis

    2013-01-10

    Numerous aromatic plant species produce high levels of monoterpenols, using geranyl diphosphate (GPP) as a precursor. Sweet basil (Ocimum basilicum) geraniol synthase (GES) was used to evaluate the monoterpenol profiles arising from heterologous expressions in various plant models. Grapevine (Vitis vinifera) calli were transformed using Agrobacterium tumefasciens and the plants were regenerated. Thale cress (Arabidopsis thaliana) was transformed using the floral dip method. Tobacco (Nicotiana benthamiana) leaves were agro-infiltrated for transient expression. Although, as expected, geraniol was the main product detected in the leaves, different minor products were observed in these plants (V. vinifera: citronellol and nerol; N. benthamiana: linalool and nerol; A. thaliana: none). O. basilicum GES expression was also carried out with microbial system yeasts (Saccharomyces cerevisiae) and Escherichia coli. These results suggest that the functional properties of a monoterpenol synthase depend not only on the enzyme's amino-acidic sequence, but also on the cellular background. They also suggest that some plant species or microbial expression systems could induce the simultaneous formation of several carbocations, and could thus have a natural tendency to produce a wider spectrum of monoterpenols. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. ISOLATION AND IDENTIFICATION OF A THERMOTOLERANT PLANT GROWTH PROMOTING PSEUDOMONAS PUTIDA PRODUCING TREHALOSE SYNTHASE

    Directory of Open Access Journals (Sweden)

    Ali Sk.Z.

    2013-08-01

    Full Text Available A thermotolerant plant growth promoting Pseudomonas isolate growing at 40oC producing trehalose synthase (TreS was isolated from rhizosphere soil under semi arid conditions of India. Trehalose synthase was extracted; purified and enzymatic activity was examined at various temperatures and pH. The optimum temperature and pH was 38oC and pH 7.5 and the activity declined at above or below the optimum pH and temperature. The enzyme was active on maltose and trehalose among saccharides tested. The enzyme had a higher catalytic activity for maltose with a trehalose yield of 72% than for trehalose where 30% yield of maltose was achieved, indicating maltose as preferred substrate. The isolate showed multiple plant growth promoting traits (indole acetic acid (IAA, phosphate solubilization, siderophore and ammonia both at ambient (28oC and high temperature (40oC. Based on phenotypic and 16SrRNA analysis the isolate was identified as Pseudomonas putida (Accession No. GU396283.

  17. Inversion of Extender Unit Selectivity in the Erythromycin Polyketide Synthase by Acyltransferase Domain Engineering.

    Science.gov (United States)

    Koryakina, Irina; Kasey, Christian; McArthur, John B; Lowell, Andrew N; Chemler, Joseph A; Li, Shasha; Hansen, Douglas A; Sherman, David H; Williams, Gavin J

    2017-01-20

    Acyltransferase (AT) domains of polyketide synthases (PKSs) select extender units for incorporation into polyketides and dictate large portions of the structures of clinically relevant natural products. Accordingly, there is significant interest in engineering the substrate specificity of PKS ATs in order to site-selectively manipulate polyketide structure. However, previous attempts to engineer ATs have yielded mutant PKSs with relaxed extender unit specificity, rather than an inversion of selectivity from one substrate to another. Here, by directly screening the extender unit selectivity of mutants from active site saturation libraries of an AT from the prototypical PKS, 6-deoxyerythronolide B synthase, a set of single amino acid substitutions was discovered that dramatically impact the selectivity of the PKS with only modest reductions of product yields. One particular substitution (Tyr189Arg) inverted the selectivity of the wild-type PKS from its natural substrate toward a non-natural alkynyl-modified extender unit while maintaining more than twice the activity of the wild-type PKS with its natural substrate. The strategy and mutations described herein form a platform for combinatorial biosynthesis of site-selectively modified polyketide analogues that are modified with non-natural and non-native chemical functionality.

  18. The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.

    Science.gov (United States)

    Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra

    2016-04-01

    The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.

  19. Expanding tryptophan-containing cyclodipeptide synthase spectrum by identification of nine members from Streptomyces strains.

    Science.gov (United States)

    Liu, Jing; Yu, Huili; Li, Shu-Ming

    2018-03-24

    Cyclodipeptide synthases (CDPSs) comprise normally 200-300 amino acid residues and are mainly found in bacteria. They hijack aminoacyl-tRNAs from the ribosomal machinery for cyclodipeptide formation. In this study, nine new CDPS genes from eight Streptomyces strains were cloned into pET28a vector and expressed in Escherichia coli. Structural elucidation of the isolated products led to the identification of one cyclo-L-Trp-L-Leu, two cyclo-L-Trp-L-Pro, and three cyclo-L-Trp-L-Trp synthases. Other three CDPSs produce cyclo-L-Trp-L-Ala or cyclo-L-Trp-L-Tyr as the major cyclodipeptide. Total product yields of 46 to 211 mg/L E. coli culture were obtained. Our findings represent rare examples of CDPS family derived from actinobacteria that form various tryptophan-containing cyclodipeptides. Furthermore, this study highlights the potential of the microbial machinery for tryptophan-containing cyclodipeptide biosynthesis and provides valid experimental basis for further combination of these CDPS genes with other modification genes in synthetic biology.

  20. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  1. A novel multidomain polyketide synthase is essential for zeamine production and the virulence of Dickeya zeae.

    Science.gov (United States)

    Zhou, Jianuan; Zhang, Haibao; Wu, Jien; Liu, Qiongguang; Xi, Pinggen; Lee, Jasmine; Liao, Jinling; Jiang, Zide; Zhang, Lian-Hui

    2011-10-01

    Dickeya zeae is the causal agent of the rice foot rot disease, but its mechanism of infection remains largely unknown. In this study, we identified and characterized a novel gene designated as zmsA. The gene encodes a large protein of 2,346 amino acids in length, which consists of multidomains arranged in the order of N-terminus, β-ketoacyl synthase, acyl transferase, acyl carrier protein, β-ketoacyl reductase, dehydratase. This multidomain structure and sequence alignment analysis suggest that ZmsA is a member of the polyketide synthase family. Mutation of zmsA abolished antimicrobial activity and attenuated the virulence of D. zeae. To determine the relationship between antimicrobial activity and virulence, active compounds were purified from D. zeae EC1 and were structurally characterized. This led to identification of two polyamino compounds, i.e., zeamine and zeamine II, that were phytotoxins and potent antibiotics. These results have established the essential role of ZmsA in zeamine biosynthesis and presented a new insight on the molecular mechanisms of D. zeae pathogenicity.

  2. Invertase and sucrose synthase activities in coffee plants sprayed with sucrose solution

    Directory of Open Access Journals (Sweden)

    Silva José Carlos da

    2003-01-01

    Full Text Available One management practice of which the efficiency has not yet been scientifically tested is spraying coffee plants with diluted sucrose solutions as a source of carbon for the plant. This paper evaluates the effect of foliar spraying with sugar on the endogenous level of carbohydrates and on the activities of invertase and sucrose synthase in coffee (Coffea arabica L. seedlings with reduced (low and high (normal levels of carbon reserve. The concentrations used were 0.5 and 1.0% sucrose, and water as a control. The use of sucrose at 1.0% caused an increase in the concentration of total soluble sugars in depauperate plants, as well as increased the activity of the following enzymes: cell wall and vacuole acid invertase, neutral cytosol invertase and sucrose synthase. In plants with high level of carbon reserve, no increments in total soluble sugar levels or in enzymatic activity were observed. Regardless of treatments or plants physiological state, no differences in transpiration or stomatal conductance were observed, demonstrating the stomatal control of transpiration. Photosynthesis was stimulated with the use of 0.5 and 1.0 % sucrose only in depauperate plants. Coffee seedling spraying with sucrose is only efficient for depauperate plants, at the concentration of 1.0%.

  3. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    Science.gov (United States)

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  4. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    Division of Plant Biotechnology, Institute of Forest Genetics and Tree Breeding, P.B. No. 1061 ... known as forest red gum has an extensive natural distribu- ...... mechanical stress. Plant J. 22, 495–502. Wu A., Hu J. S. and Liu J. 2009 Functional analysis of a cotton cel- lulose synthase A4 gene promoter in transgenic tobacco ...

  5. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  6. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative ...

  7. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    2014-12-26

    Dec 26, 2014 ... RESEARCH ARTICLE. Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. MANISHA PATNAIK1,5, PALLABI PATI1, SURENDRA N. SWAIN2, MANOJ K.

  8. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  9. Contribution of granule bound starch synthase in kernel modification

    African Journals Online (AJOL)

    ACSS

    The stability of both GBSS and zein proteins coupled with the use of SDS-PAGE implied that only one was more reliable and required further validation. It was clear from this study, that kernel modification was regulated by complex genetic interactions. Fairly distinct systems such as the starch synthases, zein proteins and ...

  10. Biosynthesis of polyketides by trans-AT polyketide synthases.

    OpenAIRE

    Helfrich Eric J N; Piel Jörn

    2016-01-01

    This review discusses the biosynthesis of natural products that are generated by trans AT polyketide synthases a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  11. Biosynthesis of polyketides by trans-AT polyketide synthases.

    Science.gov (United States)

    Helfrich, Eric J N; Piel, Jörn

    2016-02-01

    This review discusses the biosynthesis of natural products that are generated by trans-AT polyketide synthases, a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  12. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    HP

    Purpose: To explore the antioxidant properties of the methanol extract of Pericarpium Zanthoxyli and its effect on inducible nitric oxide synthase (iNOS), cycleooxygenase-2 (COX-2) and lipopolysaccharides (LPS)-induced cell damage in macrophage cells. Methods: Anti-oxidant activities were tested by measuring free ...

  13. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 and Lipid Peroxidation by Methanol Extract of Pericarpium Zanthoxyli. ... Production of iNOS induced by LPS was significantly (p < 0.05) inhibited by the extract, suggesting that the extract inhibits nitric oxide (NO) production by suppressing iNOS expression.

  14. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  15. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  16. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    This study was undertaken to investigate the association of aldosterone synthase C-344T, angiotensin II type I receptor A1166C and 11- hydroxysteroid dehydrogenase type 2 G534A polymorphisms with essential hypertension in the population of Odisha, India. A total of 246 hypertensive subjects (males, 159; females, ...

  17. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  18. A functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.J.; van Leeuwen, H.; Koopman, J.; Faddeeva-Vakhrusheva, A.; Suring, W.J.; de Boer, T.E.; Mariën, A.G.H.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  19. Functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.; van Leeuwen, H.; Koopman, J.; Faddeeva, A.; Suring, W.; de Boer, T.E.; Mariën, J.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    2013-01-01

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  20. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along with ...

  1. Expression of Inducible Nitric Oxide Synthase in the Epithelial ...

    African Journals Online (AJOL)

    Conclusion: iNOS was over expressed in OKCs when compared with DC and RC suggesting that iNOS may contribute to the aggressive behavior of OKC. This is yet another evidence to support that OKC is the neoplasm. Keywords: Dentigerous cyst, Immunohistochemistry, Inducible nitric oxide synthase, Odontogenic ...

  2. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  3. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  4. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  5. Cryo-EM structure of the yeast ATP synthase.

