EGVII endoglucanase and nucleic acids encoding the same
Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA
2009-05-05
The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.
BGL6 beta-glucosidase and nucleic acids encoding the same
Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA
2009-09-01
The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
Nucleic acid compositions and the encoding proteins
Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.
2014-09-02
The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
CDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Safford, R.; de Silva, J.; Lucas, C.
1987-01-01
Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH
Polymeric peptide pigments with sequence-encoded properties
Energy Technology Data Exchange (ETDEWEB)
Lampel, Ayala; McPhee, Scott A.; Park, Hang-Ah; Scott, Gary G.; Humagain, Sunita; Hekstra, Doeke R.; Yoo, Barney; Frederix, Pim W. J. M.; Li, Tai-De; Abzalimov, Rinat R.; Greenbaum, Steven G.; Tuttle, Tell; Hu, Chunhua; Bettinger, Christopher J.; Ulijn, Rein V.
2017-06-08
Melanins are a family of heterogeneous polymeric pigments that provide ultraviolet (UV) light protection, structural support, coloration, and free radical scavenging. Formed by oxidative oligomerization of catecholic small molecules, the physical properties of melanins are influenced by covalent and noncovalent disorder. We report the use of tyrosine-containing tripeptides as tunable precursors for polymeric pigments. In these structures, phenols are presented in a (supra-)molecular context dictated by the positions of the amino acids in the peptide sequence. Oxidative polymerization can be tuned in a sequence-dependent manner, resulting in peptide sequence–encoded properties such as UV absorbance, morphology, coloration, and electrochemical properties over a considerable range. Short peptides have low barriers to application and can be easily scaled, suggesting near-term applications in cosmetics and biomedicine.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
2000-07-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Sequence of a cDNA encoding turtle high mobility group 1 protein.
Zheng, Jifang; Hu, Bi; Wu, Duansheng
2005-07-01
In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.
cDNA encoding a polypeptide including a hev ein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)
2000-07-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase
International Nuclear Information System (INIS)
Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.
1987-01-01
A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants
Towards predicting the encoding capability of MR fingerprinting sequences.
Sommer, K; Amthor, T; Doneva, M; Koken, P; Meineke, J; Börnert, P
2017-09-01
Sequence optimization and appropriate sequence selection is still an unmet need in magnetic resonance fingerprinting (MRF). The main challenge in MRF sequence design is the lack of an appropriate measure of the sequence's encoding capability. To find such a measure, three different candidates for judging the encoding capability have been investigated: local and global dot-product-based measures judging dictionary entry similarity as well as a Monte Carlo method that evaluates the noise propagation properties of an MRF sequence. Consistency of these measures for different sequence lengths as well as the capability to predict actual sequence performance in both phantom and in vivo measurements was analyzed. While the dot-product-based measures yielded inconsistent results for different sequence lengths, the Monte Carlo method was in a good agreement with phantom experiments. In particular, the Monte Carlo method could accurately predict the performance of different flip angle patterns in actual measurements. The proposed Monte Carlo method provides an appropriate measure of MRF sequence encoding capability and may be used for sequence optimization. Copyright © 2017 Elsevier Inc. All rights reserved.
Sequence-to-Sequence Prediction of Vehicle Trajectory via LSTM Encoder-Decoder Architecture
Park, Seong Hyeon; Kim, ByeongDo; Kang, Chang Mook; Chung, Chung Choo; Choi, Jun Won
2018-01-01
In this paper, we propose a deep learning based vehicle trajectory prediction technique which can generate the future trajectory sequence of surrounding vehicles in real time. We employ the encoder-decoder architecture which analyzes the pattern underlying in the past trajectory using the long short-term memory (LSTM) based encoder and generates the future trajectory sequence using the LSTM based decoder. This structure produces the $K$ most likely trajectory candidates over occupancy grid ma...
Sequence of a cloned cDNA encoding human ribosomal protein S11
Energy Technology Data Exchange (ETDEWEB)
Lott, J B; Mackie, G A
1988-02-11
The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
Toward a Better Compression for DNA Sequences Using Huffman Encoding.
Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi
2017-04-01
Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).
Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin
2008-11-04
We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.
International Nuclear Information System (INIS)
Harper, J.F.; Surowy, T.K.; Sussman, M.R.
1989-01-01
In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
International Nuclear Information System (INIS)
Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.
1987-01-01
cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells
Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes
International Nuclear Information System (INIS)
Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.
1988-01-01
Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity
Energy Technology Data Exchange (ETDEWEB)
Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.
2017-08-15
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E
2013-07-23
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Energy Technology Data Exchange (ETDEWEB)
Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.
2016-03-22
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids
Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James
2015-01-01
Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223
Extraordinarily adaptive properties of the genetically encoded amino acids.
Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H James
2015-03-24
Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or "chemistry space." Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.
Directory of Open Access Journals (Sweden)
Sasmita Barik
2014-01-01
Full Text Available Conglutinin, a collagenous C-type lectin, acts as soluble pattern recognition receptor (PRR in recognition of pathogens. In the present study, genes encoding neck and carbohydrate recognition domain (NCRD of conglutinin in goat and blackbuck were amplified, cloned, and sequenced. The obtained 488 bp ORFs encoding NCRD were submitted to NCBI with accession numbers KC505182 and KC505183. Both nucleotide and predicted amino acid sequences were analysed with sequences of other ruminants retrieved from NCBI GenBank using DNAstar and Megalign5.2 software. Sequence analysis revealed maximum similarity of blackbuck sequence with wild ruminants like nilgai and buffalo, whereas goat sequence displayed maximum similarity with sheep sequence at both nucleotide and amino acid level. Phylogenetic analysis further indicated clear divergence of wild ruminants from the domestic ruminants in separate clusters. The predicted secondary structures of NCRD protein in goat and blackbuck using SWISSMODEL ProtParam online software were found to possess 6 beta-sheets and 3 alpha-helices which are identical to the result obtained in case of sheep, cattle, buffalo, and nilgai. However, quaternary structure in goat, sheep, and cattle was found to differ from that of buffalo, nilgai, and blackbuck, suggesting a probable variation in the efficiency of antimicrobial activity among wild and domestic ruminants.
Freimuth, Paul I.
2010-04-06
The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.
Molecular mechanisms for protein-encoded inheritance
Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David
2013-01-01
Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598
Energy Technology Data Exchange (ETDEWEB)
Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.
1981-09-01
The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.
International Nuclear Information System (INIS)
Dinur, T.; Osiecki, K.M.; Legler, G.; Gatt, S.; Desnick, R.J.; Grabowski, G.A.
1986-01-01
Human acid β-glucosidase (D-glucosyl-N-acylsphingosine glucohydrolase, EC 3.2.1.45) cleaves the glucosidic bonds of glucosylceramide and synthetic β-glucosides. The deficient activity of this hydrolase is the enzymatic defect in the subtypes and variants of Gaucher disease, the most prevalent lysosomal storage disease. To isolate and characterize the catalytic site of the normal enzyme, brominated 3 H-labeled conduritol B epoxide ( 3 H-Br-CBE), which inhibits the enzyme by binding covalently to this site, was used as an affinity label. Under optimal conditions 1 mol of 3 H-Br-CBE bound to 1 mol of pure enzyme protein, indicating the presence of a single catalytic site per enzyme subunit. After V 8 protease digestion of the 3 H-Br-CBE-labeled homogeneous enzyme, three radiolabeled peptides, designated peptide A, B, or C, were resolved by reverse-phase HPLC. The partial amino acid sequence (37 residues) of peptide A (M/sub r/, 5000) was determined. The sequence of this peptide, which contained the catalytic site, had exact homology to the sequence near the carboxyl terminus of the protein, as predicted from the nucleotide sequence of the full-length cDNA encoding acid β-glucosidase
Plasmid-encoded diacetyl (acetoin) reductase in Leuconostoc pseudomesenteroides
DEFF Research Database (Denmark)
Rattray, Fergal P; Myling-Petersen, Dorte; Larsen, Dianna
2003-01-01
A plasmid-borne diacetyl (acetoin) reductase (butA) from Leuconostoc pseudomesenteroides CHCC2114 was sequenced and cloned. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 257 amino acids which had high identity at the amino acid level to diacetyl (acetoin...
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming
2012-04-01
The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.
Cloning, sequencing and expression of cDNA encoding growth ...
Indian Academy of Sciences (India)
Unknown
of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.
Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques
2016-05-01
To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.
Soybean phytase and nucleic acid encoding the same
1999-01-01
Isolated soybean phytase polypeptides and isolated nucleic acids encoding soybean phytases are provided. The invention is also directed to nucleic acid expression constructs, vectors, and host cells comprising the isolated soybean phytase nucleic acids, as well as methods for producing recombinant and non-recombinant purified soybean phytase. The invention also relates to transgenic plants expressing the soybean phytase, particularly expression under seed-specific expression control elements.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...
International Nuclear Information System (INIS)
Lee, C.C.; Bowman, B.H.; Yang, F.
1987-01-01
The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-01-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-04-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Haynes, Barton F [Durham, NC; Gao, Feng [Durham, NC; Korber, Bette T [Los Alamos, NM; Hahn, Beatrice H [Birmingham, AL; Shaw, George M [Birmingham, AL; Kothe, Denise [Birmingham, AL; Li, Ying Ying [Hoover, AL; Decker, Julie [Alabaster, AL; Liao, Hua-Xin [Chapel Hill, NC
2011-12-06
The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.
Dynamic encoding of speech sequence probability in human temporal cortex.
Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F
2015-05-06
Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.
The cDNA sequence of a neutral horseradish peroxidase.
Bartonek-Roxå, E; Eriksson, H; Mattiasson, B
1991-02-16
A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.
International Nuclear Information System (INIS)
Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.
1991-01-01
The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression
Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K
1986-01-01
Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...
A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.
Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C
2008-12-01
A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Directory of Open Access Journals (Sweden)
Suomeng Dong
Full Text Available Root and stem rot disease of soybean is caused by the oomycete Phytophthora sojae. The avirulence (Avr genes of P. sojae control race-cultivar compatibility. In this study, we identify the P. sojae Avr3c gene and show that it encodes a predicted RXLR effector protein of 220 amino acids. Sequence and transcriptional data were compared for predicted RXLR effectors occurring in the vicinity of Avr4/6, as genetic linkage of Avr3c and Avr4/6 was previously suggested. Mapping of DNA markers in a F(2 population was performed to determine whether selected RXLR effector genes co-segregate with the Avr3c phenotype. The results pointed to one RXLR candidate gene as likely to encode Avr3c. This was verified by testing selected genes by a co-bombardment assay on soybean plants with Rps3c, thus demonstrating functionality and confirming the identity of Avr3c. The Avr3c gene together with eight other predicted genes are part of a repetitive segment of 33.7 kb. Three near-identical copies of this segment occur in a tandem array. In P. sojae strain P6497, two identical copies of Avr3c occur within the repeated segments whereas the third copy of this RXLR effector has diverged in sequence. The Avr3c gene is expressed during the early stages of infection in all P. sojae strains examined. Virulent alleles of Avr3c that differ in amino acid sequence were identified in other strains of P. sojae. Gain of virulence was acquired through mutation and subsequent sequence exchanges between the two copies of Avr3c. The results illustrate the importance of segmental duplications and RXLR effector evolution in the control of race-cultivar compatibility in the P. sojae and soybean interaction.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Directory of Open Access Journals (Sweden)
Xu Wanhong
2008-12-01
Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV
The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase
Directory of Open Access Journals (Sweden)
Santos Diógenes S
2008-04-01
Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Nonlinear analysis of sequence repeats of multi-domain proteins
Energy Technology Data Exchange (ETDEWEB)
Huang Yanzhao [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Li Mingfeng [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Xiao Yi [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China)]. E-mail: lmf_bill@sina.com
2007-11-15
Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences.
Directory of Open Access Journals (Sweden)
Lior Levy
2017-10-01
Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.
Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers
Directory of Open Access Journals (Sweden)
Pattana Srifah Huehne
2013-08-01
Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them
Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika
2007-03-13
The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).
Langner, Robert; Sternkopf, Melanie A; Kellermann, Tanja S; Grefkes, Christian; Kurth, Florian; Schneider, Frank; Zilles, Karl; Eickhoff, Simon B
2014-07-01
The neurobiological organization of action-oriented working memory is not well understood. To elucidate the neural correlates of translating visuo-spatial stimulus sequences into delayed (memory-guided) sequential actions, we measured brain activity using functional magnetic resonance imaging while participants encoded sequences of four to seven dots appearing on fingers of a left or right schematic hand. After variable delays, sequences were to be reproduced with the corresponding fingers. Recall became less accurate with longer sequences and was initiated faster after long delays. Across both hands, encoding and recall activated bilateral prefrontal, premotor, superior and inferior parietal regions as well as the basal ganglia, whereas hand-specific activity was found (albeit to a lesser degree during encoding) in contralateral premotor, sensorimotor, and superior parietal cortex. Activation differences after long versus short delays were restricted to motor-related regions, indicating that rehearsal during long delays might have facilitated the conversion of the memorandum into concrete motor programs at recall. Furthermore, basal ganglia activity during encoding selectively predicted correct recall. Taken together, the results suggest that to-be-reproduced visuo-spatial sequences are encoded as prospective action representations (motor intentions), possibly in addition to retrospective sensory codes. Overall, our study supports and extends multi-component models of working memory, highlighting the notion that sensory input can be coded in multiple ways depending on what the memorandum is to be used for. Copyright © 2013 Wiley Periodicals, Inc.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
International Nuclear Information System (INIS)
Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong
1989-01-01
A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Sequence variations in the FAD2 gene in seeded pumpkins.
Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P
2015-12-21
Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Barras, F; Chatterjee, A K
1987-10-01
In Erwinia chrysanthemi (EC16) the clustered pelA and pelE genes encode an acidic (pI 4.2) and a basic (pI 10.0) pectate lyase (Pel), respectively. The pelA gene has been isolated on a 1.2 kb restriction fragment and the direction of transcription determined. DNA hybridization analysis showed that the pelE sequence shares DNA homology with pelA but not with pelB or pelC, two genes encoding other Pel species in EC16. Since Pel A and Pel E enzymes showed little similarity in terms of catalytic properties, it is proposed that pelA and pelE are duplicates which have highly diverged.
Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease
International Nuclear Information System (INIS)
Szopa, J.
1995-01-01
The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs
Detection of nucleic acid sequences by invader-directed cleavage
Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert
1999-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.
Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H
1995-01-01
Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Pau, S; Jahn, G; Sakreida, K; Domin, M; Lotze, M
2013-01-01
Long-term intensive sensorimotor training alters functional representation of the motor and sensory system and might even result in structural changes. However, there is not much knowledge about how previous training impacts learning transfer and functional representation. We tested 14 amateur pianists and 15 musically naïve participants in a short-term finger sequence training procedure, differing considerably from piano playing and measured associated functional representation with functional magnetic resonance imaging. The conditions consisted of encoding a finger sequence indicated by hand symbols ("sequence encoding") and subsequently replaying the sequence from memory, both with and without auditory feedback ("sequence retrieval"). Piano players activated motor areas and the mirror neuron system more strongly than musically naïve participants during encoding. When retrieving the sequence, musically naïve participants showed higher activation in similar brain areas. Thus, retrieval activations of naïve participants were comparable to encoding activations of piano players, who during retrieval performed the sequences more accurately despite lower motor activations. Interestingly, both groups showed primary auditory activation even during sequence retrieval without auditory feedback, supporting previous reports about coactivation of the auditory cortex after learned association with motor performance. When playing with auditory feedback, only pianists lateralized to the left auditory cortex. During encoding activation in left primary somatosensory cortex in the height of the finger representations had a predictive value for increased motor performance later on (error rates). Contrarily, decreased performance was associated with increased visual cortex activation during encoding. Our study extends previous reports about training transfer of motor knowledge resulting in superior training effects in musicians. Performance increase went along with activity in
International Nuclear Information System (INIS)
Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo
1988-01-01
Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged
Directory of Open Access Journals (Sweden)
S. S. Hasson
2010-01-01
Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.
Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I
2000-05-01
L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
Zimmermann, Karel; Gibrat, Jean-François
2010-01-04
Sequence comparisons make use of a one-letter representation for amino acids, the necessary quantitative information being supplied by the substitution matrices. This paper deals with the problem of finding a representation that provides a comprehensive description of amino acid intrinsic properties consistent with the substitution matrices. We present a Euclidian vector representation of the amino acids, obtained by the singular value decomposition of the substitution matrices. The substitution matrix entries correspond to the dot product of amino acid vectors. We apply this vector encoding to the study of the relative importance of various amino acid physicochemical properties upon the substitution matrices. We also characterize and compare the PAM and BLOSUM series substitution matrices. This vector encoding introduces a Euclidian metric in the amino acid space, consistent with substitution matrices. Such a numerical description of the amino acid is useful when intrinsic properties of amino acids are necessary, for instance, building sequence profiles or finding consensus sequences, using machine learning algorithms such as Support Vector Machine and Neural Networks algorithms.
Directory of Open Access Journals (Sweden)
Zimmermann Karel
2010-01-01
Full Text Available Abstract Background Sequence comparisons make use of a one-letter representation for amino acids, the necessary quantitative information being supplied by the substitution matrices. This paper deals with the problem of finding a representation that provides a comprehensive description of amino acid intrinsic properties consistent with the substitution matrices. Results We present a Euclidian vector representation of the amino acids, obtained by the singular value decomposition of the substitution matrices. The substitution matrix entries correspond to the dot product of amino acid vectors. We apply this vector encoding to the study of the relative importance of various amino acid physicochemical properties upon the substitution matrices. We also characterize and compare the PAM and BLOSUM series substitution matrices. Conclusions This vector encoding introduces a Euclidian metric in the amino acid space, consistent with substitution matrices. Such a numerical description of the amino acid is useful when intrinsic properties of amino acids are necessary, for instance, building sequence profiles or finding consensus sequences, using machine learning algorithms such as Support Vector Machine and Neural Networks algorithms.
Directory of Open Access Journals (Sweden)
Zhou Yuan Wu
2013-07-01
Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.
SCALCE: boosting sequence compression algorithms using locally consistent encoding.
Hach, Faraz; Numanagic, Ibrahim; Alkan, Can; Sahinalp, S Cenk
2012-12-01
provides up to 2.01 times better compression while improving the running time by a factor of 5.17. SCALCE also provides the option to compress the quality scores as well as the read names, in addition to the reads themselves. This is achieved by compressing the quality scores through order-3 Arithmetic Coding (AC) and the read names through gzip through the reordering SCALCE provides on the reads. This way, in comparison with gzip compression of the unordered FASTQ files (including reads, read names and quality scores), SCALCE (together with gzip and arithmetic encoding) can provide up to 3.34 improvement in the compression rate and 1.26 improvement in running time. Our algorithm, SCALCE (Sequence Compression Algorithm using Locally Consistent Encoding), is implemented in C++ with both gzip and bzip2 compression options. It also supports multithreading when gzip option is selected, and the pigz binary is available. It is available at http://scalce.sourceforge.net. fhach@cs.sfu.ca or cenk@cs.sfu.ca Supplementary data are available at Bioinformatics online.
Wang, S Y; Gudas, L J
1990-09-15
We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
International Nuclear Information System (INIS)
Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.
1989-01-01
Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin
Li, Yushuang; Song, Tian; Yang, Jiasheng; Zhang, Yi; Yang, Jialiang
2016-01-01
In this paper, we have proposed a novel alignment-free method for comparing the similarity of protein sequences. We first encode a protein sequence into a 440 dimensional feature vector consisting of a 400 dimensional Pseudo-Markov transition probability vector among the 20 amino acids, a 20 dimensional content ratio vector, and a 20 dimensional position ratio vector of the amino acids in the sequence. By evaluating the Euclidean distances among the representing vectors, we compare the similarity of protein sequences. We then apply this method into the ND5 dataset consisting of the ND5 protein sequences of 9 species, and the F10 and G11 datasets representing two of the xylanases containing glycoside hydrolase families, i.e., families 10 and 11. As a result, our method achieves a correlation coefficient of 0.962 with the canonical protein sequence aligner ClustalW in the ND5 dataset, much higher than those of other 5 popular alignment-free methods. In addition, we successfully separate the xylanases sequences in the F10 family and the G11 family and illustrate that the F10 family is more heat stable than the G11 family, consistent with a few previous studies. Moreover, we prove mathematically an identity equation involving the Pseudo-Markov transition probability vector and the amino acids content ratio vector.
Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.
Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G
2002-11-01
The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Anastasiia Kovaliova
2017-03-01
Full Text Available Here we report the draft genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia. The draft genome has a size of 4.9 Mb and encodes multiple K+-transporters and proton-consuming decarboxylases. The phylogenetic analysis based on concatenated ribosomal proteins revealed that strain DV clusters together with the acid-tolerant Desulfovibrio sp. TomC and Desulfovibrio magneticus. The draft genome sequence and annotation have been deposited at GenBank under the accession number MLBG00000000.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
International Nuclear Information System (INIS)
Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.
1988-01-01
Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease
Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene
International Nuclear Information System (INIS)
Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.
1990-01-01
An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations
International Nuclear Information System (INIS)
Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.
1991-01-01
The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids
International Nuclear Information System (INIS)
Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.
1990-01-01
The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
International Nuclear Information System (INIS)
Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.
1988-01-01
A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint
2004-02-01
Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.
