Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro
2004-11-15
Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
Expanding the product portfolio of fungal type I fatty acid synthases
DEFF Research Database (Denmark)
Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia
2017-01-01
Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Fatty acid synthase inhibitors isolated from Punica granatum L
International Nuclear Information System (INIS)
Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng
2012-01-01
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)
Fatty acid synthase inhibitors isolated from Punica granatum L
Energy Technology Data Exchange (ETDEWEB)
Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)
2012-05-15
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)
International Nuclear Information System (INIS)
Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.
1986-01-01
Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2
Energy Technology Data Exchange (ETDEWEB)
Petry, T.W.; Krauss, R.S.; Eling, T.E.
1986-08-01
We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas
2014-01-01
Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722
2011-07-01
controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the
Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.
Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian
2010-10-01
According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins
Directory of Open Access Journals (Sweden)
Manuel Fischer
2017-06-01
Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Ivontsin, L. A.; Mashkovtseva, E. V.; Nartsissov, Ya R.
2017-11-01
Implications of quantum-mechanical approach to the description of proton transport in biological systems are a tempting subject for an overlapping of fundamental physics and biology. The model of proton transport through the integrated membrane enzyme FoF1-ATP synthase responsible for ATP synthesis was developed. The estimation of the mathematical expectation of the proton transfer time through the half-channel was performed. Observed set of proton pathways through the inlet half-channel showed the nanosecond timescale highly dependable of some amino acid residues. There were proposed two types of crucial amino acids: critically localized (His245) and being a part of energy conserving system (Asp119).
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie
2011-09-02
The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.
Henritzi, Sandra; Fischer, Manuel; Grininger, Martin; Oreb, Mislav; Boles, Eckhard
2018-01-01
The ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway. The previously engineered short-chain acyl-CoA producing yeast Fas1 R1834K /Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L -1 in a 72-h fermentation. The additional accumulation of 90 mg L -1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L -1 . However, in growth tests concentrations even lower than 50.0 mg L -1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different
7.5-Å cryo-em structure of the mycobacterial fatty acid synthase.
Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc
2013-03-11
The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
International Nuclear Information System (INIS)
Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin
2015-01-01
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
Energy Technology Data Exchange (ETDEWEB)
Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)
2015-10-23
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.
2010-01-01
Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Inhibition of fatty acid synthase prevents preadipocyte differentiation
International Nuclear Information System (INIS)
Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.
2005-01-01
Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...
Directory of Open Access Journals (Sweden)
D. M. Djuric
1996-01-01
Full Text Available The possible involvement of different effector systems (nitric oxide synthase, guanylate cyclase, β-adrenergic and muscarinic cholinergic receptors, cyclooxygenase and lipoxygenase, and Na+,K+-ATPase was evaluated in a histamine H3 receptor agonist-induced ((Rα-methylhistamine, (Rα-MeHA endothelium-dependent rat aorta relaxation assay. (Rα-MeHA (0.1 nM – 0.01 mM relaxed endothelium-dependent rat aorta, with a pD2 value of 8.22 ± 0.06, compared with a pD2 value of 7.98 ± 0.02 caused by histamine (50% and 70% relaxation, respectively. The effect of (Rα-MeHA (0.1 nM – 0.01 mM was competitively antagonized by thioperamide (1, 10 and 30 nM (pA2 = 9.21 ± 0.40; slope = 1.03 ± 0.35 but it was unaffected by pyrilamine (100 nM, cimetidine (1 μM, atropine (10 μM, propranolol (1 μM, indomethacin (10 μM or nordthydroguaiaretic acid (0.1 mM. Inhibitors of nitric oxide synthase, L-NG-monomethylarginine (L-NMMA, 10 μM and NG-nitro-L-arginine methylester (L-NOARG, 10 μM inhibited the relaxation effect of (Rα-MeHA, by approximately 52% and 70%, respectively. This inhibitory effect of L-NMMA was partially reversed by L-arginine (10 μM. Methylene blue (10 μM and ouabain (10 μM inhibited relaxation (Rα-MeHA-induced by approximately 50% and 90%, respectively. The products of cyclooxygenase and lipoxygenase are not involved in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation nor are the muscarinic cholinergic and β-adrenergic receptors. The results also suggest the involvement of NO synthase, guanylate cyclase and Na+,K+-ATPase in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation.
E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique
2013-12-01
We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
Energy Technology Data Exchange (ETDEWEB)
Hopperton, Kathryn E., E-mail: kathryn.hopperton@mail.utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: robin.duncan@uwaterloo.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: richard.bazinet@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: m.archer@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare
International Nuclear Information System (INIS)
Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.
2014-01-01
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of
International Nuclear Information System (INIS)
Chang, Soo-Ik; Hammes, G.G.
1989-01-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution
Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.
Directory of Open Access Journals (Sweden)
Damien Garrido
2015-02-01
Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell
Producing biofuels using polyketide synthases
Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D
2013-04-16
The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.
Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang
2008-10-24
The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.
Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.
Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George
2017-09-01
Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Haines, Ricci J; Corbin, Karen D; Pendleton, Laura C; Eichler, Duane C
2012-07-27
Endothelial nitric-oxide synthase (eNOS) utilizes l-arginine as its principal substrate, converting it to l-citrulline and nitric oxide (NO). l-Citrulline is recycled to l-arginine by two enzymes, argininosuccinate synthase (AS) and argininosuccinate lyase, providing the substrate arginine for eNOS and NO production in endothelial cells. Together, these three enzymes, eNOS, AS, and argininosuccinate lyase, make up the citrulline-NO cycle. Although AS catalyzes the rate-limiting step in NO production, little is known about the regulation of AS in endothelial cells beyond the level of transcription. In this study, we showed that AS Ser-328 phosphorylation was coordinately regulated with eNOS Ser-1179 phosphorylation when bovine aortic endothelial cells were stimulated by either a calcium ionophore or thapsigargin to produce NO. Furthermore, using in vitro kinase assay, kinase inhibition studies, as well as protein kinase Cα (PKCα) knockdown experiments, we demonstrate that the calcium-dependent phosphorylation of AS Ser-328 is mediated by PKCα. Collectively, these findings suggest that phosphorylation of AS at Ser-328 is regulated in accordance with the calcium-dependent regulation of eNOS under conditions that promote NO production and are in keeping with the rate-limiting role of AS in the citrulline-NO cycle of vascular endothelial cells.
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
International Nuclear Information System (INIS)
Wu Defeng; Cederbaum, Arthur
2006-01-01
Polyunsaturated fatty acids such as arachidonic acid (AA) play an important role in alcohol-induced liver injury. AA promotes toxicity in rat hepatocytes with high levels of cytochrome P4502E1 and in HepG2 E47 cells which express CYP2E1. Nitric oxide (NO) participates in the regulation of various cell activities as well as in cytotoxic events. NO may act as a protectant against cytotoxic stress or may enhance cytotoxicity when produced at elevated concentrations. The goal of the current study was to evaluate the effect of endogenously or exogenously produced NO on AA toxicity in liver cells with high expression of CYP2E1 and assess possible mechanisms for its actions. Pyrazole-induced rat hepatocytes or HepG2 cells expressing CYP2E1 were treated with AA in the presence or absence of an inhibitor of nitric oxide synthase L-N G -Nitroarginine Methylester (L-NAME) or the NO donors S-nitroso-N-acetylpenicillamine (SNAP), and (Z)-1-[-(2-aminoethyl)-N-(2-aminoethyl)]diazen-1-ium-1,2-diolate (DETA-NONO). AA decreased cell viability from 100% to 48 ± 6% after treatment for 48 h. In the presence of L-NAME, viability was further lowered to 23 ± 5%, while, SNAP or DETA-NONO increased viability to 66 ± 8 or 71 ± 6%. The L-NAME potentiated toxicity was primarily necrotic in nature. L-NAME did not affect CYP2E1 activity or CYP2E1 content. SNAP significantly lowered CYP2E1 activity but not protein. AA treatment increased lipid peroxidation and lowered GSH levels. L-NAME potentiated while SNAP prevented these changes. Thus, L-NAME increased, while NO donors decreased AA-induced oxidative stress. Antioxidants prevented the L-NAME potentiation of AA toxicity. Damage to mitochondria by AA was shown by a decline in the mitochondrial membrane potential (MMP). L-NAME potentiated this decline in MMP in association with its increase in AA-induced oxidative stress and toxicity. NO donors decreased this decline in MMP in association with their decrease in AA-induced oxidative stress and
Ji, Yingbin; Liu, Jian; Xing, Da
2016-09-01
In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C
2010-08-10
Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Jin, Li; Piao, Zhe Hao; Liu, Chun Ping; Sun, Simei; Liu, Bin; Kim, Gwi Ran; Choi, Sin Young; Ryu, Yuhee; Kee, Hae Jin; Jeong, Myung Ho
2018-03-01
Hypertension causes cardiac hypertrophy and leads to heart failure. Apoptotic cells are common in hypertensive hearts. Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) is associated with apoptosis. We recently demonstrated that gallic acid reduces nitric oxide synthase inhibition-induced hypertension. Gallic acid is a trihydroxybenzoic acid and has been shown to have beneficial effects, such as anti-cancer, anti-calcification and anti-oxidant activity. The purpose of this study was to determine whether gallic acid regulates cardiac hypertrophy and apoptosis in essential hypertension. Gallic acid significantly lowered systolic and diastolic blood pressure in spontaneously hypertensive rats (SHRs). Wheat germ agglutinin (WGA) and H&E staining revealed that gallic acid reduced cardiac enlargement in SHRs. Gallic acid treatment decreased cardiac hypertrophy marker genes, including atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP), in SHRs. The four isoforms, α, β, δ and γ, of CaMKII were increased in SHRs and were significantly reduced by gallic acid administration. Gallic acid reduced cleaved caspase-3 protein as well as bax, p53 and p300 mRNA levels in SHRs. CaMKII δ overexpression induced bax and p53 expression, which was attenuated by gallic acid treatment in H9c2 cells. Gallic acid treatment reduced DNA fragmentation and the TUNEL positive cells induced by angiotensin II. Taken together, gallic acid could be a novel therapeutic for the treatment of hypertension through suppression of CaMKII δ-induced apoptosis. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing
2017-12-01
Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Zhang, Baochun; Crankshaw, Will; Nesemeier, Ryan; Patel, Jay; Nweze, Ikenna; Lakshmanan, Jaganathan; Harbrecht, Brian G
2015-02-01
Induced nitric oxide synthase (iNOS) is induced in hepatocytes by shock and inflammatory stimuli. Excessive NO from iNOS mediates shock-induced hepatic injury and death, so understanding the regulation of iNOS will help elucidate the pathophysiology of septic shock. In vitro, cytokines induce iNOS expression through activation of signaling pathways including mitogen-activated protein kinases and nuclear factor κB. Cytokines also induce calcium (Ca(2+)) mobilization and activate calcium-mediated intracellular signaling pathways, typically through activation of calmodulin-dependent kinases (CaMK). Calcium regulates NO production in macrophages but the role of calcium and calcium-mediated signaling in hepatocyte iNOS expression has not been defined. Primary rat hepatocytes were isolated, cultured, and induced to produce NO with proinflammatory cytokines. Calcium mobilization and Ca(2+)-mediated signaling were altered with ionophore, Ca(2+) channel blockers, and inhibitors of CaMK. The Ca(2+) ionophore A23187 suppressed cytokine-stimulated NO production, whereas Ethylene glycol tetraacetic acid and nifedipine increased NO production, iNOS messenger RNA, and iNOS protein expression. Inhibition of CaMK with KN93 and CBD increased NO production but the calcineurin inhibitor FK 506 decreased iNOS expression. These data demonstrate that calcium-mediated signaling regulates hepatocyte iNOS expression and does so through a mechanism independent of calcineurin. Changes in intracellular calcium levels may regulate iNOS expression during hepatic inflammation induced by proinflammatory cytokines. Copyright © 2015 Elsevier Inc. All rights reserved.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Trujillo, Uldaeliz
2013-02-28
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Directory of Open Access Journals (Sweden)
Uldaeliz Trujillo
Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of
Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel
2013-01-01
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Enzymatic regulation of organic acid metabolism in an alkali-tolerant ...
African Journals Online (AJOL)
Tuoyo Aghomotsegin
2016-10-05
Oct 5, 2016 ... seedlings of C. virgata were treated with varying salt and alkali stress. First, the composition and .... mechanisms of organic acid accumulation in C. virgata ..... dehydrogenase and ferredoxin-dependent glutamate synthase in.
Zirpel, Bastian; Stehle, Felix; Kayser, Oliver
2015-09-01
The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
p63 promotes cell survival through fatty acid synthase.
Directory of Open Access Journals (Sweden)
Venkata Sabbisetti
2009-06-01
Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.
Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg
2013-02-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Directory of Open Access Journals (Sweden)
Rawat Richa
2011-05-01
Full Text Available Abstract Background Cyclopropane fatty acids (CPA have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
The crystal structure of human GDP-L-fucose synthase.
Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua
2013-09-01
Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.
Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A
2018-04-03
5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase
International Nuclear Information System (INIS)
Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.
1990-01-01
The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
International Nuclear Information System (INIS)
Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso
2012-01-01
This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A
2011-01-01
Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.
Directory of Open Access Journals (Sweden)
Jun Yu
Full Text Available Chronic alterations in blood flow initiate structural changes in vessel lumen caliber to normalize shear stress. The loss of endothelial derived nitric oxide synthase (eNOS in mice promotes abnormal flow dependent vascular remodeling, thus uncoupling mechanotransduction from adaptive vascular remodeling. However, the mechanisms of how the loss of eNOS promotes abnormal remodeling are not known. Here we show that abnormal flow-dependent remodeling in eNOS knockout mice (eNOS (-/- is associated with activation of the platelet derived growth factor (PDGF signaling pathway leading to the induction of the inhibitor of apoptosis, survivin. Interfering with PDGF signaling or survivin function corrects the abnormal remodeling seen in eNOS (-/- mice. Moreover, nitric oxide (NO negatively regulates PDGF driven survivin expression and cellular proliferation in cultured vascular smooth muscle cells. Collectively, our data suggests that eNOS negatively regulates the PDGF-survivin axis to maintain proportional flow-dependent luminal remodeling and vascular quiescence.
Broadbent, J R; Oberg, T S; Hughes, J E; Ward, R E; Brighton, C; Welker, D L; Steele, J L
2014-03-01
Lactic acid is an important industrial chemical commonly produced through microbial fermentation. The efficiency of acid extraction is increased at or below the acid's pKa (pH 3.86), so there is interest in factors that allow for a reduced fermentation pH. We explored the role of cyclopropane synthase (Cfa) and polysorbate (Tween) 80 on acid production and membrane lipid composition in Lactobacillus casei ATCC 334 at low pH. Cells from wild-type and an ATCC 334 cfa knockout mutant were incubated in APT broth medium containing 3 % glucose plus 0.02 or 0.2 % Tween 80. The cultures were allowed to acidify the medium until it reached a target pH (4.5, 4.0, or 3.8), and then the pH was maintained by automatic addition of NH₄OH. Cells were collected at the midpoint of the fermentation for membrane lipid analysis, and media samples were analyzed for lactic and acetic acids when acid production had ceased. There were no significant differences in the quantity of lactic acid produced at different pH values by wild-type or mutant cells grown in APT, but the rate of acid production was reduced as pH declined. APT supplementation with 0.2 % Tween 80 significantly increased the amount of lactic acid produced by wild-type cells at pH 3.8, and the rate of acid production was modestly improved. This effect was not observed with the cfa mutant, which indicated Cfa activity and Tween 80 supplementation were each involved in the significant increase in lactic acid yield observed with wild-type L. casei at pH 3.8.
Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid
Energy Technology Data Exchange (ETDEWEB)
Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD
2015-10-26
Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.
Use of linalool synthase in genetic engineering of scent production
Pichersky, Eran
1998-01-01
A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.
Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther
2017-06-01
Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
Hopperton, Kathryn E; Duncan, Robin E; Bazinet, Richard P; Archer, Michael C
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from (14)C-labeled acetate to those supplied exogenously as (14)C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2-3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice
International Nuclear Information System (INIS)
Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.
2006-01-01
α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
Directory of Open Access Journals (Sweden)
Mai-Britt Mosbech
Full Text Available Ceramide and its metabolites constitute a diverse group of lipids, which play important roles as structural entities of biological membranes as well as regulators of cellular growth, differentiation, and development. The C. elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. HYL-1 function is required for synthesis of ceramides and sphingolipids containing very long acyl-chains (≥C24, while HYL-2 is required for synthesis of ceramides and sphingolipids containing shorter acyl-chains (≤C22. Here we show that functional loss of HYL-2 decreases lifespan, while loss of HYL-1 or LAGR-1 does not affect lifespan. We show that loss of HYL-1 and LAGR-1 functions extend lifespan in an autophagy-dependent manner, as knock down of the autophagy-associated gene ATG-12 abolishes hyl-1;lagr-1 longevity. The transcription factors PHA-4/FOXA, DAF-16/FOXO, and SKN-1 are also required for the observed lifespan extension, as well as the increased number of autophagosomes in hyl-1;lagr-1 animals. Both autophagic events and the transcription factors PHA-4/FOXA, DAF-16, and SKN-1 have previously been associated with dietary restriction-induced longevity. Accordingly, we find that hyl-1;lagr-1 animals display reduced feeding, increased resistance to heat, and reduced reproduction. Collectively, our data suggest that specific sphingolipids produced by different ceramide synthases have opposing roles in determination of C. elegans lifespan. We propose that loss of HYL-1 and LAGR-1 result in dietary restriction-induced autophagy and consequently prolonged longevity.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
Molecular cloning and characterization of strictosidine synthase, a ...
African Journals Online (AJOL)
Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...
Motani, Kou; Ito, Shinji; Nagata, Shigekazu
2015-05-15
Cytoplasmic DNA activates cyclic GMP-AMP synthase (cGAS) to produce cyclic 2'-5'3'-5'GMP-AMP dinucleotide (2'5 'cGAMP). The binding of 2'5'cGAMP to an adaptor protein, stimulator of IFN genes (STING), activates a transcription factor, IFN regulatory factor 3, leading to the induction of IFN and chemokine gene expression. In this study, we found that the 2'5'cGAMP-dependent STING activation induced highly upregulated CXCL10 gene expression. Formation of a distinct STING dimer, which was detected by native PAGE, was induced by 2'5'cGAMP, but not 3'-5'3'-5'cGAMP. Analysis of DNase II(-/-) mice, which constitutively produce IFN-β and CXCL10, showed the accumulation of 2'5'cGAMP in their fetal livers and spleens, suggesting that the undigested DNA accumulating in DNase II(-/-) cells may have leaked from the lysosomes into the cytoplasm. The DNase II(-/-) mouse embryonic fibroblasts produced 2'5'cGAMP in a cGAS-dependent manner during apoptotic cell engulfment. However, cGAS deficiency did not impair the STING-dependent upregulation of CXCL10 in DNase II(-/-) mouse embryonic fibroblasts that was induced by apoptotic cell engulfment or DNA lipofection. These results suggest the involvement of a cGAS-independent additional DNA sensor(s) that induces the STING-dependent activation of innate immunity. Copyright © 2015 by The American Association of Immunologists, Inc.
Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J
2016-06-15
Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.
Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg
2013-01-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714
Insights into the reactivation of cobalamin-dependent methionine synthase
Energy Technology Data Exchange (ETDEWEB)
Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)
2009-12-10
Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.
Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun
2016-11-16
The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
Energy Technology Data Exchange (ETDEWEB)
Fukuda, Jun [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan); Tsujimura, Seiya [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan)], E-mail: seiya@kais.kyoto-u.ac.jp; Kano, Kenji [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan)], E-mail: kkano@kais.kyoto-u.ac.jp
2008-12-30
This paper describes the characterization of mediated electro-enzymatic electrolysis systems based on NAD-dependent dehydrogenase reactions in the tricarboxylic acid (TCA) cycle. A micro-bulk electrolysis system with a carbon felt anode immersed in an electrolysis solution with a value of about 10 {mu}L was constructed for coulometric analysis of the substrate oxidation. Diaphorase (DI) was used to couple the NAD-dependent dehydrogenase reaction with the anode reaction of a suitable redox mediator. We focused on three types of NAD-dependant dehydrogenases reactions in this research: (1) isocitrate oxidation, in which the standard Gibbs energy change ({delta}G{sup o}') is negative; (2) {alpha}-ketoglutarate oxidation, which involves an electrochemically active coenzyme A (CoA); and (3) malate oxidation, which is thermodynamically unfavorable because of a large positive {delta}G{sup o}' value. The complete electrolysis of isocitrate was easily achieved, supporting the effective re-oxidation of NADH in the diaphorase-catalyzed electrochemical reaction. CoA was unfavorably oxidized at the electrodes in the presence of some mediators. The electrocatalytic oxidation of CoA was suppressed and the quantitative electrochemical oxidation of {alpha}-ketoglutarate was achieved by selecting a suitable mediator with negligibly slow electron transfer kinetics with CoA. The uphill malate oxidation was susceptible to product inhibition in the bioelectrochemical system, although NADH generated in the malate dehydrogenase reaction was immediately oxidized in the electrochemical system. The inhibition was successfully suppressed by linking citrate synthase to quench oxaloacetate and to make the total {delta}G{sup o}' value negative.
International Nuclear Information System (INIS)
Fukuda, Jun; Tsujimura, Seiya; Kano, Kenji
2008-01-01
This paper describes the characterization of mediated electro-enzymatic electrolysis systems based on NAD-dependent dehydrogenase reactions in the tricarboxylic acid (TCA) cycle. A micro-bulk electrolysis system with a carbon felt anode immersed in an electrolysis solution with a value of about 10 μL was constructed for coulometric analysis of the substrate oxidation. Diaphorase (DI) was used to couple the NAD-dependent dehydrogenase reaction with the anode reaction of a suitable redox mediator. We focused on three types of NAD-dependant dehydrogenases reactions in this research: (1) isocitrate oxidation, in which the standard Gibbs energy change (ΔG o ') is negative; (2) α-ketoglutarate oxidation, which involves an electrochemically active coenzyme A (CoA); and (3) malate oxidation, which is thermodynamically unfavorable because of a large positive ΔG o ' value. The complete electrolysis of isocitrate was easily achieved, supporting the effective re-oxidation of NADH in the diaphorase-catalyzed electrochemical reaction. CoA was unfavorably oxidized at the electrodes in the presence of some mediators. The electrocatalytic oxidation of CoA was suppressed and the quantitative electrochemical oxidation of α-ketoglutarate was achieved by selecting a suitable mediator with negligibly slow electron transfer kinetics with CoA. The uphill malate oxidation was susceptible to product inhibition in the bioelectrochemical system, although NADH generated in the malate dehydrogenase reaction was immediately oxidized in the electrochemical system. The inhibition was successfully suppressed by linking citrate synthase to quench oxaloacetate and to make the total ΔG o ' value negative
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.
Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard
2015-05-22
HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S
2008-02-01
Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.