    Science.gov (United States)

    Lau, Wilson C Y; Baker, Lindsay A; Rubinstein, John L

    2008-10-24

    We have used electron cryomicroscopy of single particles to determine the structure of the ATP synthase from Saccharomyces cerevisiae. The resulting map at 24 A resolution can accommodate atomic models of the F(1)-c(10) subcomplex, the peripheral stalk subcomplex, and the N-terminal domain of the oligomycin sensitivity conferral protein. The map is similar to an earlier electron cryomicroscopy structure of bovine mitochondrial ATP synthase but with important differences. It resolves the internal structure of the membrane region of the complex, especially the membrane embedded subunits b, c, and a. Comparison of the yeast ATP synthase map, which lacks density from the dimer-specific subunits e and g, with a map of the bovine enzyme that included e and g indicates where these subunits are located in the intact complex. This new map has allowed construction of a model of subunit arrangement in the F(O) motor of ATP synthase that dictates how dimerization of the complex via subunits e and g might occur.

  6. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  7. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as the

  8. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  9. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    International Nuclear Information System (INIS)

    Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi

    2008-01-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

  10. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota, E-mail: kuroki.ryota@jaea.go.jp [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)

    2008-03-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

  11. Identification of a polyketide synthase required for alternariol (AOH and alternariol-9-methyl ether (AME formation in Alternaria alternata.

    Directory of Open Access Journals (Sweden)

    Debjani Saha

    Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.

  12. A Systems Chemical Biology Study of Malate Synthase and Isocitrate Lyase Inhibition in Mycobacterium tuberculosis During Active and NRP Growth

    Science.gov (United States)

    May, Elebeoba E.; Leitão, Andrei; Tropsha, Alexander; Oprea, Tudor I.

    2013-01-01

    The ability of Mycobacterium tuberculosis (Mtb) to survive in low oxygen environments enables the bacterium to persist in a latent state within host tissues. In vitro studies of Mtb growth have identified changes in isocitrate lyase (ICL) and malate synthase (MS) that enable bacterial persistent under low oxygen and other environmentally limiting conditions. Systems chemical biology (SCB) enables us to evaluate the effects of small molecule inhibitors not only on the reaction catalyzed by malate synthase and isocitrate lyase, but the effect on the complete tricarboxylic acid cycle (TCA) by taking into account complex network relationships within that system. To study the kinetic consequences of inhibition on persistent bacilli, we implement a systems-chemical biology (SCB) platform and perform a chemistry-centric analysis of key metabolic pathways believed to impact Mtb latency. We explore consequences of disrupting the function of malate synthase (MS) and isocitrate lyase (ICL) during aerobic and hypoxic non-replicating persistence (NRP) growth by using the SCB method to identify small molecules that inhibit the function of MS and ICL, and simulating the metabolic consequence of the disruption. Results indicate variations in target and non-target reaction steps, clear differences in the normal and low oxygen models, as well as dosage dependent response. Simulation results from singular and combined enzyme inhibition strategies suggest ICL may be the more effective target for chemotherapeutic treatment against Mtb growing in a microenvironment where oxygen is slowly depleted, which may favor persistence. PMID:24121675

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. Active-site-directed inhibition of 3-hydroxy-3-methylglutaryl coenzyme A synthase by 3-chloropropionyl coenzyme A

    International Nuclear Information System (INIS)

    Miziorko, H.M.; Behnke, C.E.

    1985-01-01

    3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue

  15. Cloning and characterization of Ginkgo biloba levopimaradiene synthase which catalyzes the first committed step in ginkgolide biosynthesis.

    Science.gov (United States)

    Schepmann, H G; Pang, J; Matsuda, S P

    2001-08-15

    Levopimaradiene synthase, which catalyzes the initial cyclization step in ginkgolide biosynthesis, was cloned and functionally characterized. A Ginkgo biloba cDNA library was prepared from seedling roots and a probe was amplified using primers corresponding to conserved gymnosperm terpene synthase sequences. Colony hybridization and rapid amplification of cDNA ends yielded a full-length clone encoding a predicted protein (873 amino acids, 100,289 Da) similar to known gymnosperm diterpene synthases. The sequence includes a putative N-terminal plastid transit peptide and three aspartate-rich regions. The full-length protein expressed in Escherichia coli cyclized geranylgeranyl diphosphate to levopimaradiene, which was identical to a synthetic standard by GC/MS analysis. Removing 60 or 79 N-terminal residues increased levopimaradiene production, but a 128-residue N-terminal deletion lacked detectable activity. This is the first cloned ginkgolide biosynthetic gene and the first in vitro observation of an isolated ginkgolide biosynthetic enzyme. Copyright 2001 Academic Press.

  16. The Rice Terpene Synthase Gene OsTPS19 Functions as an (S)-Limonene Synthase in planta and its Overexpression Leads to Enhanced Resistance to the Blast Fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defense mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defense gene. Here, we report the functional characterization of OsTPS19, which is upregulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defense against M. oryzae, at least partly, by inhibiting spore germination. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Triacetic acid lactone production from Saccharomyces cerevisiae

    Science.gov (United States)

    Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...

  18. Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme

    Directory of Open Access Journals (Sweden)

    Alberto Macone

    2010-03-01

    Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.

  19. Detailed characterization of the substrate specificity of mouse wax synthase.

    Science.gov (United States)

    Miklaszewska, Magdalena; Kawiński, Adam; Banaś, Antoni

    2013-01-01

    Wax synthases are membrane-associated enzymes catalysing the esterification reaction between fatty acyl-CoA and a long chain fatty alcohol. In living organisms, wax esters function as storage materials or provide protection against harmful environmental influences. In industry, they are used as ingredients for the production of lubricants, pharmaceuticals, and cosmetics. Currently the biological sources of wax esters are limited to jojoba oil. In order to establish a large-scale production of desired wax esters in transgenic high-yielding oilseed plants, enzymes involved in wax esters synthesis from different biological resources should be characterized in detail taking into consideration their substrate specificity. Therefore, this study aims at determining the substrate specificity of one of such enzymes -- the mouse wax synthase. The gene encoding this enzyme was expressed heterologously in Saccharomyces cerevisiae. In the in vitro assays (using microsomal fraction from transgenic yeast), we evaluated the preferences of mouse wax synthase towards a set of combinations of 11 acyl-CoAs with 17 fatty alcohols. The highest activity was observed for 14:0-CoA, 12:0-CoA, and 16:0-CoA in combination with medium chain alcohols (up to 5.2, 3.4, and 3.3 nmol wax esters/min/mg microsomal protein, respectively). Unsaturated alcohols longer than 18°C were better utilized by the enzyme in comparison to the saturated ones. Combinations of all tested alcohols with 20:0-CoA, 22:1-CoA, or Ric-CoA were poorly utilized by the enzyme, and conjugated acyl-CoAs were not utilized at all. Apart from the wax synthase activity, mouse wax synthase also exhibited a very low acyl-CoA:diacylglycerol acyltransferase activity. However, it displayed neither acyl-CoA:monoacylglycerol acyltransferase, nor acyl-CoA:sterol acyltransferase activity.

  20. Pseudouridine synthase 1: a site-specific synthase without strict sequence recognition requirements

    Science.gov (United States)

    Sibert, Bryan S.; Patton, Jeffrey R.

    2012-01-01

    Pseudouridine synthase 1 (Pus1p) is an unusual site-specific modification enzyme in that it can modify a number of positions in tRNAs and can recognize several other types of RNA. No consensus recognition sequence or structure has been identified for Pus1p. Human Pus1p was used to determine which structural or sequence elements of human tRNASer are necessary for pseudouridine (Ψ) formation at position 28 in the anticodon stem-loop (ASL). Some point mutations in the ASL stem of tRNASer had significant effects on the levels of modification and compensatory mutation, to reform the base pair, restored a wild-type level of Ψ formation. Deletion analysis showed that the tRNASer TΨC stem-loop was a determinant for modification in the ASL. A mini-substrate composed of the ASL and TΨC stem-loop exhibited significant Ψ formation at position 28 and a number of mutants were tested. Substantial base pairing in the ASL stem (3 out of 5 bp) is required, but the sequence of the TΨC loop is not required for modification. When all nucleotides in the ASL stem other than U28 were changed in a single mutant, but base pairing was retained, a near wild-type level of modification was observed. PMID:22102571

  1. A new salicylate synthase AmS is identified for siderophores biosynthesis in Amycolatopsis methanolica 239(T).

    Science.gov (United States)

    Xie, Feng; Dai, Shengwang; Shen, Jinzhao; Ren, Biao; Huang, Pei; Wang, Qiushui; Liu, Xueting; Zhang, Buchang; Dai, Huanqin; Zhang, Lixin

    2015-07-01

    Siderophores are important for the growth of bacteria or the applications in treatment of iron overload-associated diseases due to the iron-chelating property. Salicylate synthase played a key role in the biosynthesis of some NRPS-derived siderophores by the providing of an iron coordination moiety as the initial building block. A new salicylate synthase, namely AmS, was identified in the biosynthesis pathway of siderophore amychelin in Amycolatopsis methanolica 239(T), since it shunt chorismate, an integrant precursor, from primary to secondary metabolite flow. The amino acid sequence alignment and phylogenetic analysis showed that AmS grouped into a new cluster. In vitro assays of AmS revealed its wide temperature tolerance ranged from 0 to 40 °C and narrow pH tolerant ranged from 7.0 to 9.0. AmS was resistant to organic solvents and non-ionic detergents. Moreover, AmS converted chorismate to salicylate with K m of 129.05 μM, k cat of 2.20 min(-1) at optimal conditions, indicating its low substrate specificity and comparable velocity to reported counterparts (Irp9 and MbtI). These properties of AmS may improve the iron-seizing ability of A. methanolica to compete with its neighbors growing in natural environments. Most importantly, serine and cysteine residues were found to be important for the catalytic activity of AmS. This study presented AmS as a new cluster of salicylate synthase and the reaction mechanism and potential applications of salicylate synthase were highlighted as well.

  2. Kinetic characterization and phosphoregulation of the Francisella tularensis 1-deoxy-D-xylulose 5-phosphate reductoisomerase (MEP synthase.

    Directory of Open Access Journals (Sweden)

    Safdar Jawaid

    Full Text Available Deliberate and natural outbreaks of infectious disease underscore the necessity of effective vaccines and antimicrobial/antiviral therapeutics. The prevalence of antibiotic resistant strains and the ease by which antibiotic resistant bacteria can be intentionally engineered further highlights the need for continued development of novel antibiotics against new bacterial targets. Isoprenes are a class of molecules fundamentally involved in a variety of crucial biological functions. Mammalian cells utilize the mevalonic acid pathway for isoprene biosynthesis, whereas many bacteria utilize the methylerythritol phosphate (MEP pathway, making the latter an attractive target for antibiotic development. In this report we describe the cloning and characterization of Francisella tularensis MEP synthase, a MEP pathway enzyme and potential target for antibiotic development. In vitro growth-inhibition assays using fosmidomycin, an inhibitor of MEP synthase, illustrates the effectiveness of MEP pathway inhibition with F. tularensis. To facilitate drug development, F. tularensis MEP synthase was cloned, expressed, purified, and characterized. Enzyme assays produced apparent kinetic constants (K(M(DXP = 104 microM, K(M(NADPH = 13 microM, k(cat(DXP = 2 s(-1, k(cat(NADPH = 1.3 s(-1, an IC(50 for fosmidomycin of 247 nM, and a K(i for fosmidomycin of 99 nM. The enzyme exhibits a preference for Mg(+2 as a divalent cation. Titanium dioxide chromatography-tandem mass spectrometry identified Ser177 as a site of phosphorylation. S177D and S177E site-directed mutants are inactive, suggesting a mechanism for post-translational control of metabolic flux through the F. tularensis MEP pathway. Overall, our study suggests that MEP synthase is an excellent target for the development of novel antibiotics against F. tularensis.