Shen, Ping; Fan, Jianzhong; Guo, Lihua; Li, Jiahua; Li, Ang; Zhang, Jing; Ying, Chaoqun; Ji, Jinru; Xu, Hao; Zheng, Beiwen; Xiao, Yonghong
2017-05-12
Shigellosis is the most common cause of gastrointestinal infections in developing countries. In China, the species most frequently responsible for shigellosis is Shigella flexneri. S. flexneri remains largely unexplored from a genomic standpoint and is still described using a vocabulary based on biochemical and serological properties. Moreover, increasing numbers of ESBL-producing Shigella strains have been isolated from clinical samples. Despite this, only a few cases of ESBL-producing Shigella have been described in China. Therefore, a better understanding of ESBL-producing Shigella from a genomic standpoint is required. In this study, a S. flexneri type 1a isolate SP1 harboring bla CTX-M-14 , which was recovered from the patient with diarrhea, was subjected to whole genome sequencing. The draft genome assembly of S. flexneri strain SP1 consisted of 4,592,345 bp with a G+C content of 50.46%. RAST analysis revealed the genome contained 4798 coding sequences (CDSs) and 100 RNA-encoding genes. We detected one incomplete prophage and six candidate CRISPR loci in the genome. In vitro antimicrobial susceptibility testing demonstrated that strain SP1 is resistant to ampicillin, amoxicillin/clavulanic acid, cefazolin, ceftriaxone and trimethoprim. In silico analysis detected genes mediating resistance to aminoglycosides, β-lactams, phenicol, tetracycline, sulphonamides, and trimethoprim. The bla CTX-M-14 gene was located on an IncFII2 plasmid. A series of virulence factors were identified in the genome. In this study, we report the whole genome sequence of a bla CTX-M-14 -encoding S. flexneri strain SP1. Dozens of resistance determinants were detected in the genome and may be responsible for the multidrug-resistance of this strain, although further confirmation studies are warranted. Numerous virulence factors identified in the strain suggest that isolate SP1 is potential pathogenic. The availability of the genome sequence and comparative analysis with other S
Gillner, Danuta M.; Bienvenue, David L.; Nocek, Boguslaw P.; Joachimiak, Andrzej; Zachary, Vincentos; Bennett, Brian; Holz, Richard C.
2008-01-01
The catalytic and structural properties of the H67A and H349A altered dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) from H. influenzae were investigated. Based on sequence alignment with CPG2 both H67 and H349 were predicted to be Zn(II) ligands. Catalytic activity was observed for the H67A altered DapE enzyme which exhibited kcat = 1.5 ± 0.5 sec−1 and Km = 1.4 ± 0.3 mM. No catalytic activity was observed for H349A under the experimental conditions used. The EPR and ele...
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W
1991-05-01
Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616.
Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N
2001-01-01
A gene (pel1) encoding pectin lyase (Pel1) was isolated from a shoyu koji mold, Aspergillus oryzae KBN616, and characterized. The structural gene comprised 1,196 bp with a single intron. The ORF encoded 381 amino acids with a signal peptide of 20 amino acids. The deduced amino acid sequence showed high similarity to those of Aspergillus niger pectin lyases and Glomerella cingulata PnlA. The pel1 gene was successfully overexpressed under the promoter of the A. oryzae TEF1 gene. The molecular mass of the recombinant pectin lyase substantially coincided with that calculated based on nucleotide sequence.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
ADS genes for reducing saturated fatty acid levels in seed oils
Heilmann, Ingo H.; Shanklin, John
2010-02-02
The present invention relates to enzymes involved in lipid metabolism. In particular, the present invention provides coding sequences for Arabidopsis Desaturases (ADS), the encoded ADS polypeptides, and methods for using the sequences and encoded polypeptides, where such methods include decreasing and increasing saturated fatty acid content in plant seed oils.
Sugarcane expressed sequences tags (ESTs encoding enzymes involved in lignin biosynthesis pathways
Directory of Open Access Journals (Sweden)
Ramos Rose Lucia Braz
2001-01-01
Full Text Available Lignins are phenolic polymers found in the secondary wall of plant conductive systems where they play an important role by reducing the permeability of the cell wall to water. Lignins are also responsible for the rigidity of the cell wall and are involved in mechanisms of resistance to pathogens. The metabolic routes and enzymes involved in synthesis of lignins have been largely characterized and representative genes that encode enzymes involved in these processes have been cloned from several plant species. The synthesis of lignins is liked to the general metabolism of the phenylpropanoids in plants, having enzymes (e.g. phenylalanine ammonia-lyase (PAL, cinnamate 4-hydroxylase (C4H and caffeic acid O-methyltransferase (COMT common to other processes as well as specific enzymes such as cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. Some maize and sorghum mutants, shown to have defective in CAD and/or COMT activity, are easier to digest because they have a reduced lignin content, something which has motivated different research groups to alter the lignin content and composition of model plants by genetic engineering try to improve, for example, the efficiency of paper pulping and digestibility. In the work reported in this paper, we have made an inventory of the sugarcane expressed sequence tag (EST coding for enzymes involved in lignin metabolism which are present in the sugarcane EST genome project (SUCEST database. Our analysis focused on the key enzymes ferulate-5-hydroxylase (F5H, caffeic acid O-methyltransferase (COMT, caffeoyl CoA O-methyltransferase (CCoAOMT, hydroxycinnamate CoA ligase (4CL, cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. The comparative analysis of these genes with those described in other species could be used as molecular markers for breeding as well as for the manipulation of lignin metabolism in sugarcane.
Hybridization and sequencing of nucleic acids using base pair mismatches
Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua
2001-01-01
Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.
Dunham, S P; Onions, D E
2001-06-21
A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Optimization of short amino acid sequences classifier
Barcz, Aleksy; Szymański, Zbigniew
This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.
International Nuclear Information System (INIS)
Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.
1990-01-01
Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human
Evidence for Human Fronto-Central Gamma Activity during Long-Term Memory Encoding of Word Sequences
Meeuwissen, Esther Berendina; Takashima, Atsuko; Fernández, Guillén; Jensen, Ole
2011-01-01
Although human gamma activity (30–80 Hz) associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM) formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM) maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG) we identified significant differences in the gamma and beta activity. Robust gamma activity (55–65 Hz) in left BA6 (supplementary motor area (SMA)/pre-SMA) was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions. PMID:21738641
Evidence for human fronto-central gamma activity during long-term memory encoding of word sequences.
Directory of Open Access Journals (Sweden)
Esther Berendina Meeuwissen
Full Text Available Although human gamma activity (30-80 Hz associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG we identified significant differences in the gamma and beta activity. Robust gamma activity (55-65 Hz in left BA6 (supplementary motor area (SMA/pre-SMA was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions.
Complete cDNA sequence coding for human docking protein
Energy Technology Data Exchange (ETDEWEB)
Hortsch, M; Labeit, S; Meyer, D I
1988-01-11
Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.
Ferry, Alissa L.; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques
2016-01-01
To understand language, humans must encode information from rapid, sequential streams of syllables--tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences.…
Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes
International Nuclear Information System (INIS)
Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.
1988-01-01
The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients
Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays
DEFF Research Database (Denmark)
Dobrowolska, G; Boldyreff, B; Issinger, O G
1991-01-01
The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....
DEFF Research Database (Denmark)
van der Ploeg, J; Van Hall, Gerrit; Janssen, D B
1991-01-01
B) was cloned and could be allocated to a 6.5-kb EcoRI-BglII fragment. Part of this fragment was sequenced, and the dhlB open reading frame was identified by comparison with the N-terminal amino acid sequence of the protein. The gene was found to encode a protein of 27,433 Da that showed considerable homology...... chromatography. The enzyme was active with 2-halogenated carboxylic acids and converted only the L-isomer of 2-chloropropionic acid with inversion of configuration to produce D-lactate. The activity of the enzyme was not readily influenced by thiol reagents. The gene encoding the haloacid dehalogenase (dhl...... (60.5 and 61.0% similarity) with the two other haloacid dehalogenases sequenced to date but not with the haloalkane dehalogenase from X. autotrophicus GJ10....
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A
2012-09-01
The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
Beliaev, A S; Saffarini, D A
1998-12-01
Iron and manganese oxides or oxyhydroxides are abundant transition metals, and in aquatic environments they serve as terminal electron acceptors for a large number of bacterial species. The molecular mechanisms of anaerobic metal reduction, however, are not understood. Shewanella putrefaciens is a facultative anaerobe that uses Fe(III) and Mn(IV) as terminal electron acceptors during anaerobic respiration. Transposon mutagenesis was used to generate mutants of S. putrefaciens, and one such mutant, SR-21, was analyzed in detail. Growth and enzyme assays indicated that the mutation in SR-21 resulted in loss of Fe(III) and Mn(IV) reduction but did not affect its ability to reduce other electron acceptors used by the wild type. This deficiency was due to Tn5 inactivation of an open reading frame (ORF) designated mtrB. mtrB encodes a protein of 679 amino acids and contains a signal sequence characteristic of secreted proteins. Analysis of membrane fractions of the mutant, SR-21, and wild-type cells indicated that MtrB is located on the outer membrane of S. putrefaciens. A 5.2-kb DNA fragment that contains mtrB was isolated and completely sequenced. A second ORF, designated mtrA, was found directly upstream of mtrB. The two ORFs appear to be arranged in an operon. mtrA encodes a putative 10-heme c-type cytochrome of 333 amino acids. The N-terminal sequence of MtrA contains a potential signal sequence for secretion across the cell membrane. The amino acid sequence of MtrA exhibited 34% identity to NrfB from Escherichia coli, which is involved in formate-dependent nitrite reduction. To our knowledge, this is the first report of genes encoding proteins involved in metal reduction.
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
cDNA sequences of two inducible T-cell genes
Energy Technology Data Exchange (ETDEWEB)
Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))
1989-03-01
The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.
Cheng, Ryan; Morcos, Faruck; Levine, Herbert; Onuchic, Jose
2014-03-01
An important challenge in biology is to distinguish the subset of residues that allow bacterial two-component signaling (TCS) proteins to preferentially interact with their correct TCS partner such that they can bind and transfer signal. Detailed knowledge of this information would allow one to search sequence-space for mutations that can systematically tune the signal transmission between TCS partners as well as re-encode a TCS protein to preferentially transfer signals to a non-partner. Motivated by the notion that this detailed information is found in sequence data, we explore the mutual sequence co-evolution between signaling partners to infer how mutations can positively or negatively alter their interaction. Using Direct Coupling Analysis (DCA) for determining evolutionarily conserved interprotein interactions, we apply a DCA-based metric to quantify mutational changes in the interaction between TCS proteins and demonstrate that it accurately correlates with experimental mutagenesis studies probing the mutational change in the in vitro phosphotransfer. Our methodology serves as a potential framework for the rational design of TCS systems as well as a framework for the system-level study of protein-protein interactions in sequence-rich systems. This research has been supported by the NSF INSPIRE award MCB-1241332 and by the CTBP sponsored by the NSF (Grant PHY-1308264).
MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES
Geertsma, Eric Robin; Poolman, Berend
2008-01-01
The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,
Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M
1996-01-01
A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high
Complete genome sequence of pronghorn virus, a pestivirus
The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Nielsen, Morten
2012-01-01
Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Hussain, Shahid M; De Becker, Jan; Hop, Wim C J; Dwarkasing, Soendersing; Wielopolski, Piotr A
2005-03-01
To optimize and assess the feasibility of a single-shot black-blood T2-weighted spin-echo echo-planar imaging (SSBB-EPI) sequence for MRI of the liver using sensitivity encoding (SENSE), and compare the results with those obtained with a T2-weighted turbo spin-echo (TSE) sequence. Six volunteers and 16 patients were scanned at 1.5T (Philips Intera). In the volunteer study, we optimized the SSBB-EPI sequence by interactively changing the parameters (i.e., the resolution, echo time (TE), diffusion weighting with low b-values, and polarity of the phase-encoding gradient) with regard to distortion, suppression of the blood signal, and sensitivity to motion. The influence of each change was assessed. The optimized SSBB-EPI sequence was applied in patients (N = 16). A number of items, including the overall image quality (on a scale of 1-5), were used for graded evaluation. In addition, the signal-to-noise ratio (SNR) of the liver was calculated. Statistical analysis was carried out with the use of Wilcoxon's signed rank test for comparison of the SSBB-EPI and TSE sequences, with P = 0.05 considered the limit for significance. The SSBB-EPI sequence was improved by the following steps: 1) less frequency points than phase-encoding steps, 2) a b-factor of 20, and 3) a reversed polarity of the phase-encoding gradient. In patients, the mean overall image quality score for the optimized SSBB-EPI (3.5 (range: 1-4)) and TSE (3.6 (range: 3-4)), and the SNR of the liver on SSBB-EPI (mean +/- SD = 7.6 +/- 4.0) and TSE (8.9 +/- 4.6) were not significantly different (P > .05). Optimized SSBB-EPI with SENSE proved to be feasible in patients, and the overall image quality and SNR of the liver were comparable to those achieved with the standard respiratory-triggered T2-weighted TSE sequence. (c) 2005 Wiley-Liss, Inc.
Isolation and sequence analysis of a cDNA clone encoding the fifth complement component
DEFF Research Database (Denmark)
Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten
1985-01-01
DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...
International Nuclear Information System (INIS)
Oosterom-Dragon, E.A.; Anderson, C.W.
1983-01-01
Radiochemical microsequence analysis of selected tryptic peptides of the adenovirus type 2 33K nonstructural protein has revealed the precise region of the genomic nucleotide sequence that encodes this protein. The initiation codon for the 33K protein lies 606 nucleotides to the right of the EcoRI restriction site at 70.7 map units and 281 nucleotides to the left of the postulated carboxyterminal codon of the adenovirus 100K protein. The coding regions for these two proteins thus overlap; however, the 33K protein is derived from the +1 frame with respect to the postulated 100K reading frame. Our results contradict an earlier published report suggesting that these two proteins share extensive amino acid sequence homology. The published nucleotide sequence of the Ad2 EcoRI-F fragment (70.7 to 75.9 map units) cannot accomodate in a single reading frame the peptide sequences of the 33K protein that we have determined. Sequence analysis of DNA fragments derived from virus has confirmed the published nucleotide sequence in all critical regions with respect to the coding region for the 33K protein. Consequently, our data are only consistent with the existence of an mRNA splice within the coding for 33K. Consensus donor and acceptor splice sequences have been located that would predict the removal of 202 nucleotides from the transcripts for the 33K protein. Removal of these nucleotides would explain the structure of a peptide that cannot otherwise be directly encoded by the EcoRI-F fragment. Identification of the precise splice points by peptide sequencing has permitted a prediction of the complete amino acid sequence for the 33K protein
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Joosten, H.J.; Han, Y.; Niu, W.; Vervoort, J.J.M.; Dunaway-Mariano, D.; Schaap, P.J.
2008-01-01
Aspergillus niger produces oxalic acid through the hydrolysis of oxaloacetate, catalyzed by the cytoplasmic enzyme oxaloacetate acetylhydrolase (OAH). The A. niger genome encodes four additional open reading frames with strong sequence similarity to OAH yet only the oahA gene encodes OAH activity.
Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.
Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S
1985-07-01
The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
de Vries, R P; Poulsen, C H; Madrid, S; Visser, J
1998-01-01
An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.
de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap
1998-01-01
An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512
Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P
1994-07-08
The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family
Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay
2011-09-01
Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.
Ficarelli, A; Tassi, F; Restivo, F M
1999-03-01
We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.
Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki
2007-01-01
Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-gluta...
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Recent advances in nanopore-based nucleic acid analysis and sequencing
International Nuclear Information System (INIS)
Shi, Jidong; Fang, Ying; Hou, Junfeng
2016-01-01
Nanopore-based sequencing platforms are transforming the field of genomic science. This review (containing 116 references) highlights some recent progress on nanopore-based nucleic acid analysis and sequencing. These studies are classified into three categories, biological, solid-state, and hybrid nanopores, according to their nanoporous materials. We begin with a brief description of the translocation-based detection mechanism of nanopores. Next, specific examples are given in nanopore-based nucleic acid analysis and sequencing, with an emphasis on identifying strategies that can improve the resolution of nanopores. This review concludes with a discussion of future research directions that will advance the practical applications of nanopore technology. (author)
Gentil, Coline A; Gammill, Hilary S; Luu, Christine T; Mayes, Maureen D; Furst, Dan E; Nelson, J Lee
2017-03-07
Specific HLA class II alleles are associated with systemic sclerosis (SSc) risk, clinical characteristics, and autoantibodies. HLA nomenclature initially developed with antibodies as typing reagents defining DRB1 allele groups. However, alleles from different DRB1 allele groups encode the same third hypervariable region (3rd HVR) sequence, the primary T-cell recognition site, and 3rd HVR charge differences can affect interactions with T cells. We considered 3rd HVR sequences (amino acids 67-74) irrespective of the allele group and analyzed parental inheritance considered according to the 3rd HVR charge, comparing SSc patients with controls. In total, 306 families (121 SSc and 185 controls) were HLA genotyped and parental HLA-haplotype origin was determined. Analysis was conducted according to DRβ1 3rd HVR sequence, charge, and parental inheritance. The distribution of 3rd HVR sequences differed in SSc patients versus controls (p = 0.007), primarily due to an increase of specific DRB1*11 alleles, in accord with previous observations. The 3rd HVR sequences were next analyzed according to charge and parental inheritance. Paternal transmission of DRB1 alleles encoding a +2 charge 3rd HVR was significantly reduced in SSc patients compared with maternal transmission (p = 0.0003, corrected for analysis of four charge categories p = 0.001). To a lesser extent, paternal transmission was increased when charge was 0 (p = 0.021, corrected for multiple comparisons p = 0.084). In contrast, paternal versus maternal inheritance was similar in controls. SSc patients differed from controls when DRB1 alleles were categorized according to 3rd HVR sequences. Skewed parental inheritance was observed in SSc patients but not in controls when the DRβ1 3rd HVR was considered according to charge. These observations suggest that epigenetic modulation of HLA merits investigation in SSc.
DEFF Research Database (Denmark)
Knudsen, K; Madsen, AS; Mygind, P
1999-01-01
Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.
Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.
2002-01-01
The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth
Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana
Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG
The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth
Genome Sequence of Novel Human Parechovirus Type 17
B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica
2017-01-01
ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.
Directory of Open Access Journals (Sweden)
Rafael Pernil
2015-04-01
Full Text Available Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Representation of protein-sequence information by amino acid subalphabets
DEFF Research Database (Denmark)
Andersen, C.A.F.; Brunak, Søren
2004-01-01
-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids...
Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)
Energy Technology Data Exchange (ETDEWEB)
Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)
1988-08-11
The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.
International Nuclear Information System (INIS)
Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.
1988-01-01
cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed
Soil amino acid composition across a boreal forest successional sequence
Nancy R. Werdin-Pfisterer; Knut Kielland; Richard D. Boone
2009-01-01
Soil amino acids are important sources of organic nitrogen for plant nutrition, yet few studies have examined which amino acids are most prevalent in the soil. In this study, we examined the composition, concentration, and seasonal patterns of soil amino acids across a primary successional sequence encompassing a natural gradient of plant productivity and soil...
International Nuclear Information System (INIS)
Reynolds, D.S.; Gurley, D.S.; Stevens, R.L.; Austen, K.F.; Serafin, W.E.; Sugarbaker, D.J.
1989-01-01
Human skin and lung mast cells and rodent peritoneal cells contain a carboxypeptidase in their secretory granules. The authors have screened human lung cDNA libraries with a mouse mast cell carboxypeptidase A (MC-CPA) cDNA probe to isolate a near-full-length cDNA that encodes human MC-CPA. The 5' end of the human MC-CPA transcript was defined by direct mRNA sequencing and by isolation and partial sequencing of the human MC-CPA gene. Human MC-CPA is predicted to be translated as a 417 amino acid preproenzyme which includes a 15 amino acid signal peptide and a 94-amino acid activation peptide. The mature human MC-CPA enzyme has a predicted size of 36.1 kDa, a net positive charge of 16 at neutral pH, and 86% amino acid sequence identity with mouse MC-CPA. DNA blot analyses showed that human MC-CPA mRNA is transcribed from a single locus in the human genome. Comparison of the human MC-CPA with mouse MC-CPA and with three rat pancreatic carboxypeptidases shows that these enzymes are encoded by distinct but homologous genes
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V
2018-04-10
Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by
Jacobsson, Susanne; Hedberg, Sara Thulin; Mölling, Paula; Unemo, Magnus; Comanducci, Maurizio; Rappuoli, Rino; Olcén, Per
2009-03-04
During the recent years, projects are in progress for designing broad-range non-capsular-based meningococcal vaccines, covering also serogroup B isolates. We have examined three genes encoding antigens (NadA, GNA1030 and GNA2091) included in a novel vaccine, i.e. the 5 Component Vaccine against Meningococcus B (5CVMB), in terms of gene prevalence and sequence variations. These data were combined with the results from a similar study, examining the two additional antigens included in the 5CVMB (fHbp and GNA2132). nadA and fHbp v. 1 were present in 38% (n=36), respectively 71% (n=67) of the isolates, whereas gna2132, gna1030 and gna2091 were present in all the Neisseria meningitidis isolates tested (n=95). The level of amino acid conservation was relatively high in GNA1030 (93%), GNA2091 (92%), and within the main variants of NadA and fHbp. GNA2132 (54% of the amino acids conserved) appeared to be the most diversified antigen. Consequently, the theoretical coverage of the 5CVMB antigens and the feasibility to use these in a broad-range meningococcal vaccine is appealing.
Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao
2005-01-01
We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.
DEFF Research Database (Denmark)
Ladefoged, Søren; Birkelund, Svend; Hauge, S
1995-01-01
gene was sequenced, and its gene product was characterized with the goal of elucidating the structure and function of Lmp1. A total of 7,196 bp in the lmp1 region was sequenced. An open reading frame of 4,032 bp, encoding a protein of 1,344 amino acids with a calculated molecular weight of 147...
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Directory of Open Access Journals (Sweden)
McCallion Andrew S
2009-01-01
Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in
Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.
2002-01-01
Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The
Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs
Directory of Open Access Journals (Sweden)
Ruan Jishou
2007-04-01
Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)
Energy Technology Data Exchange (ETDEWEB)
Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.
2017-08-29
The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).
Heinke, Florian; Bittrich, Sebastian; Kaiser, Florian; Labudde, Dirk
2016-01-01
To understand the molecular function of biopolymers, studying their structural characteristics is of central importance. Graphics programs are often utilized to conceive these properties, but with the increasing number of available structures in databases or structure models produced by automated modeling frameworks this process requires assistance from tools that allow automated structure visualization. In this paper a web server and its underlying method for generating graphical sequence representations of molecular structures is presented. The method, called SequenceCEROSENE (color encoding of residues obtained by spatial neighborhood embedding), retrieves the sequence of each amino acid or nucleotide chain in a given structure and produces a color coding for each residue based on three-dimensional structure information. From this, color-highlighted sequences are obtained, where residue coloring represent three-dimensional residue locations in the structure. This color encoding thus provides a one-dimensional representation, from which spatial interactions, proximity and relations between residues or entire chains can be deduced quickly and solely from color similarity. Furthermore, additional heteroatoms and chemical compounds bound to the structure, like ligands or coenzymes, are processed and reported as well. To provide free access to SequenceCEROSENE, a web server has been implemented that allows generating color codings for structures deposited in the Protein Data Bank or structure models uploaded by the user. Besides retrieving visualizations in popular graphic formats, underlying raw data can be downloaded as well. In addition, the server provides user interactivity with generated visualizations and the three-dimensional structure in question. Color encoded sequences generated by SequenceCEROSENE can aid to quickly perceive the general characteristics of a structure of interest (or entire sets of complexes), thus supporting the researcher in the initial
Directory of Open Access Journals (Sweden)
Xiaoyu Wang
Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.