International Nuclear Information System (INIS)
Hwang, Yong Pil; Kim, Hyung Gyun; Hien, Tran Thi; Jeong, Myung Ho; Jeong, Tae Cheon; Jeong, Hye Gwang
2011-01-01
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-α-stimulated monocytes to endothelial cells and suppressed the TNF-α induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-α-induced nuclear factor-κB activation, which was attenuated by pretreatment with N G -nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: ► Puerarin induced the phosphorylation of eNOS and the production of NO. ► Puerarin activated eNOS through ER-dependent PI3-kinase and Ca 2+ -dependent AMPK. ► Puerarin-induced NO was involved in the inhibition of NF-kB activation. ► Puerarin may help for prevention of vascular dysfunction and diabetes.
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
DEFF Research Database (Denmark)
Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.
1999-01-01
cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...
Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yong Pil; Kim, Hyung Gyun [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of); Hien, Tran Thi [College of Pharmacy, Chosun University, Gwangju (Korea, Republic of); Jeong, Myung Ho [Heart Research Center, Chonnam National University Hospital, Gwangju (Korea, Republic of); Jeong, Tae Cheon, E-mail: taecheon@ynu.ac.kr [College of Pharmacy, Yeungnam University, Gyungsan (Korea, Republic of); Jeong, Hye Gwang, E-mail: hgjeong@cnu.ac.kr [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of)
2011-11-15
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-{alpha}-stimulated monocytes to endothelial cells and suppressed the TNF-{alpha} induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-{alpha}-induced nuclear factor-{kappa}B activation, which was attenuated by pretreatment with N{sup G}-nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: Black-Right-Pointing-Pointer Puerarin induced the phosphorylation of eNOS and the production of NO. Black-Right-Pointing-Pointer Puerarin activated eNOS through ER-dependent PI3-kinase and Ca{sup 2+}-dependent AMPK. Black-Right-Pointing-Pointer Puerarin-induced NO was involved in the inhibition of NF-kB activation. Black-Right-Pointing-Pointer Puerarin may help for prevention of vascular dysfunction and diabetes.
Studies on the Active Site of Deacetoxycephalosporin C Synthase
Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama
1999-01-01
The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Directory of Open Access Journals (Sweden)
Häberle J
2011-08-01
Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia
Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.
2011-01-01
Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Kruse, Rikke; Harvald, Eva Bang
2013-01-01
Ceramide and its metabolites constitute a diverse group of lipids, which play important roles as structural entities of biological membranes as well as regulators of cellular growth, differentiation, and development. The C. elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2...... that hyl-1;lagr-1 animals display reduced feeding, increased resistance to heat, and reduced reproduction. Collectively, our data suggest that specific sphingolipids produced by different ceramide synthases have opposing roles in determination of C. elegans lifespan. We propose that loss of HYL-1 and LAGR......, and lagr-1. HYL-1 function is required for synthesis of ceramides and sphingolipids containing very long acyl-chains (≥C24), while HYL-2 is required for synthesis of ceramides and sphingolipids containing shorter acyl-chains (≤C22). Here we show that functional loss of HYL-2 decreases lifespan, while loss...
International Nuclear Information System (INIS)
Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.
2006-01-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase
Energy Technology Data Exchange (ETDEWEB)
Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)
2006-03-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.
International Nuclear Information System (INIS)
Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua
2010-01-01
Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°
Predicting the catalytic sites of isopenicillin N synthase (IPNS ...
African Journals Online (AJOL)
Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
DEFF Research Database (Denmark)
Jensen, Mai-Britt Mosbech; Færgeman, Nils J.; Ejsing, Christer S.
2011-01-01
, these lipid species are recognized as bioactive signalling molecules involved in regulation of cell growth, differentiation, senescence, and apoptosis, and thus a delicate equilibrium between the levels of these interconvertible lipid species underlies the balance between cell survival and death. The C....... elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. Here we show that functional loss of HYL-1 and LAGR-1 depletes 43:1;3 sphingolipids and extends lifespan in a PHA-4-, SKN-1-, and ATG-12-dependent manner. The transcription factors PHA-4 and SKN-1 as well as ATG-12, which...
DEFF Research Database (Denmark)
González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael
2010-01-01
The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.
Directory of Open Access Journals (Sweden)
Anna Zdyb
Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Directory of Open Access Journals (Sweden)
Nataliya E Chorna
Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
Sulfur amino acid metabolism in doxorubicin-resistant breast cancer cells
International Nuclear Information System (INIS)
Ryu, Chang Seon; Kwak, Hui Chan; Lee, Kye Sook; Kang, Keon Wook; Oh, Soo Jin; Lee, Ki Ho; Kim, Hwan Mook; Ma, Jin Yeul; Kim, Sang Kyum
2011-01-01
Although methionine dependency is a phenotypic characteristic of tumor cells, it remains to be determined whether changes in sulfur amino acid metabolism occur in cancer cells resistant to chemotherapeutic medications. We compared expression/activity of sulfur amino acid metabolizing enzymes and cellular levels of sulfur amino acids and their metabolites between normal MCF-7 cells and doxorubicin-resistant MCF-7 (MCF-7/Adr) cells. The S-adenosylmethionine/S-adenosylhomocysteine ratio, an index of transmethylation potential, in MCF-7/Adr cells decreased to ∼ 10% relative to that in MCF-7 cells, which may have resulted from down-regulation of S-adenosylhomocysteine hydrolase. Expression of homocysteine-clearing enzymes, such as cystathionine beta-synthase, methionine synthase/methylene tetrahydrofolate reductase, and betaine homocysteine methyltransferase, was up-regulated in MCF-7/Adr cells, suggesting that acquiring doxorubicin resistance attenuated methionine-dependence and activated transsulfuration from methionine to cysteine. Homocysteine was similar, which is associated with a balance between the increased expressions of homocysteine-clearing enzymes and decreased extracellular homocysteine. Despite an elevation in cysteine, cellular GSH decreased in MCF-7/Adr cells, which was attributed to over-efflux of GSH into the medium and down-regulation of the GSH synthesis enzyme. Consequently, MCF-7/Adr cells were more sensitive to the oxidative stress induced by bleomycin and menadione than MCF-7 cells. In conclusion, our results suggest that regulating sulfur amino acid metabolism may be a possible therapeutic target for chemoresistant cancer cells. These results warrant further investigations to determine the role of sulfur amino acid metabolism in acquiring anticancer drug resistance in cancer cells using chemical and biological regulators involved in sulfur amino acid metabolism. - Research highlights: → MCF-7/Adr cells showed decreases in cellular GSH
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses.
Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J; Stunden, H James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R; Cain, Jason E; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P
2017-10-03
Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS) detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40) large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development. IMPORTANCE Recent studies suggest that low-dose DNA-damaging compounds traditionally used in cancer therapy can have opposite effects on antiviral responses, either suppressing (with the example of CPT) or potentiating (with the example of doxorubicin) them. Our work demonstrates that the minor DNA damage promoted by low-dose CPT can also trigger strong antiviral responses, dependent on the presence of viral oncogenes. Taken together, these results call for caution in the therapeutic use of low-dose chemotherapy agents to modulate antiviral responses in humans. Copyright © 2017 Pépin et al.
Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay
2017-05-07
Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase
Directory of Open Access Journals (Sweden)
Santos Diógenes S
2008-04-01
Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Kelley, M.J.; Carman, G.M.
1987-01-01
The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism
Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer
Abu-Soud, Husam M.; Stuehr, Dennis J.
1993-11-01
Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.
International Nuclear Information System (INIS)
Kampa, Marilena; Boskou, Dimitrios; Gravanis, Achille; Castanas, Elias; Alexaki, Vassilia-Ismini; Notas, George; Nifli, Artemissia-Phoebe; Nistikaki, Anastassia; Hatzoglou, Anastassia; Bakogeorgou, Efstathia; Kouimtzoglou, Elena; Blekas, George
2004-01-01
The oncoprotective role of food-derived polyphenol antioxidants has been described but the implicated mechanisms are not yet clear. In addition to polyphenols, phenolic acids, found at high concentrations in a number of plants, possess antioxidant action. The main phenolic acids found in foods are derivatives of 4-hydroxybenzoic acid and 4-hydroxycinnamic acid. This work concentrates on the antiproliferative action of caffeic acid, syringic acid, sinapic acid, protocatechuic acid, ferulic acid and 3,4-dihydroxy-phenylacetic acid (PAA) on T47D human breast cancer cells, testing their antioxidant activity and a number of possible mechanisms involved (interaction with membrane and intracellular receptors, nitric oxide production). The tested compounds showed a time-dependent and dose-dependent inhibitory effect on cell growth with the following potency: caffeic acid > ferulic acid = protocatechuic acid = PAA > sinapic acid = syringic acid. Caffeic acid and PAA were chosen for further analysis. The antioxidative activity of these phenolic acids in T47D cells does not coincide with their inhibitory effect on tumoral proliferation. No interaction was found with steroid and adrenergic receptors. PAA induced an inhibition of nitric oxide synthase, while caffeic acid competes for binding and results in an inhibition of aryl hydrocarbon receptor-induced CYP1A1 enzyme. Both agents induce apoptosis via the Fas/FasL system. Phenolic acids exert a direct antiproliferative action, evident at low concentrations, comparable with those found in biological fluids after ingestion of foods rich in phenolic acids. Furthermore, the direct interaction with the aryl hydrocarbon receptor, the nitric oxide synthase inhibition and their pro-apoptotic effect provide some insights into their biological mode of action
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Ament, K.; Schie, C.C.; Bouwmeester, H.J.; Haring, M.A.; Schuurink, R.C.
2006-01-01
Two cDNAs encoding geranylgeranyl pyrophosphate (GGPP) synthases from tomato (Lycopersicon esculentum) have been cloned and functionally expressed in Escherichia coli. LeGGPS1 was predominantly expressed in leaf tissue and LeGGPS2 in ripening fruit and flower tissue. LeGGPS1 expression was induced
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells
International Nuclear Information System (INIS)
Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.
1986-01-01
Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
wALADin benzimidazoles differentially modulate the function of porphobilinogen synthase orthologs.
Lentz, Christian S; Halls, Victoria S; Hannam, Jeffrey S; Strassel, Silke; Lawrence, Sarah H; Jaffe, Eileen K; Famulok, Michael; Hoerauf, Achim; Pfarr, Kenneth M
2014-03-27
The heme biosynthesis enzyme porphobilinogen synthase (PBGS) is a potential drug target in several human pathogens. wALADin1 benzimidazoles have emerged as species-selective PBGS inhibitors against Wolbachia endobacteria of filarial worms. In the present study, we have systematically tested wALADins against PBGS orthologs from bacteria, protozoa, metazoa, and plants to elucidate the inhibitory spectrum. However, the effect of wALADin1 on different PBGS orthologs was not limited to inhibition: several orthologs were stimulated by wALADin1; others remained unaffected. We demonstrate that wALADins allosterically modulate the PBGS homooligomeric equilibrium with inhibition mediated by favoring low-activity oligomers, while 5-aminolevulinic acid, Mg(2+), or K(+) stabilized high-activity oligomers. Pseudomonas aeruginosa PBGS could be inhibited or stimulated by wALADin1 depending on these factors and pH. We have defined the wALADin chemotypes responsible for either inhibition or stimulation, facilitating the design of tailored PBGS modulators for potential application as antimicrobial agents, herbicides, or drugs for porphyric disorders.
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
Ceramide synthase 2 facilitates S1P-dependent egress of thymocytes into the circulation in mice.
Rieck, Michael; Kremser, Christiane; Jobin, Katarzyna; Mettke, Elisabeth; Kurts, Christian; Gräler, Markus; Willecke, Klaus; Kolanus, Waldemar
2017-04-01
Well-defined gradients of the lipid mediator sphingosine-1-phosphate (S1P) direct chemotactic egress of mature thymocytes from the thymus into the circulation. Although it is known that these gradients result from low S1P levels in the thymic parenchyma and high S1P concentrations at the exit sites and in the plasma, the biochemical mechanisms that regulate these differential S1P levels remain unclear. Several studies demonstrated that ceramide synthase 2 (Cers2) regulates the levels of the S1P precursor sphingosine. We, therefore, investigated whether Cers2 is involved in the regulation of S1P gradients and S1P-dependent egress into the circulation. By analyzing Cers2-deficient mice, we demonstrate that Cers2 limits the levels of S1P in thymus and blood to maintain functional S1P gradients that mediate thymocyte emigration into the circulation. This function is specific for Cers2, as we also show that Cers4 is not involved in the regulation of thymic egress. Our study identified Cers2 as an important regulator of S1P-dependent thymic egress, and thus contributes to the understanding of how S1P gradients are maintained in vivo. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Helicase-dependent amplification of nucleic acids.
Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand
2013-10-11
Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
Energy Technology Data Exchange (ETDEWEB)
Marcella, Aaron M.; Culbertson, Sannie J.; Shogren-Knaak, Michael A.; Barb, Adam W.
2017-11-01
The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05 and 4.10 Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a KD = 62 ± 13 nM, followed by the binding of two more equivalents of holo-ACPP with KD = 1.2 ± 0.2 μM. Cooperativity was not observed for apo-ACPP which bound with KD = 2.4 ± 0.1 μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis.
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Sydor, Tobias; von Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert
2013-03-01
Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. © 2012 Blackwell Publishing Ltd.
The adaptive mechanisms that protect brain metabolism during and after hypoxia, for instance, during hypoxic preconditioning, are coordinated in part by nitric oxide (NO). We tested the hypothesis that acute transient hypoxia stimulates NO synthase (NOS)-activated mechanisms of m...
Arginine-dependent acid resistance in Salmonella enterica serovar Typhimurium
Kieboom, J.; Abee, T.
2006-01-01
Salmonella enterica serovar Typhimurium does not survive a pH 2.5 acid challenge under conditions similar to those used for Escherichia coli (J. W. Foster, Nat. Rev. Microbiol. 2:898-907, 2004). Here, we provide evidence that S. enterica serovar Typhimurium can display arginine-dependent acid
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gómez, Cristina; Horna, Dina H.; Olano, Carlos; Palomino-Schätzlein, Martina; Pineda-Lucena, Antonio; Carbajo, Rodrigo J.; Braña, Alfredo F.; Méndez, Carmen; Salas, José A.
2011-01-01
Biosynthesis of the hybrid polyketide-nonribosomal peptide antibiotic streptolydigin, 3-methylaspartate, is utilized as precursor of the tetramic acid moiety. The three genes from the Streptomyces lydicus streptolydigin gene cluster slgE1-slgE2-slgE3 are involved in 3-methylaspartate supply. SlgE3, a ferredoxin-dependent glutamate synthase, is responsible for the biosynthesis of glutamate from glutamine and 2-oxoglutarate. In addition to slgE3, housekeeping NADPH- and ferredoxin-dependent glu...
Demiroglu-Zergeroglu, Asuman; Candemir, Gulsife; Turhanlar, Ebru; Sagir, Fatma; Ayvali, Nurettin
2016-12-01
The unrestrained EGFR signalling contributes to malignant phenotype in a number of cancers including Malignant Mesotheliomas. Present study was designed to evaluate EGFR-dependent anti-proliferative and apoptotic effects of Gallic acid in transformed Mesothelial (MeT-5A) and Malignant Mesothelioma (SPC212) cells. Gallic acid reduced the viability of Malignant Mesothelioma cells in a concentration and time-dependent manner. However, viability of mesothelial cells reduced only at high concentration and longer time periods. Gallic acid restrained the activation of EGFR, ERK1/2 and AKT proteins and down regulated expression of Cyclin D and Bcl-2 genes, but upregulated the expression of p21 gene in EGF-induced SPC212 cells. GA-induced transitory G1 arrest and triggered mitochondrial and death receptor mediated apoptosis, which requires p38MAPK activation. The data provided here indicate that GA is able to inhibit EGFR dependent proliferation and survival signals and induces p38 pathway dependent apoptosis in Malignant Mesothelioma cells. On the basis of these experimental findings it is worthwhile to investigate further the biological activity of Gallic acid on other Mesothelioma cell lines harbouring aberrant EGFR signals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens
Directory of Open Access Journals (Sweden)
Mahiran Basri
2012-08-01
Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V
2004-01-30
C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
International Nuclear Information System (INIS)
Lee, Miyoung; Lee, Sangchoon; Cho, Junehaeng; Ryu, Seong Eon; Yoon, Moonyoung; Koo, Bonsung
2013-01-01
Acetolactate synthase (ALS) is a thiamine diphosphate (ThDP)-dependent enzyme that catalyzes the decarboxylation of pyruvate and then condenses the hydroxyethyl moiety with another molecule of pyruvate to give 2-acetolactate (AL). AL is a key metabolic intermediate in various metabolic pathways of microorganisms. In addition, AL can be converted to acetoin, an important physiological metabolite that is excreted by many microorganisms. There are two types of ALSs reported in the literature, anabolic aceto-hydroxyacid synthase (AHAS) and catabolic ALSs (cALS). The anabolic AHAS is primarily found in plants, fungi, and bacteria, is involved in the biosynthesis of branched-chain amino acids (BCAAs), and contains flavin adenine dinucleotide (FAD), whereas the cALS is found only in some bacteria and is involved in the butanediol fermentation pathway. Both of the enzymes are ThDP-dependent and require a divalent metal ion for catalytic activity. Despite the similarities of the reactions catalyzed, the cALS can be distinguished from anabolic AHAS by a low optimal pH of about 6.0, FAD-independent functionality, a genetic location within the butanediol operon, and lack of a regulatory subunit. It is noteworthy that the structural and functional features of AHAS have been extensively studied, in contrast to those of cALS, for which only limited information is available. To date, the only crystal structure of cALS reported is from Klebsiella pneumonia, which revealed that the overall structure of K. pneumonia ALS is similar to that of AHAS except for the FAD binding region found in AHAS
International Nuclear Information System (INIS)
Migge, A.; Carrayol, E.; Hirel, B.; Lohmann, M.; Meya, G.; Becker, T.W.
1998-01-01
The influence of ultraviolet A (UV-A) or B (UV-B) light and of the nitrogen source on the induction of ferredoxin-dependent glutamate synthase (Fd-GOGAT, EC 1.4.7.1) was examined in etiolated cotyledons of tomato (Lycopersicon escu- lentum L.). The Fd-GOGAT activity increased upon illumination of etiolated tomato cotyledons with UV-A or UV-B light. This stimulation of Fd-GOGAT activity was correlated with an increase in both the Fd-GOGAT transcript level and the Fd-GOGAT protein abundance. These results suggest that UV-A or UV-B light stimulates the de novo synthesis of Fd-GOGAT in etiolated tomato cotyledons. Both UV-A and UV-B light failed to influence the activity of NADH-GOGAT (EC 1.4.1.14) in etiolated tomato cotyledons. Taken together, our data indicate that the tomato genes encoding Fd- or NADH-dependent glutamate synthase are regulated differently by UV-A or UV-B light. No difference with respect to both the Fd-GOGAT transcript and protein abundance was found between cotyledons of tomato seedlings grown with either nitrate or ammonium as the sole N-source in the dark or in white light. In addition, the increase in the Fd-GOGAT protein pool induced by white light in etiolated nitrate-grown tomato seedling cotyledons was similar to that induced by white light in etiolated ammonium-grown tomato seedling cotyledons. These results show that the tomato Fd-GOGAT protein level does not depend strongly on the nature of the nitrogen source and that there appears to be no major stimulatory effect on the Fd-GOGAT protein pool produced by nitrate during the illumination of etiolated tomato cotyledons
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Poly(aspartic acid) with adjustable pH-dependent solubility.
Németh, Csaba; Gyarmati, Benjámin; Abdullin, Timur; László, Krisztina; Szilágyi, András
2017-02-01
Poly(aspartic acid) (PASP) derivatives with adjustable pH-dependent solubility were synthesized and characterized to establish the relationship between their structure and solubility in order to predict their applicability as a basic material for enteric coatings. Polysuccinimide, the precursor of PASP, was modified with short chain alkylamines, and the residual succinimide rings were subsequently opened to prepare the corresponding PASP derivatives. Study of the effect of the type and concentration of the side groups on the pH-dependent solubility of PASP showed that solubility can be adjusted by proper selection of the chemical structure. The Henderson-Hasselbalch (HH) and the extended HH equations were used to describe the pH-dependent solubility of the polymers quantitatively. The estimate provided by the HH equation is poor, but an accurate description of the pH-dependent solubility can be found with the extended HH equation. The dissolution rate of a polymer film prepared from a selected PASP derivative was determined by fluorescence marking. The film dissolved rapidly when the pH was increased above its pK a . Cellular viability tests show that PASP derivatives are non-toxic to a human cell line. These polymers are thus of great interest as starting materials for enteric coatings. Poly(amino acid) type biocompatible polymers were synthesized for future use as pharmaceutical film coatings. To this end, we tailored the pH-dependent solubility of poly(aspartic acid) (PASP). It was found that both the solubility and the pK a values of the modified PASP depended strongly on composition. Fluorescent marking was used to characterize the dissolution of a chosen PASP derivative. In acidic media only a negligible amount of the polymer dissolved, but dissolution was very fast and complete at the pH values that prevail in the small intestine. As a consequence, enteric coatings based on such PASP derivatives may be used for drug delivery in the gastrointestinal tract
International Nuclear Information System (INIS)
Bruns, B.; Hahlbrock, K.; Schäfer, E.
1986-01-01
The fluence dependence of the time course of accumulation of chalcone synthase mRNA in ultraviolet (UV)-light-irradiated cell suspension cultures of parsley (Petroselinum crispum) and the additional effects of blue and far-red light have been investigated. Variations of the UV fluence had no detectable influence on the initial rate of increase in mRNA amount or translational activity, nor on the preceding lag period of approximately 3 h, but strongly influenced the duration of the transient increase. The effects were the same whether the fluence rate or the time of irradiation was varied to obtain a given fluence. Blue-light pretreatment of the cells resulted in increased amounts of mRNA and abolished the apparent lag period. This effect remained cryptic without the subsequent UV-light treatment. Irradiation with long-wavelength far-red light following UV-light pulses shortened the duration of the mRNA accumulation period. This effect was not altered by a preceding blue-light treatment. Thus, three photoreceptors, a UV-B receptor, a blue-light receptor and phytochrome, participate in the regulation of chalcone synthase mRNA accumulation in this system
Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T
2016-03-01
Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.
Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai
2013-04-01
An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.
Dries, Eef; Santiago, Demetrio J; Johnson, Daniel M; Gilbert, Guillaume; Holemans, Patricia; Korte, Sanne M; Roderick, H Llewelyn; Sipido, Karin R
2016-10-15
The dyadic cleft, where coupled ryanodine receptors (RyRs) reside, is thought to serve as a microdomain for local signalling, as supported by distinct modulation of coupled RyRs dependent on Ca 2+ /calmodulin-dependent kinase II (CaMKII) activation during high-frequency stimulation. Sympathetic stimulation through β-adrenergic receptors activates an integrated signalling cascade, enhancing Ca 2+ cycling and is at least partially mediated through CaMKII. Here we report that CaMKII activation during β-adrenergic signalling is restricted to the dyadic cleft, where it enhances activity of coupled RyRs thereby contributing to the increase in diastolic events. Nitric oxide synthase 1 equally participates in the local modulation of coupled RyRs. In contrast, the increase in the Ca 2+ content of the sarcoplasmic reticulum and related increase in the amplitude of the Ca 2+ transient are primarily protein kinase A-dependent. The present data extend the concept of microdomain signalling in the dyadic cleft and give perspectives for selective modulation of RyR subpopulations and diastolic events. In cardiac myocytes, β-adrenergic stimulation enhances Ca 2+ cycling through an integrated signalling cascade modulating L-type Ca 2+ channels (LTCCs), phospholamban and ryanodine receptors (RyRs). Ca 2+ /calmodulin-dependent kinase II (CaMKII) and nitric oxide synthase 1 (NOS1) are proposed as prime mediators for increasing RyR open probability. We investigate whether this pathway is confined to the high Ca 2+ microdomain of the dyadic cleft and thus to coupled RyRs. Pig ventricular myocytes are studied under whole-cell voltage-clamp and confocal line-scan imaging with Fluo-4 as a [Ca 2+ ] i indicator. Following conditioning depolarizing pulses, spontaneous RyR activity is recorded as Ca 2+ sparks, which are assigned to coupled and non-coupled RyR clusters. Isoproterenol (ISO) (10 nm) increases Ca 2+ spark frequency in both populations of RyRs. However, CaMKII inhibition reduces
Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase
DEFF Research Database (Denmark)
Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne
2015-01-01
The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC 2.7.6.1) catalyses the Mg2+-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP...