  3. MapsiDB: an integrated web database for type I polyketide synthases.

    Science.gov (United States)

    Tae, Hongseok; Sohng, Jae Kyung; Park, Kiejung

    2009-10-01

    Polyketides have diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. They are biosynthesized from short carboxylic acid precursors by polyketide synthases (PKSs). As natural polyketide products include many clinically important drugs and the volume of data on polyketides is rapidly increasing, the development of a database system to manage polyketide data is essential. MapsiDB is an integrated web database formulated to contain data on type I polyketides and their PKSs, including domain and module composition and related genome information. Data on polyketides were collected from journals and online resources and processed with analysis programs. Web interfaces were utilized to construct and to access this database, allowing polyketide researchers to add their data to this database and to use it easily.

  4. The Nitrile-Forming Enzyme 7-Cyano-7-Deazaguanine Synthase from Geobacillus kaustophilus: A Reverse Nitrilase?

    Science.gov (United States)

    Winkler, Margit; Dokulil, Katharina; Weber, Hansjörg; Pavkov-Keller, Tea; Wilding, Birgit

    2015-11-02

    7-Cyano-7-deazaguanine synthase (E.C. 6.3.4.20) is an enzyme that catalyzes the formation of a nitrile from a carboxylic acid and ammonia at the expense of ATP. The protein from G. kaustophilus was heterologously expressed, and its biochemical characteristics were explored by using a newly developed HPLC-MS based assay, (31) P NMR, and a fluorescence-based thermal-shift assay. The protein showed the expected high thermostability, had a pH optimum at pH 9.5, and an apparent temperature optimum at 60 °C. We observed strict substrate specificity of QueC for the natural substrate 7-carboxy-7-deazaguanine, and determined AMP and pyrophosphate as co-products of preQ0. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  6. Tetrahydrobiopterin, but not L-arginine, decreases NO synthase uncoupling in cells expressing high levels of endothelial NO synthase

    NARCIS (Netherlands)

    Bevers, LM; Braam, B; Post, JA; van Zonneveld, AJ; Rabelink, TJ; Koomans, HA; Verhaar, MC; Joles, JA

    Endothelial NO synthase (eNOS) produces superoxide when depleted of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) and L-arginine by uncoupling the electron flow from NO production. High expression of eNOS has been reported to have beneficial effects in atherosclerotic arteries after relatively short

  7. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    Science.gov (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  9. Homocysteine and cysteine loads in patients with homocystinuria due to cystathionine synthase deficiency: effects of vitamin B-6.

    Science.gov (United States)

    Rassin, D K; Longhi, R C; Sternowsky, H J; Sturman, J A; Gaull, G E

    1977-08-15

    The metabolic response of patients with homocystinuria due to cystabhionine synthase deficiency to oral loads of homocysteine indicates: that even severely affected patients with homocystinuria have pools of cystine in their tissues; that control of sulfur amino acid metabolism favors increased concentrations of methionine rather than homocystine in the plasma; and that even patients who apparently are not B-6-responsive respond differently to the loads of homocysteine when challenged during B-6-treatment compared with their response before B-6 treatment. Loading tests with homocysteine indicate that B-6 treatment be of some benefit even in individuals who do not have an obvious biochemical response to such therapy.

  10. A single residue mutation of 5-enoylpyruvylshikimate-3-phosphate synthase in Pseudomonas stutzeri enhances resistance to the herbicide glyphosate.

    Science.gov (United States)

    Liang, Aimin; Sha, Jiying; Lu, Wei; Chen, Ming; Li, Liang; Jin, Dan; Yan, Yongliang; Wang, Jin; Ping, Shuzhen; Zhang, Wei; Wang, Yiding; Lin, Min

    2008-08-01

    A novel class II 5-enoylpyruvylshikimate-3-phosphate synthase (EPSPS) was identified from Pseudomonas stutzeri A1501 by complementation of an Escherichia coli auxotrophic aroA mutant. The single amino acid substitution of serine (Ser) for asparagine (Asn)-130 of the A1501 EPSPS enhanced resistance to 200 mM glyphosate. The mutated EPSPS had a 2.5-fold increase for IC(50) [glyphosate] value, a 2-fold increase for K (i) [glyphosate] value, but a K (m) [PEP] value similar to that of wild type. The effect of the single residue mutation on glyphosate resistance was also analyzed using a computer-based three-dimensional model.

  11. Characterization of a 1,4-{beta}-D-glucan synthase from Dictyostelium discoideum. Progress report, May 1990--January 1992

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, R.L.

    1992-01-15

    Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.

  12. Systematic analysis of rat 12/15-lipoxygenase enzymes reveals critical role for spinal eLOX3 hepoxilin synthase activity in inflammatory hyperalgesia

    OpenAIRE

    Gregus, Ann M.; Dumlao, Darren S.; Wei, Spencer C.; Norris, Paul C.; Catella, Laura C.; Meyerstein, Flore G.; Buczynski, Matthew W.; Steinauer, Joanne J.; Fitzsimmons, Bethany L.; Yaksh, Tony L.; Dennis, Edward A.

    2013-01-01

    Previously, we observed significant increases in spinal 12-lipoxygenase (LOX) metabolites, in particular, hepoxilins, which contribute to peripheral inflammation-induced tactile allodynia. However, the enzymatic sources of hepoxilin synthase (HXS) activity in rats remain elusive. Therefore, we overexpressed each of the 6 rat 12/15-LOX enzymes in HEK-293T cells and measured by LC-MS/MS the formation of HXB3, 12-HETE, 8-HETE, and 15-HETE from arachidonic acid (AA) at baseline and in the presenc...

  13. A Feedback-Insensitive Isopropylmalate Synthase Affects Acylsugar Composition in Cultivated and Wild Tomato.

    Science.gov (United States)

    Ning, Jing; Moghe, Gaurav D; Leong, Bryan; Kim, Jeongwoon; Ofner, Itai; Wang, Zhenzhen; Adams, Christopher; Jones, A Daniel; Zamir, Dani; Last, Robert L

    2015-11-01

    Acylsugars are insecticidal specialized metabolites produced in the glandular trichomes of plants in the Solanaceae family. In the tomato clade of the Solanum genus, acylsugars consist of aliphatic acids of different chain lengths esterified to sucrose, or less frequently to glucose. Through liquid chromatography-mass spectrometry screening of introgression lines, we previously identified a region of chromosome 8 in the Solanum pennellii LA0716 genome (IL8-1/8-1-1) that causes the cultivated tomato Solanum lycopersicum to shift from producing acylsucroses with abundant 3-methylbutanoic acid acyl chains derived from leucine metabolism to 2-methylpropanoic acid acyl chains derived from valine metabolism. We describe multiple lines of evidence implicating a trichome-expressed gene from this region as playing a role in this shift. S. lycopersicum M82 SlIPMS3 (Solyc08g014230) encodes a functional end product inhibition-insensitive version of the committing enzyme of leucine biosynthesis, isopropylmalate synthase, missing the carboxyl-terminal 160 amino acids. In contrast, the S. pennellii LA0716 IPMS3 allele found in IL8-1/8-1-1 encodes a nonfunctional truncated IPMS protein. M82 transformed with an SlIPMS3 RNA interference construct exhibited an acylsugar profile similar to that of IL8-1-1, whereas the expression of SlIPMS3 in IL8-1-1 partially restored the M82 acylsugar phenotype. These IPMS3 alleles are polymorphic in 14 S. pennellii accessions spread throughout the geographical range of occurrence for this species and are associated with acylsugars containing varying amounts of 2-methylpropanoic acid and 3-methylbutanoic acid acyl chains. © 2015 American Society of Plant Biologists. All Rights Reserved.

  14. Modulation of cyanoalanine synthase and O-acetylserine (thiol) lyases A and B activity by beta-substituted alanyl and anion inhibitors.

    Science.gov (United States)

    Warrilow, Andrew G S; Hawkesford, Malcolm J

    2002-03-01

    The reaction mechanisms of three enzymes belonging to a single gene family are compared: a cyanoalanine synthase and two isoforms of O-acetylserine (thiol) lyase (O-ASTL) isolated from spinach (Spinacea oleracea L. cv. Medina). O-ASTL represents a major regulatory point in the S-assimilatory pathway, and the related cyanoalanine synthase, which is specific to the mitochondrial compartment, has evolved an independent function of cyanide detoxification. All three enzymes catalysed both the cysteine synthesis and cyanoalanine synthesis reactions although with different efficiencies, and which may be explained by a single amino acid substitution in the substrate-binding pocket of the enzyme. Substituted alanine and nucleophillic inhibitors caused predominantly non-competitive inhibition, indicating binding to both E- and F-forms of the enzyme in a bi-bi ping-pong kinetic model. Michaelis-Menten kinetics were observed when the alanyl substrate was varied in the presence and absence of inhibitors. The use of alanyl inhibitors has shown that the alanyl half-cycle of both the cysteine synthesis and cyanoalanine synthesis reactions of cyanoalanine synthase and O-acetylserine (thiol) lyases are similar. This is in contrast to the results observed with nucleophillic inhibitors, which have shown that the mechanisms of anion binding and processing differ between cyanoalanine synthase and O-ASTLs.

  15. Crystallographic and enzymatic insights into the mechanisms of Mg-ADP inhibition in the A1complex of the A1AOATP synthase.

    Science.gov (United States)

    Singh, Dhirendra; Grüber, Gerhard

    2018-01-01

    F-ATP synthases are described to have mechanisms which regulate the unnecessary depletion of ATP pool during an energy limited state of the cell. Mg-ADP inhibition is one of the regulatory features where Mg-ADP gets entrapped in the catalytic site, preventing the binding of ATP and further inhibiting ATP hydrolysis. Knowledge about the existence and regulation of the related archaeal-type A 1 A O ATP synthases (A 3 B 3 CDE 2 FG 2 ac) is limited. We demonstrate MgADP inhibition of the enzymatically active A 3 B 3 D- and A 3 B 3 DF complexes of Methanosarcina mazei Gö1 A-ATP synthase and reveal the importance of the amino acids P235 and S238 inside the P-loop (GPFGSGKTV) of the catalytic A subunit. Substituting these two residues by the respective P-loop residues alanine and cysteine (GAFGCGKTV) of the related eukaryotic V-ATPase increases significantly the ATPase activity of the enzyme variant and abolishes MgADP inhibition. The atomic structure of the P235A, S238C double mutant of subunit A of the Pyrococcus horikoshii OT3 A-ATP synthase provides details of how these critical residues affect nucleotide-binding and ATP hydrolysis in this molecular engine. The qualitative data are confirmed by quantitative results derived from fluorescence correlation spectroscopy experiments. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Science.gov (United States)

    Wang, Guoliang; Zhao, Ge; Feng, Yanbin; Xuan, Jinsong; Sun, Jianwei; Guo, Baotai; Jiang, Guoyong; Weng, Manli; Yao, Jianting; Wang, Bin; Duan, Delin; Liu, Tao

    2010-01-01

    The full-length cDNA sequence (3219 base pairs) of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS) was isolated by RACE-PCR and deposited in GenBank (NCBI) with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5), whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB). Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI). All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94%) and in amino acid composition (>96%). Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes. PMID:20714424

  17. Suppression of allene oxide synthase 3 in potato increases degree of arbuscular mycorrhizal fungal colonization.

    Science.gov (United States)