RTA, a candidate G protein-coupled receptor: Cloning, sequencing, and tissue distribution
International Nuclear Information System (INIS)
Ross, P.C.; Figler, R.A.; Corjay, M.H.; Barber, C.M.; Adam, N.; Harcus, D.R.; Lynch, K.R.
1990-01-01
Genomic and cDNA clones, encoding a protein that is a member of the guanine nucleotide-binding regulatory protein (G protein)-coupled receptor superfamily, were isolated by screening rat genomic and thoracic aorta cDNA libraries with an oligonucleotide encoding a highly conserved region of the M 1 muscarinic acetylcholine receptor. Sequence analyses of these clones showed that they encode a 343-amino acid protein (named RTA). The RTA gene is single copy, as demonstrated by restriction mapping and Southern blotting of genomic clones and rat genomic DNA. RTA RNA sequences are relatively abundant throughout the gut, vas deferens, uterus, and aorta but are only barely detectable (on Northern blots) in liver, kidney, lung, and salivary gland. In the rat brain, RTA sequences are markedly abundant in the cerebellum. TRA is most closely related to the mas oncogene (34% identity), which has been suggested to be a forebrain angiotensin receptor. They conclude that RTA is not an angiotensin receptor; to date, they have been unable to identify its ligand
Chen, Peng; Li, Jinyan; Limsoon, Wong; Kuwahara, Hiroyuki; Huang, Jianhua Z.; Gao, Xin
2013-01-01
Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.
Chen, Peng
2013-07-23
Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.
Chen, Peng; Li, Jinyan; Wong, Limsoon; Kuwahara, Hiroyuki; Huang, Jianhua Z; Gao, Xin
2013-08-01
Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. Copyright © 2013 Wiley Periodicals, Inc.
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
International Nuclear Information System (INIS)
Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.
1987-01-01
The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.
Haggarty, N W; Dunbar, B; Fothergill, L A
1983-01-01
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Alvarez, Rene; Seal, Bruce S
2005-01-01
Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the
Directory of Open Access Journals (Sweden)
Alvarez Rene
2005-04-01
Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
Amino acid sequences and structures of chicken and turkey beta 2-microglobulin
DEFF Research Database (Denmark)
Welinder, K G; Jespersen, H M; Walther-Rasmussen, J
1991-01-01
The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11...
Directory of Open Access Journals (Sweden)
Mariza M. Coêlho
2011-01-01
Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.
Born, T L; Zheng, R; Blanchard, J S
1998-07-21
Hydrolysis of N-succinyl-L,L-diaminopimelic acid by the dapE-encoded desuccinylase is required for the bacterial synthesis of lysine and meso-diaminopimelic acid. We have investigated the catalytic mechanism of the recombinant enzyme from Haemophilus influenzae. The desuccinylase was overexpressed in Escherichia coli and purified to homogeneity. Steady-state kinetic experiments verified that the enzyme is metal-dependent, with a Km for N-succinyl-L,L-diaminopimelic acid of 1.3 mM and a turnover number of 200 s-1 in the presence of zinc. The maximal velocity was independent of pH above 7 but decreased with a slope of 1 below pH 7. The pH dependence of V/K was bell-shaped with apparent pKs of 6.5 and 8.3. Both L,L- and D,L-diaminopimelic acid were competitive inhibitors of the substrate, but d,d-diaminopimelic acid was not. Solvent kinetic isotope effect studies yielded inverse isotope effects, with values for D2OV/K of 0.62 and D2OV of 0.78. Determination of metal stoichiometry by ICP-AES indicated one tightly bound metal ion, while sequence homologies suggest the presence of two metal binding sites. On the basis of these observations, we propose a chemical mechanism for this metalloenzyme, which has a number of important structurally defined homologues.
Cloning and expression of a cDNA encoding human sterol carrier protein 2
International Nuclear Information System (INIS)
Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.
1991-01-01
The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions
Improved entropy encoding for high efficient video coding standard
Directory of Open Access Journals (Sweden)
B.S. Sunil Kumar
2018-03-01
Full Text Available The High Efficiency Video Coding (HEVC has better coding efficiency, but the encoding performance has to be improved to meet the growing multimedia applications. This paper improves the standard entropy encoding by introducing the optimized weighing parameters, so that higher rate of compression can be accomplished over the standard entropy encoding. The optimization is performed using the recently introduced firefly algorithm. The experimentation is carried out using eight benchmark video sequences and the PSNR for varying rate of data transmission is investigated. Comparative analysis based on the performance statistics is made with the standard entropy encoding. From the obtained results, it is clear that the originality of the decoded video sequence is preserved far better than the proposed method, though the compression rate is increased. Keywords: Entropy, Encoding, HEVC, PSNR, Compression
Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist
Directory of Open Access Journals (Sweden)
Wernegreen Jennifer J
2010-12-01
Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.
Malamud, Mariano; Carasi, Paula; Bronsoms, Sílvia; Trejo, Sebastián A; Serradell, María de Los Angeles
2017-04-01
The S-layer is a proteinaceous envelope constituted by subunits that self-assemble to form a two-dimensional lattice that covers the surface of different species of Bacteria and Archaea, and it could be involved in cell recognition of microbes among other several distinct functions. In this work, both proteomic and genomic approaches were used to gain knowledge about the sequences of the S-layer protein (SLPs) encoding genes expressed by six aggregative and sixteen non-aggregative strains of potentially probiotic Lactobacillus kefiri. Peptide mass fingerprint (PMF) analysis confirmed the identity of SLPs extracted from L. kefiri, and based on the homology with phylogenetically related species, primers located outside and inside the SLP-genes were employed to amplify genomic DNA. The O-glycosylation site SASSAS was found in all L. kefiri SLPs. Ten strains were selected for sequencing of the complete genes. The total length of the mature proteins varies from 492 to 576 amino acids, and all SLPs have a calculated pI between 9.37 and 9.60. The N-terminal region is relatively conserved and shows a high percentage of positively charged amino acids. Major differences among strains are found in the C-terminal region. Different groups could be distinguished regarding the mature SLPs and the similarities observed in the PMF spectra. Interestingly, SLPs of the aggregative strains are 100% homologous, although these strains were isolated from different kefir grains. This knowledge provides relevant data for better understanding of the mechanisms involved in SLPs functionality and could contribute to the development of products of biotechnological interest from potentially probiotic bacteria.
Directory of Open Access Journals (Sweden)
Atteyet F Yassin
Full Text Available The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM systems, type II toxin-antitoxin (TA, CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA and topisomerase IV (ParC enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Ferreira, A B; Oliveira, M N V de; Freitas, F S; Paiva, A D; Alfenas-Zerbini, P; Silva, D F da; Queiroz, M V de; Borges, A C; Moraes, C A de
2015-01-01
Amino acid decarboxylation is important for the maintenance of intracellular pH under acid stress. This study aims to carry out phylogenetic and expression analysis by real-time PCR of two genes that encode proteins involved in ornithine decarboxylation in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress. Sequencing and phylogeny analysis of genes encoding ornithine decarboxylase and amino acid permease in L. delbrueckii UFV H2b20 showed their high sequence identity (99%) and grouping with those of L. delbrueckii subsp. bulgaricus ATCC 11842. Exposure of L. delbrueckii UFV H2b20 cells in MRS pH 3.5 for 30 and 60 min caused a significant increase in expression of the gene encoding ornithine decarboxylase (up to 8.1 times higher when compared to the control treatment). Increased expression of the ornithine decarboxylase gene demonstrates its involvement in acid stress response in L. delbrueckii UFV H2b20, evidencing that the protein encoded by that gene could be involved in intracellular pH regulation. The results obtained show ornithine decarboxylation as a possible mechanism of adaptation to an acidic environmental condition, a desirable and necessary characteristic for probiotic cultures and certainly important to the survival and persistence of the L. delbrueckii UFV H2b20 in the human gastrointestinal tract.
Human tissue factor: cDNA sequence and chromosome localization of the gene
International Nuclear Information System (INIS)
Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.
1987-01-01
A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes
Isolation of a novel abscisic acid stress ripening ( OsASR ) gene ...
African Journals Online (AJOL)
Isolation of a novel abscisic acid stress ripening ( OsASR ) gene from rice and analysis of the response of this gene to abiotic stresses. ... The cDNA with the whole open reading frame (ORF) was amplified by PCR and cloned. Sequence analysis showed that the cDNA encodes a protein of 284 amino acid residues with ...
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...
Borrmann, Annika; Milles, Sigrid; Plass, Tilman; Dommerholt, Jan; Verkade, Jorge M M; Wiessler, Manfred; Schultz, Carsten; van Hest, Jan C M; van Delft, Floris L; Lemke, Edward A
2012-09-24
Visualizing biomolecules by fluorescent tagging is a powerful method for studying their behaviour and function inside cells. We prepared and genetically encoded an unnatural amino acid (UAA) that features a bicyclononyne moiety. This UAA offered exceptional reactivity in strain-promoted azide-alkyne cycloadditions. Kinetic measurements revealed that the UAA reacted also remarkably fast in the inverse-electron-demand Diels-Alder cycloaddition with tetrazine-conjugated dyes. Genetic encoding of the new UAA inside mammalian cells and its subsequent selective labeling at low dye concentrations demonstrate the usefulness of the new amino acid for future imaging studies. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Chakrabarti Mrinmay
2010-08-01
Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Liu, X; Gorovsky, M A
1996-01-01
A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.
Haggarty, N W; Dunbar, B; Fothergill, L A
1983-01-01
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356
2010-01-01
of appropriate animal model systems. For OP poisoning, the guinea pig (Cavia porcellus) is a commonly used animal model because guinea pigs more...endogenous bioscavenger in vivo. Although guinea pigs historically have been used to test OP poisoning therapies, it has been found recently that guinea pig AChE...transcribed mRNA encoding guinea pig AChE, amplified the resulting cDNA, and sequenced this product. The nucleotide and deduced amino acid sequences of
3D representations of amino acids—applications to protein sequence comparison and classification
Directory of Open Access Journals (Sweden)
Jie Li
2014-08-01
Full Text Available The amino acid sequence of a protein is the key to understanding its structure and ultimately its function in the cell. This paper addresses the fundamental issue of encoding amino acids in ways that the representation of such a protein sequence facilitates the decoding of its information content. We show that a feature-based representation in a three-dimensional (3D space derived from amino acid substitution matrices provides an adequate representation that can be used for direct comparison of protein sequences based on geometry. We measure the performance of such a representation in the context of the protein structural fold prediction problem. We compare the results of classifying different sets of proteins belonging to distinct structural folds against classifications of the same proteins obtained from sequence alone or directly from structural information. We find that sequence alone performs poorly as a structure classifier. We show in contrast that the use of the three dimensional representation of the sequences significantly improves the classification accuracy. We conclude with a discussion of the current limitations of such a representation and with a description of potential improvements.
International Nuclear Information System (INIS)
Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.
1987-01-01
Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences
Directory of Open Access Journals (Sweden)
Alexandra E Grier
2016-01-01
Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)
International Nuclear Information System (INIS)
Nylund, Stian; Karlsen, Marius; Nylund, Are
2008-01-01
The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae
Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo
2014-01-25
Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Offerman, Kristy; Carulei, Olivia; van der Walt, Anelda Philine; Douglass, Nicola; Williamson, Anna-Lise
2014-06-12
Two novel avipoxviruses from South Africa have been sequenced, one from a Feral Pigeon (Columba livia) (FeP2) and the other from an African penguin (Spheniscus demersus) (PEPV). We present a purpose-designed bioinformatics pipeline for analysis of next generation sequence data of avian poxviruses and compare the different avipoxviruses sequenced to date with specific emphasis on their evolution and gene content. The FeP2 (282 kbp) and PEPV (306 kbp) genomes encode 271 and 284 open reading frames respectively and are more closely related to one another (94.4%) than to either fowlpox virus (FWPV) (85.3% and 84.0% respectively) or Canarypox virus (CNPV) (62.0% and 63.4% respectively). Overall, FeP2, PEPV and FWPV have syntenic gene arrangements; however, major differences exist throughout their genomes. The most striking difference between FeP2 and the FWPV-like avipoxviruses is a large deletion of ~16 kbp from the central region of the genome of FeP2 deleting a cc-chemokine-like gene, two Variola virus B22R orthologues, an N1R/p28-like gene and a V-type Ig domain family gene. FeP2 and PEPV both encode orthologues of vaccinia virus C7L and Interleukin 10. PEPV contains a 77 amino acid long orthologue of Ubiquitin sharing 97% amino acid identity to human ubiquitin. The genome sequences of FeP2 and PEPV have greatly added to the limited repository of genomic information available for the Avipoxvirus genus. In the comparison of FeP2 and PEPV to existing sequences, FWPV and CNPV, we have established insights into African avipoxvirus evolution. Our data supports the independent evolution of these South African avipoxviruses from a common ancestral virus to FWPV and CNPV.
Kim, K S; Chilton, W S; Farrand, S K
1996-06-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.
Directory of Open Access Journals (Sweden)
Michael G Jobling
Full Text Available Some enterotoxigenic Escherichia coli (ETEC produce a type II heat-labile enterotoxin (LT-II that activates adenylate cyclase in susceptible cells but is not neutralized by antisera against cholera toxin or type I heat-labile enterotoxin (LT-I. LT-I variants encoded by plasmids in ETEC from humans and pigs have amino acid sequences that are ≥ 95% identical. In contrast, LT-II toxins are chromosomally encoded and are much more diverse. Early studies characterized LT-IIa and LT-IIb variants, but a novel LT-IIc was reported recently. Here we characterized the LT-II encoding loci from 48 additional ETEC isolates. Two encoded LT-IIa, none encoded LT-IIb, and 46 encoded highly related variants of LT-IIc. Phylogenetic analysis indicated that the predicted LT-IIc toxins encoded by these loci could be assigned to 6 subgroups. The loci corresponding to individual toxins within each subgroup had DNA sequences that were more than 99% identical. The LT-IIc subgroups appear to have arisen by multiple recombinational events between progenitor loci encoding LT-IIc1- and LT-IIc3-like variants. All loci from representative isolates encoding the LT-IIa, LT-IIb, and each subgroup of LT-IIc enterotoxins are preceded by highly-related genes that are between 80 and 93% identical to predicted phage lysozyme genes. DNA sequences immediately following the B genes differ considerably between toxin subgroups, but all are most closely related to genomic sequences found in predicted prophages. Together these data suggest that the LT-II loci are inserted into lambdoid type prophages that may or may not be infectious. These findings raise the possibility that production of LT-II enterotoxins by ETEC may be determined by phage conversion and may be activated by induction of prophage, in a manner similar to control of production of Shiga-like toxins by converting phages in isolates of enterohemmorhagic E. coli.
[Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].
Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo
2008-09-01
Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Directory of Open Access Journals (Sweden)
James B Howard
Full Text Available Amino acid residues critical for a protein's structure-function are retained by natural selection and these residues are identified by the level of variance in co-aligned homologous protein sequences. The relevant residues in the nitrogen fixation Component 1 α- and β-subunits were identified by the alignment of 95 protein sequences. Proteins were included from species encompassing multiple microbial phyla and diverse ecological niches as well as the nitrogen fixation genotypes, anf, nif, and vnf, which encode proteins associated with cofactors differing at one metal site. After adjusting for differences in sequence length, insertions, and deletions, the remaining >85% of the sequence co-aligned the subunits from the three genotypes. Six Groups, designated Anf, Vnf , and Nif I-IV, were assigned based upon genetic origin, sequence adjustments, and conserved residues. Both subunits subdivided into the same groups. Invariant and single variant residues were identified and were defined as "core" for nitrogenase function. Three species in Group Nif-III, Candidatus Desulforudis audaxviator, Desulfotomaculum kuznetsovii, and Thermodesulfatator indicus, were found to have a seleno-cysteine that replaces one cysteinyl ligand of the 8Fe:7S, P-cluster. Subsets of invariant residues, limited to individual groups, were identified; these unique residues help identify the gene of origin (anf, nif, or vnf yet should not be considered diagnostic of the metal content of associated cofactors. Fourteen of the 19 residues that compose the cofactor pocket are invariant or single variant; the other five residues are highly variable but do not correlate with the putative metal content of the cofactor. The variable residues are clustered on one side of the cofactor, away from other functional centers in the three dimensional structure. Many of the invariant and single variant residues were not previously recognized as potentially critical and their identification
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
International Nuclear Information System (INIS)
Mangin, M.; Webb, A.C.; Dreyer, B.E.
1988-01-01
Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12
International Nuclear Information System (INIS)
Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.
1988-01-01
cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues
Nocek, Boguslaw P.; Gillner, Danuta M.; Fan, Yao; Holz, Richard C.; Joachimiak, Andrzej
2010-01-01
Biosynthesis of lysine and meso-diaminopimelic acid in bacteria provides essential components for protein synthesis and construction of the bacterial peptidoglycan cell wall. The dapE operon enzymes synthesize both meso-diaminopimelic acid and lysine and, therefore, represent a potential targets for novel antibacterials. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase functions in a late step of the pathway and converts N-succinyl-L,L-diaminopimelic acid (L,L-SDAP) to L,L-di...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Energy Technology Data Exchange (ETDEWEB)
Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.
1997-04-01
This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.
RevTrans: multiple alignment of coding DNA from aligned amino acid sequences
DEFF Research Database (Denmark)
Wernersson, Rasmus; Pedersen, Anders Gorm
2003-01-01
The simple fact that proteins are built from 20 amino acids while DNA only contains four different bases, means that the 'signal-to-noise ratio' in protein sequence alignments is much better than in alignments of DNA. Besides this information-theoretical advantage, protein alignments also benefit...... proteins. It is therefore preferable to align coding DNA at the amino acid level and it is for this purpose we have constructed the program RevTrans. RevTrans constructs a multiple DNA alignment by: (i) translating the DNA; (ii) aligning the resulting peptide sequences; and (iii) building a multiple DNA...
The amino acid sequence of snapping turtle (Chelydra serpentina) ribonuclease
Beintema, Jacob; Broos, Jaap; Meulenberg, Janneke; Schüller, Cornelis
1985-01-01
Snapping turtle (Chelydra serpentina) ribonuclease was isolated from pancreatic tissue. Turtle ribonuclease binds much more weakly to the affinity chromatography matrix used than mammalian ribonucleases. The amino acid sequence was determined from overlapping peptides obtained from three different
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Directory of Open Access Journals (Sweden)
Janeth Silva Pinheiro
2008-01-01
Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.
International Nuclear Information System (INIS)
Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.
1987-01-01
The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor
Wang, R; McFarland, J G; Kekomaki, R; Newman, P J
1993-12-01
A new platelet alloantigen, termed CA, has recently been implicated in a case of neonatal alloimmune thrombocytopenia (NATP) in a Filipino family in Canada. Maternal anti-CA serum reacted with glycoprotein (GP) IIIa and maintained its reactivity after removal of high mannose carbohydrate residues from GPIIIa. The monoclonal antibody (MoAb) AP3 partially blocked binding of anti-CA to GPIIIa, suggesting that the CA polymorphism is proximal to the AP3 epitope. Platelet RNA polymerase chain reaction (PCR) was used to amplify the region of GPIIIa cDNA that encodes this region of the protein. DNA sequence analysis showed a GA nucleotide substitution at base 1564 that results in an arginine (Arg) (CGG)glutamine (Gln) (CAG) polymorphism in amino acid (AA) 489. Further analysis of PCR-amplified genomic DNA from 27 normal individuals showed that AA 489 is encoded by a mutational "hot spot" of the GPIIIa gene, as three different codons for the wild-type Arg489 of GPIIIa were also found. The codon usage for Arg489 was found to be: CGG (63%), CGA (37%), and CGC (Definition of these new molecular variants of the beta 3 integrin chain should prove valuable in the diagnosis of NATP in these two geographically disparate populations, and it may also provide useful genetic markers for examining other pathologic variations of the GPIIb-IIIa complex.
Correlation between fibroin amino acid sequence and physical silk properties.
Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek
2003-09-12
The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Directory of Open Access Journals (Sweden)
Javier Villacreses
2015-04-01
Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong
2015-03-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.
DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG
2015-01-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630
Directory of Open Access Journals (Sweden)
GangQiang Li
Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio
2005-01-01
In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.
Murine protein H is comprised of 20 repeating units, 61 amino acids in length
DEFF Research Database (Denmark)
Kristensen, Torsten; Tack, B F
1986-01-01
A cDNA library constructed from size-selected (greater than 28 S) poly(A)+ RNA isolated from the livers of C57B10. WR mice was screened by using a 249-base-pair (bp) cDNA fragment encoding 83 amino acid residues of human protein H as a probe. Of 120,000 transformants screened, 30 hybridized......, 448 bp of 3'-untranslated sequence, and a polyadenylylated tail of undetermined length. Murine pre-protein H was deduced to consist of an 18-amino acid signal peptide and 1216 residues of H-protein sequence. Murine H was composed of 20 repetitive units, each about 61 amino acid residues in length...
Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)
International Nuclear Information System (INIS)
Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.
1987-01-01
The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia
Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc
2015-01-01
Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. Copyright © 2014 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Takahashi, N.; Takahashi, Y.; Blumberg, B.S.; Putnam, F.W.