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
He, Quan; Kubec, Roman; Jadhav, Abhijit P; Musah, Rabi A
2011-11-01
A study of an enzyme that reacts with the sulfenic acid produced by the alliinase in Petiveria alliacea L. (Phytolaccaceae) to yield the P. alliacea lachrymator (phenylmethanethial S-oxide) showed the protein to be a dehydrogenase. It functions by abstracting hydride from sulfenic acids of appropriate structure to form their corresponding sulfines. Successful hydride abstraction is dependent upon the presence of a benzyl group on the sulfur to stabilize the intermediate formed on abstraction of hydride. This dehydrogenase activity contrasts with that of the lachrymatory factor synthase (LFS) found in onion, which catalyzes the rearrangement of 1-propenesulfenic acid to (Z)-propanethial S-oxide, the onion lachrymator. Based on the type of reaction it catalyzes, the onion LFS should be classified as an isomerase and would be called a "sulfenic acid isomerase", whereas the P. alliacea LFS would be termed a "sulfenic acid dehydrogenase". Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Amro Abd al fattah Amara
2012-04-01
Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Marcella, Aaron M; Culbertson, Sannie J; Shogren-Knaak, Michael A; Barb, Adam W
2017-11-24
The Escherichia coli holo-(acyl carrier protein) synthase (ACPS) catalyzes the coenzyme A-dependent activation of apo-ACPP to generate holo-(acyl carrier protein) (holo-ACPP) in an early step of fatty acid biosynthesis. E. coli ACPS is sufficiently different from the human fatty acid synthase to justify the development of novel ACPS-targeting antibiotics. Models of E. coli ACPS in unliganded and holo-ACPP-bound forms solved by X-ray crystallography to 2.05and 4.10Å, respectively, revealed that ACPS bound three product holo-ACPP molecules to form a 3:3 hexamer. Solution NMR spectroscopy experiments validated the ACPS binding interface on holo-ACPP using chemical shift perturbations and by determining the relative orientation of holo-ACPP to ACPS by fitting residual dipolar couplings. The binding interface is organized to arrange contacts between positively charged ACPS residues and the holo-ACPP phosphopantetheine moiety, indicating product contains more stabilizing interactions than expected in the enzyme:substrate complex. Indeed, holo-ACPP bound the enzyme with greater affinity than the substrate, apo-ACPP, and with negative cooperativity. The first equivalent of holo-ACPP bound with a K D =62±13nM, followed by the binding of two more equivalents of holo-ACPP with K D =1.2±0.2μM. Cooperativity was not observed for apo-ACPP which bound with K D =2.4±0.1μM. Strong product binding and high levels of holo-ACPP in the cell identify a potential regulatory role of ACPS in fatty acid biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
Shibui, S; Hoshino, T; Iwasaki, K; Nomura, K; Jastreboff, M M
1989-05-01
A method of identifying thymidylate synthase (TS) at the cellular level was developed using anti-TS monoclonal antibody (M-TS-4), a monoclonal antibody created against purified TS from a HeLa cell line. In HeLa cells and four human glioma cell lines (U-251, U-87, 343-MGA, and SF-188), TS was identified primarily in the cytoplasm. Autoradiographic and flow cytometric studies showed that TS appeared mainly in the G1 phase and subsided early in the S phase; thus, the G1 phase can be divided into TS-positive and -negative fractions. Nuclear TS was not demonstrated unequivocally with M-TS-4, and the relationship between nuclear TS and DNA synthesis could not be determined. Although the percentage of TS-positive cells was larger than the S-phase fraction measured by autoradiography after a pulse of tritiated thymidine or by the immunoperoxidase method using BUdR, the ratios were within a similar range (1.2-1.4) in all cell lines studied. Therefore, the S-phase fraction can be estimated indirectly from the percentage of TS-positive cells measured by M-TS-4. Because the emergence of TS detected by our method is cell cycle dependent, M-TS-4 may be useful for biochemical studies of TS and for cytokinetic analysis.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming
2012-01-01
Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...
Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina
2010-06-01
In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
De Wit, M. de; Spoel, S.H.; Sanchez-Perez, G.F.; Gommers, C.M.M.; Pieterse, C.M.J.; Voesenek, L.A.C.J.; Pierik, R.
2013-01-01
In dense stands of plants, such as agricultural monocultures, plants are exposed simultaneously to competition for light and other stresses such as pathogen infection. Here, we show that both salicylic acid (SA)-dependent and jasmonic acid (JA)-dependent disease resistance is inhibited by a
Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E M; Jenkins, Jermaine L; Heimiller, Chelsea; Maines, Mahin D
2016-08-01
Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1-3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T(308) before S(473) autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S(230) in hBVR (225)RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR's PDK1 binding (161)RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.-Miralem, T., Lerner
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Carglumic acid: a second look. Confirmed progress in a rare urea cycle disorder.
2008-04-01
(1) N-acetylglutamate synthase deficiency is a rare congenital disorder that causes hyperammonaemic comas, resulting in severe neurological morbidity and usually leading to death during childhood. (2) Carglumic acid is the first drug to be used for replacement therapy. Data available in 2003 showed beneficial effects on growth and psychomotor development. (3) In 2007, about 20 patients treated with carglumic acid for N-acetyglutamate synthase deficiency, for at least 5 years in half of cases, were all still alive. Their development was normal when treatment was initiated before complications occurred. (4) No serious adverse effects have been observed. (5) In practice, although this treatment has to continue for life, carglumic acid represents a major advance for patients with N-acetylglutamate synthase deficiency.
Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M
2017-07-11
Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced
Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan
2007-07-01
Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).
Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin
Lechner, Matthias; Lirk, Philipp; Rieder, Josef
2005-01-01
Inducible nitric oxide synthase (iNOS) is one of three key enzymes generating nitric oxide (NO) from the amino acid l-arginine. iNOS-derived NO plays an important role in numerous physiological (e.g. blood pressure regulation, wound repair and host defence mechanisms) and pathophysiological
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Directory of Open Access Journals (Sweden)
Êurica Adélia Nogueira Ribeiro
2012-01-01
Full Text Available The objective of the study was to investigate the mechanism of the relaxant activity of the ent-15α-acetoxykaur-16-en-19-oic acid (KA-acetoxy. In rat mesenteric artery rings, KA-acetoxy induced a concentration-dependent relaxation in vessels precontracted with phenylephrine. In the absence of endothelium, the vasorelaxation was significantly shifted to the right without reduction of the maximum effect. Endothelium-dependent relaxation was significantly attenuated by pretreatment with L-NAME, an inhibitor of the NO-synthase (NOS, indomethacin, an inhibitor of the cyclooxygenase, L-NAME + indomethacin, atropine, a nonselective antagonist of the muscarinic receptors, ODQ, selective inhibitor of the guanylyl cyclase enzyme, or hydroxocobalamin, a nitric oxide scavenger. The relaxation was completely reversed in the presence of L-NAME + 1 mM L-arginine or L-arginine, an NO precursor. Diterpene-induced relaxation was not affected by TEA, a nonselective inhibitor of K+ channels. The KA-acetoxy antagonized CaCl2-induced contractions in a concentration-dependent manner and also inhibited an 80 mM KCl-induced contraction. The KA-acetoxy did not interfere with Ca2+ release from intracellular stores. The vasorelaxant induced by KA-acetoxy seems to involve the inhibition of the Ca2+ influx and also, at least in part, by endothelial muscarinic receptors activation, NO and PGI2 release.
Directory of Open Access Journals (Sweden)
Saito Koji
2005-08-01
Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1
Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew
2017-07-01
Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
In vitro biochemical characterization of all barley endosperm starch synthases
DEFF Research Database (Denmark)
Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian
2016-01-01
Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Santoso, D; Thornburg, R
2000-08-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.
Helgadóttir, Sunna; Sinapah, Sylvie; Söll, Dieter; Ling, Jiqiang
2012-01-02
In methanogenic archaea, Sep-tRNA:Cys-tRNA synthase (SepCysS) converts Sep-tRNA(Cys) to Cys-tRNA(Cys). The mechanism of tRNA-dependent cysteine formation remains unclear due to the lack of functional studies. In this work, we mutated 19 conserved residues in Methanocaldococcus jannaschii SepCysS, and employed an in vivo system to determine the activity of the resulting variants. Our results show that three active-site cysteines (Cys39, Cys42 and Cys247) are essential for SepCysS activity. In addition, combined with structural modeling, our mutational and functional analyses also reveal multiple residues that are important for the binding of PLP, Sep and tRNA. Our work thus represents the first systematic functional analysis of conserved residues in archaeal SepCysSs, providing insights into the catalytic and substrate binding mechanisms of this poorly characterized enzyme. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Chakraborty, Jayashree B; Mahato, Sanjit K; Joshi, Kalpana; Shinde, Vaibhav; Rakshit, Srabanti; Biswas, Nabendu; Choudhury Mukherjee, Indrani; Mandal, Labanya; Ganguly, Dipyaman; Chowdhury, Avik A; Chaudhuri, Jaydeep; Paul, Kausik; Pal, Bikas C; Vinayagam, Jayaraman; Pal, Churala; Manna, Anirban; Jaisankar, Parasuraman; Chaudhuri, Utpal; Konar, Aditya; Roy, Siddhartha; Bandyopadhyay, Santu
2012-01-01
Alcoholic extract of Piper betle (Piper betle L.) leaves was recently found to induce apoptosis of CML cells expressing wild type and mutated Bcr-Abl with imatinib resistance phenotype. Hydroxy-chavicol (HCH), a constituent of the alcoholic extract of Piper betle leaves, was evaluated for anti-CML activity. Here, we report that HCH and its analogues induce killing of primary cells in CML patients and leukemic cell lines expressing wild type and mutated Bcr-Abl, including the T315I mutation, with minimal toxicity to normal human peripheral blood mononuclear cells. HCH causes early but transient increase of mitochondria-derived reactive oxygen species. Reactive oxygen species-dependent persistent activation of JNK leads to an increase in endothelial nitric oxide synthase-mediated nitric oxide generation. This causes loss of mitochondrial membrane potential, release of cytochrome c from mitochondria, cleavage of caspase 9, 3 and poly-adenosine diphosphate-ribose polymerase leading to apoptosis. One HCH analogue was also effective in vivo in SCID mice against grafts expressing the T315I mutation, although to a lesser extent than grafts expressing wild type Bcr-Abl, without showing significant bodyweight loss. Our data describe the role of JNK-dependent endothelial nitric oxide synthase-mediated nitric oxide for anti-CML activity of HCH and this molecule merits further testing in pre-clinical and clinical settings. © 2011 Japanese Cancer Association.
Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo
2014-09-01
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako
2014-01-01
Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl- 14 C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with
Energy Technology Data Exchange (ETDEWEB)
Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)
2014-10-03
Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or
Kaurilind, Eve; Brosché, Mikael
2017-01-01
Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Vassilopoulos, Athanassios; Pennington, J Daniel; Andresson, Thorkell; Rees, David M; Bosley, Allen D; Fearnley, Ian M; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Deng, Chu-Xia; Walker, John E; Gius, David
2014-08-01
Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCP(K139) directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins.
Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses
Directory of Open Access Journals (Sweden)
Geneviève Pèépin
2017-10-01
Full Text Available Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1 by low-dose camptothecin (CPT can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40 large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development.
Plasma Ascorbic Acid in Insulin and Non-insulin Dependent Diabetes
African Journals Online (AJOL)
Blood glucose, plasma ascorbic acid and haemoglobin levels were estimated in insulin dependent diabetics, non-insulin dependent diabetics and controls matched for number, sex and age. Significantly higher levels of these parameters were found in control group than in the other two groups. Statistically differences were ...
Vos, TA; van Goor, H; Tuyt, L; de Jager-Krikken, A; Leuvenink, R; Kuipers, F; Jansen, PLM; Moshage, H
The inducible nitric oxide synthase (iNOS) promoter contains nuclear factor kappa B (NF-kappa B) binding sites. NF-kappa B activation is determined, in part, by the intracellular redox status, The aim of this study was to determine the importance of the cellular glutathione status in relation to
Czech Academy of Sciences Publication Activity Database
Manzano, D.; Busquets, A.; Closa, M.; Hoyerová, Klára; Schaller, H.; Kamínek, Miroslav; Arró, M.; Ferrer, A.
2006-01-01
Roč. 61, 1-2 (2006), s. 195-213 ISSN 0167-4412 R&D Projects: GA AV ČR(CZ) IAA600380507 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * cytokinin * farnesyl diphosphate synthase * isoprenoid Subject RIV: EF - Botanics Impact factor: 3.577, year: 2006
International Nuclear Information System (INIS)
Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.
1989-01-01
The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex
Directory of Open Access Journals (Sweden)
Micaela S Sordelli
2011-04-01
Full Text Available Nitric oxide production, catalyzed by nitric oxide synthase (NOS, should be strictly regulated to allow embryo implantation. Thus, our first aim was to study NOS activity during peri-implantation in the rat uterus. Day 6 inter-implantation sites showed lower NOS activity (0.19±0.01 pmoles L-citrulline mg prot(-1 h(-1 compared to days 4 (0.34±0.03 and 5 (0.35±0.02 of pregnancy and to day 6 implantation sites (0.33±0.01. This regulation was not observed in pseudopregnancy. Both dormant and active blastocysts maintained NOS activity at similar levels. Anandamide (AEA, an endocannabinoid, binds to cannabinoid receptors type 1 (CB1 and type 2 (CB2, and high concentrations are toxic for implantation and embryo development. Previously, we observed that AEA synthesis presents an inverted pattern compared to NOS activity described here. We adopted a pharmacological approach using AEA, URB-597 (a selective inhibitor of fatty acid amide hydrolase, the enzyme that degrades AEA and receptor selective antagonists to investigate the effect of AEA on uterine NOS activity in vitro in rat models of implantation. While AEA (0.70±0.02 vs 0.40±0.04 and URB-597 (1.08±0.09 vs 0.83±0.06 inhibited NOS activity in the absence of a blastocyst (pseudopregnancy through CB2 receptors, AEA did not modulate NOS on day 5 pregnant uterus. Once implantation begins, URB-597 decreased NOS activity on day 6 implantation sites via CB1 receptors (0.25±0.04 vs 0.40±0.05. While a CB1 antagonist augmented NOS activity on day 6 inter-implantation sites (0.17±0.02 vs 0.27±0.02, a CB2 antagonist decreased it (0.17±0.02 vs 0.12±0.01. Finally, we described the expression and localization of cannabinoid receptors during implantation. In conclusion, AEA levels close to and at implantation sites seems to modulate NOS activity and thus nitric oxide production, fundamental for implantation, via cannabinoid receptors. This modulation depends on the presence of the blastocyst. These
Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme
Directory of Open Access Journals (Sweden)
Alberto Macone
2010-03-01
Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.
Fujimoto, S; Okano, I; Tanaka, Y; Sumida, Y; Tsuda, J; Kawakami, N; Shimohama, S
1996-06-01
We have purified bovine brain Zn(2+)-dependent acid phosphatase (Zn(2+)-APase), which requires Zn2+ ions to hydrolyze the substrate p-nitrophenyl phosphate (pNPP) in an acidic environment. The substrate specificity and metal requirement of Zn(2+)-APase at a physiological pH was also studied. The enzyme exhibited hydrolytic activity on myo-inositol-1- and -2-monophosphates, 2'-adenosine monophosphate, 2'-guanosine monophosphate, and the alpha- and beta-glycerophosphates, glucose-1-phosphate, and fructose-6-phosphate in 50 mM Tris-HCl buffer (pH 7.4) in the presence of Mg2+ ions, but not on pNPP and phosphotyrosine. Zn2+, Mn2+ and Co2+ ions were less effective for activation. Among the above substrates, myo-inositol-1-phosphate was the most susceptible to hydrolysis by the enzyme in the presence of 3 mM Mg2+ ions. The enzyme exhibited an optimum pH at around 8 for myo-inositol-1-phosphate in the presence of 3 mM Mg2+ ions. The Mg(2+)-dependent myo-inositol-1-phosphatase activity of the enzyme was significantly inhibited by Li+ ions. The Zn(2+)-dependent p-nitrophenyl phosphatase activity and Mg(2+)-dependent myo-inositol-1-phosphatase activity of the purified enzyme fraction exhibited similar behavior on Sephadex G-100 and Mono Q colomns. These findings suggest that Zn(2+)-APase also exhibits Mg(2+)-dependent myo-inositol-1-phosphatase activity under physiological conditions.
Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.
Directory of Open Access Journals (Sweden)
Anke Wittmann
Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.
Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase.
Directory of Open Access Journals (Sweden)
Anne eJunker
2013-07-01
Full Text Available Putrescine N-methyltransferases (PMTs are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-L-methionine (SAM as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs, which are ubiquitous enzymes of polyamine metabolism. SPDS use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in Datura stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom.
Santoso, Djoko; Thornburg, Robert
2000-01-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Czech Academy of Sciences Publication Activity Database
Jendeková, L.; Kojšová, S.; Andriantsitohaina, R.; Pecháňová, Olga
2006-01-01
Roč. 55, č. S1 (2006), S31-S37 ISSN 0862-8408 Grant - others:VEGA(SK) 2/6148/26; VEGA(SK) 1/342906 Institutional research plan: CEZ:AV0Z50110509 Keywords : red wine polyphenols * oxidative damage * nitric oxide synthase Subject RIV: ED - Physiology Impact factor: 2.093, year: 2006
DEFF Research Database (Denmark)
Vestergaard, H; Andersen, P H; Lund, S
1994-01-01
The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Energy Technology Data Exchange (ETDEWEB)
Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)
2015-08-07
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.
International Nuclear Information System (INIS)
Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin
2015-01-01
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Molecular cloning and functional characterization of porcine cyclic GMP-AMP synthase.
Wang, Jiang; Chu, Beibei; Du, Lili; Han, Yingqian; Zhang, Xuemei; Fan, Shuangshuang; Wang, Yueying; Yang, Guoyu
2015-06-01
Cyclic GMP-AMP synthase (cGAS), which belongs to the nucleotidyltransferase family, recognizes cytosolic DNA and induces the type I interferon (IFN) pathway through the synthesis of the second messenger cGAMP. In this study, porcine cGAS (p-cGAS) was identified and its tissue distribution, subcellular localization, and functions in innate immunity were characterized. The coding sequence of p-cGAS is 1494 bp long, encodes 497 amino acids, and is most similar (74%) to Bos taurus cGAS. p-cGAS mRNA is abundant in the spleen, duodenum, jejunum, and ileum. The subcellular distribution of p-cGAS is not only in the cytosol, but also on the endoplasmic reticulum (ER) membrane. The overexpression of wild-type p-cGAS in porcine kidney epithelial cells, but not its catalytically inactive mutants, induced IFN-β expression, which was dependent on STING and IRF3. However, the downregulation of p-cGAS by RNA interference markedly reduced IFN-β expression after pseudorabies virus (PRV) infection or poly(dA:dT) transfection. These results demonstrate that p-cGAS is an important DNA sensor, required for IFN-β activation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Glutamic acid as anticancer agent: An overview
Dutta, Satyajit; Ray, Supratim; Nagarajan, K.
2013-01-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...
Delli-Bovi, Teegan A; Spalding, Maroya D; Prigge, Sean T
2010-10-11
Biotin is an essential enzyme cofactor that acts as a CO2 carrier in carboxylation and decarboxylation reactions. The E. coli genome encodes a biosynthetic pathway that produces biotin from pimeloyl-CoA in four enzymatic steps. The final step, insertion of sulfur into desthiobiotin to form biotin, is catalyzed by the biotin synthase, BioB. A dedicated biotin ligase (BirA) catalyzes the covalent attachment of biotin to biotin-dependent enzymes. Isotopic labeling has been a valuable tool for probing the details of the biosynthetic process and assaying the activity of biotin-dependent enzymes, however there is currently no established method for 35S labeling of biotin. In this study, we produced [35S]-biotin from Na35SO4 and desthiobiotin with a specific activity of 30.7 Ci/mmol, two orders of magnitude higher than previously published methods. The biotinylation domain (PfBCCP-79) from the Plasmodium falciparum acetyl-CoA carboxylase (ACC) was expressed in E. coli as a biotinylation substrate. We found that overexpression of the E. coli biotin synthase, BioB, and biotin ligase, BirA, increased PfBCCP-79 biotinylation 160-fold over basal levels. Biotinylated PfBCCP-79 was purified by affinity chromatography, and free biotin was liberated using acid hydrolysis. We verified that we had produced radiolabeled biologically active [D]-biotin that specifically labels biotinylated proteins through reuptake in E. coli. The strategy described in our report provides a simple and effective method for the production of [35S]-biotin in E. coli based on affinity chromatography.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
Glucagon Couples Hepatic Amino Acid Catabolism to mTOR-Dependent Regulation of α-Cell Mass
Directory of Open Access Journals (Sweden)
Mark J. Solloway
2015-07-01
Full Text Available Understanding the regulation of islet cell mass has important implications for the discovery of regenerative therapies for diabetes. The liver plays a central role in metabolism and the regulation of endocrine cell number, but liver-derived factors that regulate α-cell and β-cell mass remain unidentified. We propose a nutrient-sensing circuit between liver and pancreas in which glucagon-dependent control of hepatic amino acid metabolism regulates α-cell mass. We found that glucagon receptor inhibition reduced hepatic amino acid catabolism, increased serum amino acids, and induced α-cell proliferation in an mTOR-dependent manner. In addition, mTOR inhibition blocked amino-acid-dependent α-cell replication ex vivo and enabled conversion of α-cells into β-like cells in vivo. Serum amino acids and α-cell proliferation were increased in neonatal mice but fell throughout postnatal development in a glucagon-dependent manner. These data reveal that amino acids act as sensors of glucagon signaling and can function as growth factors that increase α-cell proliferation.