    Morcillo, Rafael Jorge León; Navarrete, María Isabel Tamayo; Bote, Juan Antonio Ocampo; Monguio, Salomé Prat; García-Garrido, José Manuel

    2016-01-15

    Arbuscular mycorrhizal (AM) is a mutually beneficial interaction among higher plants and soil fungi of the phylum Glomeromycota. Numerous studies have pointed that jasmonic acid plays an important role in the development of the intraradical fungus. This compound belongs to a group of biologically active compounds known as oxylipins which are derived from the oxidative metabolism of polyunsaturated fatty acids. Studies of the regulatory role played by oxylipins in AM colonization have generally focused on jasmonates, while few studies exist on the 9-LOX pathway of oxylipins during AM formation. Here, the cDNA of Allene oxide synthase 3 (AOS3), a key enzyme in the 9-LOX pathway, was used in the RNA interference (RNAi) system to transform potato plants in order to suppress its expression. Results show increases in AOS3 gene expression and 9-LOX products in roots of wild type potato mycorrhizal plants. The suppression of AOS3 gene expression increases the percentage of root with mycorrhizal colonization at early stages of AM formation. AOS3 RNA interference lead to an induction of LOXA and 13-LOX genes, a reduction in AOS3 derived 9-LOX oxylipin compounds and an increase in jasmonic acid content, suggesting compensation between 9 and 13-LOX pathways. The results in a whole support the hypothesis of a regulatory role for the 9-LOX oxylipin pathway during mycorrhization. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    International Nuclear Information System (INIS)

    Różycki, Bartosz; Cieplak, Marek

    2014-01-01

    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme

  19. Proteolytic and partial sequencing studies of the bifunctional dihydrofolate reductase-thymidylate synthase from Daucus carota.

    Science.gov (United States)

    Cella, R; Carbonera, D; Orsi, R; Ferri, G; Iadarola, P

    1991-06-01

    The bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) of Daucus carota has been further characterized as regards molecular weight, amino acid composition, protease digestion and microsequencing of proteolytic peptides. Data reported in this paper demonstrate that the carrot protein has a calculated Mr of 124,000 thus indicating that, contrarily to what has previously been suggested, it occurs as a dimer of identical subunits. Results of partial amino acid microsequencing show the presence of sequences highly homologous with those of the active sites of both DHFR and TS from other organisms confirming, at the structural level, the bifunctional nature of the carrot protein. As in the case of Leishmania tropica DHFR-TS, incubation of the carrot protein with V8 protease led to a rapid loss of TS activity while retaining that of DHFR. However the pattern of proteolysis did not allow to establish whether the sequence of domains is DHFR-TS as in Leishmania, or vice versa. Low homology of other amino acid sequences, as judged by computer analysis, and absence of common epitopes indicate an apparent divergence between carrot and leishmanian proteins.

  20. Structural and functional annotation of citrate synthase from Aspergillus niger ANJ-120.

    Science.gov (United States)

    Mustafa, Ghulam; Arif, Rawaba; Bukhari, Shazia Anwer; Ali, Muhammad; Sharif, Sumaira; Atta, Asia

    2018-03-01

    Citrate synthase (CS) is involved in citric acid biosynthesis which is a well-established metabolic pathway. The condensation of acetyl-CoA with oxaloacetate is catalyzed by CS. Citric acid (CA) has a number of applications in pharmaceutical industry. CA in combination with bicarbonates is used as an effervescent in the preparations of tablets and powders. It has also been used as an anticoagulant and acidulant to form mild astringent. In current study, detailed structural and functional analyses of CS protein were carried out using various bioinformatics tools. Structural modeling was also done by building 3D model of CS from Aspergillus niger ANJ-120 using Modeller 9.16 software. The 3D Model was then evaluated using different online approaches. Furthermore, superimposition of query and template structures, Root Mean Squared Deviation and visualization of generated model were done through UCSF Chimera 1.5.3. Even though various roles of CS protein were already known and verified experimentally, here we presented a structural analysis of CS protein. The structural investigation of CS protein will be helpful for protein engineering strategies and understanding the interactions among proteins. Due to large number of applications, the production of citric acid by A. niger and its bioinformatics studies will offer substantial improvement in commercial scale intensification of this useful product.

  1. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  2. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...... and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has...

  3. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal...... and sex showed no such changes. Our data support the hypothesis that NO is a pathogenic factor in MS, and that NOS IR is strongly expressed in brain regions appearing normal by MRI...

  5. PKMiner: a database for exploring type II polyketide synthases

    OpenAIRE

    Kim Jinki; Yi Gwan-Su

    2012-01-01

    Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyke...

  6. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    OpenAIRE

    Yan Ping Lim; Maybelle K. Go; Wen Shan Yew

    2016-01-01

    Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs) using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalc...

  7. ASMPKS: an analysis system for modular polyketide synthases

    OpenAIRE

    Kong Eun-Bae; Tae Hongseok; Park Kiejung

    2007-01-01

    Abstract Background Polyketides are secondary metabolites of microorganisms with diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. Polyketides are synthesized by serialized reactions of a set of enzymes called polyketide synthase(PKS)s, which coordinate the elongation of carbon skeletons by the stepwise condensation of short carbon precursors. Due to their importance as drugs, the volume of data on polyketides is rapi...

  8. Deficiency of mitochondrial ATP synthase of nuclear genetic origin

    Czech Academy of Sciences Publication Activity Database

    Sperl, W.; Ješina, Pavel; Zeman, J.; Mayr, J. A.; DeMeirleir, L.; VanCoster, R.; Pícková, Andrea; Hansíková, H.; Houšťková, H.; Krejčík, Zdeněk; Koch, J.; Smet, J.; Muss, W.; Holme, E.; Houštěk, Josef

    2006-01-01

    Roč. 16, č. 11 (2006), s. 821-829 ISSN 0960-8966 R&D Projects: GA MZd(CZ) NR7790; GA MŠk(CZ) 1M0520 Grant - others:CZ-AT(CZ) 6-06-3 Institutional research plan: CEZ:AV0Z50110509 Keywords : mitochondria * ATP synthase * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.615, year: 2006

  9. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  10. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  11. The cellulose synthase superfamily in fully sequenced plants and algae

    Directory of Open Access Journals (Sweden)

    Xu Ying

    2009-07-01

    Full Text Available Abstract Background The cellulose synthase superfamily has been classified into nine cellulose synthase-like (Csl families and one cellulose synthase (CesA family. The Csl families have been proposed to be involved in the synthesis of the backbones of hemicelluloses of plant cell walls. With 17 plant and algal genomes fully sequenced, we sought to conduct a genome-wide and systematic investigation of this superfamily through in-depth phylogenetic analyses. Results A single-copy gene is found in the six chlorophyte green algae, which is most closely related to the CslA and CslC families that are present in the seven land plants investigated in our analyses. Six proteins from poplar, grape and sorghum form a distinct family (CslJ, providing further support for the conclusions from two recent studies. CslB/E/G/H/J families have evolved significantly more rapidly than their widely distributed relatives, and tend to have intragenomic duplications, in particular in the grape genome. Conclusion Our data suggest that the CslA and CslC families originated through an ancient gene duplication event in land plants. We speculate that the single-copy Csl gene in green algae may encode a mannan synthase. We confirm that the rest of the Csl families have a different evolutionary origin than CslA and CslC, and have proposed a model for the divergence order among them. Our study provides new insights about the evolution of this important gene family in plants.

  12. Iterative polyketide biosynthesis by modular polyketide synthases in bacteria.

    Science.gov (United States)

    Chen, Haotong; Du, Liangcheng

    2016-01-01

    Modular polyketide synthases (type I PKSs) in bacteria are responsible for synthesizing a significant percentage of bioactive natural products. This group of synthases has a characteristic modular organization, and each module within a PKS carries out one cycle of polyketide chain elongation; thus each module is non-iterative in function. It was possible to predict the basic structure of a polyketide product from the module organization of the PKSs, since there generally existed a co-linearity between the number of modules and the number of chain elongations. However, more and more bacterial modular PKSs fail to conform to the canonical rules, and a particularly noteworthy group of non-canonical PKSs is the bacterial iterative type I PKSs. This review covers recent examples of iteratively used modular PKSs in bacteria. These non-canonical PKSs give rise to a large array of natural products with impressive structural diversity. The molecular mechanism behind the iterations is often unclear, presenting a new challenge to the rational engineering of these PKSs with the goal of generating new natural products. Structural elucidation of these synthase complexes and better understanding of potential PKS-PKS interactions as well as PKS-substrate recognition may provide new prospects and inspirations for the discovery and engineering of new bioactive polyketides.

  13. Regulation of expression, activity and localization of fungal chitin synthases

    Science.gov (United States)

    Rogg, Luise E.; Fortwendel, Jarrod R.; Juvvadi, Praveen R.; Steinbach, William J.

    2013-01-01

    The fungal cell wall represents an attractive target for pharmacologic inhibition, as many of the components are fungal-specific. Though targeted inhibition of β-glucan synthesis is effective treatment for certain fungal infections, the ability of the cell wall to dynamically compensate via the cell wall integrity pathway may limit overall efficacy. To date, chitin synthesis inhibitors have not been successfully deployed in the clinical setting. Fungal chitin synthesis is a complex and highly regulated process. Regulation of chitin synthesis occurs on multiple levels, thus targeting of these regulatory pathways may represent an exciting alternative approach. A variety of signaling pathways have been implicated in chitin synthase regulation, at both transcriptional and post-transcriptional levels. Recent research suggests that localization of chitin synthases likely represents a major regulatory mechanism. However, much of the regulatory machinery is not necessarily shared among different chitin synthases. Thus, an in depth understanding of the precise roles of each protein in cell wall maintenance and repair will be essential to identifying the most likely therapeutic targets. PMID:21526913

  14. The Structural Basis of Erwinia rhapontici Isomaltulose Synthase

    Science.gov (United States)

    Xu, Zheng; Li, Sha; Li, Jie; Li, Yan; Feng, Xiaohai; Wang, Renxiao; Xu, Hong; Zhou, Jiahai

    2013-01-01

    Sucrose isomerase NX-5 from Erwiniarhapontici efficiently catalyzes the isomerization of sucrose to isomaltulose (main product) and trehalulose (by-product). To investigate the molecular mechanism controlling sucrose isomer formation, we determined the crystal structures of native NX-5 and its mutant complexes E295Q/sucrose and D241A/glucose at 1.70 Å, 1.70 Å and 2.00 Å, respectively. The overall structure and active site architecture of NX-5 resemble those of other reported sucrose isomerases. Strikingly, the substrate binding mode of NX-5 is also similar to that of trehalulose synthase from Pseudomonasmesoacidophila MX-45 (MutB). Detailed structural analysis revealed the catalytic RXDRX motif and the adjacent 10-residue loop of NX-5 and isomaltulose synthase PalI from Klebsiella sp. LX3 adopt a distinct orientation from those of trehalulose synthases. Mutations of the loop region of NX-5 resulted in significant changes of the product ratio between isomaltulose and trehalulose. The molecular dynamics simulation data supported the product specificity of NX-5 towards isomaltulose and the role of the loop330-339 in NX-5 catalysis. This work should prove useful for the engineering of sucrose isomerase for industrial carbohydrate biotransformations. PMID:24069347

  15. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  16. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  17. Structural Analysis of Thymidylate Synthase from Kaposi's Sarcoma-Associated Herpesvirus with the Anticancer Drug Raltitrexed.