1987-01-01
The structural changes in four genetic variants of human serum albumin were analyzed by tandem high-pressure liquid chromatography (HPLC) of the tryptic peptides, HPLC mapping and isoelectric focusing of the CNBr fragments, and amino acid sequence analysis of the purified peptides. Lysine-372 of normal (common) albumin A was changed to glutamic acid both in albumin Naskapi, a widespread polymorphic variant of North American Indians, and in albumin Mersin found in Eti Turks. The two variants also exhibited anomalous migration in NaDodSO 4 /PAGE, which is attributed to a conformational change. The identity of albumins Naskapi and Mersin may have originated through descent from a common mid-Asiatic founder of the two migrating ethnic groups, or it may represent identical but independent mutations of the albumin gene. In albumin Adana, from Eti Turks, the substitution site was not identified but was localized to the region from positions 447 through 548. The substitution of aspartic acid-550 by glycine was found in albumin Mexico-2 from four individuals of the Pima tribe. Although only single-point substitutions have been found in these and in certain other genetic variants of human albumin, five differences exist in the amino acid sequences inferred from cDNA sequences by workers in three other laboratories. However, our results on albumin A and on 14 different genetic variants accord with the amino acid sequence of albumin deduced from the genomic sequence. The apparent amino acid substitutions inferred from comparison of individual cDNA sequences probably reflect artifacts in cloning or in cDNA sequence analysis rather than polymorphism of the coding sections of the albumin gene
Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David
2012-01-01
Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095
Cloning and sequence of the human adrenodoxin reductase gene
International Nuclear Information System (INIS)
Lin, Dong; Shi, Y.; Miller, W.L.
1990-01-01
Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon
McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.
2016-05-01
Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogr...
Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus
DEFF Research Database (Denmark)
Hansen, T S; Andreasen, P H; Dreisig, H
1991-01-01
We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...
Secondary structure classification of amino-acid sequences using state-space modeling
Brunnert, Marcus; Krahnke, Tillmann; Urfer, Wolfgang
2001-01-01
The secondary structure classification of amino acid sequences can be carried out by a statistical analysis of sequence and structure data using state-space models. Aiming at this classification, a modified filter algorithm programmed in S is applied to data of three proteins. The application leads to correct classifications of two proteins even when using relatively simple estimation methods for the parameters of the state-space models. Furthermore, it has been shown that the assumed initial...
Wang, Yongkang; Song, Xiaodan; Li, Xiaorong; Yang, Sang-tian; Zou, Xiang
2017-01-04
To explore the genome sequence of Aureobasidium pullulans CCTCC M2012223, analyze the key genes related to the biosynthesis of important metabolites, and provide genetic background for metabolic engineering. Complete genome of A. pullulans CCTCC M2012223 was sequenced by Illumina HiSeq high throughput sequencing platform. Then, fragment assembly, gene prediction, functional annotation, and GO/COG cluster were analyzed in comparison with those of other five A. pullulans varieties. The complete genome sequence of A. pullulans CCTCC M2012223 was 30756831 bp with an average GC content of 47.49%, and 9452 genes were successfully predicted. Genome-wide analysis showed that A. pullulans CCTCC M2012223 had the biggest genome assembly size. Protein sequences involved in the pullulan and polymalic acid pathway were highly conservative in all of six A. pullulans varieties. Although both A. pullulans CCTCC M2012223 and A. pullulans var. melanogenum have a close affinity, some point mutation and inserts were occurred in protein sequences involved in melanin biosynthesis. Genome information of A. pullulans CCTCC M2012223 was annotated and genes involved in melanin, pullulan and polymalic acid pathway were compared, which would provide a theoretical basis for genetic modification of metabolic pathway in A. pullulans.
Wilusz, T; Wieczorek, M; Polanowski, A; Denton, A; Cook, J; Laskowski, M
1983-01-01
The amino-acid sequences of two trypsin isoinhibitors, ITD I and ITD III, from squash seeds (Cucurbita maxima) were determined. Both isoinhibitors contain 29 amino-acid residues, including 6 half cystine residues. They differ only by one amino acid. Lysine in position 9 of ITD III is substituted by glutamic acid in ITD I. Arginine in position 5 is present at the reactive site of both isoinhibitors. The previously published sequence of ITD III has been shown to be incorrect.
Mudgil, Y; Singh, B N; Upadhyaya, K C; Sopory, S K; Reddy, M K
2002-05-01
We have cloned a full-length 2874-bp cDNA coding for tobacco topoisomerase I, with an ORF of 2559 bp encoding a protein of 852 amino acids with a calculated molecular mass of 95 kDa and an estimated pI of 9.51. The deduced amino acid sequence shows homology to other eukaryotic topoisomerases I. Tobacco topoisomerase I was over-expressed in Escherichia coli, and the purified recombinant protein was found to relax both positively and negatively super-coiled DNA in the absence of the divalent cation Mg(2+)and ATP. These characteristic features indicate that the tobacco enzyme is a type I topoisomerase. The recombinant protein could be phosphorylated at (a) threonine residue(s) by protein kinase C. However, phosphorylation did not cause any change in its enzymatic activity. The genomic organization of the topoisomerase I gene revealed the presence of 8 exons and 7 introns in the region corresponding to the ORF and one intron in the 3' UTR region. Transcript analysis using RT-PCR showed basal constitutive expression in all organs examined, and the gene was expressed at all stages of the cell cycle--but the level of expression increased during the G1-S phase. The transcript level also increased following exposure to light, low-temperature stress and abscisic acid, a stress hormone.
Complete sequence of RNA1 of grapevine Anatolian ringspot virus.
Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic
2012-10-01
The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.
Directory of Open Access Journals (Sweden)
Michael Andrew Meyer
2013-07-01
Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.
Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin
2005-04-01
Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.
MicroRNA-encoding long non-coding RNAs
Directory of Open Access Journals (Sweden)
Zhu Xiaopeng
2008-05-01
Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.
Amino acid code of protein secondary structure.
Shestopalov, B V
2003-01-01
The calculation of protein three-dimensional structure from the amino acid sequence is a fundamental problem to be solved. This paper presents principles of the code theory of protein secondary structure, and their consequence--the amino acid code of protein secondary structure. The doublet code model of protein secondary structure, developed earlier by the author (Shestopalov, 1990), is part of this theory. The theory basis are: 1) the name secondary structure is assigned to the conformation, stabilized only by the nearest (intraresidual) and middle-range (at a distance no more than that between residues i and i + 5) interactions; 2) the secondary structure consists of regular (alpha-helical and beta-structural) and irregular (coil) segments; 3) the alpha-helices, beta-strands and coil segments are encoded, respectively, by residue pairs (i, i + 4), (i, i + 2), (i, i = 1), according to the numbers of residues per period, 3.6, 2, 1; 4) all such pairs in the amino acid sequence are codons for elementary structural elements, or structurons; 5) the codons are divided into 21 types depending on their strength, i.e. their encoding capability; 6) overlappings of structurons of one and the same structure generate the longer segments of this structure; 7) overlapping of structurons of different structures is forbidden, and therefore selection of codons is required, the codon selection is hierarchic; 8) the code theory of protein secondary structure generates six variants of the amino acid code of protein secondary structure. There are two possible kinds of model construction based on the theory: the physical one using physical properties of amino acid residues, and the statistical one using results of statistical analysis of a great body of structural data. Some evident consequences of the theory are: a) the theory can be used for calculating the secondary structure from the amino acid sequence as a partial solution of the problem of calculation of protein three
Exhaustive search of linear information encoding protein-peptide recognition.
Kelil, Abdellali; Dubreuil, Benjamin; Levy, Emmanuel D; Michnick, Stephen W
2017-04-01
High-throughput in vitro methods have been extensively applied to identify linear information that encodes peptide recognition. However, these methods are limited in number of peptides, sequence variation, and length of peptides that can be explored, and often produce solutions that are not found in the cell. Despite the large number of methods developed to attempt addressing these issues, the exhaustive search of linear information encoding protein-peptide recognition has been so far physically unfeasible. Here, we describe a strategy, called DALEL, for the exhaustive search of linear sequence information encoded in proteins that bind to a common partner. We applied DALEL to explore binding specificity of SH3 domains in the budding yeast Saccharomyces cerevisiae. Using only the polypeptide sequences of SH3 domain binding proteins, we succeeded in identifying the majority of known SH3 binding sites previously discovered either in vitro or in vivo. Moreover, we discovered a number of sites with both non-canonical sequences and distinct properties that may serve ancillary roles in peptide recognition. We compared DALEL to a variety of state-of-the-art algorithms in the blind identification of known binding sites of the human Grb2 SH3 domain. We also benchmarked DALEL on curated biological motifs derived from the ELM database to evaluate the effect of increasing/decreasing the enrichment of the motifs. Our strategy can be applied in conjunction with experimental data of proteins interacting with a common partner to identify binding sites among them. Yet, our strategy can also be applied to any group of proteins of interest to identify enriched linear motifs or to exhaustively explore the space of linear information encoded in a polypeptide sequence. Finally, we have developed a webserver located at http://michnick.bcm.umontreal.ca/dalel, offering user-friendly interface and providing different scenarios utilizing DALEL.
Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario
2014-08-20
DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.
Directory of Open Access Journals (Sweden)
Xiaoxia Yang
Full Text Available Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.
Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong
2015-01-01
Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.
Jiang, Ni-Hao; Zhang, Guang-Hui; Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao
2014-01-01
Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb.
Directory of Open Access Journals (Sweden)
Ni-Hao Jiang
Full Text Available Erigeron breviscapus (Vant. Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable.Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37% were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40% primer pairs were successfully amplified and 19 (52.78% primer pairs exhibited polymorphisms.Using next generation sequencing (NGS technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb.
Pfleger, Brian F; Lennen, Rebecca M
2013-12-31
Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
DEFF Research Database (Denmark)
Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar
1992-01-01
O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
DEFF Research Database (Denmark)
Kjærsgård, I.V.H.; Jespersen, H.M.; Rasmussen, Søren Kjærsgård
1997-01-01
cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP la and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid...
Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23
International Nuclear Information System (INIS)
Ghaffari, S.H.; Olson, M.O.J.
1986-01-01
Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved
Primary structure of human pancreatic elastase 2 determined by sequence analysis of the cloned mRNA
International Nuclear Information System (INIS)
Fletcher, T.S.; Shen, W.F.; Largman, C.
1987-01-01
A cDNA encoding elastase 2 has been cloned from a human pancreatic cDNA library. The cDNA contains a translation initiation site and a poly(A) recognition site and encodes a protein of 269 amino acids, including a proposed 16-residue signal peptide. The amino acid sequence of the deduced mature protein contains a 12-residue activation peptide containing a cysteine at residue 1 similar to that of chymotryspin. The proposed active enzyme contains all of the characteristic active-site amino acids, including His-57, Asp-102, and Ser-195. The S1 binding pocket is bounded by Gly-216 and Ser-226, making this pocket intermediate in size between chymotrypsins and elastase 1 or protease E, consistent with the substrate specificity of elastase 2 for long-chain aliphatic or aromatic amino acids. Computer modeling studies using the amino acid sequence of elastase 2 superimposed on the X-ray structure of porcine elastase 1 suggest that a change of Gln-192 in elastase 1 to Asn-192 in elastase 2 may account for the lower catalytic efficiency of the latter enzyme. Several basic residues appear to be near the ends of the extended binding pocket of elastases which might serve to anchor the enzyme to the elastin substrate. These studies indicate that elastases 2 and elastase 1 both contain an Arg-65A as well as a basic dipeptide at 223/224 which is not present in chymotrypsins. In addition, Arg-217A is present in humaan elastase 2 but absent in rat pancreatic protein which has been proposed to be an elastase 2 on the basis of sequence homology, but which was not isolated during screening of rat pancreatic tissue extracts for elastolytic activity
Bassler, B L; Wright, M; Showalter, R E; Silverman, M R
1993-08-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of an extracellular signal molecule (autoinducer) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode functions necessary for the synthesis of, and response to, a signal molecule. Sequence analysis of the region encoding these functions revealed three open reading frames, two (luxL and luxM) that are required for production of an autoinducer substance and a third (luxN) that is required for response to this signal substance. The LuxL and LuxM proteins are not similar in amino acid sequence to other proteins in the database, but the LuxN protein contains regions of sequence resembling both the histidine protein kinase and the response regulator domains of the family of two-component, signal transduction proteins. The phenotypes of mutants with luxL, luxM and luxN defects indicated that an additional signal-response system controlling density-dependent expression of luminescence remains to be identified.
Energy Technology Data Exchange (ETDEWEB)
Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility
1993-12-31
This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.
Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus
Directory of Open Access Journals (Sweden)
Samat Kozhakhmetov
2014-01-01
Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.
Isolation and amino acid sequence of corticotropin-releasing factor from pig hypothalami.
Patthy, M; Horvath, J; Mason-Garcia, M; Szoke, B; Schlesinger, D H; Schally, A V
1985-01-01
A polypeptide was isolated from acid extracts of porcine hypothalami on the basis of its high ability to stimulate the release of corticotropin from superfused rat pituitary cells. After an initial separation by gel filtration on Sephadex G-25, further purification was carried out by reversed-phase HPLC. The isolated material was homogeneous chromatographically and by N-terminal sequencing. Based on automated gas-phase sequencing of the intact and CNBr-cleaved peptide and on carboxypeptidase ...
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
[Cloning and bioinformatics analysis of abscisic acid 8'-hydroxylase from Pseudostellariae Radix].
Li, Jun; Long, Deng-Kai; Zhou, Tao; Ding, Ling; Zheng, Wei; Jiang, Wei-Ke
2016-07-01
Abscisic acid 8'-hydroxylase was one of key enzymes genes in the metabolism of abscisic acid (ABA). Seven menbers of abscisic acid 8'-hydroxylase were identified from Pseudostellaria heterophylla transcriptome sequencing results by using sequence homology. The expression profiles of these genes were analyzed by transcriptome data. The coding sequence of ABA8ox1 was cloned and analyzed by informational technology. The full-length cDNA of ABA8ox1 was 1 401 bp,with 480 encoded amino acids. The predicated isoelectric point (pI) and relative molecular mass (MW) were 8.55 and 53 kDa,respectively. Transmembrane structure analysis showed that there were 21 amino acids in-side and 445 amino acids out-side. High level of transcripts can detect in bark of root and fibrous root. Multi-alignment and phylogenetic analysis both show that ABA8ox1 had a high similarity with the CYP707As from other plants,especially with AtCYP707A1 and AtCYP707A3 in Arabidopsis thaliana. These results lay a foundation for molecular mechanism of tuberous root expanding and response to adversity stress. Copyright© by the Chinese Pharmaceutical Association.
Acetic acid increases the phage-encoded enterotoxin A expression in Staphylococcus aureus
Directory of Open Access Journals (Sweden)
da Silva Ayla
2010-05-01
Full Text Available Abstract Background The effects of acetic acid, a common food preservative, on the bacteriophage-encoded enterotoxin A (SEA expression and production in Staphylococcus aureus was investigated in pH-controlled batch cultures carried out at pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5. Also, genomic analysis of S. aureus strains carrying sea was performed to map differences within the gene and in the temperate phage carrying sea. Results The sea expression profile was similar from pH 7.0 to 5.5, with the relative expression peaking in the transition between exponential and stationary growth phase and falling during stationary phase. The levels of sea mRNA were below the detection limit at pH 5.0 and 4.5, confirmed by very low SEA levels at these pH values. The level of relative sea expression at pH 6.0 and 5.5 were nine and four times higher, respectively, in the transitional phase than in the exponential growth phase, compared to pH 7.0 and pH 6.5, where only a slight increase in relative expression in the transitional phase was observed. Furthermore, the increase in sea expression levels at pH 6.0 and 5.5 were observed to be linked to increased intracellular sea gene copy numbers and extracellular sea-containing phage copy numbers. The extracellular SEA levels increased over time, with highest levels produced at pH 6.0 in the four growth phases investigated. Using mitomycin C, it was verified that SEA was at least partially produced as a consequence of prophage induction of the sea-phage in the three S. aureus strains tested. Finally, genetic analysis of six S. aureus strains carrying the sea gene showed specific sea phage-groups and two versions of the sea gene that may explain the different sea expression and production levels observed in this study. Conclusions Our findings suggest that the increased sea expression in S. aureus caused by acetic acid induced the sea-encoding prophage, linking SEA production to the lifecycle of the phage.
Habe, Hiroshi; Sato, Shun; Fukuoka, Tokuma; Kitamoto, Dai; Yakushi, Toshiharu; Matsushita, Kazunobu; Sakaki, Keiji
2011-01-01
Acetobacter tropicalis NBRC16470 can produce highly enantiomerically pure D-glyceric acid (D-GA; >99 % enantiomeric excess) from glycerol. To investigate whether membrane-bound alcohol dehydrogenase (mADH) is involved in GA production in A. tropicalis, we amplified part of the gene encoding mADH subunit I (adhA) using polymerase chain reaction and constructed an adhA-disrupted mutant of A. tropicalis (ΔadhA). Because ΔadhA did not produce GA, we confirmed that mADH is essential for the conversion of glycerol to GA. We also cloned and sequenced the entire region corresponding to adhA and adhB, which encodes mADH subunit II. The sequences showed high identities (84-86 %) with the equivalent mADH subunits from other Acetobacter spp.
Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.
Chang, B S; Campbell, D L
2000-08-01
Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.
Metal resistance sequences and transgenic plants
Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.
1999-10-12
The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.
Complete genome sequence of a proposed new tymovirus, tomato blistering mosaic virus.
Nicolini, Cícero; Inoue-Nagata, Alice Kazuko; Nagata, Tatsuya
2015-02-01
In a previous work, a distinct tymovirus infecting tomato plants in Brazil was reported and tentatively named tomato blistering mosaic virus (ToBMV). In this study, the complete genome sequence of ToBMV was determined and shown to have a size of 6277 nucleotides and three ORFs: ORF 1 encodes the replication-complex polyprotein, ORF 2 the movement protein, and ORF 3 the coat protein. The cleavage sites of the replication-complex polyprotein (GS/LP and VAG/QSP) of ToBMV were predicted by alignment analysis of amino acid sequences of other tymoviruses. In the phylogenetic tree, ToBMV clustered with the tymoviruses that infect solanaceous hosts.
Development and Synthesis of DNA-Encoded Benzimidazole Library.
Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A
2018-04-25
Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.
Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.
Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset
2018-03-01
The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.
DEFF Research Database (Denmark)
Bräuner-Osborne, Hans; Krogsgaard-Larsen, P
2000-01-01
Query of GenBank with the amino acid sequence of human metabotropic glutamate receptor subtype 2 (mGluR2) identified a predicted gene product of unknown function on BAC clone CIT987SK-A-69G12 (located on chromosome band 16p12) as a homologous protein. The transcript, entitled GPRC5B, was cloned f...... from an expressed sequence tag clone that contained the entire open reading frame of the transcript encoding a protein of 395 amino acids. Analysis of the protein sequence reveal that GPRC5B contains a signal peptide and seven transmembrane alpha-helices, which is a hallmark of G...
Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian
2014-03-18
The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.
International Nuclear Information System (INIS)
Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.
1988-01-01
A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Lifescience Database Archive (English)
Full Text Available List Contact us Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organis...m species. Data detail Data name Amino acid sequences of predicted proteins and their annotation for 95 orga...nism species. DOI 10.18908/lsdba.nbdc00464-001 Description of data contents Amino acid sequences of predicted proteins...Database Description Download License Update History of This Database Site Policy | Contact Us Amino acid sequences of predicted prot...eins and their annotation for 95 organism species. - Gclust Server | LSDB Archive ...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Teixeira, Monica C; Carvalho, Isabel S; Brodelius, Maria
2010-02-10
Two full-length cDNA clones PoleFAD7 and PoleFAD8, encoding plastidial omega-3 fatty acid desaturases were isolated from purslane (Portulaca oleracea). The encoded enzymes convert linoleic to alpha-linolenic acid (C18:3n-3). Three histidine clusters characteristic of fatty acid desaturases, a putative chloroplast transit peptide in the N-terminal, and three putative transmembrane domains were identified in the sequence. Both genes were expressed in all analyzed tissues showing different levels of expression. PoleFAD7 was up-regulated by wounding but not by low temperature. PoleFAD8 was up-regulated by cold stress but not by wounding. Total fatty acid and linolenic acid content were higher both, in wounded and intact leaves of plants exposed to low temperature.
Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram
2018-02-01
Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.
A flow cytometric assay technology based on quantum dots-encoded beads
International Nuclear Information System (INIS)
Wang Haiqiao; Liu Tiancai; Cao Yuancheng; Huang Zhenli; Wang Jianhao; Li Xiuqing; Zhao Yuandi
2006-01-01
A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement
DEFF Research Database (Denmark)
Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P
1991-01-01
After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Isolation and complete amino acid sequence of human thymopoietin and splenin
International Nuclear Information System (INIS)
Audhya, T.; Schlesinger, D.H.; Goldstein, G.
1987-01-01
Human thymopoietin and splenin were isolated from human thymus and spleen, respectively, by monitoring tissue fractionation with a bovine thymopoietin RIA cross-reactive with human thymopoietin and splenin. Bovine thymopoietin and splenin are 49-amino acid polypeptides that differ by only 2 amino acids at positions 34 and 43; the change at position 34 in the active-site region changes the receptor specificities and biological activities. The complete amino acid sequences of purified human thymopoietin and splenin were determined and shown to be 48-amino acid polypeptides differing at four positions. Ten amino acids, constant within each species for thymopoietin and splenin, differ between the human and bovine polypeptides. The pentapeptide active side of thymopoietin (residues 32-36) is constant between the human and bovine thymopoietins, but position 34 in the active site of splenin has changed from glutamic acid in bovine splenin to alanine in human splenin, accounting for the biological activity of the human but not the bovine splenin on the human T-cell line MOLT-4
Xu, Chunrui; Sun, Dandan; Liu, Shenghui; Zhang, Yusen
2016-10-07
In this contribution we introduced a novel graphical method to compare protein sequences. By mapping a protein sequence into 3D space based on codons and physicochemical properties of 20 amino acids, we are able to get a unique P-vector from the 3D curve. This approach is consistent with wobble theory of amino acids. We compute the distance between sequences by their P-vectors to measure similarities/dissimilarities among protein sequences. Finally, we use our method to analyze four datasets and get better results compared with previous approaches. Copyright © 2016 Elsevier Ltd. All rights reserved.
Prediction of Protein Hotspots from Whole Protein Sequences by a Random Projection Ensemble System
Directory of Open Access Journals (Sweden)
Jinjian Jiang
2017-07-01
Full Text Available Hotspot residues are important in the determination of protein-protein interactions, and they always perform specific functions in biological processes. The determination of hotspot residues is by the commonly-used method of alanine scanning mutagenesis experiments, which is always costly and time consuming. To address this issue, computational methods have been developed. Most of them are structure based, i.e., using the information of solved protein structures. However, the number of solved protein structures is extremely less than that of sequences. Moreover, almost all of the predictors identified hotspots from the interfaces of protein complexes, seldom from the whole protein sequences. Therefore, determining hotspots from whole protein sequences by sequence information alone is urgent. To address the issue of hotspot predictions from the whole sequences of proteins, we proposed an ensemble system with random projections using statistical physicochemical properties of amino acids. First, an encoding scheme involving sequence profiles of residues and physicochemical properties from the AAindex1 dataset is developed. Then, the random projection technique was adopted to project the encoding instances into a reduced space. Then, several better random projections were obtained by training an IBk classifier based on the training dataset, which were thus applied to the test dataset. The ensemble of random projection classifiers is therefore obtained. Experimental results showed that although the performance of our method is not good enough for real applications of hotspots, it is very promising in the determination of hotspot residues from whole sequences.