Directory of Open Access Journals (Sweden)
Hannu Myllykallio
2018-05-01
Full Text Available Comparative genome analyses have led to the discovery and characterization of novel flavin- and folate-dependent methyltransferases that mainly function in DNA precursor synthesis and post-transcriptional RNA modification by forming (ribo thymidylate and its derivatives. Here we discuss the recent literature on the novel mechanistic features of these enzymes sometimes referred to as “uracil methyltransferases,” albeit we prefer to refer to them as (ribo thymidylate synthases. These enzyme families attest to the convergent evolution of nucleic acid methylation. Special focus is given to describing the unique characteristics of these flavin- and folate-dependent enzymes that have emerged as new models for studying the non-canonical roles of reduced flavin co-factors (FADH2 in relaying carbon atoms between enzyme substrates. This ancient enzymatic methylation mechanism with a very wide phylogenetic distribution may be more commonly used for biological methylation reactions than previously anticipated. This notion is exemplified by the recent discovery of additional substrates for these enzymes. Moreover, similar reaction mechanisms can be reversed by demethylases, which remove methyl groups e.g., from human histones. Future work is now required to address whether the use of different methyl donors facilitates the regulation of distinct methylation reactions in the cell. It will also be of great interest to address whether the low activity flavin-dependent thymidylate synthases ThyX represent ancestral enzymes that were eventually replaced by the more active thymidylate synthases of the ThyA family to facilitate the maintenance of larger genomes in fast-growing microbes. Moreover, we discuss the recent efforts from several laboratories to identify selective anti-microbial compounds that target flavin-dependent thymidylate synthase ThyX. Altogether we underline how the discovery of the alternative flavoproteins required for methylation of DNA and
gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower
International Nuclear Information System (INIS)
Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.
1997-01-01
gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested
Gómez, Cristina; Horna, Dina H; Olano, Carlos; Palomino-Schätzlein, Martina; Pineda-Lucena, Antonio; Carbajo, Rodrigo J; Braña, Alfredo F; Méndez, Carmen; Salas, José A
2011-08-01
Biosynthesis of the hybrid polyketide-nonribosomal peptide antibiotic streptolydigin, 3-methylaspartate, is utilized as precursor of the tetramic acid moiety. The three genes from the Streptomyces lydicus streptolydigin gene cluster slgE1-slgE2-slgE3 are involved in 3-methylaspartate supply. SlgE3, a ferredoxin-dependent glutamate synthase, is responsible for the biosynthesis of glutamate from glutamine and 2-oxoglutarate. In addition to slgE3, housekeeping NADPH- and ferredoxin-dependent glutamate synthase genes have been identified in S. lydicus. The expression of slgE3 is increased up to 9-fold at the onset of streptolydigin biosynthesis and later decreases to ∼2-fold over the basal level. In contrast, the expression of housekeeping glutamate synthases decreases when streptolydigin begins to be synthesized. SlgE1 and SlgE2 are the two subunits of a glutamate mutase that would convert glutamate into 3-methylaspartate. Deletion of slgE1-slgE2 led to the production of two compounds containing a lateral side chain derived from glutamate instead of 3-methylaspartate. Expression of this glutamate mutase also reaches a peak increase of up to 5.5-fold coinciding with the onset of antibiotic production. Overexpression of either slgE3 or slgE1-slgE2 in S. lydicus led to an increase in the yield of streptolydigin.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan
2007-01-01
Flavanone 3β-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the β-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction). PMID:17535823
Amour, Julien; Brzezinska, Anna K; Jager, Zachary; Sullivan, Corbin; Weihrauch, Dorothee; Du, Jianhai; Vladic, Nikolina; Shi, Yang; Warltier, David C; Pratt, Phillip F; Kersten, Judy R
2010-03-01
Endothelial nitric oxide synthase activity is regulated by (6R-)5,6,7,8-tetrahydrobiopterin (BH4) and heat shock protein 90. The authors tested the hypothesis that hyperglycemia abolishes anesthetic preconditioning (APC) through BH4- and heat shock protein 90-dependent pathways. Myocardial infarct size was measured in rabbits in the absence or presence of APC (30 min of isoflurane), with or without hyperglycemia, and in the presence or absence of the BH4 precursor sepiapterin. Isoflurane-dependent nitric oxide production was measured (ozone chemiluminescence) in human coronary artery endothelial cells cultured in normal (5.5 mm) or high (20 mm) glucose conditions, with or without sepiapterin (10 or 100 microm). APC decreased myocardial infarct size compared with control experiments (26 +/- 6% vs. 46 +/- 3%, respectively; P < 0.05), and this action was blocked by hyperglycemia (43 +/- 4%). Sepiapterin alone had no effect on infarct size (46 +/- 3%) but restored APC during hyperglycemia (21 +/- 3%). The beneficial actions of sepiapterin to restore APC were blocked by the nitric oxide synthase inhibitor N (G)-nitro-L-arginine methyl ester (47 +/- 2%) and the BH4 synthesis inhibitor N-acetylserotonin (46 +/- 3%). Isoflurane increased nitric oxide production to 177 +/- 13% of baseline, and this action was attenuated by high glucose concentrations (125 +/- 6%). Isoflurane increased, whereas high glucose attenuated intracellular BH4/7,8-dihydrobiopterin (BH2) (high performance liquid chromatography), heat shock protein 90-endothelial nitric oxide synthase colocalization (confocal microscopy) and endothelial nitric oxide synthase activation (immunoblotting). Sepiapterin increased BH4/BH2 and dose-dependently restored nitric oxide production during hyperglycemic conditions (149 +/- 12% and 175 +/- 9%; 10 and 100 microm, respectively). The results indicate that tetrahydrobiopterin and heat shock protein 90-regulated endothelial nitric oxide synthase activity play a central
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Dependence of the metabolic fecal amino acids on the amino acid content of the feed. 1
International Nuclear Information System (INIS)
Krawielitzki, K.; Schadereit, R.; Voelker, T.; Reichel, K.
1981-01-01
The amount of metabolic fecal amino acids (MFAA) in dependence on the amino acid intake was determined for graded maize rations in 15 N-labelled rats and the part of labelled endogenous amino acids in feces was calculated by the isotope dilution method. The excretion of amino acids and MFAA in feces are described as functions of the amino acid intake for 17 amino acids and calculated regressively. For all 17 amino acids investigated, there was a more or less steep increase of MFAA according to an increasing amino acid intake. In contrast to N-free feeding, the MFAA increase to the 2- to 4.5-fold value in feeding with pure maize (16.5% crude protein). The thesis of the constancy of the excretion of MFAA can consequently be no longer maintained. The true digestibility according to the conventional method is, on an average of all amino acids, 7.3 units below ascertained according to the 15 N method. The limiting amino acids lysine and threonine revealed the greatest difference. Tryptophane as first limiting amino acid could not be determined. The true digestibility of nearly all amino acids ascertained for maize by the isotope method is above 90%. (author)
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
Directory of Open Access Journals (Sweden)
Mostafa Waly
2016-01-01
Full Text Available The folate and cobalamin (Cbl- dependent enzyme methionine synthase (MS is highly sensitive to oxidation and its activity affects all methylation reactions. Recent studies have revealed alternative splicing of MS mRNA in human brain and patient-derived fibroblasts. Here we show that MS mRNA in SH-SY5Y human neuroblastoma cells is alternatively spliced, resulting in three primary protein species, thus providing a useful model to examine cofactor dependence of these variant enzymes. MS activity was dependent upon methylcobalamin (MeCbl or the combination of hydroxocobalamin (OHCbl and S-adenosylmethionine (SAM. OHCbl-based activity was eliminated by depletion of the antioxidant glutathione (GSH but could be rescued by provision of either glutathionylcobalamin (GSCbl or MeCbl. Pretreatment of cells with lead, arsenic, aluminum, mercury, or the ethylmercury-containing preservative thimerosal lowered GSH levels and inhibited MS activity in association with decreased uptake of cysteine, which is rate-limiting for GSH synthesis. Thimerosal treatment decreased cellular levels of GSCbl and MeCbl. These findings indicate that the alternatively spliced form of MS expressed in SH-SY5Y human neuronal cells is sensitive to inhibition by thimerosal and neurotoxic metals, and lower GSH levels contribute to their inhibitory action.
Bidmon, H J; Emde, B; Kowalski, T; Schmitt, M; Mayer, B; Kato, K; Asayama, K; Witte, O W; Zilles, K
2001-09-01
Neuronal nitric oxide-I is constitutively expressed in approximately 2% of cortical interneurons and is co-localized with gamma-amino butric acid, somatostatin or neuropeptide Y. These interneurons additionally express high amounts of glutamate receptors which mediate the glutamate-induced hyperexcitation following cerebral injury, under these conditions nitric oxide production increases contributing to a potentiation of oxidative stress. However, perilesional nitric oxide synthase-I containing neurons are known to be resistant to ischemic and excitotoxic injury. In vitro studies show that nitrosonium and nitroxyl ions inactivate N-methyl-D-aspartate receptors, resulting in neuroprotection. The question remains of how these cells are protected against their own high intracellular nitric oxide production after activation. In this study, we investigated immunocytochemically nitric oxide synthase-I containing cortical neurons in rats after unilateral, cortical photothrombosis. In this model of focal ischemia, perilesional, constitutively nitric oxide synthase-I containing neurons survived and co-expressed antioxidative enzymes, such as manganese- and copper-zinc-dependent superoxide dismutases, heme oxygenase-2 and cytosolic glutathione peroxidase. This enhanced antioxidant expression was accompanied by a strong perinuclear presence of the antiapoptotic Bcl-2 protein. No colocalization was detectable with upregulated heme oxygenase-1 in glia and the superoxide and prostaglandin G(2)-producing cyclooxygenase-2 in neurons. These results suggest that nitric oxide synthase-I containing interneurons are protected against intracellular oxidative damage and apoptosis by Bcl-2 and several potent antioxidative enzymes. Since nitric oxide synthase-I positive neurons do not express superoxide-producing enzymes such as cyclooxygenase-1, xanthine oxidase and cyclooxygenase-2 in response to injury, this may additionally contribute to their resistance by reducing their internal
DEFF Research Database (Denmark)
Prats, Clara; Cadefau, Joan A; Cussó, Roser
2005-01-01
Glycogen metabolism has been the subject of extensive research, but the mechanisms by which it is regulated are still not fully understood. It is well accepted that the rate-limiting enzymes in glycogenesis and glycogenolysis are glycogen synthase (GS) and glycogen phosphorylase (GPh), respectively....... Both enzymes are regulated by reversible phosphorylation and by allosteric effectors. However, evidence in the literature indicates that changes in muscle GS and GPh intracellular distribution may constitute a new regulatory mechanism of glycogen metabolism. Already in the 1960s, it was proposed...... that glycogen was present in dynamic cellular organelles that were termed glycosomas but no such cellular entities have ever been demonstrated. The aim of this study was to characterize muscle GS and GPh intracellular distribution and to identify possible translocation processes of both enzymes. Using in situ...
SULPHUR-CONTAINING AMINO ACIDS METABOLISM IN EXPERIMENTAL HYPER- AND HYPOTHYROIDISM IN RATS.
Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O
2017-10-01
Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis
International Nuclear Information System (INIS)
Carpenter, M.F.; Smith, F.L.
1986-01-01
Purified prostaglandin synthase produces a carbon-centered, oxygen-dependent free radical which they have shown forms a spin-trapped adduct with 4-POBN and has characteristic hyperfine spin coupling constants (hfsc). As production of this radical is cyclooxygenase-dependent, additional studies on radical production were done using soybean lipoxygenase. The latter generates a lipid substrate-derived free radical trapped by the EPR spin trap 4-POBN [α-(4-pyridyl 1-oxide)N-tert-butyl nitrone]. With linoleate as substrate, the hfsc are a/sub N/ = 15.5 G, a/sub β//sup H/ = 2.7 G. This signal is inhibited by ETYA, various antioxidants and heat inactivation of the enzyme. Additional hfsc are not seen when the enzyme is incubated in an 17 O 2 atmosphere, but the signal is inhibited by anaerobeosis. Substitution of 13 C 18 carbon free fatty acids from Chlorella pyrenoisdosa for linoleate produces 2 new lines for each of the original 6 observed with 12 C substrate; the new spectrum has hfsc of a/sub N/ = 16.0 G, a/sub β//sup H/ = 2.4 G, a/sub β/ 13 C = 4.2 G. This demonstrates that the radical is carbon centered and oxygen-dependent and appears not to be the same radical formed by enzymic hydrogen abstraction from the lipid substrate. This radical and the prostaglandin synthase-dependent radical appear to be nearly identical
Gómez, Cristina; Horna, Dina H.; Olano, Carlos; Palomino-Schätzlein, Martina; Pineda-Lucena, Antonio; Carbajo, Rodrigo J.; Braña, Alfredo F.; Méndez, Carmen; Salas, José A.
2011-01-01
Biosynthesis of the hybrid polyketide-nonribosomal peptide antibiotic streptolydigin, 3-methylaspartate, is utilized as precursor of the tetramic acid moiety. The three genes from the Streptomyces lydicus streptolydigin gene cluster slgE1-slgE2-slgE3 are involved in 3-methylaspartate supply. SlgE3, a ferredoxin-dependent glutamate synthase, is responsible for the biosynthesis of glutamate from glutamine and 2-oxoglutarate. In addition to slgE3, housekeeping NADPH- and ferredoxin-dependent glutamate synthase genes have been identified in S. lydicus. The expression of slgE3 is increased up to 9-fold at the onset of streptolydigin biosynthesis and later decreases to ∼2-fold over the basal level. In contrast, the expression of housekeeping glutamate synthases decreases when streptolydigin begins to be synthesized. SlgE1 and SlgE2 are the two subunits of a glutamate mutase that would convert glutamate into 3-methylaspartate. Deletion of slgE1-slgE2 led to the production of two compounds containing a lateral side chain derived from glutamate instead of 3-methylaspartate. Expression of this glutamate mutase also reaches a peak increase of up to 5.5-fold coinciding with the onset of antibiotic production. Overexpression of either slgE3 or slgE1-slgE2 in S. lydicus led to an increase in the yield of streptolydigin. PMID:21665968
International Nuclear Information System (INIS)
Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi
2008-01-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1
Energy Technology Data Exchange (ETDEWEB)
Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)
2008-03-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.
Crystal structure of riboflavin synthase
Energy Technology Data Exchange (ETDEWEB)
Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)
2010-03-05
Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.
Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe
2015-08-01
Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Beld, Joris; Abbriano, Raffaela; Finzel, Kara; Hildebrand, Mark; Burkart, Michael D
2016-04-01
In both eukaryotes and prokaryotes, fatty acid synthases are responsible for the biosynthesis of fatty acids in an iterative process, extending the fatty acid by two carbon units every cycle. Thus, odd numbered fatty acids are rarely found in nature. We tested whether representatives of diverse microbial phyla have the ability to incorporate odd-chain fatty acids as substrates for their fatty acid synthases and their downstream enzymes. We fed various odd and short chain fatty acids to the bacterium Escherichia coli, cyanobacterium Synechocystis sp. PCC 6803, green microalga Chlamydomonas reinhardtii and diatom Thalassiosira pseudonana. Major differences were observed, specifically in the ability among species to incorporate and elongate short chain fatty acids. We demonstrate that E. coli, C. reinhardtii, and T. pseudonana can produce longer fatty acid products from short chain precursors (C3 and C5), while Synechocystis sp. PCC 6803 lacks this ability. However, Synechocystis can incorporate and elongate longer chain fatty acids due to acyl-acyl carrier protein synthetase (AasS) activity, and knockout of this protein eliminates the ability to incorporate these fatty acids. In addition, expression of a characterized AasS from Vibrio harveyii confers a similar capability to E. coli. The ability to desaturate exogenously added fatty acids was only observed in Synechocystis and C. reinhardtii. We further probed fatty acid metabolism of these organisms by feeding desaturase inhibitors to test the specificity of long-chain fatty acid desaturases. In particular, supplementation with thia fatty acids can alter fatty acid profiles based on the location of the sulfur in the chain. We show that coupling sensitive gas chromatography mass spectrometry to supplementation of unnatural fatty acids can reveal major differences between fatty acid metabolism in various organisms. Often unnatural fatty acids have antibacterial or even therapeutic properties. Feeding of short
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Sulfuric acid nucleation: power dependencies, variation with relative humidity, and effect of bases
Directory of Open Access Journals (Sweden)
J. H. Zollner
2012-05-01
Full Text Available Nucleation of particles composed of sulfuric acid, water, and nitrogen base molecules was studied using a continuous flow reactor. The particles formed from these vapors were detected with an ultrafine condensation particle counter, while vapors of sulfuric acid and nitrogen bases were detected by chemical ionization mass spectrometry. Variation of particle numbers with sulfuric acid concentration yielded a power dependency on sulfuric acid of 5 ± 1 for relative humidities of 14–68% at 296 K; similar experiments with varying water content yielded power dependencies on H2O of ~7. The critical cluster contains about 5 H2SO4 molecules and a new treatment of the power dependency for H2O suggests about 12 H2O molecules for these conditions. Addition of 2-to-45 pptv of ammonia or methyl amine resulted in up to millions of times more particles than in the absence of these compounds. Particle detection capabilities, sulfuric acid and nitrogen base detection, wall losses, and the extent of particle growth are discussed. Results are compared to previous laboratory nucleation studies and they are also discussed in terms of atmospheric nucleation scenarios.
Study of Valproic Acid-Enhanced Hepatocyte Steatosis
Chang, Renin; Chou, Mei-Chia; Hung, Li-Ying; Wang, Mu-En; Hsu, Meng-Chieh; Chiu, Chih-Hsien
2016-01-01
Valproic acid (VPA) is one of the most widely used antiepilepsy drugs. However, several side effects, including weight gain and fatty liver, have been reported in patients following VPA treatment. In this study, we explored the molecular mechanisms of VPA-induced hepatic steatosis using FL83B cell line-based in vitro model. Using fluorescent lipid staining technique, we found that VPA enhanced oleic acid- (OLA-) induced lipid accumulation in a dose-dependent manner in hepatocytes; this may be due to upregulated lipid uptake, triacylglycerol (TAG) synthesis, and lipid droplet formation. Real-time PCR results showed that, following VPA treatment, the expression levels of genes encoding cluster of differentiation 36 (Cd36), low-density lipoprotein receptor-related protein 1 (Lrp1), diacylglycerol acyltransferase 2 (Dgat2), and perilipin 2 (Plin2) were increased, that of carnitine palmitoyltransferase I a (Cpt1a) was not affected, and those of acetyl-Co A carboxylase α (Acca) and fatty acid synthase (Fasn) were decreased. Furthermore, using immunofluorescence staining and flow cytometry analyses, we found that VPA also induced peroxisome proliferator-activated receptor γ (PPARγ) nuclear translocation and increased levels of cell-surface CD36. Based on these results, we propose that VPA may enhance OLA-induced hepatocyte steatosis through the upregulation of PPARγ- and CD36-dependent lipid uptake, TAG synthesis, and lipid droplet formation. PMID:27034954
Study of Valproic Acid-Enhanced Hepatocyte Steatosis
Directory of Open Access Journals (Sweden)
Renin Chang
2016-01-01
Full Text Available Valproic acid (VPA is one of the most widely used antiepilepsy drugs. However, several side effects, including weight gain and fatty liver, have been reported in patients following VPA treatment. In this study, we explored the molecular mechanisms of VPA-induced hepatic steatosis using FL83B cell line-based in vitro model. Using fluorescent lipid staining technique, we found that VPA enhanced oleic acid- (OLA- induced lipid accumulation in a dose-dependent manner in hepatocytes; this may be due to upregulated lipid uptake, triacylglycerol (TAG synthesis, and lipid droplet formation. Real-time PCR results showed that, following VPA treatment, the expression levels of genes encoding cluster of differentiation 36 (Cd36, low-density lipoprotein receptor-related protein 1 (Lrp1, diacylglycerol acyltransferase 2 (Dgat2, and perilipin 2 (Plin2 were increased, that of carnitine palmitoyltransferase I a (Cpt1a was not affected, and those of acetyl-Co A carboxylase α (Acca and fatty acid synthase (Fasn were decreased. Furthermore, using immunofluorescence staining and flow cytometry analyses, we found that VPA also induced peroxisome proliferator-activated receptor γ (PPARγ nuclear translocation and increased levels of cell-surface CD36. Based on these results, we propose that VPA may enhance OLA-induced hepatocyte steatosis through the upregulation of PPARγ- and CD36-dependent lipid uptake, TAG synthesis, and lipid droplet formation.
Directory of Open Access Journals (Sweden)
Ananya Chatterjee
2012-01-01
Full Text Available The healing activity of gallic acid enriched ethanolic extract (GAE of Phyllanthus emblica fruits (amla against the indomethacin-induced gastric ulceration in mice was investigated. The activity was correlated with the ability of GAE to alter the cyclooxygenase- (COX- dependent healing pathways. Histology of the stomach tissues revealed maximum ulceration on the 3rd day after indomethacin (18 mg/kg, single dose administration that was associated with significant increase in inflammatory factors, namely, mucosal myeloperoxidase (MPO activity and inducible nitric oxide synthase (i-NOS expression. Proangiogenic parameters such as the levels of prostaglandin (PG E2, vascular endothelial growth factor (VEGF, hepatocyte growth factor (HGF, von Willebrand Factor VIII, and endothelial NOS (e-NOS were downregulated by indomethacin. Treatment with GAE (5 mg/kg/day and omeprazole (3 mg/kg/day for 3 days led to effective healing of the acute ulceration, while GAE could reverse the indomethacin-induced proinflammatory changes of the designated biochemical parameters. The ulcer healing activity of GAE was, however, compromised by coadministration of the nonspecific NOS inhibitor, N-nitro-L-arginine methyl ester (L-NAME, but not the i-NOS-specific inhibitor, L-N6-(1-iminoethyl lysine hydrochloride (L-NIL. Taken together, these results suggested that the GAE treatment accelerates ulcer healing by inducing PGE2 synthesis and augmenting e-NOS/i-NOS ratio.
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
Rudling, Mats; Bonde, Ylva
2015-01-01
Bile acid synthesis has been considered a prototype for how a physiological process is controlled by end product feedback inhibition. By this feedback inhibition, bile acid concentrations are kept within safe ranges. However, careful examination of published rodent data strongly suggests that bile acid synthesis is also under potent positive feedback control by hydrophilic bile acids. Current concepts on the regulation of bile acid synthesis are derived from mouse models. Recent data have shown that mice have farnesoid X receptor (FXR) antagonistic bile acids capable of quenching responses elicited by FXR agonistic bile acids. This is important to recognize to understand the regulation of bile acid synthesis in the mouse, and in particular to clarify if mouse model findings are valid also in the human situation. In addition to classic end product feedback inhibition, regulation of bile acid synthesis in the mouse largely appears also to be driven by changes in hepatic levels of murine bile acids such as α- and β-muricholic acids. This has not been previously recognized. Stimulated bile acid synthesis or induction of the apical sodium-dependent bile acid transporter in the intestine, increase the availability of chenodeoxycholic acid in the liver, thereby promoting hepatic conversion of this bile acid into muricholic acids. Recognition of these mechanisms is essential for understanding the regulation of bile acid synthesis in the mouse, and for our awareness of important species differences in the regulation of bile acid synthesis in mice and humans. 2015 S. Karger AG, Basel.
DEFF Research Database (Denmark)
Brodersen, P; Petersen, M; Nielsen, Henrik Bjørn
2006-01-01
Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective...