    Directory of Open Access Journals (Sweden)

    Yong Mi Choi

    Full Text Available Kaposi's sarcoma-associated herpesvirus (KSHV is a highly infectious human herpesvirus that causes Kaposi's sarcoma. KSHV encodes functional thymidylate synthase, which is a target for anticancer drugs such as raltitrexed or 5-fluorouracil. Thymidylate synthase catalyzes the conversion of 2'-deoxyuridine-5'-monophosphate (dUMP to thymidine-5'-monophosphate (dTMP using 5,10-methylenetetrahydrofolate (mTHF as a co-substrate. The crystal structures of thymidylate synthase from KSHV (apo, complexes with dUMP (binary, and complexes with both dUMP and raltitrexed (ternary were determined at 1.7 Å, 2.0 Å, and 2.4 Å, respectively. While the ternary complex structures of human thymidylate synthase and E. coli thymidylate synthase had a closed conformation, the ternary complex structure of KSHV thymidylate synthase was observed in an open conformation, similar to that of rat thymidylate synthase. The complex structures of KSHV thymidylate synthase did not have a covalent bond between the sulfhydryl group of Cys219 and C6 atom of dUMP, unlike the human thymidylate synthase. The catalytic Cys residue demonstrated a dual conformation in the apo structure, and its sulfhydryl group was oriented toward the C6 atom of dUMP with no covalent bond upon ligand binding in the complex structures. These structural data provide the potential use of antifolates such as raltitrexed as a viral induced anticancer drug and structural basis to design drugs for targeting the thymidylate synthase of KSHV.

  18. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  19. [Cloning and prokaryotic expression of Rhodoblastus acidophilus 5-aminolevlinate synthase gene].

    Science.gov (United States)

    Zhang, De-yong; Cheng, Fei-xue; Cheng, Ju-e; Zhang, Zhan-hong; Liu, Yong

    2007-08-01

    5-aminolevulinic acid (ALA) is formed by the enzyme ALA synthase (ALAS). However, the fidelity of ALAS gene among species is low. The ALAS gene of photosynthetic bacteria Rhodoblastus acidophilus was cloned from its genomic DNA by conventional PCR and Veterette PCR and further sequenced. The identity of ALAS gene among photosynthetic bacteria species is from 64.0% to 95.1% according to phylogenic analysis. Furthermore, the ALAS gene was subcloned into an expression vector pQE30. For the overproduction of ALA, the recombinant ALAS was overexpressed in Escherichia coli strains JM109, M15 and BL21 (DE3), respectively. The expected 44kD protein was detected by SDS-PAGE in three E. coli strains after IPTG induction and further purified by affinity purification on Ni-NTA. The conditions including strain, medium, substrate of ALA synthesize (glycine and succinic acid), and ALA dehydratase inhibitor (levulinic acid) were optimized for attainning the maximum yield of ALA in E. coli. The ALA production was established on E. coli M15, medium 1 supplied with 100mmol/L glycine and 50mmol/L succinic acid, and 40mmol/L levulinic acid. The activity of ALAS was up to 333U/min x mg of protein. Meanwhile, the output of ALA was reached to 5.379g/L, which is the highest yield of ALA up to date by biofermentation. ALA has a variety of agricultural applications not only as an herbicide, insecticide, and growth promoting factor, but also based on its ability to confer salt and cold temperature tolerance in plants. Our recombinant bacteria are of great potential in the production of ALA. Our results offer an easy and simple ALA mass production method and may stimulate the application of ALA in agriculture.

  20. CELLULOSE SYNTHASE INTERACTIVE1 Is Required for Fast Recycling of Cellulose Synthase Complexes to the Plasma Membrane in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Lei; Singh, Abhishek; Bashline, Logan; Li, Shundai; Yingling, Yaroslava G.; Gu, Ying

    2015-10-06

    Plants are constantly subjected to various biotic and abiotic stresses and have evolved complex strategies to cope with these stresses. For example, plant cells endocytose plasma membrane material under stress and subsequently recycle it back when the stress conditions are relieved. Cellulose biosynthesis is a tightly regulated process that is performed by plasma membrane-localized cellulose synthase (CESA) complexes (CSCs). However, the regulatory mechanism of cellulose biosynthesis under abiotic stress has not been well explored. In this study, we show that small CESA compartments (SmaCCs) or microtubule-associated cellulose synthase compartments (MASCs) are critical for fast recovery of CSCs to the plasma membrane after stress is relieved in Arabidopsis thaliana. This SmaCC/MASC-mediated fast recovery of CSCs is dependent on CELLULOSE SYNTHASE INTERACTIVE1 (CSI1), a protein previously known to represent the link between CSCs and cortical microtubules. Independently, AP2M, a core component in clathrin-mediated endocytosis, plays a role in the formation of SmaCCs/MASCs. Together, our study establishes a model in which CSI1-dependent SmaCCs/MASCs are formed through a process that involves endocytosis, which represents an important mechanism for plants to quickly regulate cellulose synthesis under abiotic stress.

  1. Role of a Highly Conserved and Catalytically Important Glutamate-49 in the Enterococcus faecalis Acetolactate Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Miyoung; Lee, Sangchoon; Cho, Junehaeng; Ryu, Seong Eon; Yoon, Moonyoung [Hanyang Univ., Seoul (Korea, Republic of); Koo, Bonsung [Rural Development Administration, Suwon (Korea, Republic of)

    2013-02-15

    Acetolactate synthase (ALS) is a thiamine diphosphate (ThDP)-dependent enzyme that catalyzes the decarboxylation of pyruvate and then condenses the hydroxyethyl moiety with another molecule of pyruvate to give 2-acetolactate (AL). AL is a key metabolic intermediate in various metabolic pathways of microorganisms. In addition, AL can be converted to acetoin, an important physiological metabolite that is excreted by many microorganisms. There are two types of ALSs reported in the literature, anabolic aceto-hydroxyacid synthase (AHAS) and catabolic ALSs (cALS). The anabolic AHAS is primarily found in plants, fungi, and bacteria, is involved in the biosynthesis of branched-chain amino acids (BCAAs), and contains flavin adenine dinucleotide (FAD), whereas the cALS is found only in some bacteria and is involved in the butanediol fermentation pathway. Both of the enzymes are ThDP-dependent and require a divalent metal ion for catalytic activity. Despite the similarities of the reactions catalyzed, the cALS can be distinguished from anabolic AHAS by a low optimal pH of about 6.0, FAD-independent functionality, a genetic location within the butanediol operon, and lack of a regulatory subunit. It is noteworthy that the structural and functional features of AHAS have been extensively studied, in contrast to those of cALS, for which only limited information is available. To date, the only crystal structure of cALS reported is from Klebsiella pneumonia, which revealed that the overall structure of K. pneumonia ALS is similar to that of AHAS except for the FAD binding region found in AHAS.

  2. N-acetylglutamate synthase deficiency: an insight into the genetics, epidemiology, pathophysiology, and treatment

    Directory of Open Access Journals (Sweden)

    Caldovic L

    2011-08-01

    Full Text Available Nicholas Ah Mew, Ljubica CaldovicCenter for Genetic Medicine Research, Children’s Research Institute, Children’s National Medical Center, Washington DC, USAAbstract: The conversion of ammonia into urea by the human liver requires the coordinated function of the 6 enzymes and 2 transporters of the urea cycle. The initial and rate-limiting enzyme of the urea cycle, carbamylphosphate synthetase 1 (CPS1, requires an allosteric activator, N-acetylglutamate (NAG. The formation of this unique cofactor from glutamate and acetyl Coenzyme-A is catalyzed by N-acetylglutamate synthase (NAGS. An absence of NAG as a consequence of NAGS deficiency may compromise flux through CPS1 and result in hyperammonemia. The NAGS gene encodes a 528-amino acid protein, consisting of a C-terminal catalytic domain, a variable segment, and an N-terminal mitochondrial targeting signal. Only 22 mutations in the NAGS gene have been reported to date, mostly in the catalytic domain. NAGS is primarily expressed in the liver and intestine. However, it is also surprisingly expressed in testis, stomach and spleen, and during early embryonic development at levels not concordant with the expression of other urea cycle enzymes, CPS1, or ornithine transcarbamylase. The purpose of NAGS expression in these tissues, and its significance to NAGS deficiency is as yet unknown. Inherited NAGS deficiency is the rarest of the urea cycle disorders, and we review the currently reported 34 cases. Treatment of NAGS deficiency with N-carbamyglutamate, a stable analog of NAG, can restore deficient urea cycle function and normalize blood ammonia in affected patients.Keywords: urea cycle, urea cycle disorder, N-acetyl-L-glutamate, N-acetylglutamate synthase, hyperammonemia, N-carbamyl-L-glutamate

  3. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. Copyright © 2014. Published by Elsevier Inc.

  4. Perspective of microsomal prostaglandin E2 synthase-1 as drug target in inflammation-related disorders.

    Science.gov (United States)

    Koeberle, Andreas; Werz, Oliver

    2015-11-01

    Prostaglandin (PG)E2 encompasses crucial roles in pain, fever, inflammation and diseases with inflammatory component, such as cancer, but is also essential for gastric, renal, cardiovascular and immune homeostasis. Cyclooxygenases (COX) convert arachidonic acid to the intermediate PGH2 which is isomerized to PGE2 by at least three different PGE2 synthases. Inhibitors of COX - non-steroidal anti-inflammatory drugs (NSAIDs) - are currently the only available therapeutics that target PGE2 biosynthesis. Due to adverse effects of COX inhibitors on the cardiovascular system (COX-2-selective), stomach and kidney (COX-1/2-unselective), novel pharmacological strategies are in demand. The inducible microsomal PGE2 synthase (mPGES)-1 is considered mainly responsible for the excessive PGE2 synthesis during inflammation and was suggested as promising drug target for suppressing PGE2 biosynthesis. However, 15 years after intensive research on the biology and pharmacology of mPGES-1, the therapeutic value of mPGES-1 as drug target is still vague and mPGES-1 inhibitors did not enter the market so far. This commentary will first shed light on the structure, mechanism and regulation of mPGES-1 and will then discuss its biological function and the consequence of its inhibition for the dynamic network of eicosanoids. Moreover, we (i) present current strategies for interfering with mPGES-1-mediated PGE2 synthesis, (ii) summarize bioanalytical approaches for mPGES-1 drug discovery and (iii) describe preclinical test systems for the characterization of mPGES-1 inhibitors. The pharmacological potential of selective mPGES-1 inhibitor classes as well as dual mPGES-1/5-lipoxygenase inhibitors is reviewed and pitfalls in their development, including species discrepancies and loss of in vivo activity, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Germacrene A is a product of the aristolochene synthase-mediated conversion of farnesylpyrophosphate to aristolochene.