International Nuclear Information System (INIS)
O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.
1987-01-01
Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats
Energy Technology Data Exchange (ETDEWEB)
Satheshkumar, P.S.; Chavre, James; Moss, Bernard, E-mail: bmoss@nih.gov
2013-09-15
The vaccinia virus O3 protein, a component of the entry–fusion complex, is encoded by all chordopoxviruses. We constructed truncation mutants and demonstrated that the transmembrane domain, which comprises two-thirds of this 35 amino acid protein, is necessary and sufficient for interaction with the entry–fusion complex and function in cell entry. Nevertheless, neither single amino acid substitutions nor alanine scanning mutagenesis revealed essential amino acids within the transmembrane domain. Moreover, replication-competent mutant viruses were generated by randomization of 10 amino acids of the transmembrane domain. Of eight unique viruses, two contained only two amino acids in common with wild type and the remainder contained one or none within the randomized sequence. Although these mutant viruses formed normal size plaques, the entry–fusion complex did not co-purify with the mutant O3 proteins suggesting a less stable interaction. Thus, despite low specific sequence requirements, the transmembrane domain is sufficient for function in entry. - Highlights: • The 35 amino acid O3 protein is required for efficient vaccinia virus entry. • The transmembrane domain of O3 is necessary and sufficient for entry. • Mutagenesis demonstrated extreme sequence flexibility compatible with function.
Comparative genomics of the lactic acid bacteria
Energy Technology Data Exchange (ETDEWEB)
Makarova, K.; Slesarev, A.; Wolf, Y.; Sorokin, A.; Mirkin, B.; Koonin, E.; Pavlov, A.; Pavlova, N.; Karamychev, V.; Polouchine, N.; Shakhova, V.; Grigoriev, I.; Lou, Y.; Rokhsar, D.; Lucas, S.; Huang, K.; Goodstein, D. M.; Hawkins, T.; Plengvidhya, V.; Welker, D.; Hughes, J.; Goh, Y.; Benson, A.; Baldwin, K.; Lee, J. -H.; Diaz-Muniz, I.; Dosti, B.; Smeianov, V; Wechter, W.; Barabote, R.; Lorca, G.; Altermann, E.; Barrangou, R.; Ganesan, B.; Xie, Y.; Rawsthorne, H.; Tamir, D.; Parker, C.; Breidt, F.; Broadbent, J.; Hutkins, R.; O' Sullivan, D.; Steele, J.; Unlu, G.; Saier, M.; Klaenhammer, T.; Richardson, P.; Kozyavkin, S.; Weimer, B.; Mills, D.
2006-06-01
Lactic acid-producing bacteria are associated with various plant and animal niches and play a key role in the production of fermented foods and beverages. We report nine genome sequences representing the phylogenetic and functional diversity of these bacteria. The small genomes of lactic acid bacteria encode a broad repertoire of transporters for efficient carbon and nitrogen acquisition from the nutritionally rich environments they inhabit and reflect a limited range of biosynthetic capabilities that indicate both prototrophic and auxotrophic strains. Phylogenetic analyses, comparison of gene content across the group, and reconstruction of ancestral gene sets indicate a combination of extensive gene loss and key gene acquisitions via horizontal gene transfer during the coevolution of lactic acid bacteria with their habitats.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Dynamic encoding of natural luminance sequences by LGN bursts.
Directory of Open Access Journals (Sweden)
Nicholas A Lesica
2006-07-01
Full Text Available In the lateral geniculate nucleus (LGN of the thalamus, visual stimulation produces two distinct types of responses known as tonic and burst. Due to the dynamics of the T-type Ca(2+ channels involved in burst generation, the type of response evoked by a particular stimulus depends on the resting membrane potential, which is controlled by a network of modulatory connections from other brain areas. In this study, we use simulated responses to natural scene movies to describe how modulatory and stimulus-driven changes in LGN membrane potential interact to determine the luminance sequences that trigger burst responses. We find that at low resting potentials, when the T channels are de-inactivated and bursts are relatively frequent, an excitatory stimulus transient alone is sufficient to evoke a burst. However, to evoke a burst at high resting potentials, when the T channels are inactivated and bursts are relatively rare, prolonged inhibitory stimulation followed by an excitatory transient is required. We also observe evidence of these effects in vivo, where analysis of experimental recordings demonstrates that the luminance sequences that trigger bursts can vary dramatically with the overall burst percentage of the response. To characterize the functional consequences of the effects of resting potential on burst generation, we simulate LGN responses to different luminance sequences at a range of resting potentials with and without a mechanism for generating bursts. Using analysis based on signal detection theory, we show that bursts enhance detection of specific luminance sequences, ranging from the onset of excitatory sequences at low resting potentials to the offset of inhibitory sequences at high resting potentials. These results suggest a dynamic role for burst responses during visual processing that may change according to behavioral state.
Gupta, M K; Niyogi, R; Misra, M
2013-01-01
In this paper, we propose a method to create the 60-dimensional feature vector for protein sequences via the general form of pseudo amino acid composition. The construction of the feature vector is based on the contents of amino acids, total distance of each amino acid from the first amino acid in the protein sequence and the distribution of 20 amino acids. The obtained cosine distance metric (also called the similarity matrix) is used to construct the phylogenetic tree by the neighbour joining method. In order to show the applicability of our approach, we tested it on three proteins: 1) ND5 protein sequences from nine species, 2) ND6 protein sequences from eight species, and 3) 50 coronavirus spike proteins. The results are in agreement with known history and the output from the multiple sequence alignment program ClustalW, which is widely used. We have also compared our phylogenetic results with six other recently proposed alignment-free methods. These comparisons show that our proposed method gives a more consistent biological relationship than the others. In addition, the time complexity is linear and space required is less as compared with other alignment-free methods that use graphical representation. It should be noted that the multiple sequence alignment method has exponential time complexity.
Structure and expression of an unusually acidic matrix protein of pearl oyster shells
International Nuclear Information System (INIS)
Tsukamoto, Daiki; Sarashina, Isao; Endo, Kazuyoshi
2004-01-01
We report identification and characterization of the unusually acidic molluscan shell matrix protein Aspein, which may have important roles in calcium carbonate biomineralization. The Aspein gene (aspein) encodes a sequence of 413 amino acids, including a high proportion of Asp (60.4%), Gly (16.0%), and Ser (13.2%), and the predicted isoelectric point is 1.45; this is the most acidic of all the molluscan shell matrix proteins sequenced so far, or probably even of all known proteins on earth. The main body of Aspein is occupied by (Asp) 2-10 sequences punctuated with Ser-Gly dipeptides. RT-PCR demonstrated that the transcript of aspein is expressed at the outer edge of the mantle, corresponding to the calcitic prismatic layer, but not at the inner part of the mantle, corresponding to the aragonitic nacreous layer. Our findings and previous in vitro experiments taken together suggest that Aspein is responsible for directed formation of calcite in the shell of the pearl oyster Pinctada fucata
Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.
Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice
2007-04-01
A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.
Differential Gene Expression of Longan Under Simulated Acid Rain Stress.
Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang
2017-05-01
Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.
Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P
1993-03-31
Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.
A model for visual memory encoding.
Directory of Open Access Journals (Sweden)
Rodolphe Nenert
Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.
A model for visual memory encoding.
Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P
2014-01-01
Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.
Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66
Directory of Open Access Journals (Sweden)
Bin Liu
2016-06-01
Full Text Available Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA. Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276, with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids.
Pinto, Ameet J.; Sharp, Jonathan O.; Yoder, Michael J.; Almstrand, Robert
2016-01-01
Bacteria belonging to the family Acidimicrobiaceae are frequently encountered in heavy metal-contaminated acidic environments. However, their phylogenetic and metabolic diversity is poorly resolved. We present draft genome sequences of two novel and phylogenetically distinct Acidimicrobiaceae members assembled from an acid mine drainage biofilm metagenome.
Mutant fatty acid desaturase and methods for directed mutagenesis
Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY
2008-01-29
The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.
Molecular cloning of growth hormone encoding cDNA of Indian
Indian Academy of Sciences (India)
A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...
Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C
2001-10-31
Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.
Monascus ruber as cell factory for lactic acid production at low pH.
Weusthuis, Ruud A; Mars, Astrid E; Springer, Jan; Wolbert, Emil Jh; van der Wal, Hetty; de Vrije, Truus G; Levisson, Mark; Leprince, Audrey; Houweling-Tan, G Bwee; Pha Moers, Antoine; Hendriks, Sjon Na; Mendes, Odette; Griekspoor, Yvonne; Werten, Marc Wt; Schaap, Peter J; van der Oost, John; Eggink, Gerrit
2017-07-01
A Monascus ruber strain was isolated that was able to grow on mineral medium at high sugar concentrations and 175g/l lactic acid at pH 2.8. Its genome and transcriptomes were sequenced and annotated. Genes encoding lactate dehydrogenase (LDH) were introduced to accomplish lactic acid production and two genes encoding pyruvate decarboxylase (PDC) were knocked out to subdue ethanol formation. The strain preferred lactic acid to glucose as carbon source, which hampered glucose consumption and therefore also lactic acid production. Lactic acid consumption was stopped by knocking out 4 cytochrome-dependent LDH (CLDH) genes, and evolutionary engineering was used to increase the glucose consumption rate. Application of this strain in a fed-batch fermentation resulted in a maximum lactic acid titer of 190g/l at pH 3.8 and 129g/l at pH 2.8, respectively 1.7 and 2.2 times higher than reported in literature before. Yield and productivity were on par with the best strains described in literature for lactic acid production at low pH. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
CLONING AND SEQUENCING OF PGIP FROM ‘JIN SERIES’ ALMOND (PRUNUS DULCIS
Directory of Open Access Journals (Sweden)
Yuhu Han
2015-12-01
Full Text Available Specific primers synthesized according to conservative regions of polygalacturonase inhibiting protein (PGIP gene were used to amplify Prunus Dulcis genomic DNA by polymerase-chain reaction (PCR. Six bands (pgip1, pgip2, pgip3, pgip4, pgip5 and pgip6 of genes were obtained and cloned into PBS-T vector. According to the length of bands, 717bp, 864bp, 796bp were A1 (pgip1, pgip2, pgip3, A2 (pgip4, A4 (pgip5, pgip6, respectively. DNA sequences showed that the fragments taken together were the gene encoding PGIP. A2 and A3 contained two exons interrupted by one intron, which has GT-AG sequence. Its DNA and amino acid sequences were highly homologies to those from Prunus Persica; Prunus Salicina; Prunus Americana; Prunus Mume, respectively. A conserved lencinerial fragment exists in the derived protein sequence.
Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W
1989-01-01
A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...
Cloning, sequence and expression of the pel gene from an Amycolata sp.
Brühlmann, F; Keen, N T
1997-11-20
The pel gene from an Amycolata sp. encoding a pectate lyase (EC 4.2.2.2) was isolated by activity screening a genomic DNA library in Streptomyces lividans TK24. Subsequent subcloning and sequencing of a 2.3 kb BamHI BglII fragment revealed an open reading frame of 930 nt corresponding to a protein of 29,660 Da. The overall G + C content for the coding region was 65%, with a strong G + C preference in the third (wobble) codon position (93%). A putative ribosome-binding site 5'-GGGAG-3' preceded the translational start codon by 7 base pairs. The Amycolata pectate lyase contains a signal peptide of 26 amino acids, that is cleaved after the sequence Ala-Thr-Ala. The size of the deduced protein as well as its N-terminal amino-acid sequence match the wild-type pectate lyase from the Amycolata sp. Expression of the pel gene in S. lividans TK24 resulted in high pectate lyase activity in the culture supernatant, concomitant with the appearance of a dominant protein band on a sodium dodecyl polyacrylamide gel at 30 kDa. No pectate lyase activity was detected in E. coli BL21 with the pel gene under the strong T7 promotor. The deduced amino-acid sequence showed 40% identity with PelE from Erwinia chrysanthemi and the pectate lyase from Glomerella cingulata. The Amycolata pectate lyase clearly belongs to the pectate lyase superfamily, sharing all functional amino acids and likely has a similar structural topology as Pels from Erwinia chrysanthemi and Bacillus subtilis.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum
International Nuclear Information System (INIS)
Anon.
1986-01-01
Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively
Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium
Cai, Yongping; Lin, Yi
2013-01-01
In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048
Energy Technology Data Exchange (ETDEWEB)
Wei, D; Andrews, G K
1988-01-25
A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.
Role of Virus-Encoded microRNAs in Avian Viral Diseases
Directory of Open Access Journals (Sweden)
Yongxiu Yao
2014-03-01
Full Text Available With total dependence on the host cell, several viruses have adopted strategies to modulate the host cellular environment, including the modulation of microRNA (miRNA pathway through virus-encoded miRNAs. Several avian viruses, mostly herpesviruses, have been shown to encode a number of novel miRNAs. These include the highly oncogenic Marek’s disease virus-1 (26 miRNAs, avirulent Marek’s disease virus-2 (36 miRNAs, herpesvirus of turkeys (28 miRNAs, infectious laryngotracheitis virus (10 miRNAs, duck enteritis virus (33 miRNAs and avian leukosis virus (2 miRNAs. Despite the closer antigenic and phylogenetic relationship among some of the herpesviruses, miRNAs encoded by different viruses showed no sequence conservation, although locations of some of the miRNAs were conserved within the repeat regions of the genomes. However, some of the virus-encoded miRNAs showed significant sequence homology with host miRNAs demonstrating their ability to serve as functional orthologs. For example, mdv1-miR-M4-5p, a functional ortholog of gga-miR-155, is critical for the oncogenicity of Marek’s disease virus. Additionally, we also describe the potential association of the recently described avian leukosis virus subgroup J encoded E (XSR miRNA in the induction of myeloid tumors in certain genetically-distinct chicken lines. In this review, we describe the advances in our understanding on the role of virus-encoded miRNAs in avian diseases.
Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses
Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.
2004-01-01
The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.
Cyclic Concatenated Genetic Encoder: A mathematical proposal for biological inferences.
Duarte-González, M E; Echeverri, O Y; Guevara, J M; Palazzo, R
2018-01-01
The organization of the genetic information and its ability to be conserved and translated to proteins with low error rates have been the subject of study by scientists from different disciplines. Recently, it has been proposed that living organisms display an intra-cellular transmission system of genetic information, similar to a model of digital communication system, in which there is the ability to detect and correct errors. In this work, the concept of Concatenated Genetic Encoder is introduced and applied to the analysis of protein sequences as a tool for exploring evolutionary relationships. For such purposes Error Correcting Codes (ECCs) are used to represent proteins. A methodology for representing or identifying proteins by use of BCH codes over ℤ 20 and F 4 ×ℤ 5 is proposed and cytochrome b6-f complex subunit 6-OS sequences, corresponding to different plants species, are analyzed according to the proposed methodology and results are contrasted to phylogenetic and taxonomic analyses. Through the analyses, it was observed that using BCH codes only some sequences are identified, all of which differ in one amino acid from the original sequence. In addition, mathematical relationships among identified sequences are established by considering minimal polynomials, where such sequences showed a close relationship as revealed in the phylogenetic reconstruction. Results, here shown, point out that communication theory may provide biology of interesting and useful tools to identify biological relationships among proteins, however the proposed methodology needs to be improved and rigorously tested in order to become into an applicable tool for biological analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M
1993-11-01
A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Encoding color information for visual tracking: Algorithms and benchmark.
Liang, Pengpeng; Blasch, Erik; Ling, Haibin
2015-12-01
While color information is known to provide rich discriminative clues for visual inference, most modern visual trackers limit themselves to the grayscale realm. Despite recent efforts to integrate color in tracking, there is a lack of comprehensive understanding of the role color information can play. In this paper, we attack this problem by conducting a systematic study from both the algorithm and benchmark perspectives. On the algorithm side, we comprehensively encode 10 chromatic models into 16 carefully selected state-of-the-art visual trackers. On the benchmark side, we compile a large set of 128 color sequences with ground truth and challenge factor annotations (e.g., occlusion). A thorough evaluation is conducted by running all the color-encoded trackers, together with two recently proposed color trackers. A further validation is conducted on an RGBD tracking benchmark. The results clearly show the benefit of encoding color information for tracking. We also perform detailed analysis on several issues, including the behavior of various combinations between color model and visual tracker, the degree of difficulty of each sequence for tracking, and how different challenge factors affect the tracking performance. We expect the study to provide the guidance, motivation, and benchmark for future work on encoding color in visual tracking.
Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA
DEFF Research Database (Denmark)
Cowell, G M; Kønigshøfer, E; Danielsen, E M
1988-01-01
The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
International Nuclear Information System (INIS)
Feild, M.J.; Armstrong, F.B.
1987-01-01
E. coli JA199 pDU11 harbors a multicopy plasmid containing the ilv GEDAY gene cluster of S. typhimurium. TmB, gene product of ilv E, was purified, crystallized, and subjected to Edman degradation using a gas phase sequencer. The intact protein yielded an amino terminal 31 residue sequence. Both carboxymethylated apoenzyme and [ 3 H]-NaBH-reduced holoenzyme were then subjected to digestion by trypsin. The digests were fractionated using reversed phase HPLC, and the peptides isolated were sequenced. The borohydride-treated holoenzyme was used to isolate the cofactor-binding peptide. The peptide is 27 residues long and a comparison with known sequences of other aminotransferases revealed limited homology. Peptides accounting for 211 of 288 predicted residues have been sequenced, including 9 residues of the carboxyl terminus. Comparison of peptides with the inferred amino acid sequence of the E. coli K-12 enzyme has helped determine the sequence of the amino terminal 59 residues; only two differences between the sequences are noted in this region
Matsuoka, Masanari; Sugita, Masatake; Kikuchi, Takeshi
2014-09-18
Proteins that share a high sequence homology while exhibiting drastically different 3D structures are investigated in this study. Recently, artificial proteins related to the sequences of the GA and IgG binding GB domains of human serum albumin have been designed. These artificial proteins, referred to as GA and GB, share 98% amino acid sequence identity but exhibit different 3D structures, namely, a 3α bundle versus a 4β + α structure. Discriminating between their 3D structures based on their amino acid sequences is a very difficult problem. In the present work, in addition to using bioinformatics techniques, an analysis based on inter-residue average distance statistics is used to address this problem. It was hard to distinguish which structure a given sequence would take only with the results of ordinary analyses like BLAST and conservation analyses. However, in addition to these analyses, with the analysis based on the inter-residue average distance statistics and our sequence tendency analysis, we could infer which part would play an important role in its structural formation. The results suggest possible determinants of the different 3D structures for sequences with high sequence identity. The possibility of discriminating between the 3D structures based on the given sequences is also discussed.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.
Gillner, Danuta M; Bienvenue, David L; Nocek, Boguslaw P; Joachimiak, Andrzej; Zachary, Vincentos; Bennett, Brian; Holz, Richard C
2009-01-01
The catalytic and structural properties of the H67A and H349A dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) from Haemophilus influenzae were investigated. On the basis of sequence alignment with the carboxypeptidase from Pseudomonas sp. strain RS-16, both H67 and H349 were predicted to be Zn(II) ligands. The H67A DapE enzyme exhibited a decreased catalytic efficiency (180-fold) compared with wild-type (WT) DapE towards N-succinyldiaminopimelic acid. No catalytic activity was observed for H349A under the experimental conditions used. The electronic paramagnetic resonance (EPR) and electronic absorption data indicate that the Co(II) ion bound to H349A-DapE is analogous to that of WT DapE after the addition of a single Co(II) ion. The addition of 1 equiv of Co(II) to H67A DapE provides spectra that are very different from those of the first Co(II) binding site of the WT enzyme, but that are similar to those of the second binding site. The EPR and electronic absorption data, in conjunction with the kinetic data, are consistent with the assignment of H67 and H349 as active-site metal ligands for the DapE from H. influenzae. Furthermore, the data suggest that H67 is a ligand in the first metal binding site, while H349 resides in the second metal binding site. A three-dimensional homology structure of the DapE from H. influenzae was generated using the X-ray crystal structure of the DapE from Neisseria meningitidis as a template and superimposed on the structure of the aminopeptidase from Aeromonas proteolytica (AAP). This homology structure confirms the assignment of H67 and H349 as active-site ligands. The superimposition of the homology model of DapE with the dizinc(II) structure of AAP indicates that within 4.0 A of the Zn(II) binding sites of AAP all of the amino acid residues of DapE are nearly identical.
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Storing data encoded DNA in living organisms
Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA
2006-06-06
Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.
Directory of Open Access Journals (Sweden)
Andreas Martin Lisewski
2008-09-01
Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.
International Nuclear Information System (INIS)
Chang, Soo-Ik; Hammes, G.G.
1989-01-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Amino acid sequence analysis of the annexin super-gene family of proteins.
Barton, G J; Newman, R H; Freemont, P S; Crumpton, M J
1991-06-15
The annexins are a widespread family of calcium-dependent membrane-binding proteins. No common function has been identified for the family and, until recently, no crystallographic data existed for an annexin. In this paper we draw together 22 available annexin sequences consisting of 88 similar repeat units, and apply the techniques of multiple sequence alignment, pattern matching, secondary structure prediction and conservation analysis to the characterisation of the molecules. The analysis clearly shows that the repeats cluster into four distinct families and that greatest variation occurs within the repeat 3 units. Multiple alignment of the 88 repeats shows amino acids with conserved physicochemical properties at 22 positions, with only Gly at position 23 being absolutely conserved in all repeats. Secondary structure prediction techniques identify five conserved helices in each repeat unit and patterns of conserved hydrophobic amino acids are consistent with one face of a helix packing against the protein core in predicted helices a, c, d, e. Helix b is generally hydrophobic in all repeats, but contains a striking pattern of repeat-specific residue conservation at position 31, with Arg in repeats 4 and Glu in repeats 2, but unconserved amino acids in repeats 1 and 3. This suggests repeats 2 and 4 may interact via a buried saltbridge. The loop between predicted helices a and b of repeat 3 shows features distinct from the equivalent loop in repeats 1, 2 and 4, suggesting an important structural and/or functional role for this region. No compelling evidence emerges from this study for uteroglobin and the annexins sharing similar tertiary structures, or for uteroglobin representing a derivative of a primordial one-repeat structure that underwent duplication to give the present day annexins. The analyses performed in this paper are re-evaluated in the Appendix, in the light of the recently published X-ray structure for human annexin V. The structure confirms most of
Exploring the influence of encoding format on subsequent memory.