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Suzuki, Mamoru; Higashiura, Akifumi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan); Aritake, Kosuke; Urade, Yoshihiro; Uodome, Nobuko [Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka 565-0874 (Japan); Hossain, MD. Tofazzal [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Nakagawa, Atsushi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan)
2013-11-01
Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolution of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo
2017-01-01
Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng
2013-02-08
The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Directory of Open Access Journals (Sweden)
Piero Leone
2018-01-01
Full Text Available FAD synthase (FADS, EC 2.7.7.2 is the last essential enzyme involved in the pathway of biosynthesis of Flavin cofactors starting from Riboflavin (Rf. Alternative splicing of the human FLAD1 gene generates different isoforms of the enzyme FAD synthase. Besides the well characterized isoform 1 and 2, other FADS isoforms with different catalytic domains have been detected, which are splice variants. We report the characterization of one of these novel isoforms, a 320 amino acid protein, consisting of the sole C-terminal 3′-phosphoadenosine 5′-phosphosulfate (PAPS reductase domain (named FADS6. This isoform has been previously detected in Riboflavin-Responsive (RR-MADD and Non-responsive Multiple Acyl-CoA Dehydrogenase Deficiency (MADD patients with frameshift mutations of FLAD1 gene. To functionally characterize the hFADS6, it has been over-expressed in Escherichia coli and purified with a yield of 25 mg·L−1 of cell culture. The protein has a monomeric form, it binds FAD and is able to catalyze FAD synthesis (kcat about 2.8 min−1, as well as FAD pyrophosphorolysis in a strictly Mg2+-dependent manner. The synthesis of FAD is inhibited by HgCl2. The enzyme lacks the ability to hydrolyze FAD. It behaves similarly to PAPS. Combining threading and ab-initio strategy a 3D structural model for such isoform has been built. The relevance to human physio-pathology of this FADS isoform is discussed.
Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase
International Nuclear Information System (INIS)
Durchschlag, H.; Zipper, P.
1985-01-01
Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
2012-01-01
Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis increased HPV during
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
Directory of Open Access Journals (Sweden)
Ketabchi Farzaneh
2012-01-01
Full Text Available Abstract Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV optimizes gas exchange during local acute (0-30 min, as well as sustained (> 30 min hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate, and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA, a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS, decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc. This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction.
Ketabchi, Farzaneh; Ghofrani, Hossein A; Schermuly, Ralph T; Seeger, Werner; Grimminger, Friedrich; Egemnazarov, Bakytbek; Shid-Moosavi, S Mostafa; Dehghani, Gholam A; Weissmann, Norbert; Sommer, Natascha
2012-01-31
Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Hypercapnia with and without acidosis increased HPV during conditions of sustained hypoxia. The
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa
2018-05-11
(-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.
Tellier, Stéphanie; Dallocchio, Aymeric; Guigonis, Vincent; Saint-Marcoux, Frank; Llanas, Brigitte; Ichay, Lydia; Bandin, Flavio; Godron, Astrid; Morin, Denis; Brochard, Karine; Gandia, Peggy; Bouchet, Stéphane; Marquet, Pierre; Decramer, Stéphane
2016-01-01
Background and objectives Therapeutic drug monitoring of mycophenolic acid can improve clinical outcome in organ transplantation and lupus, but data are scarce in idiopathic nephrotic syndrome. The aim of our study was to investigate whether mycophenolic acid pharmacokinetics are associated with disease control in children receiving mycophenolate mofetil for the treatment of steroid–dependent nephrotic syndrome. Design, setting, participants, & measurements This was a retrospective multicenter study including 95 children with steroid–dependent nephrotic syndrome treated with mycophenolate mofetil with or without steroids. Area under the concentration-time curve of mycophenolic acid was determined in all children on the basis of sampling times at 20, 60, and 180 minutes postdose, using Bayesian estimation. The association between a threshold value of the area under the concentration-time curve of mycophenolic acid and the relapse rate was assessed using a negative binomial model. Results In total, 140 areas under the concentration-time curve of mycophenolic acid were analyzed. The findings indicate individual dose adaptation in 53 patients (38%) to achieve an area under the concentration-time curve target of 30–60 mg·h/L. In a multivariable negative binomial model including sex, age at disease onset, time to start of mycophenolate mofetil, previous immunomodulatory treatment, and concomitant prednisone dose, a level of area under the concentration-time curve of mycophenolic acid >45 mg·h/L was significantly associated with a lower relapse rate (rate ratio, 0.65; 95% confidence interval, 0.46 to 0.89; P=0.01). Conclusions Therapeutic drug monitoring leading to individualized dosing may improve the efficacy of mycophenolate mofetil in steroid–dependent nephrotic syndrome. Additional prospective studies are warranted to determine the optimal target for area under the concentration-time curve of mycophenolic acid in this population. PMID:27445161
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
International Nuclear Information System (INIS)
Gonzalez-Rubio, Sandra; Linares, Clara I.; Bello, Rosario I.; Gonzalez, Raul; Ferrin, Gustavo; Hidalgo, Ana B.; Munoz-Gomariz, Elisa; Rodriguez, Blanca A.; Barrera, Pilar; Ranchal, Isidora; Duran-Prado, Mario; Aguilar-Melero, Patricia; De la Mata, Manuel; Muntane, Jordi
2010-01-01
The intracellular oxidative stress has been involved in bile acid-induced cell death in hepatocytes. Nitric oxide (NO) exerts cytoprotective properties in glycochenodeoxycholic acid (GCDCA)-treated hepatocytes. The study evaluated the involvement of Ca 2+ on the regulation of NO synthase (NOS)-3 expression during N-acetylcysteine (NAC) cytoprotection against GCDCA-induced cell death in hepatocytes. The regulation of Ca 2+ pools (EGTA or BAPTA-AM) and NO (L-NAME or NO donor) production was assessed during NAC cytoprotection in GCDCA-treated HepG2 cells. The stimulation of Ca 2+ entrance was induced by A23187 in HepG2. Cell death, Ca 2+ mobilization, NOS-1, -2 and -3 expression, AP-1 activation, and NO production were evaluated. GCDCA reduced intracellular Ca 2+ concentration and NOS-3 expression, and enhanced cell death in HepG2. NO donor prevented, and L-NAME enhanced, GCDCA-induced cell death. The reduction of Ca 2+ entry by EGTA, but not its release from intracellular stores by BAPTA-AM, enhanced cell death in GCDCA-treated cells. The stimulation of Ca 2+ entrance by A23187 reduced cell death and enhanced NOS-3 expression in GCDCA-treated HepG2 cells. The cytoprotective properties of NAC were related to the recovery of intracellular Ca 2+ concentration, NOS-3 expression and NO production induced by GCDCA-treated HepG2 cells. The increase of NO production by Ca 2+ -dependent NOS-3 expression during NAC administration reduces cell death in GCDCA-treated hepatocytes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Rubio, Sandra; Linares, Clara I; Bello, Rosario I [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Gonzalez, Raul; Ferrin, Gustavo [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Hepaticas y Digestivas (CIBEREH o Ciberehd) (Spain); Hidalgo, Ana B [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Munoz-Gomariz, Elisa [Department of Biostatistics, Reina Sofia University Hospital, Cordoba (Spain); Rodriguez, Blanca A [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Barrera, Pilar; Ranchal, Isidora [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Hepaticas y Digestivas (CIBEREH o Ciberehd) (Spain); Duran-Prado, Mario [Instituto de Parasitologia y Biomedicina Lopez Neyra, CSIC, Granada (Spain); CIBER Fisiopatologia de la Obesidad y Nutricion CB06/03, Instituto de Salud Carlos III, Ministerio de Sanidad y Consumo (Spain); Aguilar-Melero, Patricia [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); De la Mata, Manuel [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Hepaticas y Digestivas (CIBEREH o Ciberehd) (Spain); Muntane, Jordi [Liver Research Unit, Reina Sofia University Hospital, Cordoba (Spain); Centro de Investigacion Biomedica en Red de Enfermedades Hepaticas y Digestivas (CIBEREH o Ciberehd) (Spain)
2010-01-15
The intracellular oxidative stress has been involved in bile acid-induced cell death in hepatocytes. Nitric oxide (NO) exerts cytoprotective properties in glycochenodeoxycholic acid (GCDCA)-treated hepatocytes. The study evaluated the involvement of Ca{sup 2+} on the regulation of NO synthase (NOS)-3 expression during N-acetylcysteine (NAC) cytoprotection against GCDCA-induced cell death in hepatocytes. The regulation of Ca{sup 2+} pools (EGTA or BAPTA-AM) and NO (L-NAME or NO donor) production was assessed during NAC cytoprotection in GCDCA-treated HepG2 cells. The stimulation of Ca{sup 2+} entrance was induced by A23187 in HepG2. Cell death, Ca{sup 2+} mobilization, NOS-1, -2 and -3 expression, AP-1 activation, and NO production were evaluated. GCDCA reduced intracellular Ca{sup 2+} concentration and NOS-3 expression, and enhanced cell death in HepG2. NO donor prevented, and L-NAME enhanced, GCDCA-induced cell death. The reduction of Ca{sup 2+} entry by EGTA, but not its release from intracellular stores by BAPTA-AM, enhanced cell death in GCDCA-treated cells. The stimulation of Ca{sup 2+} entrance by A23187 reduced cell death and enhanced NOS-3 expression in GCDCA-treated HepG2 cells. The cytoprotective properties of NAC were related to the recovery of intracellular Ca{sup 2+} concentration, NOS-3 expression and NO production induced by GCDCA-treated HepG2 cells. The increase of NO production by Ca{sup 2+}-dependent NOS-3 expression during NAC administration reduces cell death in GCDCA-treated hepatocytes.
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
International Nuclear Information System (INIS)
Van Winkle, L.J.; Christensen, H.N.; Campione, A.L.
1985-01-01
Mouse blastocysts which had been activated from diapause in utero appeared to take up amino acids via a Na - -dependent transport system with novel characteristics. In contrast to other cell types, uptake of 3-aminoendobicyclo [3,2,1]octane-3-carboxylic acid (BCO) by blastocysts was largely Na - dependent. Moreover, L-alanine and BCO met standard criteria for mutual competitive inhibition of the Na - -dependent transport of each other. The Ki for each of these amino acids as an inhibitor of transport of the other had a value similar to the value of its Km for transport. In addition, both 2-aminoendobicyclo [2,2,1]heptane-2-carboxylic acid and L-valine appeared to inhibit Na - -dependent transport of alanine and BCO competitively. Finally, alanine and L-lysine appeared to compete for the same Na+-dependent transport sites in blastocysts. For these reasons, the authors conclude that lysine, alanine, and BCO are transported by a common Na+-dependent system in blastocysts. In addition, the apparent interaction of the system with other basic amino acids, such as 1-dimethylpiperidine-4-amino-4-carboxylic acid, which has a nondissociable positive charge on its side chain, and L-arginine and L-homoarginine, whose cationic forms are highly predominant at neutral pH, suggests that the cationic forms of basic amino acids are transported by the wide-scope system
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan
2016-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...
Directory of Open Access Journals (Sweden)
I MADE ARTIKA
2010-09-01
Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.
Modulation of hyaluronan synthase activity in cellular membrane fractions.
Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto
2009-10-30
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.
Directory of Open Access Journals (Sweden)
Abeer Abousaab
2016-12-01
Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J
2012-01-01
In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.
Fumonisins (FB) are mycotoxins found in corn. FB1 is the most common FB. It is the cause of farm animal diseases and is carcinogenic in rodents. The mode of action is the inhibition of ceramide synthase (CerS). Inhibition of CerS in mice causes a dose-dependent accumulation of sphinganine 1-phosphat...
Bias-dependent amino-acid-induced conductance changes in short semi-metallic carbon nanotubes
International Nuclear Information System (INIS)
Abadir, G B; Walus, K; Pulfrey, D L
2010-01-01
We study the interaction between short semi-metallic carbon nanotubes and different amino acids using molecular dynamics and ab initio (density functional theory/non-equilibrium Green's function) simulations. We identify two different mechanisms of nanotube conductance change upon adsorption of amino acids: one due to the change of the coordinates of the nanotube arising from van der Waals forces of interaction with the adsorbed amino acid; and one due to electrostatic interactions, which appear only in the case of charged amino acids. We also find that the transport mechanism and the changes in the conductance of the tube upon amino acid adsorption are bias dependent.
Nitric oxide signalling and neuronal nitric oxide synthase in the heart under stress.
Zhang, Yin Hua
2017-01-01
Nitric oxide (NO) is an imperative regulator of the cardiovascular system and is a critical mechanism in preventing the pathogenesis and progression of the diseased heart. The scenario of bioavailable NO in the myocardium is complex: 1) NO is derived from both endogenous NO synthases (endothelial, neuronal, and/or inducible NOSs [eNOS, nNOS, and/or iNOS]) and exogenous sources (entero-salivary NO pathway) and the amount of NO from exogenous sources varies significantly; 2) NOSs are located at discrete compartments of cardiac myocytes and are regulated by distinctive mechanisms under stress; 3) NO regulates diverse target proteins through different modes of post-transcriptional modification (soluble guanylate cyclase [sGC]/cyclic guanosine monophosphate [cGMP]/protein kinase G [PKG]-dependent phosphorylation, S -nitrosylation, and transnitrosylation); 4) the downstream effectors of NO are multidimensional and vary from ion channels in the plasma membrane to signalling proteins and enzymes in the mitochondria, cytosol, nucleus, and myofilament; 5) NOS produces several radicals in addition to NO (e.g. superoxide, hydrogen peroxide, peroxynitrite, and different NO-related derivatives) and triggers redox-dependent responses. However, nNOS inhibits cardiac oxidases to reduce the sources of oxidative stress in diseased hearts. Recent consensus indicates the importance of nNOS protein in cardiac protection under pathological stress. In addition, a dietary regime with high nitrate intake from fruit and vegetables together with unsaturated fatty acids is strongly associated with reduced cardiovascular events. Collectively, NO-dependent mechanisms in healthy and diseased hearts are better understood and shed light on the therapeutic prospects for NO and NOSs in clinical applications for fatal human heart diseases.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun
2017-01-01
Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Chronic nitric oxide synthase inhibition exacerbates renal dysfunction in cirrhotic rats
DEFF Research Database (Denmark)
Graebe, M.; Brond, L.; Christensen, S.
2004-01-01
The present study investigated sodium balance and renal tubular function in cirrhotic rats with chronic blockade of the nitric oxide (NO) system. Rats were treated with the nonselective NO synthase inhibitor NG-nitro-l-arginine methyl ester (l-NAME) starting on the day of common bile duct ligation...... (CBL). Three weeks of daily sodium balance studies showed that CBL rats developed sodium retention compared with sham-operated rats and that l-NAME treatment dose dependently deteriorated cumulative sodium balance by reducing urinary sodium excretion. Five weeks after CBL, renal clearance studies were...
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
DEFF Research Database (Denmark)
Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.
2010-01-01
In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...
Possible Involvement of Hydrosulfide in B12-Dependent Methyl Group Transfer
Directory of Open Access Journals (Sweden)
John I. Toohey
2017-04-01
Full Text Available Evidence from several fields of investigation lead to the hypothesis that the sulfur atom is involved in vitamin B12-dependent methyl group transfer. To compile the evidence, it is necessary to briefly review the following fields: methylation, the new field of sulfane sulfur/hydrogen sulfide (S°/H2S, hydrosulfide derivatives of cobalamins, autoxidation of hydrosulfide radical, radical S-adenosylmethionine methyl transfer (RSMT, and methionine synthase (MS. Then, new reaction mechanisms for B12-dependent methyl group transfer are proposed; the mechanisms are facile and overcome difficulties that existed in previously-accepted mechanisms. Finally, the theory is applied to the effect of S°/H2S in nerve tissue involving the “hypomethylation theory” that was proposed 50 years ago to explain the neuropathology resulting from deficiency of vitamin B12 or folic acid. The conclusions are consistent with emerging evidence that sulfane sulfur/hydrogen sulfide may be beneficial in treating Alzheimer’s disease.
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Kivlehan, Francine; Mavré, François; Talini, Luc; Limoges, Benoît; Marchal, Damien
2011-09-21
We described an electrochemical method to monitor in real-time the isothermal helicase-dependent amplification of nucleic acids. The principle of detection is simple and well-adapted to the development of portable, easy-to-use and inexpensive nucleic acids detection technologies. It consists of monitoring a decrease in the electrochemical current response of a reporter DNA intercalating redox probe during the isothermal DNA amplification. The method offers the possibility to quantitatively analyze target nucleic acids in less than one hour at a single constant temperature, and to perform at the end of the isothermal amplification a DNA melt curve analysis for differentiating between specific and non-specific amplifications. To illustrate the potentialities of this approach for the development of a simple, robust and low-cost instrument with high throughput capability, the method was validated with an electrochemical system capable of monitoring up to 48 real-time isothermal HDA reactions simultaneously in a disposable microplate consisting of 48-electrochemical microwells. Results obtained with this approach are comparable to that obtained with a well-established but more sophisticated and expensive fluorescence-based method. This makes for a promising alternative detection method not only for real-time isothermal helicase-dependent amplification of nucleic acid, but also for other isothermal DNA amplification strategies.
Directory of Open Access Journals (Sweden)
Joan Crous-Masó
2018-05-01
Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases
International Nuclear Information System (INIS)
Blacklock, Brenda J.; Jaworski, Jan G.
2006-01-01
The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates
Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)
2011-01-01
Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583
Musah, Rabi A; He, Quan; Kubec, Roman
2009-11-01
A novel lachrymatory factor synthase (LFS) was isolated and purified from the roots of the Amazonian medicinal plant Petiveria alliacea. The enzyme is a heterotetrameric glycoprotein comprised of two alpha-subunits (68.8 kD each), one gamma-subunit (22.5 kD), and one delta-subunit (11.9 kD). The two alpha-subunits are glycosylated and connected by a disulfide bridge. The LFS has an isoelectric point of 5.2. It catalyzes the formation of a sulfine lachrymator, (Z)-phenylmethanethial S-oxide, only in the presence of P. alliacea alliinase and its natural substrate, S-benzyl-l-cysteine sulfoxide (petiveriin). Depending on its concentration relative to that of P. alliacea alliinase, the LFS sequesters, to varying degrees, the sulfenic acid intermediate formed by alliinase-mediated breakdown of petiveriin. At LFS:alliinase of 5:1, LFS sequesters all of the sulfenic acid formed by alliinase action on petiveriin, and converts it entirely to (Z)-phenylmethanethial S-oxide. However, starting at LFS:alliinase of 5:2, the LFS is unable to sequester all of the sulfenic acid produced by the alliinase, with the result that sulfenic acid that escapes the action of the LFS condenses with loss of water to form S-benzyl phenylmethanethiosulfinate (petivericin). The results show that the LFS and alliinase function in tandem, with the alliinase furnishing the sulfenic acid substrate on which the LFS acts. The results also show that the LFS modulates the formation of biologically active thiosulfinates that are downstream of the alliinase in a manner dependent upon the relative concentrations of the LFS and the alliinase. These observations suggest that manipulation of LFS-to-alliinase ratios in plants displaying this system may provide a means by which to rationally modify organosulfur small molecule profiles to obtain desired flavor and/or odor signatures, or increase the presence of desirable biologically active small molecules.
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Yang, Surong; Chen, Changrui; Li, Yiying; Ren, Zhenghua; Zhang, Yungang; Wu, Gantong; Wang, Hao; Hu, Zhenzhen; Yao, Minghui
2013-06-01
To evaluate whether saw palmetto extract (SPE) relaxes corpus cavernosum and explore the underlying mechanisms. Forty Sprague-Dawley rats and 30 New Zealand rabbits were randomly allocated into 3 SPE-treated groups (low-, middle-, and high-dose) and 1 saline-treated control group. SPE was administered intragastrically for 7 consecutive days. Another 23 rats treated with sildenafil were used to appraise the erectile response to electrical stimulation of nerves in the corpus cavernosum. The erectile functions of rats and rabbits were evaluated 24 hours after the last SPE administration or 15 minutes after intragastric sildenafil. Outcome measures included corpus cavernosum electrical activity recording, phosphodiesterase 5 (PDE5) activity detected by the colorimetric quantitative method, and messenger ribonucleic acid (mRNA) expression level for PDE5 and inducible nitric oxide synthase (iNOS) determined using real-time polymerase chain reaction. In the SPE-treated animals, the relaxant response to electrical stimulation of nerves in the corpus cavernosum, reflected by the amplitude of the electrical activity within the cavernosum, was significantly and dose-dependently augmented. Similar effects were observed in the sildenafil-treated rats. PDE5 activity in rat and rabbit corpus cavernosum tissues was significantly and dose-dependently inhibited in SPE-treated animals, whereas the iNOS mRNA level increased compared with the saline group. PDE5 mRNA, however, was only significantly enhanced in the rats treated with the middle dose of SPE. The results suggest that SPE may have potential application value for the prevention or treatment of erectile dysfunction through an increase in iNOS mRNA expression and inhibition of PDE5 activity in corpus cavernosum smooth muscles. Copyright © 2013 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
Lanaspa, Miguel A; Sanchez-Lozada, Laura G; Choi, Yea-Jin; Cicerchi, Christina; Kanbay, Mehmet; Roncal-Jimenez, Carlos A; Ishimoto, Takuji; Li, Nanxing; Marek, George; Duranay, Murat; Schreiner, George; Rodriguez-Iturbe, Bernardo; Nakagawa, Takahiko; Kang, Duk-Hee; Sautin, Yuri Y; Johnson, Richard J
2012-11-23
Uric acid is an independent risk factor in fructose-induced fatty liver, but whether it is a marker or a cause remains unknown. Hepatocytes exposed to uric acid developed mitochondrial dysfunction and increased de novo lipogenesis, and its blockade prevented fructose-induced lipogenesis. Rather than a consequence, uric acid induces fatty liver Hyperuricemic people are more prone to develop fructose-induced fatty liver. Metabolic syndrome represents a collection of abnormalities that includes fatty liver, and it currently affects one-third of the United States population and has become a major health concern worldwide. Fructose intake, primarily from added sugars in soft drinks, can induce fatty liver in animals and is epidemiologically associated with nonalcoholic fatty liver disease in humans. Fructose is considered lipogenic due to its ability to generate triglycerides as a direct consequence of the metabolism of the fructose molecule. Here, we show that fructose also stimulates triglyceride synthesis via a purine-degrading pathway that is triggered from the rapid phosphorylation of fructose by fructokinase. Generated AMP enters into the purine degradation pathway through the activation of AMP deaminase resulting in uric acid production and the generation of mitochondrial oxidants. Mitochondrial oxidative stress results in the inhibition of aconitase in the Krebs cycle, resulting in the accumulation of citrate and the stimulation of ATP citrate lyase and fatty-acid synthase leading to de novo lipogeneis. These studies provide new insights into the pathogenesis of hepatic fat accumulation under normal and diseased states.
Andrews, Rachel E.; Galileo, Deni S.; Martin-DeLeon, Patricia A.
2015-01-01
Deletion of the gene encoding the widely conserved plasma membrane calcium ATPase 4 (PMCA4), a major Ca2+ efflux pump, leads to loss of sperm motility and male infertility in mice. PMCA4's partners in sperm and how its absence exerts its effect on fertility are unknown. We hypothesize that in sperm PMCA4 interacts with endothelial nitric oxide synthase (eNOS) and neuronal nitric oxide synthase (nNOS) which are rapidly activated by Ca2+, and that these fertility-modulating proteins are present...
Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G
1995-01-01
A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils.
Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.
Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S
2013-11-01
The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.
Asuncion Valenzuela, Malyn M; Castro, Imilce; Gonda, Amber; Diaz Osterman, Carlos J; Jutzy, Jessica M; Aspe, Jonathan R; Khan, Salma; Neidigh, Jonathan W; Wall, Nathan R
2015-01-01
New agent development, mechanistic understanding, and combinatorial partnerships with known and novel modalities continue to be important in the study of pancreatic cancer and its improved treatment. In this study, known antimetabolite drugs such as gemcitabine (ribonucleotide reductase inhibitor) and 5-fluorouracil (thymidylate synthase inhibitor) were compared with novel members of these two drug families in the treatment of a chemoresistant pancreatic cancer cell line PANC-1. Cellular survival data, along with protein and messenger ribonucleic acid expression for survivin, XIAP, cIAP1, and cIAP2, were compared from both the cell cytoplasm and from exosomes after single modality treatment. While all antimetabolite drugs killed PANC-1 cells in a time- and dose-dependent manner, neither family significantly altered the cytosolic protein level of the four inhibitors of apoptosis (IAPs) investigated. Survivin, XIAP, cIAP1, and cIAP2 were found localized to exosomes where no significant difference in expression was recorded. This inability for significant and long-lasting expression may be a reason why pancreatic cancer lacks responsiveness to these and other cancer-killing agents. Continued investigation is required to determine the responsibilities of these IAPs in their role in chemoresistance in pancreatic adenocarcinoma. PMID:25767396
Developmentally dependent and different roles of fatty acids OMEGA-6 and OMEGA-3
DEFF Research Database (Denmark)
Mourek, J; Mourek, J
2011-01-01
The developmentally-dependent differences in the biological significances and effects of PUFA-OMEGA-6 (namely of arachidonic acid) and PUFA-OMEGA-3 (namely of docosahexaenoic acid) are discussed. The clinical results as well as developmental experiences are indicating a hypothesis of the evolution...... that created mutual relationship between those two substances (with immunological basis and following recuperation). The anti-inflammatory actions of PUFA-OMEGA-3 are the most visible (and significant) contrasts as compared with the large affects of namely arachidonic acid and its metabolites....
Sooman, Linda; Wennman, Anneli; Hamberg, Mats; Hoffmann, Inga; Oliw, Ernst H
2016-02-01
The genome of Aspergillus niger codes for a fusion protein (EHA25900), which can be aligned with ~50% sequence identity to 9S-dioxygenase (DOX)-allene oxide synthase (AOS) of Fusarium oxysporum, homologues of the Fusarium and Colletotrichum complexes and with over 62% sequence identity to homologues of Aspergilli, including (DOX)-9R-AOS of Aspergillus terreus. The aims were to characterize the enzymatic activities of EHA25900 and to identify crucial amino acids for the stereospecificity. Recombinant EHA25900 oxidized 18:2n-6 sequentially to 9R-hydroperoxy-10(E),12(Z)-octadecadienoic acid (9R-HPODE) and to a 9R(10)-allene oxide. 9S- and 9R-DOX-AOS catalyze abstraction of the pro-R hydrogen at C-11, but the direction of oxygen insertion differs. A comparison between twelve 9-DOX domains of 9S- and 9R-DOX-AOS revealed conserved amino acid differences, which could contribute to the chirality of products. The Gly616Ile replacement of 9R-DOX-AOS (A. niger) increased the biosynthesis of 9S-HPODE and the 9S(10)-allene oxide, whereas the Phe627Leu replacement led to biosynthesis of 9S-HPODE and the 9S(10)-allene oxide as main products. The double mutant (Gly616Ile, Phe627Leu) formed over 90% of the 9S stereoisomer of HPODE. 9S-HPODE was formed by antarafacial hydrogen abstraction and oxygen insertion, i.e., the original H-abstraction was retained but the product chirality was altered. We conclude that 9R-DOX-AOS can be altered to 9S-DOX-AOS by replacement of two amino acids (Gly616Ile, Phe627Leu) in the DOX domain. Copyright © 2015 Elsevier B.V. All rights reserved.
Glutamic acid as anticancer agent: An overview.
Dutta, Satyajit; Ray, Supratim; Nagarajan, K
2013-10-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.
Mukherjee, J J; Dekker, E E
1987-10-25
Starting with 100 g (wet weight) of a mutant of Escherichia coli K-12 forced to grow on L-threonine as sole carbon source, we developed a 6-step procedure that provides 30-40 mg of homogeneous 2-amino-3-ketobutyrate CoA ligase (also called aminoacetone synthetase or synthase). This ligase, which catalyzes the cleavage/condensation reaction between 2-amino-3-ketobutyrate (the presumed product of the L-threonine dehydrogenase-catalyzed reaction) and glycine + acetyl-CoA, has an apparent molecular weight approximately equal to 85,000 and consists of two identical (or nearly identical) subunits with Mr = 42,000. Computer analysis of amino acid composition data, which gives the best fit nearest integer ratio for each residue, indicates a total of 387 amino acids/subunit with a calculated Mr = 42,093. Stepwise Edman degradation provided the N-terminal sequence of the first 21 amino acids. It is a pyridoxal phosphate-dependent enzyme since (a) several carbonyl reagents caused greater than 90% loss of activity, (b) dialysis against buffer containing hydroxylamine resulted in 89% loss of activity coincident with an 86% decrease in absorptivity at 428 nm, (c) incubation of the apoenzyme with 20 microM pyridoxal phosphate showed a parallel recovery (greater than 90%) of activity and 428-nm absorptivity, and (d) reduction of the holoenzyme with NaBH4 resulted in complete inactivation, disappearance of a new absorption maximum at 333 nm. Strict specificity for glycine is shown but acetyl-CoA (100%), n-propionyl-CoA (127%), or n-butyryl-CoA (16%) is utilized in the condensation reaction. Apparent Km values for acetyl-CoA, n-propionyl-CoA, and glycine are 59 microM, 80 microM, and 12 mM, respectively; the pH optimum = 7.5. Added divalent metal ions or sulfhydryl compounds inhibited catalysis of the condensation reaction.
Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke
2008-08-01
Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.
Triacetic acid lactone production from Saccharomyces cerevisiae
Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...
Nitric oxide production from macrophages is regulated by arachidonic acid metabolites.
Imai, Y; Kolb, H; Burkart, V
1993-11-30
In activated macrophages the inducible form of the enzyme nitric oxide (NO) synthase generates high amounts of the toxic mediator NO. After 20 h of treatment with LPS rat peritoneal macrophages release 12-16 nmol NO2-/10(5) cells which is detectable in the culture supernatant by the Griess reaction as a measure of NO formation. The addition of aminoguanidine (1 mM), a preferential inhibitor of the inducible NO-synthase, completely abolished NO2-accumulation. Incubation with indomethacin or acetyl-salicylic acid, preferential inhibitors of the cyclooxygenase pathway of the arachidonic acid metabolism, did not influence NO2- levels. Nordihydro-guaiaretic acid (50 microM), a preferential inhibitor of the lipoxygenase pathway, caused strong reduction of NO2- accumulation to 1.9 +/- 0.3 nmol/200 microliter. Simultaneous inhibition of cyclo- and lipoxygenase by BW755c resulted in an intermediate effect (7.3 +/- 1.1 nmol/200 microliter NO2-). These results show that the induction of NO production in activated macrophages is regulated by products of the lipoxygenase-pathway of the arachidonic acid metabolism.
Directory of Open Access Journals (Sweden)
Ehsan Karimi
2012-11-01
Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Sun, Ye; Li, Xue
2014-07-01
Haploinsufficiency of Eya1 causes the branchio-oto-renal (BOR) syndrome, and abnormally high levels of Eya1 are linked to breast cancer progression and poor prognosis. Therefore, regulation of Eya1 activity is key to its tissue-specific functions and oncogenic activities. Here, we show that Eya1 is posttranslationally modified by ubiquitin and that its ubiquitination level is self-limited to prevent premature degradation. Eya1 has an evolutionarily conserved CDC4 phosphodegron (CPD) signal, a target site of glycogen synthase kinase 3 (GSK3) kinase and Fbw7 ubiquitin ligase, which is required for Eya1 ubiquitination. Genetic deletion of Fbw7 and pharmacological inhibition of GSK3 significantly decrease Eya1 ubiquitination. Conversely, activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the canonical Wnt signal suppresses Eya1 ubiquitination. Compound Eya1(+/-); Wnt9b(+/-) mutants exhibit an increased penetrance of renal defect, indicating that they function in the same genetic pathway in vivo. Together, these findings reveal that the canonical Wnt and PI3K/Akt signal pathways restrain the GSK3/Fbw7-dependent Eya1 ubiquitination, and they further suggest that dysregulation of this novel axis contributes to tumorigenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)
2011-08-17
The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.
Hege, Marianne; Jung, Finn; Sellmann, Cathrin; Jin, Chengjun; Ziegenhardt, Doreen; Hellerbrand, Claus; Bergheim, Ina
2018-01-01
Results of in vitro and in vivo studies suggest that consumption of beer is less harmful for the liver than consumption of spirits. It also has been suggested that secondary plant compounds derived from hops such as xanthohumol or iso-α-acids may have beneficial effects on the development of liver diseases of various etiologies. The aim of this study was to determine whether iso-α-acids consumed in doses achieved by "normal" beer consumption have beneficial effects on health. Female C57 Bl/6 J mice, pretreated for 4 d with an iso-α-acid-rich extract (∼30% iso-α-acids from hops, 0.75 mg/kg body weight), were fed one bolus of ethanol (6 g/kg body weight intragastric) or an iso-caloric maltodextrin solution. Markers of liver damage, toll-like receptor-4 signaling, and lipid peroxidation were determined. Furthermore, the effect of isohumulone on the lipopolysaccharide-dependent activation of J774 A.1 macrophages, used as a model of Kupffer cells, was determined. In the liver, acute ethanol administration led to a significant accumulation of fat (∼10-fold), which was accompanied by significantly higher inducible nitric oxide synthase protein level, elevated nitric oxide production, and increased plasminogen activator inhibitor 1 protein concentration when compared to controls. In mice pretreated with iso-α-acids, these effects of alcohol were markedly attenuated. Pretreatment of J774 A.1 macrophages with isohumulone significantly attenuated lipopolysaccharide-induced mRNA expression of inducible nitric oxide synthase and interleukin-6 as well as the release of nitric oxide. Taken together, iso-α-acids markedly attenuated the development of acute alcohol-induced damage in mice. Copyright © 2017 Elsevier Inc. All rights reserved.
Folic acid fortification: why not vitamin B12 also?
Selhub, Jacob; Paul, Ligi
2011-01-01
Folic acid fortification of cereal grains was introduced in many countries to prevent neural tube defect occurrence. The metabolism of folic acid and vitamin B12 intersect during the transfer of the methyl group from 5-methyltetrahydrofolate to homocysteine catalyzed by B12-dependent methioine synthase. Regeneration of tetrahydrofolate via this reaction makes it available for synthesis of nucleotide precursors. Thus either folate or vitamin B12 deficiency can result in impaired cell division and anemia. Exposure to extra folic acid through fortification may be detrimental to those with vitamin B12 deficiency. Among participants of National Health And Nutrition Examination Survey with low vitamin B12 status, high serum folate (>59 nmol/L) was associated with higher prevalence of anemia and cognitive impairment when compared with normal serum folate. We also observed an increase in the plasma concentrations of total homocysteine and methylmalonic acid (MMA), two functional indicators of vitamin B12 status, with increase in plasma folate under low vitamin B12 status. These data strongly imply that high plasma folate is associated with the exacerbation of both the biochemical and clinical status of vitamin B12 deficiency. Hence any food fortification policy that includes folic acid should also include vitamin B12. Copyright © 2011 International Union of Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Miziorko, H.M.; Behnke, C.E.
1985-01-01
3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue
Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G
1995-01-01
A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils. PMID:7542530
Mullen, Thomas D.; Spassieva, Stefka; Jenkins, Russell W.; Kitatani, Kazuyuki; Bielawski, Jacek; Hannun, Yusuf A.; Obeid, Lina M.
2011-01-01
Mammalian ceramide synthases 1 to 6 (CerS1–6) generate Cer in an acyl-CoA-dependent manner, and expression of individual CerS has been shown to enhance the synthesis of ceramides with particular acyl chain lengths. However, the contribution of each CerS to steady-state levels of specific Cer species has not been evaluated. We investigated the knockdown of individual CerS in the MCF-7 human breast adenocarcinoma cell line by using small-interfering RNA (siRNA). We found that siRNA-induced down...
Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A
2002-11-01
Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Lopez-Zavala, Alonso A; Guevara-Hernandez, Eduardo; Vazquez-Lujan, Luz H; Sanchez-Paz, Arturo; Garcia-Orozco, Karina D; Contreras-Vergara, Carmen A; Lopez-Leal, Gamaliel; Arvizu-Flores, Aldo A; Ochoa-Leyva, Adrian; Sotelo-Mundo, Rogerio R
2018-01-01
Thymidylate synthase (TS, E.C. 2.1.1.45) is a crucial enzyme for de novo deoxythymidine monophosphate (dTMP) biosynthesis. The gene for this enzyme is thyA , which encodes the folate-dependent TS that converts deoxyuridine monophosphate group (dUMP) into (dTMP) using the cofactor 5,10-methylenetetrahydrofolate (mTHF) as a carbon donor. We identified the thyA gene in the genome of the Vibrio parahaemolyticus strain FIM-S1708+ that is innocuous to humans but pathogenic to crustaceans. Surprisingly, we found changes in the residues that bind the substrate dUMP and mTHF, previously postulated as invariant among all TSs known (Finer-Moore, Santi & Stroud, 2003). Interestingly, those amino acid changes were also found in a clade of microorganisms that contains Vibrionales , Alteromonadales , Aeromonadales , and Pasteurellales (VAAP) from the Gammaproteobacteria class. In this work, we studied the biochemical properties of recombinant TS from V. parahemolyticus FIM-S1708+ (VpTS) to address the natural changes in the TS amino acid sequence of the VAAP clade. Interestingly, the K m for dUMP was 27.3 ± 4.3 µM, about one-fold larger compared to other TSs. The K m for mTHF was 96.3 ± 18 µM, about three- to five-fold larger compared to other species, suggesting also loss of affinity. Thus, the catalytic efficiency was between one or two orders of magnitude smaller for both substrates. We used trimethoprim, a common antibiotic that targets both TS and DHFR for inhibition studies. The IC 50 values obtained were high compared to other results in the literature. Nonetheless, this molecule could be a lead for the design antibiotics towards pathogens from the VAAP clade. Overall, the experimental results also suggest that in the VAAP clade the nucleotide salvage pathway is important and should be investigated, since the de novo dTMP synthesis appears to be compromised by a less efficient thymidylate synthase.
Directory of Open Access Journals (Sweden)
Alonso A. Lopez-Zavala
2018-06-01
Full Text Available Thymidylate synthase (TS, E.C. 2.1.1.45 is a crucial enzyme for de novo deoxythymidine monophosphate (dTMP biosynthesis. The gene for this enzyme is thyA, which encodes the folate-dependent TS that converts deoxyuridine monophosphate group (dUMP into (dTMP using the cofactor 5,10-methylenetetrahydrofolate (mTHF as a carbon donor. We identified the thyA gene in the genome of the Vibrio parahaemolyticus strain FIM-S1708+ that is innocuous to humans but pathogenic to crustaceans. Surprisingly, we found changes in the residues that bind the substrate dUMP and mTHF, previously postulated as invariant among all TSs known (Finer-Moore, Santi & Stroud, 2003. Interestingly, those amino acid changes were also found in a clade of microorganisms that contains Vibrionales, Alteromonadales, Aeromonadales, and Pasteurellales (VAAP from the Gammaproteobacteria class. In this work, we studied the biochemical properties of recombinant TS from V. parahemolyticus FIM-S1708+ (VpTS to address the natural changes in the TS amino acid sequence of the VAAP clade. Interestingly, the Km for dUMP was 27.3 ± 4.3 µM, about one-fold larger compared to other TSs. The Km for mTHF was 96.3 ± 18 µM, about three- to five-fold larger compared to other species, suggesting also loss of affinity. Thus, the catalytic efficiency was between one or two orders of magnitude smaller for both substrates. We used trimethoprim, a common antibiotic that targets both TS and DHFR for inhibition studies. The IC50 values obtained were high compared to other results in the literature. Nonetheless, this molecule could be a lead for the design antibiotics towards pathogens from the VAAP clade. Overall, the experimental results also suggest that in the VAAP clade the nucleotide salvage pathway is important and should be investigated, since the de novo dTMP synthesis appears to be compromised by a less efficient thymidylate synthase.
Pu, Qiang-Hong; Shi, Liang; Yu, Chao
2015-03-01
1.Gallic acid is a main polyphenol in various fruits and plants. Inhibitory characteristics of gallic acid on CYP3A4 were still unclear. The objective of this work is hence to investigate inhibitory characteristics of gallic acid on CYP3A4 using testosterone as the probe substrate in human liver microsomes (HLMs) and recombinant CYP3A4 (rCYP3A4) systems. 2.Gallic acid caused concentration-dependent loss of CYP3A4 activity with IC50 values of 615.2 μM and 669.5 μM in HLM and rCYP3A4 systems, respectively. IC50-shift experiments showed that pre-incubation with gallic acid in the absence of NADPH contributed to 12- or 14-fold reduction of IC50 in HLM and rCYP3A4 systems, respectively, supporting a time-dependent inhibition. In HLM, time-dependent inactivation variables KI and Kinact were 485.8 μM and 0.05 min(-1), respectively. 3.Compared with the presence of NADPH, pre-incubation of gallic acid in the absence of NADPH markedly increased its inhibitory effects in HLM and rCYP3A4 systems. Those results indicate that CYP3A4 inactivation by gallic acid was independent on NADPH and was mainly mediated its oxidative products. 4.In conclusion, we showed that gallic acid weakly and time-dependently inactivated CYP3A4 via its oxidative products.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Almadanim, M. Cecília
2017-01-19
Calcium-dependent protein kinases (CDPKs) are involved in plant tolerance mechanisms to abiotic stresses. Although CDPKs are recognized as key messengers in signal transduction, the specific role of most members of this family remains unknown. Here we test the hypothesis that OsCPK17 plays a role in rice cold stress response by analyzing OsCPK17 knockout, silencing, and overexpressing rice lines under low temperature. Altered OsCPK17 gene expression compromises cold tolerance performance, without affecting the expression of key cold stress-inducible genes. A comparative phosphoproteomic approach led to the identification of six potential in vivo OsCPK17 targets, which are associated with sugar and nitrogen metabolism, and with osmotic regulation. To test direct interaction, in vitro kinase assays were performed, showing that the sucrose phosphate synthase OsSPS4, and the aquaporin OsPIP2;1/OsPIP2;6 are phosphorylated by OsCPK17 in a calcium-dependent manner. Altogether, our data indicates that OsCPK17 is required for a proper cold stress response in rice, likely affecting the activity of membrane channels and sugar metabolism.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K
2001-01-01
The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...
International Nuclear Information System (INIS)
Ökvist, Mats; Sasso, Severin; Roderer, Kathrin; Kast, Peter; Krengel, Ute
2009-01-01
Two shikimate-pathway enzymes from M. tuberculosis, the intracellular chorismate mutase (MtCM) and DAHP synthase (MtDS), were produced recombinantly and purified. MtCM was crystallized alone and in complex with MtDS and analyzed by X-ray diffraction. Chorismate mutase catalyzes a key step in the shikimate-biosynthetic pathway and hence is an essential enzyme in bacteria, plants and fungi. Mycobacterium tuberculosis contains two chorismate mutases, a secreted and an intracellular one, the latter of which (MtCM; Rv0948c; 90 amino-acid residues; 10 kDa) is the subject of this work. Here are reported the gene expression, purification and crystallization of MtCM alone and of its complex with another shikimate-pathway enzyme, DAHP synthase (MtDS; Rv2178c; 472 amino-acid residues; 52 kDa), which has been shown to enhance the catalytic efficiency of MtCM. The MtCM–MtDS complex represents the first noncovalent enzyme complex from the common shikimate pathway to be structurally characterized. Soaking experiments with a transition-state analogue are also reported. The crystals of MtCM and the MtCM–MtDS complex diffracted to 1.6 and 2.1 Å resolution, respectively
Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G
1998-06-09
Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.
Substrate promiscuity of a rosmarinic acid synthase from lavender (Lavandula angustifolia L.).
Landmann, Christian; Hücherig, Stefanie; Fink, Barbara; Hoffmann, Thomas; Dittlein, Daniela; Coiner, Heather A; Schwab, Wilfried
2011-08-01
One of the most common types of modification of secondary metabolites is the acylation of oxygen- and nitrogen-containing substrates to produce esters and amides, respectively. Among the known acyltransferases, the members of the plant BAHD family are capable of acylating a wide variety of substrates. Two full-length acyltransferase cDNAs (LaAT1 and 2) were isolated from lavender flowers (Lavandula angustifolia L.) by reverse transcriptase-PCR using degenerate primers based on BAHD sequences. Recombinant LaAT1 exhibited a broad substrate tolerance accepting (hydroxy)cinnamoyl-CoAs as acyl donors and not only tyramine, tryptamine, phenylethylamine and anthranilic acid but also shikimic acid and 4-hydroxyphenyllactic acid as acceptors. Thus, LaLT1 forms esters and amides like its phylogenetic neighbors. In planta LaAT1 might be involved in the biosynthesis of rosmarinic acid, the ester of caffeic acid and 3,4-dihydroxyphenyllactic acid, a major constituent of lavender flowers. LaAT2 is one of three members of clade VI with unknown function.
Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte
2014-01-01
between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...
The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.
Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra
2016-04-01
The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae
2007-01-01
In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...
Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.
Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P
2012-01-01
Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Role of NPR1 dependent and NPR1 independent genes in response to Salicylic acid
Directory of Open Access Journals (Sweden)
Neha Agarwal
2017-10-01
Full Text Available NPR1 (Nonexpressor of pathogenesis-related gene is a transcription coactivator and central regulator of systemic acquired resistance (SAR pathway. It controls wide range of pathogenesis related genes involved in various defense responses, acts by sensing SAR signal molecule, Salicylic acid (SA. Mutation in NPR1 results in increased susceptibility to pathogen infection and less expression of pathogenesis related genes. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction. For this RNA-seq was performed in Arabidopsis thaliana Col-0 and npr1-1 in response to Salicylic acid. RNA-seq analysis revealed a total of 3811 differentially expressed gene in which 2109 genes are up-regulated and 1702 genes are down-regulated. We have divided these genes in 6 categories SA induced (SI, SA repressed (SR, NPR1 dependent SI (ND-SI, NPR1 dependent SR (ND-SR, NPR1 independent SI (NI-SI, NPR1 independent SR (NI-SR. Further, Gene ontology and MapMan pathway analysis of differentially expressed genes suggested variety of biological processes and metabolic pathways that are enriched during SAR defense pathway. These results contribute to shed light on importance of both NPR1-dependent (ND and NPR1-independent (NI gene acting downstream to Salicylic acid induction in SAR pathway. The present study aimed to identify the role of NPR1 in gene expression after the Salicylic acid induction.