    Science.gov (United States)

    Calvert, Melanie J; Ashton, Peter R; Allemann, Rudolf K

    2002-10-02

    The biosynthesis of several sesquiterpenes has been proposed to proceed via germacrene A. However, to date, the production of germacrene A has not been proven directly for any of the sesquiterpene synthases for which it was postulated as an intermediate. We demonstrate here for the first time that significant amounts of germacrene A (7.5% of the total amount of products) are indeed released from wild-type aristolochene synthase (AS) from Penicillium roqueforti. Germacrene A was identified through direct GC-MS comparison to an authentic sample and through production of beta-elemene in a thermal Cope rearrangement. AS also produced a small amount of valencene through deprotonation of C6 rather than C8 in the final step of the reaction. On the basis of the X-ray structure of AS, Tyr 92 was postulated to be the active-site acid responsible for protonation of germacrene A (Caruthers, J. M.; Kang, I.; Rynkiewicz, M. J.; Cane, D. E.; Christianson, D. W. J. Biol. Chem. 2000, 275, 25533-25539). The CD spectra of a mutant protein, ASY92F, in which Tyr 92 was replaced by Phe, and of AS were very similar. ASY92F was approximately 0.1% as active as nonmutated recombinant AS. The steady-state kinetic parameters were measured as 0.138 min(-1) and 0.189 mM for k(cat) and K(M), respectively. Similar to a mutant protein of 5-epi-aristolochene (Rising, K. A.; Starks, C. M.; Noel, J. P.; Chappell, J. J. Am. Chem. Soc. 2000, 122, 1861-1866), the mutant released significant amounts of germacrene A (approximately 29%). ASY92F also produced various amounts of a further five hydrocarbons of molecular weight 204, valencene, beta-(E)-farnesene, alpha- and beta-selinene, and selina-4,11-diene.

  6. First insights into the mode of action of a "lachrymatory factor synthase"--implications for the mechanism of lachrymator formation in Petiveria alliacea, Allium cepa and Nectaroscordum species.

    Science.gov (United States)

    He, Quan; Kubec, Roman; Jadhav, Abhijit P; Musah, Rabi A

    2011-11-01

    A study of an enzyme that reacts with the sulfenic acid produced by the alliinase in Petiveria alliacea L. (Phytolaccaceae) to yield the P. alliacea lachrymator (phenylmethanethial S-oxide) showed the protein to be a dehydrogenase. It functions by abstracting hydride from sulfenic acids of appropriate structure to form their corresponding sulfines. Successful hydride abstraction is dependent upon the presence of a benzyl group on the sulfur to stabilize the intermediate formed on abstraction of hydride. This dehydrogenase activity contrasts with that of the lachrymatory factor synthase (LFS) found in onion, which catalyzes the rearrangement of 1-propenesulfenic acid to (Z)-propanethial S-oxide, the onion lachrymator. Based on the type of reaction it catalyzes, the onion LFS should be classified as an isomerase and would be called a "sulfenic acid isomerase", whereas the P. alliacea LFS would be termed a "sulfenic acid dehydrogenase". Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer c....... solfataricus CTP synthase according to a structural alignment with the E. coli enzyme all have large thermal parameters in the dimeric form. Furthermore, they are seen to undergo substantial movement upon tetramerization....

  8. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  9. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  10. The Staphylococcus aureus α-Acetolactate Synthase ALS Confers Resistance to Nitrosative Stress

    Directory of Open Access Journals (Sweden)

    Sandra M. Carvalho

    2017-07-01

    Full Text Available Staphylococcus aureus is a worldwide pathogen that colonizes the human nasal cavity and is a major cause of respiratory and cutaneous infections. In the nasal cavity, S. aureus thrives with high concentrations of nitric oxide (NO produced by the innate immune effectors and has available for growth slow-metabolizing free hexoses, such as galactose. Here, we have used deep sequencing transcriptomic analysis (RNA-Seq and 1H-NMR to uncover how S. aureus grown on galactose, a major carbon source present in the nasopharynx, survives the deleterious action of NO. We observed that, like on glucose, S. aureus withstands high concentrations of NO when using galactose. Data indicate that this resistance is, most likely, achieved through a distinct metabolism that relies on the increased production of amino acids, such as glutamate, threonine, and branched-chain amino acids (BCAAs. Moreover, we found that under NO stress the S. aureus α-acetolactate synthase (ALS enzyme, which converts pyruvate into α-acetolactate, plays an important role. ALS is proposed to prevent intracellular acidification, to promote the production of BCAAs and the activation of the TCA cycle. Additionally, ALS is shown to contribute to the successful infection of murine macrophages. Furthermore, ALS contributes to the resistance of S. aureus to beta-lactam antibiotics such as methicillin and oxacillin.

  11. Crystal structure of 3,4-dihydroxy-2-butanone 4-phosphate synthase of riboflavin biosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Calabrese, J.C.; Wawrzak, Z.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    3,4-Dihydroxy-2-butanone-4-phosphate synthase catalyzes a commitment step in the biosynthesis of riboflavin. On the enzyme, ribulose 5-phosphate is converted to 3,4-dihydroxy-2-butanone 4-phosphate and formate in steps involving enolization, ketonization, dehydration, skeleton rearrangement, and formate elimination. The enzyme is absent in humans and an attractive target for the discovery of antimicrobials for pathogens incapable of acquiring sufficient riboflavin from their hosts. The homodimer of 23 kDa subunits requires Mg{sup 2+} for activity. The first three-dimensional structure of the enzyme was determined at 1.4 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on Escherichia coli protein crystals containing gold. The protein consists of an {alpha} + {beta} fold having a complex linkage of {beta} strands. Intersubunit contacts are mediated by numerous hydrophobic interactions and three hydrogen bond networks. A proposed active site was identified on the basis of amino acid residues that are conserved among the enzyme from 19 species. There are two well-separated active sites per dimer, each of which comprise residues from both subunits. In addition to three arginines and two threonines, which may be used for recognizing the phosphate group of the substrate, the active site consists of three glutamates, two aspartates, two histidines, and a cysteine which may provide the means for general acid and base catalysis and for coordinating the Mg{sup 2+} cofactor within the active site.

  12. Impairment of Cellulose Synthases Required for Arabidopsis Secondary Cell Wall Formation Enhances Disease Resistance[W

    Science.gov (United States)

    Hernández-Blanco, Camilo; Feng, Dong Xin; Hu, Jian; Sánchez-Vallet, Andrea; Deslandes, Laurent; Llorente, Francisco; Berrocal-Lobo, Marta; Keller, Harald; Barlet, Xavier; Sánchez-Rodríguez, Clara; Anderson, Lisa K.; Somerville, Shauna; Marco, Yves; Molina, Antonio

    2007-01-01

    Cellulose is synthesized by cellulose synthases (CESAs) contained in plasma membrane–localized complexes. In Arabidopsis thaliana, three types of CESA subunits (CESA4/IRREGULAR XYLEM5 [IRX5], CESA7/IRX3, and CESA8/IRX1) are required for secondary cell wall formation. We report that mutations in these proteins conferred enhanced resistance to the soil-borne bacterium Ralstonia solanacearum and the necrotrophic fungus Plectosphaerella cucumerina. By contrast, susceptibility to these pathogens was not altered in cell wall mutants of primary wall CESA subunits (CESA1, CESA3/ISOXABEN RESISTANT1 [IXR1], and CESA6/IXR2) or POWDERY MILDEW–RESISTANT5 (PMR5) and PMR6 genes. Double mutants indicated that irx-mediated resistance was independent of salicylic acid, ethylene, and jasmonate signaling. Comparative transcriptomic analyses identified a set of common irx upregulated genes, including a number of abscisic acid (ABA)–responsive, defense-related genes encoding antibiotic peptides and enzymes involved in the synthesis and activation of antimicrobial secondary metabolites. These data as well as the increased susceptibility of ABA mutants (abi1-1, abi2-1, and aba1-6) to R. solanacearum support a direct role of ABA in resistance to this pathogen. Our results also indicate that alteration of secondary cell wall integrity by inhibiting cellulose synthesis leads to specific activation of novel defense pathways that contribute to the generation of an antimicrobial-enriched environment hostile to pathogens. PMID:17351116

  13. Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase

    Science.gov (United States)

    Junker, Anne; Fischer, Juliane; Sichhart, Yvonne; Brandt, Wolfgang; Dräger, Birgit

    2013-01-01

    Putrescine N-methyltransferases (PMTs) are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-l-methionine (SAM) as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs), which are ubiquitous enzymes of polyamine metabolism. SPDSs use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in D. stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom. PMID:23908659

  14. Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase.

    Directory of Open Access Journals (Sweden)

    Anne eJunker

    2013-07-01

    Full Text Available Putrescine N-methyltransferases (PMTs are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-L-methionine (SAM as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs, which are ubiquitous enzymes of polyamine metabolism. SPDS use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in Datura stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom.

  15. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    Full Text Available A novel trehalose synthase (TreS gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+ and Hg(2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%, making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  16. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase ( Ans ) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans +5 . The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans / ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans +5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  17. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  18. Prostaglandin H synthase catalyzes regiospecific release of tritium from labeled estradiol

    Energy Technology Data Exchange (ETDEWEB)

    Degen, G.H.; Jellinck, P.H.; Hershcopf, R.J.

    1987-06-01

    Prostaglandin H synthase (PHS) from ram seminal vesicle microsomes was found to catalyze the release of tritium (3H) from estradiol (E2) regiospecifically labeled in position C-2 or C-4 of ring A but not from positions C-17 alpha, C-16 alpha, or C-6,7. Formation of 3H2O from ring A of E2 is dependent upon native enzyme supplemented with either arachidonic acid, eicosapentaenoic acid, or hydrogen peroxide and proceeds very rapidly as do other cooxidation reactions catalyzed by PHS-peroxidase. The 3H-loss from ring A of E2 reflecting oxidative displacement of this isotope by PHS increases linearly up to 100 microM under our conditions (8-45 nmol/mg x 5 min). Loss of tritium in various blanks is negligible by comparison. Indomethacin (0.07 and 0.2 mM) inhibited the PHS-dependent release of 3H2O from estradiol but less efficiently than it inhibited DES-cooxidation measured in parallel incubations under similar conditions. Addition of EDTA (0.5 mM) had no effect on the regiospecific transfer of 3H from E2 or on DES-oxidation; ascorbic acid (0.5 mM) or NADH (0.33 mM) clearly inhibited both reactions and to a similar extent. These data suggest that estradiol-2/4-hydroxylation can be catalyzed by PHS in vitro probably via its peroxidase activity and point to PHS as an enzyme that could contribute to catechol estrogen formation in vitro by tissue preparations in the presence of unsaturated fatty acids or peroxides.

  19. Cloning and sequencing of a cDNA for the delta-subunit of photosynthetic ATP-synthase (EC 3.6.1.34) from pea (Pisum sativum).

    Science.gov (United States)

    Hoesche, J A; Berzborn, R J

    1992-12-29

    lambda gt10 cDNA clones for the nuclear encoded subunit delta of chloroplast ATP-synthase from Pisum sativum have been isolated. The 5' end was completed by PCR. The sequenced cDNA codes for the import precursor. N-Terminal sequencing of the mature protein isolated from chloroplasts revealed that the processing sites of the transit peptide from Pisum sativum and Spinacea oleracea are similar. The overall homology of the deduced amino acid sequences of the mature delta proteins from higher plants is about 40%. The conservation among hydrophilic residues is higher than for hydrophobic ones, indicating that the surface of delta is important for its function within the ATP-synthase.

  20. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Hyaluronic Acid as a Target for Intervention in Prostate Cancer Metastases

    Science.gov (United States)

    2012-06-01

    synthase (HAS) and hyaluronic acid (HA) are upregulated in metastatic prostate cancer cells. 7-Hydroxy-4-Methyl Coumarin (HMC) is an inhibitor of... Coumarin 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT...upregulated in metastatic prostate cancer cells. 7-Hydroxy-4-Methyl Coumarin (HMC) is an inhibitor of hyaluronan synthase. It is commonly available in

  2. Molecular cloning, expression, and characterization of amorpha-4,11-diene synthase, a key enzyme of artemisinin biosynthesis in Artemisia annua L.