Turney, Indira C; Dennis, Nancy A; Maillet, David; Rajah, M Natasha
2017-05-01
Distinctive encoding is greatly influenced by gist-based processes and has been shown to suffer when highly similar items are presented in close succession. Thus, elucidating the mechanisms underlying how presentation format affects gist processing is essential in determining the factors that influence these encoding processes. The current study utilised multivariate partial least squares (PLS) analysis to identify encoding networks directly associated with retrieval performance in a blocked and intermixed presentation condition. Subsequent memory analysis for successfully encoded items indicated no significant differences between reaction time and retrieval performance and presentation format. Despite no significant behavioural differences, behaviour PLS revealed differences in brain-behaviour correlations and mean condition activity in brain regions associated with gist-based vs. distinctive encoding. Specifically, the intermixed format encouraged more distinctive encoding, showing increased activation of regions associated with strategy use and visual processing (e.g., frontal and visual cortices, respectively). Alternatively, the blocked format exhibited increased gist-based processes, accompanied by increased activity in the right inferior frontal gyrus. Together, results suggest that the sequence that information is presented during encoding affects the degree to which distinctive encoding is engaged. These findings extend our understanding of the Fuzzy Trace Theory and the role of presentation format on encoding processes.
Prediction of novel archaeal enzymes from sequence-derived features
DEFF Research Database (Denmark)
Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren
2002-01-01
The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....
Schoone, G. J.; Oskam, L.; Kroon, N. C.; Schallig, H. D.; Omar, S. A.
2000-01-01
A quantitative nucleic acid sequence-based amplification (QT-NASBA) assay for the detection of Plasmodium parasites has been developed. Primers and probes were selected on the basis of the sequence of the small-subunit rRNA gene. Quantification was achieved by coamplification of the RNA in the
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Genetically encoded fluorescent coumarin amino acids
Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.
2010-10-05
The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.
Yuhara, Kahori; Yonehara, Hiromi; Hattori, Takasumi; Kobayashi, Keiichi; Kirimura, Kohtaro
2015-11-01
trans-Aconitic acid is an unsaturated organic acid that is present in some plants such as soybean and wheat; however, it remains unclear how trans-aconitic acid is degraded and/or assimilated by living cells in nature. From soil, we isolated Pseudomonas sp. WU-0701 assimilating trans-aconitic acid as a sole carbon source. In the cell-free extract of Pseudomonas sp. WU-0701, aconitate isomerase (AI; EC 5.3.3.7) activity was detected. Therefore, it seems likely that strain Pseudomonas sp. WU-0701 converts trans-aconitic acid to cis-aconitic acid with AI, and assimilates this via the tricarboxylic acid cycle. For the characterization of AI from Pseudomonas sp. WU-0701, we performed purification, determination of enzymatic properties and gene identification of AI. The molecular mass of AI purified from cell-free extract was estimated to be ~ 25 kDa by both SDS/PAGE and gel filtration analyses, indicating that AI is a monomeric enzyme. The optimal pH and temperature of purified AI for the reaction were 6.0 °C and 37 °C, respectively. The gene ais encoding AI was cloned on the basis of the N-terminal amino acid sequence of the protein, and Southern blot analysis revealed that only one copy of ais is located on the bacterial genome. The gene ais contains an ORF of 786 bp, encoding a polypeptide of 262 amino acids, including the N-terminal 22 amino acids as a putative periplasm-targeting signal peptide. It is noteworthy that the amino acid sequence of AI shows 90% and 74% identity with molybdenum ABC transporter substrate-binding proteins of Pseudomonas psychrotolerans and Xanthomonas albilineans, respectively. This is the first report on purification to homogeneity, characterization and gene identification of AI. The nucleotide sequence of ais described in this article is available in the DDBJ/EMBL/GenBank nucleotide sequence databases under the Accession No. LC010980. © 2015 FEBS.
Huerlimann, Roger
2015-07-01
The understanding of algal phylogeny is being impeded by an unknown number of events of horizontal gene transfer (HGT), and primary and secondary/tertiary endosymbiosis. Through these events, previously heterotrophic eukaryotes developed photosynthesis and acquired new biochemical pathways. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the fatty acid synthesis and elongation pathways in algae, where ACCase exists in two locations (cytosol and plastid) and in two forms (homomeric and heteromeric). All algae contain nucleus-encoded homomeric ACCase in the cytosol, independent of the origin of the plastid. Nucleus-encoded homomeric ACCase is also found in plastids of algae that arose from a secondary/tertiary endosymbiotic event. In contrast, plastids of algae that arose from a primary endosymbiotic event contain heteromeric ACCase, which consists of three nucleus-encoded and one plastid-encoded subunits. These properties of ACCase provide the potential to inform on the phylogenetic relationships of hosts and their plastids, allowing different hypothesis of endosymbiotic events to be tested. Alveolata (Dinoflagellata and Apicomplexa) and Chromista (Stramenopiles, Haptophyta and Cryptophyta) have traditionally been grouped together as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases were isolated from Isochrysis aff. galbana (TISO), Chromera velia and Nannochloropsis oculata, representing three taxonomic groups for which sequences were lacking. Phylogenetic analyses show that cytosolic ACCase strongly supports the SAR grouping. Conversely, plastidial ACCase groups the SAR with the Haptophyta, Cryptophyta and Prasinophyceae (Chlorophyta). These two ACCase based, phylogenetic relationships suggest that the plastidial homomeric ACCase was acquired by the
The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase
Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.
2009-01-01
Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826
Amiguet-Vercher, Amélia; Santuari, Luca; Gonzalez-Guzman, Miguel; Depuydt, Stephen; Rodriguez, Pedro L; Hardtke, Christian S
2015-02-01
Natural genetic variation is crucial for adaptability of plants to different environments. Seed dormancy prevents precocious germination in unsuitable conditions and is an adaptation to a major macro-environmental parameter, the seasonal variation in temperature and day length. Here we report the isolation of IBO, a quantitative trait locus (QTL) that governs c. 30% of germination rate variance in an Arabidopsis recombinant inbred line (RIL) population derived from the parental accessions Eilenburg-0 (Eil-0) and Loch Ness-0 (Lc-0). IBO encodes an uncharacterized phosphatase 2C-related protein, but neither the Eil-0 nor the Lc-0 variant, which differ in a single amino acid, have any appreciable phosphatase activity in in vitro assays. However, we found that the amino acid change in the Lc-0 variant of the IBO protein confers reduced germination rate. Moreover, unlike the Eil-0 variant of the protein, the Lc-0 variant can interfere with the activity of the phosphatase 2C ABSCISIC ACID INSENSITIVE 1 in vitro. This suggests that the Lc-0 variant possibly interferes with abscisic acid signaling, a notion that is supported by physiological assays. Thus, we isolated an example of a QTL allele with a nonsynonymous amino acid change that might mediate local adaptation of seed germination timing. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Directory of Open Access Journals (Sweden)
Bharat Bhusan Patnaik
Full Text Available Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens.Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4, at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC. SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC. The activity of the purified protein was tested against selected Gram +/- bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp. In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5'- and 3'-rapid amplification of cDNA ends (RACE-PCR. The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps involved in plant development and defense.The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit
Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo
2012-01-01
Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found
Directory of Open Access Journals (Sweden)
Smith-Keune Carolyn
2008-02-01
Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-β superfamily that negatively regulates growth of skeletal muscle tissue. The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. This gene potentially represents an important target for growth improvement of cultured finfish. Results Here we report molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer MSTN-1 gene. The barramundi MSTN-1 was encoded by three exons 379, 371 and 381 bp in length and translated into a 376-amino acid peptide. Intron 1 and 2 were 412 and 819 bp in length and presented typical GT...AG splicing sites. The upstream region contained cis-regulatory elements such as TATA-box and E-boxes. A first assessment of sequence variability suggested that higher mutation rates are found in the 5' flanking region with several SNP's present in this species. A putative micro RNA target site has also been observed in the 3'UTR (untranslated region and is highly conserved across teleost fish. The deduced amino acid sequence was conserved across vertebrates and exhibited characteristic conserved putative functional residues including a cleavage motif of proteolysis (RXXR, nine cysteines and two glycosilation sites. A qualitative analysis of the barramundi MSTN-1 expression pattern revealed that, in adult fish, transcripts are differentially expressed in various tissues other than skeletal muscles including gill, heart, kidney, intestine, liver, spleen, eye, gonad and brain. Conclusion Our findings provide valuable insights such as sequence variation and genomic information which will aid the further investigation of the barramundi MSTN-1 gene in association with growth. The finding for the first time in finfish MSTN of a miRNA target site in the 3'UTR provides an opportunity for the identification of regulatory mutations on the
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
ACID: annotation of cassette and integron data
Directory of Open Access Journals (Sweden)
Stokes Harold W
2009-04-01
Full Text Available Abstract Background Although integrons and their associated gene cassettes are present in ~10% of bacteria and can represent up to 3% of the genome in which they are found, very few have been properly identified and annotated in public databases. These genetic elements have been overlooked in comparison to other vectors that facilitate lateral gene transfer between microorganisms. Description By automating the identification of integron integrase genes and of the non-coding cassette-associated attC recombination sites, we were able to assemble a database containing all publicly available sequence information regarding these genetic elements. Specialists manually curated the database and this information was used to improve the automated detection and annotation of integrons and their encoded gene cassettes. ACID (annotation of cassette and integron data can be searched using a range of queries and the data can be downloaded in a number of formats. Users can readily annotate their own data and integrate it into ACID using the tools provided. Conclusion ACID is a community resource providing easy access to annotations of integrons and making tools available to detect them in novel sequence data. ACID also hosts a forum to prompt integron-related discussion, which can hopefully lead to a more universal definition of this genetic element.
Directory of Open Access Journals (Sweden)
Igor R. Costa
2014-12-01
Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.
The amino acid sequences and activities of synergistic hemolysins from Staphylococcus cohnii.
Mak, Pawel; Maszewska, Agnieszka; Rozalska, Malgorzata
2008-10-01
Staphylococcus cohnii ssp. cohnii and S. cohnii ssp. urealyticus are a coagulase-negative staphylococci considered for a long time as unable to cause infections. This situation changed recently and pathogenic strains of these bacteria were isolated from hospital environments, patients and medical staff. Most of the isolated strains were resistant to many antibiotics. The present work describes isolation and characterization of several synergistic peptide hemolysins produced by these bacteria and acting as virulence factors responsible for hemolytic and cytotoxic activities. Amino acid sequences of respective hemolysins from S. cohnii ssp. cohnii (named as H1C, H2C and H3C) and S. cohnii ssp. urealyticus (H1U, H2U and H3U) were identical. Peptides H1 and H3 possessed significant amino acid homology to three synergistic hemolysins secreted by Staphylococcus lugdunensis and to putative antibacterial peptide produced by Staphylococcus saprophyticus ssp. saprophyticus. On the other hand, hemolysin H2 had a unique sequence. All isolated peptides lysed red cells from different mammalian species and exerted a cytotoxic effect on human fibroblasts.
Yunus, Abdul S; Govindarajan, Dhanasekaran; Huang, Zhuhui; Samal, Siba K
2003-05-01
We report here the nucleotide and deduced amino acid (aa) sequences of the small hydrophobic (SH) gene of the avian pneumovirus strain Colorado (APV/CO). The SH gene of APV/CO is 628 nucleotides in length from gene-start to gene-end. The longest ORF of the SH gene encoded a protein of 177 aas in length. Comparison of the deduced aa sequence of the SH protein of APV/CO with the corresponding published sequences of other members of genera metapneumovirus showed 28% identity with the newly discovered human metapneumovirus (hMPV), but no discernable identity with the APV subgroup A or B. Collectively, this data supports the hypothesis that: (i) APV/CO is distinct from European APV subgroups and belongs to the novel subgroup APV/C (APV/US); (ii) APV/CO is more closely related to hMPV, a mammalian metapneumovirus, than to either APV subgroup A or B. The SH gene of APV/CO was cloned using a genomic walk strategy which initiated cDNA synthesis from genomic RNA that traversed the genes in the order 3'-M-F-M2-SH-G-5', thus confirming that gene-order of APV/CO conforms in the genus Metapneumovirus. We also provide the sequences of transcription-signals and the M-F, F-M2, M2-SH and SH-G intergenic regions of APV/CO.
Directory of Open Access Journals (Sweden)
Wen-Bin Xue
2016-07-01
Full Text Available The green alga Myrmecia incisa is one of the richest natural sources of arachidonic acid (ArA. To better understand the regulation of ArA biosynthesis in M. incisa, a novel gene putatively encoding the Δ9 fatty acid desaturase (FAD was cloned and characterized for the first time. Rapid-amplification of cDNA ends (RACE was employed to yield a full length cDNA designated as MiΔ9FAD, which is 2442 bp long in sequence. Comparing cDNA open reading frame (ORF sequence to genomic sequence indicated that there are 8 introns interrupting the coding region. The deduced MiΔ9FAD protein is composed of 432 amino acids. It is soluble and localized in the chloroplast, as evidenced by the absence of transmembrane domains as well as the presence of a 61-amino acid chloroplast transit peptide. Multiple sequence alignment of amino acids revealed two conserved histidine-rich motifs, typical for Δ9 acyl-acyl carrier protein (ACP desaturases. To determine the function of MiΔ9FAD, the gene was heterologously expressed in a Saccharomyces cerevisiae mutant strain with impaired desaturase activity. Results of GC-MS analysis indicated that MiΔ9FAD was able to restore the synthesis of monounsaturated fatty acids, generating palmitoleic acid and oleic acid through the addition of a double bond in the Δ9 position of palmitic acid and stearic acid, respectively.
International Nuclear Information System (INIS)
Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.
1987-01-01
A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 47 5 , respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association
Reiz, Bela; Li, Liang
2010-09-01
Controlled hydrolysis of proteins to generate peptide ladders combined with mass spectrometric analysis of the resultant peptides can be used for protein sequencing. In this paper, two methods of improving the microwave-assisted protein hydrolysis process are described to enable rapid sequencing of proteins containing disulfide bonds and increase sequence coverage, respectively. It was demonstrated that proteins containing disulfide bonds could be sequenced by MS analysis by first performing hydrolysis for less than 2 min, followed by 1 h of reduction to release the peptides originally linked by disulfide bonds. It was shown that a strong base could be used as a catalyst for microwave-assisted protein hydrolysis, producing complementary sequence information to that generated by microwave-assisted acid hydrolysis. However, using either acid or base hydrolysis, amide bond breakages in small regions of the polypeptide chains of the model proteins (e.g., cytochrome c and lysozyme) were not detected. Dynamic light scattering measurement of the proteins solubilized in an acid or base indicated that protein-protein interaction or aggregation was not the cause of the failure to hydrolyze certain amide bonds. It was speculated that there were some unknown local structures that might play a role in preventing an acid or base from reacting with the peptide bonds therein. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Blake T Hovde
Full Text Available Haptophytes are recognized as seminal players in aquatic ecosystem function. These algae are important in global carbon sequestration, form destructive harmful blooms, and given their rich fatty acid content, serve as a highly nutritive food source to a broad range of eco-cohorts. Haptophyte dominance in both fresh and marine waters is supported by the mixotrophic nature of many taxa. Despite their importance the nuclear genome sequence of only one haptophyte, Emiliania huxleyi (Isochrysidales, is available. Here we report the draft genome sequence of Chrysochromulina tobin (Prymnesiales, and transcriptome data collected at seven time points over a 24-hour light/dark cycle. The nuclear genome of C. tobin is small (59 Mb, compact (∼ 40% of the genome is protein coding and encodes approximately 16,777 genes. Genes important to fatty acid synthesis, modification, and catabolism show distinct patterns of expression when monitored over the circadian photoperiod. The C. tobin genome harbors the first hybrid polyketide synthase/non-ribosomal peptide synthase gene complex reported for an algal species, and encodes potential anti-microbial peptides and proteins involved in multidrug and toxic compound extrusion. A new haptophyte xanthorhodopsin was also identified, together with two "red" RuBisCO activases that are shared across many algal lineages. The Chrysochromulina tobin genome sequence provides new information on the evolutionary history, ecology and economic importance of haptophytes.
Application of Ammonium Persulfate for Selective Oxidation of Guanines for Nucleic Acid Sequencing
Directory of Open Access Journals (Sweden)
Yafen Wang
2017-07-01
Full Text Available Nucleic acids can be sequenced by a chemical procedure that partially damages the nucleotide positions at their base repetition. Many methods have been reported for the selective recognition of guanine. The accurate identification of guanine in both single and double regions of DNA and RNA remains a challenging task. Herein, we present a new, non-toxic and simple method for the selective recognition of guanine in both DNA and RNA sequences via ammonium persulfate modification. This strategy can be further successfully applied to the detection of 5-methylcytosine by using PCR.
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
Suzuki, Shun'ichi; Takenaka, Yasuhiro; Onishi, Norimasa; Yokozeki, Kenzo
2005-08-01
A DNA fragment from Microbacterium liquefaciens AJ 3912, containing the genes responsible for the conversion of 5-substituted-hydantoins to alpha-amino acids, was cloned in Escherichia coli and sequenced. Seven open reading frames (hyuP, hyuA, hyuH, hyuC, ORF1, ORF2, and ORF3) were identified on the 7.5 kb fragment. The deduced amino acid sequence encoded by the hyuA gene included the N-terminal amino acid sequence of the hydantoin racemase from M. liquefaciens AJ 3912. The hyuA, hyuH, and hyuC genes were heterologously expressed in E. coli; their presence corresponded with the detection of hydantoin racemase, hydantoinase, and N-carbamoyl alpha-amino acid amido hydrolase enzymatic activities respectively. The deduced amino acid sequences of hyuP were similar to those of the allantoin (5-ureido-hydantoin) permease from Saccharomyces cerevisiae, suggesting that hyuP protein might function as a hydantoin transporter.
The amino acid sequence of cytochrome c from Cucurbita maxima L. (pumpkin)
Thompson, E. W.; Richardson, M.; Boulter, D.
1971-01-01
The amino acid sequence of pumpkin cytochrome c was determined on 2μmol of protein. Some evidence was found for the occurrence of two forms of cytochrome c, whose sequences differed in three positions. Pumpkin cytochrome c consists of 111 residues and is homologous with mitochondrial cytochromes c from other plants. Experimental details are given in a supplementary paper that has been deposited as Supplementary Publication SUP 50005 at the National Lending Library for Science and Technology, Boston Spa, Yorks. LS23 7BQ, U.K., from whom copies can be obtained on the terms indicated in Biochem. J. (1971), 121, 7. PMID:5131733
Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.
Directory of Open Access Journals (Sweden)
Qing Jin
Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
A deep learning method for lincRNA detection using auto-encoder algorithm.
Yu, Ning; Yu, Zeng; Pan, Yi
2017-12-06
RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly
An Information Theoretic Characterisation of Auditory Encoding
Overath, Tobias; Cusack, Rhodri; Kumar, Sukhbinder; von Kriegstein, Katharina; Warren, Jason D; Grube, Manon; Carlyon, Robert P; Griffiths, Timothy D
2007-01-01
The entropy metric derived from information theory provides a means to quantify the amount of information transmitted in acoustic streams like speech or music. By systematically varying the entropy of pitch sequences, we sought brain areas where neural activity and energetic demands increase as a function of entropy. Such a relationship is predicted to occur in an efficient encoding mechanism that uses less computational resource when less information is present in the signal: we specifically tested the hypothesis that such a relationship is present in the planum temporale (PT). In two convergent functional MRI studies, we demonstrated this relationship in PT for encoding, while furthermore showing that a distributed fronto-parietal network for retrieval of acoustic information is independent of entropy. The results establish PT as an efficient neural engine that demands less computational resource to encode redundant signals than those with high information content. PMID:17958472
Multi-Temporal Land Cover Classification with Sequential Recurrent Encoders
Rußwurm, Marc; Körner, Marco
2018-03-01
Earth observation (EO) sensors deliver data with daily or weekly temporal resolution. Most land use and land cover (LULC) approaches, however, expect cloud-free and mono-temporal observations. The increasing temporal capabilities of today's sensors enables the use of temporal, along with spectral and spatial features. Domains, such as speech recognition or neural machine translation, work with inherently temporal data and, today, achieve impressive results using sequential encoder-decoder structures. Inspired by these sequence-to-sequence models, we adapt an encoder structure with convolutional recurrent layers in order to approximate a phenological model for vegetation classes based on a temporal sequence of Sentinel 2 (S2) images. In our experiments, we visualize internal activations over a sequence of cloudy and non-cloudy images and find several recurrent cells, which reduce the input activity for cloudy observations. Hence, we assume that our network has learned cloud-filtering schemes solely from input data, which could alleviate the need for tedious cloud-filtering as a preprocessing step for many EO approaches. Moreover, using unfiltered temporal series of top-of-atmosphere (TOA) reflectance data, we achieved in our experiments state-of-the-art classification accuracies on a large number of crop classes with minimal preprocessing compared to other classification approaches.
Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end
Energy Technology Data Exchange (ETDEWEB)
Mankoo, B S; Dalgleish, R
1988-03-25
The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.
Starus, Anna; Nocek, Boguslaw; Bennett, Brian; Larrabee, James A.; Shaw, Daniel L.; Sae-Lee, Wisath; Russo, Marie T.; Gillner, Danuta M.; Makowska-Grzyska, Magdalena; Joachimiak, Andrzej; Holz, Richard C.
2015-01-01
Binding of the competitive inhibitor L-captopril to the dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase from Neisseria meningitidis (NmDapE) was examined by kinetic, spectroscopic, and crystallographic methods. L-Captopril, an angiotensin-converting enzyme (ACE) inhibitor, was previously shown to be a potent inhibitor of the DapE from Haemophilus influenzae (HiDapE) with an IC50 of 3.3 μM and a measured Ki of 1.8 μM and displayed a dose-responsive antibiotic activity toward Esch...