Directory of Open Access Journals (Sweden)
S. Suresh
2016-01-01
Full Text Available The molecular structure of the three compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III has been determined using Gaussian 03W program with B3LYP method using 6-311++G (d,p basis set calculations. The molecular structures were fully optimized with atomic numbering scheme adopted in the study. To understand the mode of binding and molecular interaction, the docking studies of compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III have been carried out with prostaglandin H2 synthase-1 (1PGE as target using induced fit docking. The molecular docking results show that the interactions and energy for Aceclofenac, Salicylic Acid, and Piroxicam show the best results when docked with prostaglandin H2 synthase-1 (1PGE. The hydrogen bonding interactions of compound I (Aceclofenac are prominent with Arginine moiety, those of compound II (Salicylic Acid are prominent with Tyrosine and Serine moieties, and compound III (Piroxicam shows such interaction with Tyrosine and Arginine moieties. These interactions of prostaglandin H2 synthase-1 (1PGE with substrates are responsible for governing COX-1 inhibitor potency which in turn is a direct measure of the potency of the drug.
Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg
2010-01-01
The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448
Woo, Ji-Min; Kim, Ji-Won; Song, Ji-Won; Blank, Lars M; Park, Jin-Byung
The biosynthesis of carboxylic acids including fatty acids from biomass is central in envisaged biorefinery concepts. The productivities are often, however, low due to product toxicity that hamper whole-cell biocatalyst performance. Here, we have investigated factors that influence the tolerance of Escherichia coli to medium chain carboxylic acid (i.e., n-heptanoic acid)-induced stress. The metabolic and genomic responses of E. coli BL21(DE3) and MG1655 grown in the presence of n-heptanoic acid indicated that the GadA/B-based glutamic acid-dependent acid resistance (GDAR) system might be critical for cellular tolerance. The GDAR system, which is responsible for scavenging intracellular protons by catalyzing decarboxylation of glutamic acid, was inactive in E. coli BL21(DE3). Activation of the GDAR system in this strain by overexpressing the rcsB and dsrA genes, of which the gene products are involved in the activation of GadE and RpoS, respectively, resulted in acid tolerance not only to HCl but also to n-heptanoic acid. Furthermore, activation of the GDAR system allowed the recombinant E. coli BL21(DE3) expressing the alcohol dehydrogenase of Micrococcus luteus and the Baeyer-Villiger monooxygenase of Pseudomonas putida to reach 60% greater product concentration in the biotransformation of ricinoleic acid (i.e., 12-hydroxyoctadec-9-enoic acid (1)) into n-heptanoic acid (5) and 11-hydroxyundec-9-enoic acid (4). This study may contribute to engineering E. coli-based biocatalysts for the production of carboxylic acids from renewable biomass.
Directory of Open Access Journals (Sweden)
Ji-Min Woo
Full Text Available The biosynthesis of carboxylic acids including fatty acids from biomass is central in envisaged biorefinery concepts. The productivities are often, however, low due to product toxicity that hamper whole-cell biocatalyst performance. Here, we have investigated factors that influence the tolerance of Escherichia coli to medium chain carboxylic acid (i.e., n-heptanoic acid-induced stress. The metabolic and genomic responses of E. coli BL21(DE3 and MG1655 grown in the presence of n-heptanoic acid indicated that the GadA/B-based glutamic acid-dependent acid resistance (GDAR system might be critical for cellular tolerance. The GDAR system, which is responsible for scavenging intracellular protons by catalyzing decarboxylation of glutamic acid, was inactive in E. coli BL21(DE3. Activation of the GDAR system in this strain by overexpressing the rcsB and dsrA genes, of which the gene products are involved in the activation of GadE and RpoS, respectively, resulted in acid tolerance not only to HCl but also to n-heptanoic acid. Furthermore, activation of the GDAR system allowed the recombinant E. coli BL21(DE3 expressing the alcohol dehydrogenase of Micrococcus luteus and the Baeyer-Villiger monooxygenase of Pseudomonas putida to reach 60% greater product concentration in the biotransformation of ricinoleic acid (i.e., 12-hydroxyoctadec-9-enoic acid (1 into n-heptanoic acid (5 and 11-hydroxyundec-9-enoic acid (4. This study may contribute to engineering E. coli-based biocatalysts for the production of carboxylic acids from renewable biomass.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert
2016-09-01
Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016
Nor-ursodeoxycholic acid reverses hepatocyte-specific nemo-dependent steatohepatitis.
Beraza, Naiara; Ofner-Ziegenfuss, Lisa; Ehedego, Haksier; Boekschoten, Mark; Bischoff, Stephan C; Mueller, Michael; Trauner, Michael; Trautwein, Christian
2011-03-01
Hepatocyte-specific NEMO/NF-κB deleted mice (NEMO(Δhepa)) develop spontaneous non-alcoholic steatohepatitis (NASH). Free fatty acids and bile acids promote DR5 expression. TRAIL/NK cell-mediated activation of TRAIL-R2/DR5 plays an important role during acute injury in NEMO(Δhepa) mice. To inhibit the progression of NASH in the absence of hepatocyte-NEMO/NF-kB signaling. NEMOf/f and NEMO(Δhepa) mice were fed with a low-fat diet, and with two anticholestatic diets; UDCA and NorUDCA. The impact of these treatments on the progression of NASH was evaluated. We show that high expression of DR5 in livers from NEMO(Δhepa) mice is accompanied by an abundant presence of bile acids (BAs), misregulation of BA transporters and significant alteration of lipid metabolism-related genes. Additionally, mice lacking NEMO in hepatocytes spontaneously showed ductular response at young age. Unexpectedly, feeding of NEMO(Δhepa) mice with low-fat diet failed to improve chronic liver injury. Conversely, anti-cholestatic treatment with nor-ursodeoxycholic acid (NorUDCA), but not with ursodeoxycholic acid (UDCA), led to a significant attenuation of liver damage in NEMO(Δhepa) mice. The strong therapeutic effect of NorUDCA relied on a significant downregulation of LXR-dependent lipogenesis and the normalisation of BA metabolism through mechanisms involving cross-talk between Cyp7a1 and SHP. This was associated with the significant improvement of liver histology, NEMO(Δhepa)/NorUDCA-treated mice showed lower apoptosis and reduced CyclinD1 expression, indicating attenuation of the compensatory proliferative response to hepatocellular damage. Finally, fibrosis and ductular reaction markers were significantly reduced in NorUDCA-treated NEMO(Δhepa) mice. Overall, our work demonstrates the contribution of bile acids metabolism to the progression of NASH in the absence of hepatocyte-NF-kB through mechanisms involving DR5-apoptosis, inflammation and fibrosis. Our work suggests a potential
Musah, Rabi A.; He, Quan; Kubec, Roman
2009-01-01
A novel lachrymatory factor synthase (LFS) was isolated and purified from the roots of the Amazonian medicinal plant Petiveria alliacea. The enzyme is a heterotetrameric glycoprotein comprised of two α-subunits (68.8 kD each), one γ-subunit (22.5 kD), and one δ-subunit (11.9 kD). The two α-subunits are glycosylated and connected by a disulfide bridge. The LFS has an isoelectric point of 5.2. It catalyzes the formation of a sulfine lachrymator, (Z)-phenylmethanethial S-oxide, only in the presence of P. alliacea alliinase and its natural substrate, S-benzyl-l-cysteine sulfoxide (petiveriin). Depending on its concentration relative to that of P. alliacea alliinase, the LFS sequesters, to varying degrees, the sulfenic acid intermediate formed by alliinase-mediated breakdown of petiveriin. At LFS:alliinase of 5:1, LFS sequesters all of the sulfenic acid formed by alliinase action on petiveriin, and converts it entirely to (Z)-phenylmethanethial S-oxide. However, starting at LFS:alliinase of 5:2, the LFS is unable to sequester all of the sulfenic acid produced by the alliinase, with the result that sulfenic acid that escapes the action of the LFS condenses with loss of water to form S-benzyl phenylmethanethiosulfinate (petivericin). The results show that the LFS and alliinase function in tandem, with the alliinase furnishing the sulfenic acid substrate on which the LFS acts. The results also show that the LFS modulates the formation of biologically active thiosulfinates that are downstream of the alliinase in a manner dependent upon the relative concentrations of the LFS and the alliinase. These observations suggest that manipulation of LFS-to-alliinase ratios in plants displaying this system may provide a means by which to rationally modify organosulfur small molecule profiles to obtain desired flavor and/or odor signatures, or increase the presence of desirable biologically active small molecules. PMID:19692535
Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase
International Nuclear Information System (INIS)
Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.
2016-01-01
The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)
Król, P; Igielski, R; Pollmann, S; Kępczyńska, E
2015-05-01
Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
Fayol-Messaoudi, Domitille; Berger, Cédric N; Coconnier-Polter, Marie-Hélène; Liévin-Le Moal, Vanessa; Servin, Alain L
2005-10-01
The mechanism(s) underlying the antibacterial activity of probiotic Lactobacillus strains appears to be multifactorial and includes lowering of the pH and the production of lactic acid and of antibacterial compounds, including bacteriocins and nonbacteriocin, non-lactic acid molecules. Addition of Dulbecco's modified Eagle's minimum essential medium to the incubating medium delays the killing activity of lactic acid. We found that the probiotic strains Lactobacillus johnsonii La1, Lactobacillus rhamnosus GG, Lactobacillus casei Shirota YIT9029, L. casei DN-114 001, and L. rhamnosus GR1 induced a dramatic decrease in the viability of Salmonella enterica serovar Typhimurium SL1344 mainly attributable to non-lactic acid molecule(s) present in the cell-free culture supernatant (CFCS). These molecules were more active against serovar Typhimurium SL1344 in the exponential growth phase than in the stationary growth phase. We also showed that the production of the non-lactic acid substance(s) responsible for the killing activity was dependent on growth temperature and that both unstable and stable substances with killing activity were present in the CFCSs. We found that the complete inhibition of serovar Typhimurium SL1344 growth results from a pH-lowering effect.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
Activation of cGAS-dependent antiviral responses by DNA intercalating agents.
Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P
2017-01-09
Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Jakubowska, Monika A.; Gerasimenko, Julia V.; Gerasimenko, Oleg V.; Petersen, Ole H.
2016-01-01
Key points Acute biliary pancreatitis is a sudden and severe condition initiated by bile reflux into the pancreas.Bile acids are known to induce Ca2+ signals and necrosis in isolated pancreatic acinar cells but the effects of bile acids on stellate cells are unexplored.Here we show that cholate and taurocholate elicit more dramatic Ca2+ signals and necrosis in stellate cells compared to the adjacent acinar cells in pancreatic lobules; whereas taurolithocholic acid 3‐sulfate primarily affects acinar cells.Ca2+ signals and necrosis are strongly dependent on extracellular Ca2+ as well as Na+; and Na+‐dependent transport plays an important role in the overall bile acid uptake in pancreatic stellate cells.Bile acid‐mediated pancreatic damage can be further escalated by bradykinin‐induced signals in stellate cells and thus killing of stellate cells by bile acids might have important implications in acute biliary pancreatitis. Abstract Acute biliary pancreatitis, caused by bile reflux into the pancreas, is a serious condition characterised by premature activation of digestive enzymes within acinar cells, followed by necrosis and inflammation. Bile acids are known to induce pathological Ca2+ signals and necrosis in acinar cells. However, bile acid‐elicited signalling events in stellate cells remain unexplored. This is the first study to demonstrate the pathophysiological effects of bile acids on stellate cells in two experimental models: ex vivo (mouse pancreatic lobules) and in vitro (human cells). Sodium cholate and taurocholate induced cytosolic Ca2+ elevations in stellate cells, larger than those elicited simultaneously in the neighbouring acinar cells. In contrast, taurolithocholic acid 3‐sulfate (TLC‐S), known to induce Ca2+ oscillations in acinar cells, had only minor effects on stellate cells in lobules. The dependence of the Ca2+ signals on extracellular Na+ and the presence of sodium–taurocholate cotransporting polypeptide (NTCP) indicate a Na+‐dependent
Lu, M; Wang, L F; Du, X H; Yu, Y K; Pan, J B; Nan, Z J; Han, J; Wang, W X; Zhang, Q Z; Sun, Q P
2015-11-30
Various plant genes can be activated or inhibited by phytohormones under conditions of biotic and abiotic stress, especially in response to jasmonic acid (JA) and salicylic acid (SA). Interactions between JA and SA may be synergistic or antagonistic, depending on the stress condition. In this study, we cloned a full-length cDNA (LeWRKY1, GenBank accession No. FJ654265) from Lycopersicon esculentum by rapid amplification of cDNA ends. Sequence analysis showed that this gene is a group II WRKY transcription factor. Analysis of LeWRKY1 mRNA expression in various tissues by qRT-PCR showed that the highest and lowest expression occurred in the leaves and stems, respectively. In addition, LeWRKY1 expression was induced by JA and Botrytis cinerea Pers., but not by SA.
A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.
Directory of Open Access Journals (Sweden)
Sarah Schulz
Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.
Directory of Open Access Journals (Sweden)
Sheo B Singh
Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.
Temperature dependence of relaxation times in proton components of fatty acids
International Nuclear Information System (INIS)
Kuroda, Kagayaki; Iwabuchi, Taku; Saito, Kensuke; Obara, Makoto; Honda, Masatoshi; Imai, Yutaka
2011-01-01
We examined the temperature dependence of relaxation times in proton components of fatty acids in various samples in vitro at 11 tesla as a standard calibration data for quantitative temperature imaging of fat. The spin-lattice relaxation time, T 1 , of both the methylene (CH 2 ) chain and terminal methyl (CH 3 ) was linearly related to temperature (r>0.98, P 2 signal for calibration and observed the signal with 18% of CH 3 to estimate temperature. These findings suggested that separating the fatty acid components would significantly improve accuracy in quantitative thermometry for fat. Use of the T 1 of CH 2 seems promising in terms of reliability and reproducibility in measuring temperature of fat. (author)
Kim, Min-Hye; Kim, Jin Nam; Han, Sung Nim; Kim, Hye-Kyeong
2015-06-01
Psidium guajava (guava) leaves have been frequently used for the treatment of rheumatism, fever, arthritis and other inflammatory conditions. The purpose of this study was to identify major anti-inflammatory compounds from guava leaf extract. The methanol extract and its hexane-, dichloromethane-, ethylacetate-, n-butanol- and water-soluble phases derived from guava leaves were evaluated to determine their inhibitory activity on nitric oxide (NO) production by RAW 264.7 cells stimulated with lipopolysaccharide (LPS). The methanol extract decreased NO production in a dose-dependent manner without cytotoxicity at a concentration range of 0-100 μg/mL. The n-butanol soluble phase was the most potent among the five soluble phases. Four compounds were isolated by reversed-phase HPLC from the n-butanol soluble phase and identified to be avicularin, guaijaverin, leucocyanidin and ursolic acid by their NMR spectra. Among these compounds, ursolic acid inhibited LPS-induced NO production in a dose-dependent manner without cytotoxity at a concentration range of 1-10 µM, but the other three compounds had no effect. Ursolic acid also inhibited LPS-induced prostaglandin E2 production. A western blot analysis showed that ursolic acid decreased the LPS-stimulated inducible nitric oxide synthase and cyclooxygenase protein levels. In addition, ursolic acid suppressed the production of intracellular reactive oxygen species in LPS-stimulated RAW 264.7 cells, as measured by flow cytometry. Taken together, these results identified ursolic acid as a major anti-inflammatory compound in guava leaves.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
SEPAROVIC, DUSKA; BREEN, PAUL; BOPPANA, NITHIN B.; VAN BUREN, ERIC; JOSEPH, NICHOLAS; KRAVEKA, JACQUELINE M.; RAHMANIYAN, MEHRDAD; LI, LI; GUDZ, TATYANA I.; BIELAWSKA, ALICJA; BAI, AIPING; BIELAWSKI, JACEK; PIERCE, JASON S.; KORBELIK, MLADEN
2013-01-01
Photodynamic therapy (PDT) is not always effective as an anticancer treatment, therefore, PDT is combined with other anticancer agents for improved efficacy. The combination of dasatinib and PDT with the silicone phthalocyanine photosensitizer Pc 4 was assessed for increased killing of SCCVII mouse squamous cell carcinoma cells, a preclinical model of head and neck squamous cell carcinoma, using apoptotic markers and colony formation as experimental end-points. Because each of these treatments regulates the metabolism of the sphingolipid ceramide, their effects on mRNA levels of ceramide synthase, a ceramide-producing enzyme, and the sphingolipid profile were determined. PDT + dasatinib induced an additive loss of clonogenicity. Unlike PDT alone or PDT + dasatinib, dasatinib induced zVAD-fmk-dependent cell killing. PDT or dasatinib-induced caspase-3 activation was potentiated after the combination. PDT alone induced mitochondrial depolarization, and the effect was inhibited after the combination. Annexin V+ and propidium iodide+ cells remained at control levels after treatments. In contrast to PDT alone, dasatinib induced upregulation of ceramide synthase 1 mRNA, and the effect was enhanced after the combination. Dasatinib induced a modest increase in C20:1-and C22-ceramide but had no effect on total ceramide levels. PDT increased the levels of 12 individual ceramides and total ceramides, and the addition of dasatinib did not affect these increases. PDT alone decreased substantially sphingosine levels and inhibited the activity of acid ceramidase, an enzyme that converts ceramide to sphingosine. The data suggest that PDT-induced increases in ceramide levels do not correlate with ceramide synthase mRNA levels but rather with inhibition of ceramidase. Cell killing was zVAD-fmk-sensitive after dasatinib but not after either PDT or the combination and enhanced cell killing after the combination correlated with potentiated caspase-3 activation and upregulation of
Metabolically engineered cells for the production of polyunsaturated fatty acids
DEFF Research Database (Denmark)
2005-01-01
The present invention relates to the construction and engineering of cells, more particularly microorganisms for producing PUFAs with four or more double bonds from non-fatty acid substrates through heterologous expression of an oxygen requiring pathway. The invention especially involves...... improvement of the PUFA content in the host organism through fermentation optimization, e.g. decreasing the temperature and/or designing an optimal medium, or through improving the flux towards fatty acids by metabolic engineering, e.g. through over-expression of fatty acid synthases, over-expression of other...
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Bernsdorff, Friederike; Döring, Anne-Christin; Gruner, Katrin; Schuck, Stefan; Bräutigam, Andrea; Zeier, Jürgen
2016-01-01
We investigated the relationships of the two immune-regulatory plant metabolites, salicylic acid (SA) and pipecolic acid (Pip), in the establishment of plant systemic acquired resistance (SAR), SAR-associated defense priming, and basal immunity. Using SA-deficient sid2, Pip-deficient ald1, and sid2 ald1 plants deficient in both SA and Pip, we show that SA and Pip act both independently from each other and synergistically in Arabidopsis thaliana basal immunity to Pseudomonas syringae. Transcriptome analyses reveal that SAR establishment in Arabidopsis is characterized by a strong transcriptional response systemically induced in the foliage that prepares plants for future pathogen attack by preactivating multiple stages of defense signaling and that SA accumulation upon SAR activation leads to the downregulation of photosynthesis and attenuated jasmonate responses systemically within the plant. Whereas systemic Pip elevations are indispensable for SAR and necessary for virtually the whole transcriptional SAR response, a moderate but significant SA-independent component of SAR activation and SAR gene expression is revealed. During SAR, Pip orchestrates SA-dependent and SA-independent priming of pathogen responses in a FLAVIN-DEPENDENT-MONOOXYGENASE1 (FMO1)-dependent manner. We conclude that a Pip/FMO1 signaling module acts as an indispensable switch for the activation of SAR and associated defense priming events and that SA amplifies Pip-triggered responses to different degrees in the distal tissue of SAR-activated plants. © 2016 American Society of Plant Biologists. All rights reserved.
KRUYT, FAE; FOLKERS, GE; WALHOUT, AJM; VANDERLEEDE, BM; VANDERSAAG, PT; Kruyt, Frank
The retinoic acid (RA) receptor (RAR) beta2 promoter is strongly activated by RA in embryonal carcinoma (EC) cells. We examined this activation in the P19 EC-derived END-2 cell line and in E1A-expressing counterparts and found strong RA-dependent RARbeta2 promoter activation in the E1A-expressing
Angiotensin II stimulates superoxide production by nitric oxide synthase in thick ascending limbs.
Gonzalez-Vicente, Agustin; Saikumar, Jagannath H; Massey, Katherine J; Hong, Nancy J; Dominici, Fernando P; Carretero, Oscar A; Garvin, Jeffrey L
2016-02-01
Angiotensin II (Ang II) causes nitric oxide synthase (NOS) to become a source of superoxide (O2 (-)) via a protein kinase C (PKC)-dependent process in endothelial cells. Ang II stimulates both NO and O2 (-) production in thick ascending limbs. We hypothesized that Ang II causes O2 (-) production by NOS in thick ascending limbs via a PKC-dependent mechanism. NO production was measured in isolated rat thick ascending limbs using DAF-FM, whereas O2 (-) was measured in thick ascending limb suspensions using the lucigenin assay. Consistent stimulation of NO was observed with 1 nmol/L Ang II (P thick ascending limbs via a PKC- and NADPH oxidase-dependent process; and (2) the effect of Ang II is not due to limited substrate. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Palmitoleic Acid Improves Metabolic Functions in Fatty Liver by PPARα-Dependent AMPK Activation.
de Souza, Camila O; Teixeira, Alexandre A S; Biondo, Luana A; Lima Junior, Edson A; Batatinha, Helena A P; Rosa Neto, Jose C
2017-08-01
Palmitoleic acid, since described as lipokine, increases glucose uptake by modulation of 5'AMP-activated protein kinase (AMPK), as well as increasing lipolysis by activation of peroxisome proliferator-activated receptor-α (PPARα), in adipose tissue. However, in liver, the effects of palmitoleic acid on glucose metabolism and the role of PPARα remain unknown. To investigate whether palmitoleic acid improved the hepatic insulin sensitivity of obese mice. C57BL6 and PPARα knockout (KO) mice were fed for 12 weeks with a standard diet (SD) or high-fat diet (HF), and in the last 2 weeks were treated with oleic or palmitoleic acid. Palmitoleic acid promoted a faster uptake of glucose in the body, associated with higher insulin concentration; however, even when stimulated with insulin, palmitoleic acid did not modulate the insulin pathway (AKT, IRS). Palmitoleic acid increased the phosphorylation of AMPK, upregulated glucokinase and downregulated SREBP-1. Regarding AMPK downstream, palmitoleic acid increased the production of FGF-21 and stimulated the expression of PPARα. Palmitoleic acid treatment did not increase AMPK phosphorylation, modulate glucokinase or increase FGF-21 in liver of PPARα KO mice. In mice fed with a high-fat diet, palmitoleic acid supplementation stimulated the uptake of glucose in liver through activation of AMPK and FGF-21, dependent on PPARα. J. Cell. Physiol. 232: 2168-2177, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Triacetic acid lactone production in industrial Saccharomyces yeast strains
Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...