    Science.gov (United States)

    Mercke, P; Bengtsson, M; Bouwmeester, H J; Posthumus, M A; Brodelius, P E

    2000-09-15

    In plants, sesquiterpenes of different structural types are biosynthesized from the isoprenoid intermediate farnesyl diphosphate. The initial reaction of the biosynthesis is catalyzed by sesquiterpene cyclases (synthases). In Artemisia annua L. (annual wormwood), a number of such sesquiterpene cyclases are active. We have isolated a cDNA clone encoding one of these, amorpha-4,11-diene synthase, a putative key enzyme of artemisinin biosynthesis. This clone contains a 1641-bp open reading frame coding for 546 amino acids (63.9 kDa), a 12-bp 5'-untranslated end, and a 427-bp 3'-untranslated sequence. The deduced amino acid sequence is 32 to 51% identical with the sequence of other known sesquiterpene cyclases from angiosperms. When expressed in Escherichia coli, the recombinant enzyme catalyzed the formation of both olefinic (97.5%) and oxygenated (2.5%) sesquiterpenes from farnesyl diphosphate. GC-MS analysis identified the olefins as (E)-beta-farnesene (0.8%), amorpha-4,11diene (91.2%), amorpha-4,7(11)-diene (3.7%), gamma-humulene (1.0%), beta-sesquiphellandrene (0.5%), and an unknown olefin (0.2%) and the oxygenated sesquiterpenes as amorpha-4-en-11-ol (0.2%) (tentatively), amorpha-4-en-7-ol (2.1%), and alpha-bisabolol (0.3%) (tentatively). Using geranyl diphosphate as substrate, amorpha-4,11-diene synthase did not produce any monoterpenes. The recombinant enzyme has a broad pH optimum between 7.5 and 9.0 and the Km values for farnesyl diphosphate, Mg2+, and Mn2+ are 0.9, 70, and 13 microM, respectively, at pH 7.5. A putative reaction mechanism for amorpha-4,11-diene synthase is suggested.

  3. Alkylaryl sulfides as peroxidase reducing substrates for prostaglandin H synthase. Probes for the reactivity and environment of the ferryl-oxo complex.

    Science.gov (United States)

    Plé, P; Marnett, L J

    1989-08-25

    The peroxidase activity of prostaglandin (PGH) synthase catalyzes the reduction of PGG2 and other natural and synthetic hydroperoxides by reducing substrates. Sulfides serve as reductants by incorporating the oxo ligand from the ferryl-oxo complex which represents the higher oxidation state of the peroxidase (Compound I). A series of alkylaryl sulfides and substituted dihydrobenzo[b]thiophenes were synthesized to determine the electronic and steric requirements of PGH synthase for sulfide reducing substrates. Kinetic parameters were determined for most of the molecules by determining their ability to support reduction of 5-phenyl-4-pentenyl-1-hydroperoxide in the presence of PGH synthase purified from ram seminal vesicle microsomes. Electron-donating groups on the aryl moiety para to the sulfide enhanced reducing substrate activity (p = -0.8). As expected from previous results, the major oxidation product of p-methylthioanisole was the corresponding sulfoxide. The presence of a para-amino group increased binding to the enzyme and changed the reduction mechanism from oxygen transfer to electron transfer. The major oxidation product of p-(dimethylamino)thioanisole was identified as p-(methylamino)thioanisole; an equivalent amount of formaldehyde was produced. Increasing the size of the alkyl group attached to sulfur decreased the ability of the sulfide to act as a peroxidase reductant. The maximal turnover for reduction by p-methoxyphenylalkyl sulfides decreased 10-fold on substitution of isopropyl for ethyl. Chiral derivatives of benzo[b]thiophenes demonstrated differences in the ability of the two enantiomers to support reduction. Introduction of a carboxylic acid moiety anywhere in the molecule decreased the maximal turnover for reduction. Esterification of the carboxylate doubled the extent of reduction relative to the free acid. The results are used to develop models for the interaction of sulfides with Compound I of PGH synthase.

  4. Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

    Science.gov (United States)

    Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

    1998-01-01

    Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

  5. Identification, cloning and expression analysis of strawberry (Fragaria x ananassa) mitochondrial citrate synthase and mitochondrial malate dehydrogenase.

    Science.gov (United States)

    Iannetta, Pietro P. M.; Escobar, Nieves Medina; Ross, Heather A.; Souleyre, Edwige J. F.; Hancock, Robert D.; Witte, Claus-Peter; Davies, Howard V.

    2004-05-01

    Salt-extractable proteins from the cell walls of immature and ripe strawberry (Fragaria x ananassa Duch. cv. Elsanta) fruit were separated using two-dimensional polyacrylamide gel electrophoresis. Seven polypeptides (enzymes) were characterized from their N-terminal sequences: (1) glyceraldhyde-3-phosphate dehydrogenase (EC 1.2.1.12); (2) triose phosphate isomerase (TPI; EC 5.3.1.1); (3) mitochondrial malate dehydrogenase (mMDH; EC 1.1.1.37); (4) NADH glutamate dehydrogenase (EC 1.4.1.3); (5) chalcone synthase (ChS; EC 2.3.1.74); (6) mitochondrial citrate synthase (mCS; EC 4.1.3.7); and (7) UDP glucose:flavonoid 3-O-glucosyltransferase (UDPG:FGT; EC 2.4.1.91). The sequenced polypeptides identified only cytosolic proteins, two of which (ChS and UDPG:FGT) had already been identified as being up-regulated in ripening (strawberry) fruit and important contributors to ripe fruit character. Our focus was therefore diverted to the enzymes mMDH and mCS for further molecular characterization as potentially important determinants of fruit flavour via regulation of the sugar : acid balance. Citrate synthase (CS) and malate dehydrogenase (MDH) enzyme activities increased substantially during ripening, as did citrate and malate contents. The increase in CS activity is supported by western blot analysis. One strawberry mCS (Fa-mCS-I) and two mMDH (Fa-mMDH-I and -II) cDNAs were cloned that were 77, 82 and 53% identical (respectively) to sequences from other plant sources. Northern analysis showed that CS and MDH expression did not correlate with enzyme activities and these findings are discussed.

  6. A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.

    Directory of Open Access Journals (Sweden)

    Sarah Schulz

    Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.

  7. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  8. Carglumic acid enhances rapid ammonia detoxification in classical organic acidurias with a favourable risk-benefit profile : a retrospective observational study

    NARCIS (Netherlands)

    Valayannopoulos, Vassili; Baruteau, Julien; Delgado, Maria Bueno; Cano, Aline; Couce, Maria L; Del Toro, Mireia; Donati, Maria Alice; Garcia-Cazorla, Angeles; Gil-Ortega, David; Gomez-de Quero, Pedro; Guffon, Nathalie; Hofstede, Floris C; Kalkan-Ucar, Sema; Coker, Mahmut; Lama-More, Rosa; Martinez-Pardo Casanova, Mercedes; Molina, Agustin; Pichard, Samia; Papadia, Francesco; Rosello, Patricia; Plisson, Celine; Le Mouhaer, Jeannie; Chakrapani, Anupam

    2016-01-01

    BACKGROUND: Isovaleric aciduria (IVA), propionic aciduria (PA) and methylmalonic aciduria (MMA) are inherited organic acidurias (OAs) in which impaired organic acid metabolism induces hyperammonaemia arising partly from secondary deficiency of N-acetylglutamate (NAG) synthase. Rapid reduction in

  9. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  10. Loop-loop interactions govern multiple steps in indole-3-glycerol phosphate synthase catalysis.

    Science.gov (United States)

    Zaccardi, Margot J; O'Rourke, Kathleen F; Yezdimer, Eric M; Loggia, Laura J; Woldt, Svenja; Boehr, David D

    2014-03-01

    Substrate binding, product release, and likely chemical catalysis in the tryptophan biosynthetic enzyme indole-3-glycerol phosphate synthase (IGPS) are dependent on the structural dynamics of the β1α1 active-site loop. Statistical coupling analysis and molecular dynamic simulations had previously indicated that covarying residues in the β1α1 and β2α2 loops, corresponding to Arg54 and Asn90, respectively, in the Sulfolobus sulfataricus enzyme (ssIGPS), are likely important for coordinating functional motions of these loops. To test this hypothesis, we characterized site mutants at these positions for changes in catalytic function, protein stability and structural dynamics for the thermophilic ssIGPS enzyme. Although there were only modest changes in the overall steady-state kinetic parameters, solvent viscosity and solvent deuterium kinetic isotope effects indicated that these amino acid substitutions change the identity of the rate-determining step across multiple temperatures. Surprisingly, the N90A substitution had a dramatic effect on the general acid/base catalysis of the dehydration step, as indicated by the loss of the descending limb in the pH rate profile, which we had previously assigned to Lys53 on the β1α1 loop. These changes in enzyme function are accompanied with a quenching of ps-ns and µs-ms timescale motions in the β1α1 loop as measured by nuclear magnetic resonance studies. Altogether, our studies provide structural, dynamic and functional rationales for the coevolution of residues on the β1α1 and β2α2 loops, and highlight the multiple roles that the β1α1 loop plays in IGPS catalysis. Thus, substitution of covarying residues in the active-site β1α1 and β2α2 loops of indole-3-glycerol phosphate synthase results in functional, structural, and dynamic changes, highlighting the multiple roles that the β1α1 loop plays in enzyme catalysis and the importance of regulating the structural dynamics of this loop through noncovalent

  11. Glutamic acid as anticancer agent: An overview.

    Science.gov (United States)

    Dutta, Satyajit; Ray, Supratim; Nagarajan, K

    2013-10-01

    The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.

  12. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-05-01

    The R and S enantionmers of S-adenosyl-3-(/sup 2/H)3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with (1,4-/sup 2/H/sub 4/)-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral (/sup 2/H/sub 5/)spermidines were isolated and converted to their N/sub 1/,N/sub 7/-dibocspermidine-N/sub 4/-(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz /sup 1/H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral (/sup 2/H/sub 3/)dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH/sub 3/) in all cases studied to date.

  13. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.

    Science.gov (United States)

    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R

    2014-11-01

    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis. © 2014 The Authors.

  14. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  15. Nocardia iowensis sp. nov., an organism rich in biocatalytically important enzymes and nitric oxide synthase

    Science.gov (United States)

    Lamm, Andrew S.; Khare, Arshdeep; Conville, Patricia; Lau, Peter C. K.; Bergeron, Hélène; Rosazza, John P. N.

    2009-01-01

    Nocardia strain NRRL 5646, isolated from a garden soil sample in Osceola, Iowa, USA, was initially of interest as an antibiotic producer. It contained biocatalytically important enzymes and represented the first described nitric oxide synthase enzyme system in bacteria. The present polyphasic taxonomic study was undertaken to differentiate strain NRRL 5646T from related species of the genus Nocardia. Chemotaxonomic analyses included determinations of the fatty acid methyl ester profile (C16 : 1ω6c/C16 : 1ω7c, C16 : 0, C18 : 1ω9c and C18 : 0 10-methyl as major components), quinone [cyclo MK-8(H4) as the major component], polar lipid (diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylinositol and phosphatidylinositol mannoside as major components) and mycolic acid. These results supported its placement within the genus Nocardia. Biochemical testing and 16S rRNA, 65-kDa heat-shock protein (hsp65) and preprotein translocase (secA1) gene sequence analyses differentiated strain NRRL 5646T from recognized Nocardia species. Previous studies have demonstrated that other genetic sequences (carboxylic acid reductase, Nocardia phosphopantetheinyl transferase and GTP cyclohydrolase I) from strain NRRL 5646T can also be used to substantiate its uniqueness. The level of 16S rRNA gene sequence similarity between strain NRRL 5646T and the type strains of Nocardia tenerifensis and Nocardia brasiliensis was 98.8 %. However, strain NRRL 5646T could be clearly distinguished from these Nocardia species based on DNA–DNA hybridization data. Consequently, strain NRRL 5646T is considered to represent a novel species of the genus Nocardia, for which the name Nocardia iowensis sp. nov. is proposed. The type strain is NRRL 5646T (=UI 122540T=NRRL B-24671T=DSM 45197T). PMID:19622667

  16. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  17. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  18. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found ...