Polynucleotides encoding polypeptides having beta-glucosidase activity
Harris, Paul; Golightly, Elizabeth
2010-03-02
The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.
Kuznetsov, Igor B; McDuffie, Michael
2015-05-07
Alignment of amino acid sequences is the main sequence comparison method used in computational molecular biology. The selection of the amino acid substitution matrix best suitable for a given alignment problem is one of the most important decisions the user has to make. In a conventional amino acid substitution matrix all elements are fixed and their values cannot be easily adjusted. Moreover, most existing amino acid substitution matrices account for the average (dis)similarities between amino acid types and do not distinguish the contribution of a specific biochemical property to these (dis)similarities. PR2ALIGN is a stand-alone software program and a web-server that provide the functionality for implementing flexible user-specified alignment scoring functions and aligning pairs of amino acid sequences based on the comparison of the profiles of biochemical properties of these sequences. Unlike the conventional sequence alignment methods that use 20x20 fixed amino acid substitution matrices, PR2ALIGN uses a set of weighted biochemical properties of amino acids to measure the distance between pairs of aligned residues and to find an optimal minimal distance global alignment. The user can provide any number of amino acid properties and specify a weight for each property. The higher the weight for a given property, the more this property affects the final alignment. We show that in many cases the approach implemented in PR2ALIGN produces better quality pair-wise alignments than the conventional matrix-based approach. PR2ALIGN will be helpful for researchers who wish to align amino acid sequences by using flexible user-specified alignment scoring functions based on the biochemical properties of amino acids instead of the amino acid substitution matrix. To the best of the authors' knowledge, there are no existing stand-alone software programs or web-servers analogous to PR2ALIGN. The software is freely available from http://pr2align.rit.albany.edu.
Polypeptides having catalase activity and polynucleotides encoding same
Energy Technology Data Exchange (ETDEWEB)
Liu, Ye; Duan, Junxin; Zhang, Yu; Tang, Lan
2017-05-02
Provided are isolated polypeptides having catalase activity and polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
Hegeman, Carla E.; Grabau, Elizabeth A.
2001-01-01
Phytic acid (myo-inositol hexakisphosphate) is the major storage form of phosphorus in plant seeds. During germination, stored reserves are used as a source of nutrients by the plant seedling. Phytic acid is degraded by the activity of phytases to yield inositol and free phosphate. Due to the lack of phytases in the non-ruminant digestive tract, monogastric animals cannot utilize dietary phytic acid and it is excreted into manure. High phytic acid content in manure results in elevated phosphorus levels in soil and water and accompanying environmental concerns. The use of phytases to degrade seed phytic acid has potential for reducing the negative environmental impact of livestock production. A phytase was purified to electrophoretic homogeneity from cotyledons of germinated soybeans (Glycine max L. Merr.). Peptide sequence data generated from the purified enzyme facilitated the cloning of the phytase sequence (GmPhy) employing a polymerase chain reaction strategy. The introduction of GmPhy into soybean tissue culture resulted in increased phytase activity in transformed cells, which confirmed the identity of the phytase gene. It is surprising that the soybean phytase was unrelated to previously characterized microbial or maize (Zea mays) phytases, which were classified as histidine acid phosphatases. The soybean phytase sequence exhibited a high degree of similarity to purple acid phosphatases, a class of metallophosphoesterases. PMID:11500558
Cutfield, J F; Cutfield, S M; Carne, A; Emdin, S O; Falkmer, S
1986-07-01
Insulin from the principal islets of the teleost fish, Cottus scorpius (daddy sculpin), has been isolated and sequenced. Purification involved acid/alcohol extraction, gel filtration, and reverse-phase high-performance liquid chromatography to yield nearly 1 mg pure insulin/g wet weight islet tissue. Biological potency was estimated as 40% compared to porcine insulin. The sculpin insulin crystallised in the absence of zinc ions although zinc is known to be present in the islets in significant amounts. Two other hormones, glucagon and pancreatic polypeptide, were copurified with the insulin, and an N-terminal sequence for pancreatic polypeptide was determined. The primary structure of sculpin insulin shows a number of sequence changes unique so far amongst teleost fish. These changes occur at A14 (Arg), A15 (Val), and B2 (Asp). The B chain contains 29 amino acids and there is no N-terminal extension as seen with several other fish. Presumably as a result of the amino acid substitutions, sculpin insulin does not readily form crystals containing zinc-insulin hexamers, despite the presence of the coordinating B10 His.
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Molecular cloning and nucleotide sequence of cDNA for human liver arginase
International Nuclear Information System (INIS)
Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.
1987-01-01
Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes
Directory of Open Access Journals (Sweden)
Shuiyuan Cheng
2016-03-01
Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.
Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang
2016-03-08
Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
ERPs and oscillations during encoding predict retrieval of digit memory in superior mnemonists.
Pan, Yafeng; Li, Xianchun; Chen, Xi; Ku, Yixuan; Dong, Yujie; Dou, Zheng; He, Lin; Hu, Yi; Li, Weidong; Zhou, Xiaolin
2017-10-01
Previous studies have consistently demonstrated that superior mnemonists (SMs) outperform normal individuals in domain-specific memory tasks. However, the neural correlates of memory-related processes remain unclear. In the current EEG study, SMs and control participants performed a digit memory task during which their brain activity was recorded. Chinese SMs used a digit-image mnemonic for encoding digits, in which they associated 2-digit groups with images immediately after the presentation of each even-position digit in sequences. Behaviorally, SMs' memory of digit sequences was better than the controls'. During encoding in the study phase, SMs showed an increased right central P2 (150-250ms post onset) and a larger right posterior high-alpha (10-14Hz, 500-1720ms) oscillation on digits at even-positions compared with digits at odd-positions. Both P2 and high-alpha oscillations in the study phase co-varied with performance in the recall phase, but only in SMs, indicating that neural dynamics during encoding could predict successful retrieval of digit memory in SMs. Our findings suggest that representation of a digit sequence in SMs using mnemonics may recruit both the early-stage attention allocation process and the sustained information preservation process. This study provides evidence for the role of dynamic and efficient neural encoding processes in mnemonists. Copyright © 2017. Published by Elsevier Inc.
Arend, J; Warzecha, H; Stöckigt, J
2000-01-01
Plant cell suspension cultures of Rauvolfia are able to produce a high amount of arbutin by glucosylation of exogenously added hydroquinone. A four step purification procedure using anion exchange, hydrophobic interaction, hydroxyapatite-chromatography and chromatofocusing delivered in a yield of 0.5%, an approximately 390 fold enrichment of the involved glucosyltransferase. SDS-PAGE showed a M(r) for the enzyme of 52 kDa. Proteolysis of the pure enzyme with endoproteinase LysC revealed six peptide fragments with 9-23 amino acids which were sequenced. Sequence alignment of the six peptides showed high homologies to glycosyltransferases from other higher plants.
Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)
1994-01-01
The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.
Directory of Open Access Journals (Sweden)
Abhishek Walia
2015-12-01
Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.
Bogerd, H P; Wiegand, H L; Yang, J; Cullen, B R
2000-10-01
Nuclear export of the incompletely spliced mRNAs encoded by several complex retroviruses, including human immunodeficiency virus type 1 (HIV-1), is dependent on a virally encoded adapter protein, termed Rev in HIV-1, that directly binds both to a cis-acting viral RNA target site and to the cellular Crm1 export factor. Human endogenous retrovirus K, a family of ancient endogenous retroviruses that is not related to the exogenous retrovirus HIV-1, was recently shown to also encode a Crm1-dependent nuclear RNA export factor, termed K-Rev. Although HIV-1 Rev and K-Rev display little sequence identity, they share the ability not only to bind to Crm1 and to RNA but also to form homomultimers and shuttle between nucleus and cytoplasm. We have used mutational analysis to identify sequences in the 105-amino-acid K-Rev protein required for each of these distinct biological activities. While mutations in K-Rev that inactivate any one of these properties also blocked K-Rev-dependent nuclear RNA export, several K-Rev mutants were comparable to wild type when assayed for any of these individual activities yet nevertheless defective for RNA export. Although several nonfunctional K-Rev mutants acted as dominant negative inhibitors of K-Rev-, but not HIV-1 Rev-, dependent RNA export, these were not defined by their inability to bind to Crm1, as is seen with HIV-1 Rev. In total, this analysis suggests a functional architecture for K-Rev that is similar to, but distinct from, that described for HIV-1 Rev and raises the possibility that viral RNA export mediated by the approximately 25 million-year-old K-Rev protein may require an additional cellular cofactor that is not required for HIV-1 Rev function.
An encoding device and a method of encoding
DEFF Research Database (Denmark)
2012-01-01
The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....
Evolution of sequence-defined highly functionalized nucleic acid polymers
Chen, Zhen; Lichtor, Phillip A.; Berliner, Adrian P.; Chen, Jonathan C.; Liu, David R.
2018-03-01
The evolution of sequence-defined synthetic polymers made of building blocks beyond those compatible with polymerase enzymes or the ribosome has the potential to generate new classes of receptors, catalysts and materials. Here we describe a ligase-mediated DNA-templated polymerization and in vitro selection system to evolve highly functionalized nucleic acid polymers (HFNAPs) made from 32 building blocks that contain eight chemically diverse side chains on a DNA backbone. Through iterated cycles of polymer translation, selection and reverse translation, we discovered HFNAPs that bind proprotein convertase subtilisin/kexin type 9 (PCSK9) and interleukin-6, two protein targets implicated in human diseases. Mutation and reselection of an active PCSK9-binding polymer yielded evolved polymers with high affinity (KD = 3 nM). This evolved polymer potently inhibited the binding between PCSK9 and the low-density lipoprotein receptor. Structure-activity relationship studies revealed that specific side chains at defined positions in the polymers are required for binding to their respective targets. Our findings expand the chemical space of evolvable polymers to include densely functionalized nucleic acids with diverse, researcher-defined chemical repertoires.
Role of sequence and structural polymorphism on the mechanical properties of amyloid fibrils.
Directory of Open Access Journals (Sweden)
Gwonchan Yoon
Full Text Available Amyloid fibrils playing a critical role in disease expression, have recently been found to exhibit the excellent mechanical properties such as elastic modulus in the order of 10 GPa, which is comparable to that of other mechanical proteins such as microtubule, actin filament, and spider silk. These remarkable mechanical properties of amyloid fibrils are correlated with their functional role in disease expression. This suggests the importance in understanding how these excellent mechanical properties are originated through self-assembly process that may depend on the amino acid sequence. However, the sequence-structure-property relationship of amyloid fibrils has not been fully understood yet. In this work, we characterize the mechanical properties of human islet amyloid polypeptide (hIAPP fibrils with respect to their molecular structures as well as their amino acid sequence by using all-atom explicit water molecular dynamics (MD simulation. The simulation result suggests that the remarkable bending rigidity of amyloid fibrils can be achieved through a specific self-aggregation pattern such as antiparallel stacking of β strands (peptide chain. Moreover, we have shown that a single point mutation of hIAPP chain constituting a hIAPP fibril significantly affects the thermodynamic stability of hIAPP fibril formed by parallel stacking of peptide chain, and that a single point mutation results in a significant change in the bending rigidity of hIAPP fibrils formed by antiparallel stacking of β strands. This clearly elucidates the role of amino acid sequence on not only the equilibrium conformations of amyloid fibrils but also their mechanical properties. Our study sheds light on sequence-structure-property relationships of amyloid fibrils, which suggests that the mechanical properties of amyloid fibrils are encoded in their sequence-dependent molecular architecture.
Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N
1992-12-01
The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.
International Nuclear Information System (INIS)
Quackenbush, E.; Clabby, M.; Gottesdiener, K.M.; Barbosa, J.; Jones, N.H.; Strominger, J.L.; Speck, S.; Leiden, J.M.
1987-01-01
Complementary DNA (cDNA) clones encoding the heavy chain of the heterodimeric human membrane glycoprotein 4F2 have been isolated by immunoscreening of a λgt11 expression library. The identity of these clones has been confirmed by hybridization to RNA and DNA prepared from mouse L-cell transfectants, which were produced by whole cell gene transfer and selected for cell-surface expression of the human 4F2 heavy chain. DNA sequence analysis suggest that the 4F2 heavy-chain cDNAs encode an approximately 526-amino acid type II membrane glycoprotein, which is composed of a large C-terminal extracellular domain, a single potential transmembrane region, and a 50-81 amino acid N-terminal intracytoplasmic domain. Southern blotting experiments have shown that the 4F2 heavy-chain cDNAs are derived from a single-copy gene that has been highly conserved during mammalian evolution
Cosper, Nathaniel J; Bienvenue, David L; Shokes, Jacob E; Gilner, Danuta M; Tsukamoto, Takashi; Scott, Robert A; Holz, Richard C
2003-12-03
The Zn K-edge extended X-ray absorption fine structure (EXAFS) spectra, of the dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) from Haemophilus influenzae have been recorded in the presence of one or two equivalents of Zn(II) (i.e. [Zn_(DapE)] and [ZnZn(DapE)]). The Fourier transforms of the Zn EXAFS are dominated by a peak at ca. 2.0 A, which can be fit for both [Zn_(DapE)] and [ZnZn(DapE)], assuming ca. 5 (N,O) scatterers at 1.96 and 1.98 A, respectively. A second-shell feature at ca. 3.34 A appears in the [ZnZn(DapE)] EXAFS spectrum but is significantly diminished in [Zn_(DapE)]. These data show that DapE contains a dinuclear Zn(II) active site. Since no X-ray crystallographic data are available for any DapE enzyme, these data provide the first glimpse at the active site of DapE enzymes. In addition, the EXAFS data for DapE incubated with two competitive inhibitors, 2-carboxyethylphosphonic acid and 5-mercaptopentanoic acid, are also presented.
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.
Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz
2013-08-30
Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.
A unique dual activity amino acid hydroxylase in Toxoplasma gondii.
Directory of Open Access Journals (Sweden)
Elizabeth A Gaskell
Full Text Available The genome of the protozoan parasite Toxoplasma gondii was found to contain two genes encoding tyrosine hydroxylase; that produces L-DOPA. The encoded enzymes metabolize phenylalanine as well as tyrosine with substrate preference for tyrosine. Thus the enzymes catabolize phenylalanine to tyrosine and tyrosine to L-DOPA. The catalytic domain descriptive of this class of enzymes is conserved with the parasite enzyme and exhibits similar kinetic properties to metazoan tyrosine hydroxylases, but contains a unique N-terminal extension with a signal sequence motif. One of the genes, TgAaaH1, is constitutively expressed while the other gene, TgAaaH2, is induced during formation of the bradyzoites of the cyst stages of the life cycle. This is the first description of an aromatic amino acid hydroxylase in an apicomplexan parasite. Extensive searching of apicomplexan genome sequences revealed an ortholog in Neospora caninum but not in Eimeria, Cryptosporidium, Theileria, or Plasmodium. Possible role(s of these bi-functional enzymes during host infection are discussed.
Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.
Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K
1991-09-15
We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.
Multichannel compressive sensing MRI using noiselet encoding.
Directory of Open Access Journals (Sweden)
Kamlesh Pawar
Full Text Available The incoherence between measurement and sparsifying transform matrices and the restricted isometry property (RIP of measurement matrix are two of the key factors in determining the performance of compressive sensing (CS. In CS-MRI, the randomly under-sampled Fourier matrix is used as the measurement matrix and the wavelet transform is usually used as sparsifying transform matrix. However, the incoherence between the randomly under-sampled Fourier matrix and the wavelet matrix is not optimal, which can deteriorate the performance of CS-MRI. Using the mathematical result that noiselets are maximally incoherent with wavelets, this paper introduces the noiselet unitary bases as the measurement matrix to improve the incoherence and RIP in CS-MRI. Based on an empirical RIP analysis that compares the multichannel noiselet and multichannel Fourier measurement matrices in CS-MRI, we propose a multichannel compressive sensing (MCS framework to take the advantage of multichannel data acquisition used in MRI scanners. Simulations are presented in the MCS framework to compare the performance of noiselet encoding reconstructions and Fourier encoding reconstructions at different acceleration factors. The comparisons indicate that multichannel noiselet measurement matrix has better RIP than that of its Fourier counterpart, and that noiselet encoded MCS-MRI outperforms Fourier encoded MCS-MRI in preserving image resolution and can achieve higher acceleration factors. To demonstrate the feasibility of the proposed noiselet encoding scheme, a pulse sequences with tailored spatially selective RF excitation pulses was designed and implemented on a 3T scanner to acquire the data in the noiselet domain from a phantom and a human brain. The results indicate that noislet encoding preserves image resolution better than Fouirer encoding.
Denich, K; Craiu, A; Rugo, H; Muralidhar, G; O'Hanley, P
1991-01-01
The frequency of selected papA DNA sequences among 89 digalactoside-binding, uropathogenic Escherichia coli strains was evaluated with 12 different synthetic 15-base probes corresponding to papA genes from four digalactoside-binding piliated recombinant strains (HU849, 201B, and 200A). The papA probes encode amino acids which are common at the carboxy terminus of all strains, adjacent to the proximal portion of the intramolecular disulfide loop of strain 210B, or predicted to constitute the t...
Sequence Algebra, Sequence Decision Diagrams and Dynamic Fault Trees
International Nuclear Information System (INIS)
Rauzy, Antoine B.
2011-01-01
A large attention has been focused on the Dynamic Fault Trees in the past few years. By adding new gates to static (regular) Fault Trees, Dynamic Fault Trees aim to take into account dependencies among events. Merle et al. proposed recently an algebraic framework to give a formal interpretation to these gates. In this article, we extend Merle et al.'s work by adopting a slightly different perspective. We introduce Sequence Algebras that can be seen as Algebras of Basic Events, representing failures of non-repairable components. We show how to interpret Dynamic Fault Trees within this framework. Finally, we propose a new data structure to encode sets of sequences of Basic Events: Sequence Decision Diagrams. Sequence Decision Diagrams are very much inspired from Minato's Zero-Suppressed Binary Decision Diagrams. We show that all operations of Sequence Algebras can be performed on this data structure.
New Complexity Scalable MPEG Encoding Techniques for Mobile Applications
Directory of Open Access Journals (Sweden)
Stephan Mietens
2004-03-01
Full Text Available Complexity scalability offers the advantage of one-time design of video applications for a large product family, including mobile devices, without the need of redesigning the applications on the algorithmic level to meet the requirements of the different products. In this paper, we present complexity scalable MPEG encoding having core modules with modifications for scalability. The interdependencies of the scalable modules and the system performance are evaluated. Experimental results show scalability giving a smooth change in complexity and corresponding video quality. Scalability is basically achieved by varying the number of computed DCT coefficients and the number of evaluated motion vectors but other modules are designed such they scale with the previous parameters. In the experiments using the “Stefan” sequence, the elapsed execution time of the scalable encoder, reflecting the computational complexity, can be gradually reduced to roughly 50% of its original execution time. The video quality scales between 20 dB and 48 dB PSNR with unity quantizer setting, and between 21.5 dB and 38.5 dB PSNR for different sequences targeting 1500 kbps. The implemented encoder and the scalability techniques can be successfully applied in mobile systems based on MPEG video compression.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
Morant, Marc D.; Harris, Paul
2015-10-13
The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
Polypeptides having xylanase activity and polynucleotides encoding same
Energy Technology Data Exchange (ETDEWEB)
Spodsberg, Nikolaj
2018-02-06
The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
International Nuclear Information System (INIS)
Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.
1990-01-01
Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences
Floriano, Belén; Ruiz-Barba, José L.; Jiménez-Díaz, Rufino
1998-01-01
Enterocin I (ENTI) is a novel bacteriocin produced by Enterococcus faecium 6T1a, a strain originally isolated from a Spanish-style green olive fermentation. The bacteriocin is active against many olive spoilage and food-borne gram-positive pathogenic bacteria, including clostridia, propionibacteria, and Listeria monocytogenes. ENTI was purified to homogeneity by ammonium sulfate precipitation, binding to an SP-Sepharose fast-flow column, and phenyl-Sepharose CL-4B and C2/C18 reverse-phase chromatography. The purification procedure resulted in a final yield of 954% and a 170,000-fold increase in specific activity. The primary structure of ENTI was determined by amino acid and nucleotide sequencing. ENTI consists of 44 amino acids and does not show significant sequence similarity with any other previously described bacteriocin. Sequencing of the entI structural gene, which is located on the 23-kb plasmid pEF1 of E. faecium 6T1a, revealed the absence of a leader peptide at the N-terminal region of the gene product. A second open reading frame, ORF2, located downstream of entI, encodes a putative protein that is 72.7% identical to ENTI. entI and ORF2 appear to be cotranscribed, yielding an mRNA of ca. 0.35 kb. A gene encoding immunity to ENTI was not identified. However, curing experiments demonstrated that both enterocin production and immunity are conferred by pEF1. PMID:9835578
Modeling of the Ebola Virus Delta Peptide Reveals a Potential Lytic Sequence Motif
Directory of Open Access Journals (Sweden)
William R. Gallaher
2015-01-01
Full Text Available Filoviruses, such as Ebola and Marburg viruses, cause severe outbreaks of human infection, including the extensive epidemic of Ebola virus disease (EVD in West Africa in 2014. In the course of examining mutations in the glycoprotein gene associated with 2014 Ebola virus (EBOV sequences, a differential level of conservation was noted between the soluble form of glycoprotein (sGP and the full length glycoprotein (GP, which are both encoded by the GP gene via RNA editing. In the region of the proteins encoded after the RNA editing site sGP was more conserved than the overlapping region of GP when compared to a distant outlier species, Tai Forest ebolavirus. Half of the amino acids comprising the “delta peptide”, a 40 amino acid carboxy-terminal fragment of sGP, were identical between otherwise widely divergent species. A lysine-rich amphipathic peptide motif was noted at the carboxyl terminus of delta peptide with high structural relatedness to the cytolytic peptide of the non-structural protein 4 (NSP4 of rotavirus. EBOV delta peptide is a candidate viroporin, a cationic pore-forming peptide, and may contribute to EBOV pathogenesis.