International Nuclear Information System (INIS)
Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou
2010-01-01
Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Fedosejevs, Eric T; Gerdis, Suzanne A; Ying, Sheng; Pyc, Michal; Anderson, Erin M; Snedden, Wayne A; Mullen, Robert T; She, Yi-Min; Plaxton, William C
2016-10-15
Imported sucrose is cleaved by sucrose synthase (SUS) as a critical initial reaction in the biosynthesis of storage end-products by developing seeds. Although SUS is phosphorylated at a conserved seryl residue by an apparent CDPK (Ca 2+ -dependent protein kinase) in diverse plant tissues, the functions and mechanistic details of this process remain obscure. Thus, the native CDPK that phosphorylates RcSUS1 (Ricinus communis SUS1) at Ser 11 in developing COS (castor oil seeds) was highly purified and identified as RcCDPK2 by MS/MS. Purified RcSUS1-K (-kinase) and heterologously expressed RcCDPK2 catalyzed Ca 2+ -dependent Ser 11 phosphorylation of RcSUS1 and its corresponding dephosphopeptide, while exhibiting a high affinity for free Ca 2+ ions [K 0.5 (Ca 2+ ) < 0.4 µM]. RcSUS1-K activity, RcCDPK2 expression, and RcSUS1 Ser 11 phosphorylation peaked during early COS development and then declined in parallel. The elimination of sucrose import via fruit excision triggered RcSUS1 dephosphorylation but did not alter RcSUS1-K activity, suggesting a link between sucrose signaling and posttranslational RcCDPK2 control. Both RcCDPK2-mCherry and RcSUS1-EYFP co-localized throughout the cytosol when transiently co-expressed in tobacco suspension cells, although RcCDPK2-mCherry was also partially localized to the nucleus. Subcellular fractionation revealed that ∼20% of RcSUS1-K activity associates with microsomal membranes in developing COS, as does RcSUS1. In contrast with RcCDPK1, which catalyzes inhibitory phosphorylation of COS bacterial-type phosphoenolpyruvate carboxylase at Ser 451 , RcCDPK2 exhibited broad substrate specificity, a wide pH-activity profile centered at pH 8.5, and insensitivity to metabolite effectors or thiol redox status. Our combined results indicate a possible link between cytosolic Ca 2+ -signaling and the control of photosynthate partitioning during COS development. © 2016 The Author(s); published by Portland Press Limited on behalf of the
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Directory of Open Access Journals (Sweden)
Debjani Saha
Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.
Energy Technology Data Exchange (ETDEWEB)
Liu Yang [Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Beijing 100101 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100080 (China); Wang Jianshe; Wei Yanhong; Zhang Hongxia; Xu Muqi [Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Beijing 100101 (China); Dai Jiayin [Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Beijing 100101 (China)], E-mail: daijy@ioz.ac.cn
2008-09-29
The effects of acute perfluorododecanoic acid (PFDoA) exposure on the induction of oxidative stress and alteration of mitochondrial gene expression were studied in the livers of female zebrafish (Danio rerio). Female zebrafish were exposed to PFDoA via a single intraperitoneal injection (0, 20, 40, or 80 {mu}g PFDoA/g body weight) and were then sacrificed 48 h, 96 h, or seven days post-PFDoA administration. PFDoA-treated fish exhibited histopathological liver damage, including swollen hepatocytes, vacuolar degeneration, and nuclei pycnosis. Glutathione (GSH) content and catalase (CAT) activity decreased significantly at 48 h post-injection while superoxide dismutase (SOD) activity was initially decreased at 48 h post-injection but was then elevated by seven days post-injection. The activity of glutathione peroxidase (GPx) increased at 48 h and seven days compared to control fish, although the increased level at seven days post-injection was decreased compared to the level at 48 h post-injection. Lipid peroxidation levels were increased at seven days post-injection, while no apparent induction was observed at 48 h or 96 h post-injection. The mRNA expression of medium-chain fatty acid dehydrogenase (MCAD) was induced, while the transcriptional expression of liver fatty acid binding protein (L-FABP), peroxisome proliferating activating receptor {alpha} (PPAR{alpha}), carnitine palmitoyl-transferase I (CPT-I), uncoupling protein 2 (UCP-2), and Bcl-2 were significantly inhibited. Furthermore, the transcriptional expression of peroxisomal fatty acyl-CoA oxidase (ACOX), very long-chain acyl-CoA dehydrogenase (VLCAD), long-chain acyl-CoA dehydrogenase (LCAD) did not exhibit significant changes following PFDoA treatment. No significant changes were noted in the transcriptional expression of genes involved in mitochondrial respiratory chain and ATP synthesis, including cytochrome c oxidase subunit I (COXI), NADH dehydrogenase subunit I (NDI), and ATP synthase F0 subunit 6
International Nuclear Information System (INIS)
Liu Yang; Wang Jianshe; Wei Yanhong; Zhang Hongxia; Xu Muqi; Dai Jiayin
2008-01-01
The effects of acute perfluorododecanoic acid (PFDoA) exposure on the induction of oxidative stress and alteration of mitochondrial gene expression were studied in the livers of female zebrafish (Danio rerio). Female zebrafish were exposed to PFDoA via a single intraperitoneal injection (0, 20, 40, or 80 μg PFDoA/g body weight) and were then sacrificed 48 h, 96 h, or seven days post-PFDoA administration. PFDoA-treated fish exhibited histopathological liver damage, including swollen hepatocytes, vacuolar degeneration, and nuclei pycnosis. Glutathione (GSH) content and catalase (CAT) activity decreased significantly at 48 h post-injection while superoxide dismutase (SOD) activity was initially decreased at 48 h post-injection but was then elevated by seven days post-injection. The activity of glutathione peroxidase (GPx) increased at 48 h and seven days compared to control fish, although the increased level at seven days post-injection was decreased compared to the level at 48 h post-injection. Lipid peroxidation levels were increased at seven days post-injection, while no apparent induction was observed at 48 h or 96 h post-injection. The mRNA expression of medium-chain fatty acid dehydrogenase (MCAD) was induced, while the transcriptional expression of liver fatty acid binding protein (L-FABP), peroxisome proliferating activating receptor α (PPARα), carnitine palmitoyl-transferase I (CPT-I), uncoupling protein 2 (UCP-2), and Bcl-2 were significantly inhibited. Furthermore, the transcriptional expression of peroxisomal fatty acyl-CoA oxidase (ACOX), very long-chain acyl-CoA dehydrogenase (VLCAD), long-chain acyl-CoA dehydrogenase (LCAD) did not exhibit significant changes following PFDoA treatment. No significant changes were noted in the transcriptional expression of genes involved in mitochondrial respiratory chain and ATP synthesis, including cytochrome c oxidase subunit I (COXI), NADH dehydrogenase subunit I (NDI), and ATP synthase F0 subunit 6 (ATPo6). These
International Nuclear Information System (INIS)
Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.
2009-01-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Energy Technology Data Exchange (ETDEWEB)
Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)
2009-07-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization
DEFF Research Database (Denmark)
Prats, Clara; Helge, Jørn W; Nordby, Pernille
2009-01-01
Glycogen synthase (GS) is considered the rate-limiting enzyme in glycogenesis but still today there is a lack of understanding on its regulation. We have previously shown phosphorylation-dependent GS intracellular redistribution at the start of glycogen re-synthesis in rabbit skeletal muscle (Prats......, C., Cadefau, J. A., Cussó, R., Qvortrup, K., Nielsen, J. N., Wojtaszewki, J. F., Wojtaszewki, J. F., Hardie, D. G., Stewart, G., Hansen, B. F., and Ploug, T. (2005) J. Biol. Chem. 280, 23165-23172). In the present study we investigate the regulation of human muscle GS activity by glycogen, exercise......, and insulin. Using immunocytochemistry we investigate the existence and relevance of GS intracellular compartmentalization during exercise and during glycogen re-synthesis. The results show that GS intrinsic activity is strongly dependent on glycogen levels and that such regulation involves associated...
Functions of Ceramide Synthase Paralogs YPR114w and YJR116w of Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Shamroop K Mallela
Full Text Available Ceramide is synthesized in yeast by two redundant acyl-CoA dependent synthases, Lag1 and Lac1. In lag1∆ lac1∆ cells, free fatty acids and sphingoid bases are elevated, and ceramides are produced through the redundant alkaline ceramidases Ypc1 and Ydc1, working backwards. Even with all four of these genes deleted, cells are surviving and continue to contain small amounts of complex sphingolipids. Here we show that these residual sphingolipids are not synthesized by YPR114w or YJR116w, proteins of unknown function showing a high degree of homology to Lag1 and Lac1. Indeed, the hextuple lag1∆ lac1∆ ypc1∆ ydc1∆ ypr114w∆ yjr116w∆ mutant still contains ceramides and complex sphingolipids. Yjr116w∆ exhibit an oxygen-dependent hypersensitivity to Cu2+ due to an increased mitochondrial production of reactive oxygen species (ROS and a mitochondrially orchestrated programmed cell death in presence of copper, but also a general copper hypersensitivity that cannot be counteracted by the antioxidant N-acetyl-cysteine (NAC. Myriocin efficiently represses the synthesis of sphingoid bases of ypr114w∆, but not its growth. Both yjr116w∆ and ypr114w∆ have fragmented vacuoles and produce less ROS than wild type, before and after diauxic shift. Ypr114w∆/ypr114w∆ have an increased chronological life span. Thus, Yjr116w and Ypr114w are related, but not functionally redundant.
Stan-Lotter, Helga; Hochstein, Lawrence I.
1989-01-01
A purified ATPase associated with membranes from Halobacterium saccharovorum was compared with the F sub 1 moiety from the Escherichia coli ATP Synthase. The halobacterial enzyme was composed of two major (I and II) and two minor subunits (III and IV), whose molecular masses were 87 kDa, 60 kDa, 29 kDa, and 20 kDa, respectively. The isoelectric points of these subunits ranged from 4.1 to 4.8, which in the case of the subunits I and II was consistent with the presence of an excess of acidic amino acids (20 to 22 Mol percent). Peptide mapping of sodium dodecylsulfate-denatured subunits I and II showed no relationship between the primary structures of the individual halobacterial subunits or similarities to the subunits of the F sub 1 ATPase (EC 3.6.1.34) from E. coli. Trypsin inactivation of the halobacterial ATPase was accompanied by the partial degradation of the major subunits. This observation, taken in conjunction with molecular masses of the subunits and the native enzyme, was consistent with the previously proposed stoichiometry of 2:2:1:1. These results suggest that H. saccharovorum, and possibly, Halobacteria in general, possess an ATPase which is unlike the ubiquitous F sub o F sub 1 - ATP Synthase.
de Wit, Mieke; Spoel, Steven H; Sanchez-Perez, Gabino F; Gommers, Charlotte M M; Pieterse, Corné M J; Voesenek, Laurentius A C J; Pierik, Ronald
2013-07-01
In dense stands of plants, such as agricultural monocultures, plants are exposed simultaneously to competition for light and other stresses such as pathogen infection. Here, we show that both salicylic acid (SA)-dependent and jasmonic acid (JA)-dependent disease resistance is inhibited by a simultaneously reduced red:far-red light ratio (R:FR), the early warning signal for plant competition. Conversely, SA- and JA-dependent induced defences did not affect shade-avoidance responses to low R:FR. Reduced pathogen resistance by low R:FR was accompanied by a strong reduction in the regulation of JA- and SA-responsive genes. The severe inhibition of SA-responsive transcription in low R:FR appeared to be brought about by the repression of SA-inducible kinases. Phosphorylation of the SA-responsive transcription co-activator NPR1, which is required for full induction of SA-responsive transcription, was indeed reduced and may thus play a role in the suppression of SA-mediated defences by low R:FR-mediated phytochrome inactivation. Our results indicate that foraging for light through the shade-avoidance response is prioritised over plant immune responses when plants are simultaneously challenged with competition and pathogen attack. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Zhang, Ke; Li, Huidong; Chen, Wuxi; Zhao, Minli; Cui, Haiyang; Min, Qingsong; Wang, Haijun; Chen, Shulin; Li, Demao
2017-05-01
Docosapentaenoic acid/docosahexaenoic acid ratio (DPA/DHA ratio) in Schizochytrium was relatively stable. But ideally the ratio of DPA/DHA will vary according to the desired end use. This study reports several ways of modulating the DPA/DHA ratio. Incubation times changed the DPA/DHA ratio, and changes in this ratio were associated with the variations in the saturated fatty acid (SFAs) content. Propionic acid sharply increased the SFAs content in lipids, dramatically decreased the even-chain SFAs content, and reduced the DPA/DHA ratio. Pentanoic acid (C5:0) and heptanoic acid (C7:0) had similar effects as propionic acid, whereas butyric acid (C4:0), hexanoic acid (C6:0), and octanoic acid (C8:0) did not change the fatty acid profile and the DPA/DHA ratio. Transcription analyses show that β-oxidation might be responsible for this phenomenon. Iodoacetamide upregulated polyunsaturated fatty acid (PUFA) synthase genes, reduced the DHA content, and improved the DPA content, causing the DPA/DHA ratio to increase. These results present new insights into the regulation of the DPA/DHA ratio.
Chen, Yang; Jernerén, Fredrik; Oliw, Ernst H
2017-07-01
Plants and fungi form jasmonic acid from α-linolenic acid. The first two steps of biosynthesis in plants occur by sequential transformation by 13S-lipoxygenase and allene oxide synthase (AOS). The biosynthesis in fungi may follow this classical scheme, but the only fungal AOS discovered so far are cytochromes P450 (CYP) fused to 8- and 9-dioxygenases (DOX). In the present report, we purified recombinant 9S-DOX-AOS of Fusarium oxysporum from cell lysate by cobalt affinity chromatography to near homogeneity and studied key residues by site-directed mutagenesis. Sequence homology with 8R-DOX-linoleate diol synthases (8R-DOX-LDS) suggested that Tyr414 catalyzes hydrogen abstraction and that Cys1051 forms the heme thiolate ligand. Site-directed mutagenesis (Tyr414Phe; Cys1051Ser) led to loss of 9S-DOX and 9S-AOS activities, respectively, but other important residues in the CYP parts of 5,8- and 7,8-LDS or 9R-AOS were not conserved. The UV-visible spectrum of 9S-DOX-AOS showed a Soret band at 409 nm, which shifted to 413 nm in the Cys1051Ser mutant. The 9S-AOS of the Tyr414Phe mutant transformed 9S-hydroperoxides of α-linolenic and linoleic acids to allene oxides/α-ketols, but it did not transform 13-hydroperoxides. We conclude that 9S- and 8R-DOX catalyze hydrogen abstraction at C-11 and C-8, respectively, by homologous Tyr residues. Copyright © 2017 Elsevier Inc. All rights reserved.
Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim
2013-07-01
Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.
Ishii, Masakazu; Shibata, Rei; Kondo, Kazuhisa; Kambara, Takahiro; Shimizu, Yuuki; Tanigawa, Tohru; Bando, Yasuko K.; Nishimura, Masahiro; Ouchi, Noriyuki; Murohara, Toyoaki
2014-01-01
Dipeptidyl peptidase-4 inhibitors are known to lower glucose levels and are also beneficial in the management of cardiovascular disease. Here, we investigated whether a dipeptidyl peptidase-4 inhibitor, vildagliptin, modulates endothelial cell network formation and revascularization processes in vitro and in vivo. Treatment with vildagliptin enhanced blood flow recovery and capillary density in the ischemic limbs of wild-type mice, with accompanying increases in phosphorylation of Akt and endothelial nitric-oxide synthase (eNOS). In contrast to wild-type mice, treatment with vildagliptin did not improve blood flow in ischemic muscles of eNOS-deficient mice. Treatment with vildagliptin increased the levels of glucagon-like peptide-1 (GLP-1) and adiponectin, which have protective effects on the vasculature. Both vildagliptin and GLP-1 increased the differentiation of cultured human umbilical vein endothelial cells (HUVECs) into vascular-like structures, although vildagliptin was less effective than GLP-1. GLP-1 and vildagliptin also stimulated the phosphorylation of Akt and eNOS in HUVECs. Pretreatment with a PI3 kinase or NOS inhibitor blocked the stimulatory effects of both vildagliptin and GLP-1 on HUVEC differentiation. Furthermore, treatment with vildagliptin only partially increased the limb flow of ischemic muscle in adiponectin-deficient mice in vivo. GLP-1, but not vildagliptin, significantly increased adiponectin expression in differentiated 3T3-L1 adipocytes in vitro. These data indicate that vildagliptin promotes endothelial cell function via eNOS signaling, an effect that may be mediated by both GLP-1-dependent and GLP-1-independent mechanisms. The beneficial activity of GLP-1 for revascularization may also be partially mediated by its ability to increase adiponectin production. PMID:25100725
Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe
2014-08-01
Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.
Ogawa, Hiroyasu; Hatano, Sonoko; Sugiura, Nobuo; Nagai, Naoko; Sato, Takashi; Shimizu, Katsuji; Kimata, Koji; Narimatsu, Hisashi; Watanabe, Hideto
2012-01-01
Chondroitin sulfate (CS) is a linear polysaccharide consisting of repeating disaccharide units of N-acetyl-D-galactosamine and D-glucuronic acid residues, modified with sulfated residues at various positions. Based on its structural diversity in chain length and sulfation patterns, CS provides specific biological functions in cell adhesion, morphogenesis, neural network formation, and cell division. To date, six glycosyltransferases are known to be involved in the biosynthesis of chondroitin saccharide chains, and a hetero-oligomer complex of chondroitin sulfate synthase-1 (CSS1)/chondroitin synthase-1 and chondroitin sulfate synthase-2 (CSS2)/chondroitin polymerizing factor is known to have the strongest polymerizing activity. Here, we generated and analyzed CSS2(-/-) mice. Although they were viable and fertile, exhibiting no overt morphological abnormalities or osteoarthritis, their cartilage contained CS chains with a shorter length and at a similar number to wild type. Further analysis using CSS2(-/-) chondrocyte culture systems, together with siRNA of CSS1, revealed the presence of two CS chain species in length, suggesting two steps of CS chain polymerization; i.e., elongation from the linkage region up to Mr ∼10,000, and further extension. There, CSS2 mainly participated in the extension, whereas CSS1 participated in both the extension and the initiation. Our study demonstrates the distinct function of CSS1 and CSS2, providing a clue in the elucidation of the mechanism of CS biosynthesis.
International Nuclear Information System (INIS)
Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki
2012-01-01
The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Shinde, Mansi Y.; Sidoli, Simone; Kulej, Katarzyna; Mallory, Michael J.; Radens, Caleb M.; Reicherter, Amanda L.; Myers, Rebecca L.; Barash, Yoseph; Lynch, Kristen W.; Garcia, Benjamin A.; Klein, Peter S.
2017-01-01
Glycogen synthase kinase-3 (GSK-3) is a constitutively active, ubiquitously expressed protein kinase that regulates multiple signaling pathways. In vitro kinase assays and genetic and pharmacological manipulations of GSK-3 have identified more than 100 putative GSK-3 substrates in diverse cell types. Many more have been predicted on the basis of a recurrent GSK-3 consensus motif ((pS/pT)XXX(S/T)), but this prediction has not been tested by analyzing the GSK-3 phosphoproteome. Using stable isotope labeling of amino acids in culture (SILAC) and MS techniques to analyze the repertoire of GSK-3–dependent phosphorylation in mouse embryonic stem cells (ESCs), we found that ∼2.4% of (pS/pT)XXX(S/T) sites are phosphorylated in a GSK-3–dependent manner. A comparison of WT and Gsk3a;Gsk3b knock-out (Gsk3 DKO) ESCs revealed prominent GSK-3–dependent phosphorylation of multiple splicing factors and regulators of RNA biosynthesis as well as proteins that regulate transcription, translation, and cell division. Gsk3 DKO reduced phosphorylation of the splicing factors RBM8A, SRSF9, and PSF as well as the nucleolar proteins NPM1 and PHF6, and recombinant GSK-3β phosphorylated these proteins in vitro. RNA-Seq of WT and Gsk3 DKO ESCs identified ∼190 genes that are alternatively spliced in a GSK-3–dependent manner, supporting a broad role for GSK-3 in regulating alternative splicing. The MS data also identified posttranscriptional regulation of protein abundance by GSK-3, with ∼47 proteins (1.4%) whose levels increased and ∼78 (2.4%) whose levels decreased in the absence of GSK-3. This study provides the first unbiased analysis of the GSK-3 phosphoproteome and strong evidence that GSK-3 broadly regulates alternative splicing. PMID:28916722
DEFF Research Database (Denmark)
Mullaney, Brendan C; Blind, Raymond D; Lemieux, George A
2010-01-01
Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules, and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3...... mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3-derived long-chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine...... program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans....
Kiyota, Hiroshi; Hirai, Masami Yokota; Ikeuchi, Masahiko
2014-06-30
Nutrient balance is important for photosynthetic growth and biomass production in microalgae. Here, we investigated and compared metabolic responses of amino acid pools to nitrogen and sulfur starvation in a unicellular model cyanobacterium, Synechocystis sp. PCC 6803, and its mutant nblA1/A2. It is known that NblA1/A2-dependent and -independent breakdown of abundant photosynthetic phycobiliproteins and other cellular proteins supply nutrients to the organism. However, the contribution of the NblA1/A2-dependent nutrient supply to amino acid pool homeostasis has not been studied. Our study demonstrates that changes in the pool size of many amino acids during nitrogen starvation can be categorized as NblA1/A2-dependent (Gln, Glu, glutathione, Gly, Ile, Leu, Met, Phe, Pro, Ser, Thr, Tyr and Val) and NblA1/A2-independent (Ala, Asn, Lys, and Trp). We also report unique changes in amino acid pool sizes during sulfur starvation in wild type and the mutant and found a generally marked increase in the Lys pool in cyanobacteria during nutrient starvation. In conclusion, the NblA1/A2-dependent protein turnover contributes to the maintenance of many amino acid pools during nitrogen starvation.
Directory of Open Access Journals (Sweden)
Hiroshi Kiyota
2014-06-01
Full Text Available Nutrient balance is important for photosynthetic growth and biomass production in microalgae. Here, we investigated and compared metabolic responses of amino acid pools to nitrogen and sulfur starvation in a unicellular model cyanobacterium, Synechocystis sp. PCC 6803, and its mutant nblA1/A2. It is known that NblA1/A2-dependent and -independent breakdown of abundant photosynthetic phycobiliproteins and other cellular proteins supply nutrients to the organism. However, the contribution of the NblA1/A2-dependent nutrient supply to amino acid pool homeostasis has not been studied. Our study demonstrates that changes in the pool size of many amino acids during nitrogen starvation can be categorized as NblA1/A2-dependent (Gln, Glu, glutathione, Gly, Ile, Leu, Met, Phe, Pro, Ser, Thr, Tyr and Val and NblA1/A2-independent (Ala, Asn, Lys, and Trp. We also report unique changes in amino acid pool sizes during sulfur starvation in wild type and the mutant and found a generally marked increase in the Lys pool in cyanobacteria during nutrient starvation. In conclusion, the NblA1/A2-dependent protein turnover contributes to the maintenance of many amino acid pools during nitrogen starvation.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.