  19. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  20. The localization of chitin synthase in membranous vesicles (chitosomes) in Neurospora crassa

    NARCIS (Netherlands)

    Sietsma, JH; Din, AB; Ziv, [No Value; Sjollema, KA; Yarden, O

    Polyclonal anti-chitin synthase antibodies raised against the Saccharomyces cerevisiae CHS2 gene product were used to identify and localize chitin synthase in the filamentous ascomycete Neurospora crassa. A single band of approximately 110 kDa was observed in Western blots of total protein extracts

  1. Domain swapping of Citrus limon monoterpene synthases: impact on enzymatic activity and product specifity.

    NARCIS (Netherlands)

    Tamer, el M.K.; Lucker, J.; Bosch, D.; Verhoeven, H.A.; Verstappen, F.W.A.; Schwab, W.; Tunen, van A.J.; Voragen, A.G.J.; Maagd, de R.A.; Bouwmeester, H.J.

    2003-01-01

    Monoterpene cyclases are the key enzymes in the monoterpene biosynthetic pathway, as they catalyze the cyclization of the ubiquitous geranyl diphosphate (GDP) to the specific monoterpene skeletons. From Citrus limon, four monoterpene synthase-encoding cDNAs for a P-pinene synthase named

  2. KORRIGAN1 Interacts Specifically with Integral Components of the Cellulose Synthase Machinery

    NARCIS (Netherlands)

    Mansoori Zangir, N.; Timmers, J.F.P.; Desprez, T.; Lessa Alvim Kamei, C.; Dees, D.C.T.; Vincken, J.P.; Visser, R.G.F.; Höfte, H.; Vernhettes, S.; Trindade, L.M.

    2014-01-01

    Cellulose is synthesized by the so called rosette protein complex and the catalytic subunits of this complex are the cellulose synthases (CESAs). It is thought that the rosette complexes in the primary and secondary cell walls each contains at least three different non-redundant cellulose synthases.

  3. The Primary Diterpene Synthase Products of Picea abies Levopimaradiene/Abietadiene Synthase (PaLAS) Are Epimers of a Thermally Unstable Diterpenol*

    OpenAIRE

    Keeling, Christopher I.; Madilao, Lina L.; Zerbe, Philipp; Dullat, Harpreet K.; Bohlmann, Jörg

    2011-01-01

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay p...

  4. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Systematic replacement of lysine with glutamine and alanine in Escherichia coli malate synthase G: effect on crystallization

    International Nuclear Information System (INIS)

    Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James

    2005-01-01

    Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success

  6. Crystallization and preliminary X-ray crystallographic analysis of Aquifex aeolicus SelA, a bacterial selenocysteine synthase

    International Nuclear Information System (INIS)

    Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki

    2012-01-01

    The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN

  7. Cloning, expression, and characterization of soluble starch synthase I cDNA from taro (Colocasia esculenta Var. esculenta).

    Science.gov (United States)

    Lin, Da-Gin; Jeang, Chii-Ling

    2005-10-05

    Soluble starch synthase I (SSSI) cDNA was isolated from taro (Colocasia esculenta var. esculenta) by RT-PCR and rapid amplification of cDNA ends reaction. The transcript of this single-copy gene is 2340 bp and encodes 642 amino acids protein containing a putative transit peptide of 54 residues. Recombinant SSSI protein displayed both primer-dependent and primer-independent activities of starch synthase. More SSSI transcript was expressed in taro leaves than in tubers, with no evident expression in petioles; and more transcript and protein were found in tubers of 597 +/- 37 g of fresh weight than in smaller or larger ones. Two forms of SSSI, i.e., 72 and 66 kDa, exist in leaves, and only the 66 kDa form was found in tubers. The taro SSSI, proposed as a novel member, was located only in the soluble fraction of tuber extract, while SSSI from other sources exist in both soluble and granule-bound forms.

  8. Silencing Onion Lachrymatory Factor Synthase Causes a Significant Change in the Sulfur Secondary Metabolite Profile1[W][OA

    Science.gov (United States)

    Eady, Colin C.; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G.; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke

    2008-01-01

    Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed. PMID:18583530

  9. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  10. Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum.

    Science.gov (United States)

    Brodelius, Maria; Lundgren, Anneli; Mercke, Per; Brodelius, Peter E

    2002-07-01

    A clone encoding farnesyl diphosphate synthase (FPPS) was obtained by PCR from a cDNA library made from young leaves of Artemisia annua. A cDNA clone encoding the tobacco epi-aristolochene synthase (eAS) was kindly supplied by J. Chappell (University of Kentucky, Lexington, KY, USA). Two fusions were constructed, i.e. FPPS/eAS and eAS/FPPS. The stop codon of the N-terminal enzyme was removed and replaced by a short peptide (Gly-Ser-Gly) to introduce a linker between the two ORFs. These two fusions and the two single cDNA clones were separately introduced into a bacterial expression vector (pET32). Escherichia coli was transformed with the expression vectors and enzymatically active soluble proteins were obtained after induction with isopropyl thio-beta-d-thiogalactoside. The recombinant enzymes were purified using immobilized metal affinity chromatography on Co2+ columns. The fusion enzymes produced epi-aristolochene from isopentenyl diphosphate through a coupled reaction. The Km values of FPPS and eAS for isopentenyl diphosphate and farnesyl diphosphate, respectively, were essentially the same for the single and fused enzymes. The bifunctional enzymes showed a more efficient conversion of isopentenyl diphosphate to epi-aristolochene than the corresponding amount of single enzymes.

  11. Expression, crystallization and structure elucidation of γ-terpinene synthase from Thymus vulgaris.

    Science.gov (United States)

    Rudolph, Kristin; Parthier, Christoph; Egerer-Sieber, Claudia; Geiger, Daniel; Muller, Yves A; Kreis, Wolfgang; Müller-Uri, Frieder

    2016-01-01

    The biosynthesis of γ-terpinene, a precursor of the phenolic isomers thymol and carvacrol found in the essential oil from Thymus sp., is attributed to the activitiy of γ-terpinene synthase (TPS). Purified γ-terpinene synthase from T. vulgaris (TvTPS), the Thymus species that is the most widely spread and of the greatest economical importance, is able to catalyze the enzymatic conversion of geranyl diphosphate (GPP) to γ-terpinene. The crystal structure of recombinantly expressed and purified TvTPS is reported at 1.65 Å resolution, confirming the dimeric structure of the enzyme. The putative active site of TvTPS is deduced from its pronounced structural similarity to enzymes from other species of the Lamiaceae family involved in terpenoid biosynthesis: to (+)-bornyl diphosphate synthase and 1,8-cineole synthase from Salvia sp. and to (4S)-limonene synthase from Mentha spicata.

  12. ATP synthase from slow and fast growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  13. ATP synthase in slow- and fast-growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  14. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  15. Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae).

    Science.gov (United States)

    Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A

    2017-09-01

    Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

  16. Tomato Cutin Deficient 1 (CD1) and putative orthologs comprise an ancient family of cutin synthase-like (CUS) proteins that are conserved among land plants.

    Science.gov (United States)

    Yeats, Trevor H; Huang, Wenlin; Chatterjee, Subhasish; Viart, Hélène M-F; Clausen, Mads H; Stark, Ruth E; Rose, Jocelyn K C

    2014-03-01

    The aerial epidermis of all land plants is covered with a hydrophobic cuticle that provides essential protection from desiccation, and so its evolution is believed to have been prerequisite for terrestrial colonization. A major structural component of apparently all plant cuticles is cutin, a polyester of hydroxy fatty acids; however, despite its ubiquity, the details of cutin polymeric structure and the mechanisms of its formation and remodeling are not well understood. We recently reported that cutin polymerization in tomato (Solanum lycopersicum) fruit occurs via transesterification of hydroxyacylglycerol precursors, catalyzed by the GDSL-motif lipase/hydrolase family protein (GDSL) Cutin Deficient 1 (CD1). Here, we present additional biochemical characterization of CD1 and putative orthologs from Arabidopsis thaliana and the moss Physcomitrella patens, which represent a distinct clade of cutin synthases within the large GDSL superfamily. We demonstrate that members of this ancient and conserved family of cutin synthase-like (CUS) proteins act as polyester synthases with negligible hydrolytic activity. Moreover, solution-state NMR analysis indicates that CD1 catalyzes the formation of primarily linear cutin oligomeric products in vitro. These results reveal a conserved mechanism of cutin polyester synthesis in land plants, and suggest that elaborations of the linear polymer, such as branching or cross-linking, may require additional, as yet unknown, factors. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  17. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  18. Insight into the adsorption profiles of the Saprolegnia monoica chitin synthase MIT domain on POPA and POPC membranes by molecular dynamics simulation studies.

    Science.gov (United States)

    Kuang, Guanglin; Liang, Lijun; Brown, Christian; Wang, Qi; Bulone, Vincent; Tu, Yaoquan

    2016-02-21

    The critical role of chitin synthases in oomycete hyphal tip growth has been established. A microtubule interacting and trafficking (MIT) domain was discovered in the chitin synthases of the oomycete model organism, Saprolegnia monoica. MIT domains have been identified in diverse proteins and may play a role in intracellular trafficking. The structure of the Saprolegnia monoica chitin synthase 1 (SmChs1) MIT domain has been recently determined by our group. However, although our in vitro assay identified increased strength in interactions between the MIT domain and phosphatidic acid (PA) relative to other phospholipids including phosphatidylcholine (PC), the mechanism used by the MIT domain remains unknown. In this work, the adsorption behavior of the SmChs1 MIT domain on POPA and POPC membranes was systematically investigated by molecular dynamics simulations. Our results indicate that the MIT domain can adsorb onto the tested membranes in varying orientations. Interestingly, due to the specific interactions between MIT residues and lipid molecules, the binding affinity to the POPA membrane is much higher than that to the POPC membrane. A binding hotspot, which is critical for the adsorption of the MIT domain onto the POPA membrane, was also identified. The lower binding affinity to the POPC membrane can be attributed to the self-saturated membrane surface, which is unfavorable for hydrogen-bond and electrostatic interactions. The present study provides insight into the adsorption profile of SmChs1 and additionally has the potential to improve our understanding of other proteins containing MIT domains.

  19. Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers.

    Science.gov (United States)

    Landschütze, V; Willmitzer, L; Müller-Röber, B

    1995-02-15

    The tricarboxylic acid (TCA) cycle constitutes a major component of the mitochondrial metabolism of eucaryotes, including higher plants. To analyze the importance of this pathway, we down-regulated mitochondrial citrate synthase (mCS; EC 4.1.3.7), the first enzyme of the TCA cycle, in transgenic potato plants u