Directory of Open Access Journals (Sweden)
Poonam Sharma
2009-01-01
Full Text Available Scirpophaga incertulas Walker (Lepidoptera: Pyralideae, commonly known as yellow stem borer, is a predominant monophagous pest of rice, which causes 5% to 30% loss of the rice crop. We report for the first time, the cloning and sequence analysis of the amylase gene of this pest. The cloned gene translates into a protein of 487 amino acids having a predicted molecular weight of 54,955 daltons and a theoretical pI of 5.9. The 3D structure of the amylase is predicted from its amino acid sequence by homology modeling using the structure of the amylase from Tenebrio molitor L (Coleoptera: Tenebrionidae. We also report the purification of a dimeric α-amylase inhibitor from a local variety of wheat MP Sehore that is specific for the amylase of this pest and does not inhibit human salivary amylase or porcine pancreatic amylase. The gene encoding this inhibitor has been cloned and its sequence has been analysed to find a possible explanation for this specificity.
Willson, T A; Nagley, P
1987-09-01
This work concerns a biochemical genetic study of subunit 9 of the mitochondrial ATPase complex of Saccharomyces cerevisiae. Subunit 9, encoded by the mitochondrial oli1 gene, contains a hydrophilic loop connecting two transmembrane stems. In one particular oli1 mit- mutant 2422, the substitution of a positively charged amino acid in this loop (Arg39----Met) renders the ATPase complex non-functional. A series of 20 revertants, selected for their ability to grow on nonfermentable substrates, has been isolated from mutant 2422. The results of DNA sequence analysis of the oli1 gene in each revertant have led to the recognition of three groups of revertants. Class I revertants have undergone a same-site reversion event: the mutant Met39 is replaced either by arginine (as in wild-type) or lysine. Class II revertants maintain the mutant Met39 residue, but have undergone a second-site reversion event (Asn35----Lys). Two revertants showing an oligomycin-resistant phenotype carry this same second-site reversion in the loop region together with a further amino acid substitution in either of the two membrane-spanning segments of subunit 9 (either Gly23----Ser or Leu53----Phe). Class III revertants contain subunit 9 with the original mutant 2422 sequence, and additionally carry a recessive nuclear suppressor, demonstrated to represent a single gene. The results on the revertants in classes I and II indicate that there is a strict requirement for a positively charged residue in the hydrophilic loop close to the boundary of the lipid bilayer. The precise location of this positive charge is less stringent; in functional ATPase complexes it can be found at either residue 39 or 35. This charged residue is possibly required to interact with some other component of the mitochondrial ATPase complex. These findings, together with hydropathy plots of subunit 9 polypeptides from normal, mutant and revertant strains, led to the conclusion that the hydrophilic loop in normal subunit 9
DEFF Research Database (Denmark)
Madsen, Jack Egelund; Petersen, Bent Larsen; Motawia, Mohammed Saddik
2006-01-01
in rhamnogalacturonan-II, a complex polysaccharide essential to vascular plants, and is conserved across higher plant families. Rhamnogalacturonan-II isolated from both RGXT1 and RGXT2 T-DNA insertional mutants functioned as specific acceptor molecules in the xylosyltransferase assay. Expression of RGXT1- and RGXT2......Two homologous plant-specific Arabidopsis thaliana genes, RGXT1 and RGXT2, belong to a new family of glycosyltransferases (CAZy GT-family-77) and encode cell wall (1,3)-alpha-d-xylosyltransferases. The deduced amino acid sequences contain single transmembrane domains near the N terminus, indicative...
Richter, K; Egger, R; Negri, L; Corsi, R; Severini, C; Kreil, G
1990-01-01
We present the structure of four precursors for [D-Ala2]deltorphins I and II as deduced from cDNAs cloned from skin of the frog Phyllomedusa bicolor. These contain the genetic information for one copy of [D-Ala2]deltorphin II and zero, one, or three copies of [D-Ala2]deltorphin I. In each case, the D-alanine of the end product is encoded by a normal GCG codon for L-alanine. In addition, the existence of three peptides related to dermorphin was predicted from the amino acid sequence of the pre...
SAMPEG: a scene-adaptive parallel MPEG-2 software encoder
Farin, D.S.; Mache, N.; With, de P.H.N.; Girod, B.; Bouman, C.A.; Steinbach, E.G.
2001-01-01
This paper presents a fully software-based MPEG-2 encoder architecture, which uses scene-change detection to optimize the Group-of-Picture (GOP) structure for the actual video sequence. This feature enables easy, lossless edit cuts at scene-change positions and it also improves overall picture
Sequence and function of LuxO, a negative regulator of luminescence in Vibrio harveyi.
Bassler, B L; Wright, M; Silverman, M R
1994-05-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode a function required for the density-dependent response. Transposon Tn5 insertions in the recombinant clone were isolated, and the mutations were transferred to the genome of V. harveyi for examination of mutant phenotypes. Expression of luminescence in V. harveyi strains with transposon insertions in one locus, luxO, was independent of the density of the culture and was similar in intensity to the maximal level observed in wild-type bacteria. Sequence analysis of luxO revealed one open reading frame that encoded a protein, LuxO, similar in amino acid sequence to the response regulator domain of the family of two-component, signal transduction proteins. The constitutive phenotype of LuxO- mutants indicates that LuxO acts negatively to control expression of luminescence, and relief of repression by LuxO in the wild type could result from interactions with other components in the Lux signalling system.
Browne, Elisse C; Parakh, Sonam; Duncan, Luke F; Langford, Steven J; Atkin, Julie D; Abbott, Belinda M
2016-04-01
Cellular studies have been undertaken on a nonamer peptide nucleic acid (PNA) sequence, which binds to mRNA encoding superoxide dismutase 1, and a series of peptide nucleic acids conjugated to synthetic lipophilic vitamin analogs including a recently prepared menadione (vitamin K) analog. Reduction of both mutant superoxide dismutase 1 inclusion formation and endoplasmic reticulum stress, two of the key cellular pathological hallmarks in amyotrophic lateral sclerosis, by two of the prepared PNA oligomers is reported for the first time. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Histidine-lysine peptides as carriers of nucleic acids.
Leng, Qixin; Goldgeier, Lisa; Zhu, Jingsong; Cambell, Patricia; Ambulos, Nicholas; Mixson, A James
2007-03-01
With their biodegradability and diversity of permutations, peptides have significant potential as carriers of nucleic acids. This review will focus on the sequence and branching patterns of peptide carriers composed primarily of histidines and lysines. While lysines within peptides are important for binding to the negatively charged phosphates, histidines are critical for endosomal lysis enabling nucleic acids to reach the cytosol. Histidine-lysine (HK) polymers by either covalent or ionic bonds with liposomes augment transfection compared to liposome carriers alone. More recently, we have examined peptides as sole carriers of nucleic acids because of their intrinsic advantages compared to the bipartite HK/liposome carriers. With a protocol change and addition of a histidine-rich tail, HK peptides as sole carriers were more effective than liposomes alone in several cell lines. While four-branched polymers with a primary repeating sequence pattern of -HHK- were more effective as carriers of plasmids, eight-branched polymers with a sequence pattern of -HHHK- were more effective as carriers of siRNA. Compared to polyethylenimine, HK carriers of siRNA and plasmids had reduced toxicity. When injected intravenously, HK polymers in complex with plasmids encoding antiangiogenic proteins significantly decreased tumor growth. Furthermore, modification of HK polymers with polyethylene glycol and vascular-specific ligands increased specificity of the polyplex to the tumor by more than 40-fold. Together with further development and insight on the structure of HK polyplexes, HK peptides may prove to be useful as carriers of different forms of nucleic acids both in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Honghao Cai
Full Text Available BACKGROUND AND PURPOSE: Nuclear magnetic resonance (NMR spectroscopy has become an important technique for tissue studies. Since tissues are in semisolid-state, their high-resolution (HR spectra cannot be obtained by conventional NMR spectroscopy. Because of this restriction, extraction and high-resolution magic angle spinning (HR MAS are widely applied for HR NMR spectra of tissues. However, both of the methods are subject to limitations. In this study, the feasibility of HR (1H NMR spectroscopy based on intermolecular multiple-quantum coherence (iMQC technique is explored using fish muscle, fish eggs, and a whole fish as examples. MATERIALS AND METHODS: Intact salmon muscle tissues, intact eggs from shishamo smelt and a whole fish (Siamese algae eater are studied by using conventional 1D one-pulse sequence, Hadamard-encoded iMQC sequence, and HR MAS. RESULTS: When we use the conventional 1D one-pulse sequence, hardly any useful spectral information can be obtained due to the severe field inhomogeneity. By contrast, HR NMR spectra can be obtained in a short period of time by using the Hadamard-encoded iMQC method without shimming. Most signals from fatty acids and small metabolites can be observed. Compared to HR MAS, the iMQC method is non-invasive, but the resolution and the sensitivity of resulting spectra are not as high as those of HR MAS spectra. CONCLUSION: Due to the immunity to field inhomogeneity, the iMQC technique can be a proper supplement to HR MAS, and it provides an alternative for the investigation in cases with field distortions and with samples unsuitable for spinning. The acquisition time of the proposed method is greatly reduced by introduction of the Hadamard-encoded technique, in comparison with that of conventional iMQC method.
Directory of Open Access Journals (Sweden)
Yan Koon-Kiu
2007-11-01
Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga
ENCODE whole-genome data in the UCSC genome browser (2011 update).
Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James
2011-01-01
The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.
Kim, K S; Chilton, W S; Farrand, S K
1996-01-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...
Xinli, Xiao; Lei, Peng
2015-03-04
The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.
Gillner, Danuta M.; Bienvenue, David L.; Nocek, Boguslaw P.; Joachimiak, Andrzej; Zachary, Vincentos; Bennett, Brian; Holz, Richard C.
2009-01-01
The catalytic and structural properties of the H67A and H349A altered dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase (DapE) from H. influenzae were investigated. Based on sequence alignment with CPG2 both H67 and H349 were predicted to be Zn(II) ligands. Catalytic activity was observed for the H67A altered DapE enzyme which exhibited kcat = 1.5 ± 0.5 sec−1 and Km = 1.4 ± 0.3 mM. No catalytic activity was observed for H349A under the experimental conditions used. The EPR and electronic absorption data indicate that the Co(II) ion bound to H349A-DapE is analogous to WT DapE after the addition of a single Co(II) ion. The addition of one equivalent of Co(II) to H67A altered DapE provides spectra that are very different from the first Co(II) binding site of the WT enzyme, but similar to the second binding site. The EPR and electronic absorption data, in conjunction with the kinetic data, are consistent with the assignment of H67 and H349 as active site metal ligands for the DapE from H. influenzae. Furthermore, the data suggest that H67 is a ligand in the first metal binding site while H349 resides in the second metal binding site. A three-dimensional homology structure of the DapE from H. influenzae was generated using the X-ray crystal structure of the DapE from N. meningitidis as a template and superimposed on the structure of AAP. This homology structure confirms the assignment of H67 and H349 as active site ligands. The superimposition of the homology model of DapE with the dizinc(II) structure of AAP indicates that within 4.0 Å of the Zn(II) binding sites of AAP, all of the amino acid residues of DapE are nearly identical. PMID:18712420
DEFF Research Database (Denmark)
Behrendt, N; Rønne, E; Ploug, M
1990-01-01
-PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic acid......, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...
Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169
International Nuclear Information System (INIS)
Wright, D.A.; Staprans, S.I.; Spector, D.H.
1988-01-01
In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the [ 35 S]methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region
Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A
1992-06-01
Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.
Directory of Open Access Journals (Sweden)
Md. Zaherul Islam
2016-08-01
Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.
Next generation sequencing and molecular analysis of artichoke Italian latent virus.
Elbeaino, Toufic; Belghacem, Imen; Mascia, Tiziana; Gallitelli, Donato; Digiaro, Michele
2017-06-01
Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.
Encoded libraries of chemically modified peptides.
Heinis, Christian; Winter, Greg
2015-06-01
The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.
1987-01-01
Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines
Directory of Open Access Journals (Sweden)
Charles Addo-Quaye
2017-02-01
Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.
Beta-glucosidase variants and polynucleotides encoding same
Wogulis, Mark; Harris, Paul; Osborn, David
2017-06-27
The present invention relates to beta-glucosidase variants, e.g. beta-glucosidase variants of a parent Family GH3A beta-glucosidase from Aspergillus fumigatus. The present invention also relates to polynucleotides encoding the beta-glucosidase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the beta-glucosidase variants.
Penaud, S.; Fernandez, A.; Boudebbouze, S.; Ehrlich, S. D.; Maguin, E.; van de Guchte, M.
2006-01-01
Lactobacillus bulgaricus is a lactic acid bacteria (LAB) that, through the production of lactic acid, gradually acidifies its environment during growth. In the course of this process, L. bulgaricus acquires an improved tolerance to acidity. A survey of the recently established genome sequence shows that this bacterium possesses few of the pH control functions that have been described in other LAB and raises the question of what other mechanisms could be involved in its adaptation to the decreasing environmental pH. In some bacteria other than LAB, ion transport systems have been implicated in acid adaptation. We therefore studied the expression of this type of transport system during acid adaptation in L. bulgaricus by reverse transcription and real-time quantitative PCR and mapped transcription start sites. Intriguingly, the most significantly induced were three ATPases carrying the CPX signature of heavy-metal transporters. Protein homology and the presence of a conserved sequence motif in the promoter regions of the genes encoding these proteins strongly suggest that they are involved in copper homeostasis. Induction of this system is thought to assist in avoiding indirect damage that could result from medium acidification. PMID:16997986
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Identification of rare paired box 3 variant in strabismus by whole exome sequencing
Directory of Open Access Journals (Sweden)
Hui-Min Gong
2017-08-01
Full Text Available AIM: To identify the potentially pathogenic gene variants that contributes to the etiology of strabismus. METHODS: A Chinese pedigree with strabismus was collected and the exomes of two affected individuals were sequenced using the next-generation sequencing technology. The resulting variants from exome sequencing were filtered by subsequent bioinformatics methods and the candidate mutation was verified as heterozygous in the affected proposita and her mother by sanger sequencing. RESULTS: Whole exome sequencing and filtering identified a nonsynonymous mutation c.434G-T transition in paired box 3 (PAX3 in the two affected individuals, which were predicted to be deleterious by more than 4 bioinformatics programs. This altered amino acid residue was located in the conserved PAX domain of PAX3. This gene encodes a member of the PAX family of transcription factors, which play critical roles during fetal development. Mutations in PAX3 were associated with Waardenburg syndrome with strabismus. CONCLUSION: Our results report that the c.434G-T mutation (p.R145L in PAX3 may contribute to strabismus, expanding our understanding of the causally relevant genes for this disorder.
Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K
2013-12-01
In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
International Nuclear Information System (INIS)
Oster, J.; Parker, Jeffrey; Brassard, Lothar
2001-01-01
The versatile application of polyvinyl-alcohol-based magnetic M-PVA beads is demonstrated in the separation of genomic DNA, sequence specific nucleic acid purification, and binding of bacteria for subsequent DNA extraction and detection. It is shown that nucleic acids can be obtained in high yield and purity using M-PVA beads, making sample preparation efficient, fast and highly adaptable for automation processes
Human visual system automatically encodes sequential regularities of discrete events.
Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki
2010-06-01
For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential
International Nuclear Information System (INIS)
Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung
2003-01-01
To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES
Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.
Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P
2011-11-01
The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.
Zhang, Zhong-Lin; Shin, Margaret; Zou, Xiaolu; Huang, Jianzhi; Ho, Tun-hua David; Shen, Qingxi J
2009-05-01
Abscisic acid (ABA) and gibberellins (GAs) control several developmental processes including seed maturation, dormancy, and germination. The antagonism of these two hormones is well-documented. However, recent data from transcription profiling studies indicate that they can function as agonists in regulating the expression of many genes although the underlying mechanism is unclear. Here we report a rice WRKY gene, OsWRKY24, which encodes a protein that functions as a negative regulator of both GA and ABA signaling. Overexpression of OsWRKY24 via particle bombardment-mediated transient expression in aleurone cells represses the expression of two reporter constructs: the beta-glucuronidase gene driven by the GA-inducible Amy32b alpha-amylase promoter (Amy32b-GUS) and the ABA-inducible HVA22 promoter (HVA22-GUS). OsWRKY24 is unlikely a general repressor because it has little effect on the expression of the luciferase reporter gene driven by a constitutive ubiquitin promoter (UBI-Luciferase). As to the GA signaling, OsWRKY24 differs from OsWRKY51 and -71, two negative regulators specifically function in the GA signaling pathway, in several ways. First, OsWRKY24 contains two WRKY domains while OsWRKY51 and -71 have only one; both WRKY domains are essential for the full repressing activity of OsWRKY24. Second, binding of OsWRKY24 to the Amy32b promoter appears to involve sequences in addition to the TGAC cores of the W-boxes. Third, unlike OsWRKY71, OsWRKY24 is stable upon GA treatment. Together, these data demonstrate that OsWRKY24 is a novel type of transcriptional repressor that inhibits both GA and ABA signaling.
Genome sequence of Aspergillus luchuensis NBRC 4314
Yamada, Osamu; Machida, Masayuki; Hosoyama, Akira; Goto, Masatoshi; Takahashi, Toru; Futagami, Taiki; Yamagata, Youhei; Takeuchi, Michio; Kobayashi, Tetsuo; Koike, Hideaki; Abe, Keietsu; Asai, Kiyoshi; Arita, Masanori; Fujita, Nobuyuki; Fukuda, Kazuro; Higa, Ken-ichi; Horikawa, Hiroshi; Ishikawa, Takeaki; Jinno, Koji; Kato, Yumiko; Kirimura, Kohtaro; Mizutani, Osamu; Nakasone, Kaoru; Sano, Motoaki; Shiraishi, Yohei; Tsukahara, Masatoshi; Gomi, Katsuya
2016-01-01
Awamori is a traditional distilled beverage made from steamed Thai-Indica rice in Okinawa, Japan. For brewing the liquor, two microbes, local kuro (black) koji mold Aspergillus luchuensis and awamori yeast Saccharomyces cerevisiae are involved. In contrast, that yeasts are used for ethanol fermentation throughout the world, a characteristic of Japanese fermentation industries is the use of Aspergillus molds as a source of enzymes for the maceration and saccharification of raw materials. Here we report the draft genome of a kuro (black) koji mold, A. luchuensis NBRC 4314 (RIB 2604). The total length of nonredundant sequences was nearly 34.7 Mb, comprising approximately 2,300 contigs with 16 telomere-like sequences. In total, 11,691 genes were predicted to encode proteins. Most of the housekeeping genes, such as transcription factors and N-and O-glycosylation system, were conserved with respect to Aspergillus niger and Aspergillus oryzae. An alternative oxidase and acid-stable α-amylase regarding citric acid production and fermentation at a low pH as well as a unique glutamic peptidase were also found in the genome. Furthermore, key biosynthetic gene clusters of ochratoxin A and fumonisin B were absent when compared with A. niger genome, showing the safety of A. luchuensis for food and beverage production. This genome information will facilitate not only comparative genomics with industrial kuro-koji molds, but also molecular breeding of the molds in improvements of awamori fermentation. PMID:27651094
Conventions and nomenclature for double diffusion encoding NMR and MRI
DEFF Research Database (Denmark)
Shemesh, Noam; Jespersen, Sune N; Alexander, Daniel C
2015-01-01
, such as double diffusion encoding (DDE) NMR and MRI, may provide novel quantifiable metrics that are less easily inferred from conventional diffusion acquisitions. Despite the growing interest on the topic, the terminology for the pulse sequences, their parameters, and the metrics that can be derived from them...
DEFF Research Database (Denmark)
Pallesen, L; Poulsen, LK; Christiansen, Gunna
1995-01-01
of heterologous DNA segments encoding two reporter sequences. In the selected positions such insertions did not significantly alter the function of the FimH protein with regard to surface location and adhesive ability. The system seemed to be quite flexible, since chimeric versions of the FimH adhesin containing...... as many as 56 foreign amino acids were transported to the bacterial surface as components of the fimbrial organelles. Furthermore, the foreign protein segments were recognized by insert-specific antibodies when expressed within chimeric proteins on the surface of the bacteria. The results from...
DS-OCDMA Encoder/Decoder Performance Analysis Using Optical Low-Coherence Reflectometry
Fsaifes, Ihsan; Lepers, Catherine; Obaton, Anne-Francoise; Gallion, Philippe
2006-08-01
Direct-sequence optical code-division multiple-access (DS-OCDMA) encoder/decoder based on sampled fiber Bragg gratings (S-FBGs) is characterized using phase-sensitive optical low-coherence reflectometry (OLCR). The OLCR technique allows localized measurements of FBG wavelength and physical length inside one S-FBG. This paper shows how the discrepancies between specifications and measurements of the different FBGs have some impact on spectral and temporal pulse responses of the OCDMA encoder/decoder. The FBG physical lengths lower than the specified ones are shown to affect the mean optical power reflected by the OCDMA encoder/decoder. The FBG wavelengths that are detuned from each other induce some modulations of S-FBG reflectivity resulting in encoder/decoder sensitivity to laser wavelength drift of the OCDMA system. Finally, highlighted by this OLCR study, some solutions to overcome limitations in performance with the S-FBG technology are suggested.
Polypeptides having beta-glucosidase activity and polynucleotides encoding same
Harris, Paul; Golightly, Elizabeth
2012-11-27
The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.
Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
Maiyuran, Suchindra; Kramer, Randall; Harris, Paul
2013-10-29
The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.
The impact of path crossing on visuo-spatial serial memory: encoding or rehearsal effect?
Parmentier, Fabrice B R; Andrés, Pilar
2006-11-01
The determinants of visuo-spatial serial memory have been the object of little research, despite early evidence that not all sequences are equally remembered. Recently, empirical evidence was reported indicating that the complexity of the path formed by the to-be-remembered locations impacted on recall performance, defined for example by the presence of crossings in the path formed by successive locations (Parmentier, Elford, & Maybery, 2005). In this study, we examined whether this effect reflects rehearsal or encoding processes. We examined the effect of a retention interval and spatial interference on the ordered recall of spatial sequences with and without path crossings. Path crossings decreased recall performance, as did a retention interval. In line with the encoding hypothesis, but in contrast with the rehearsal hypothesis, the effect of crossing was not affected by the retention interval nor by tapping. The possible nature of the impact of path crossing on encoding mechanisms is discussed.
International Nuclear Information System (INIS)
Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.
1987-01-01
The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury
Wang, S Z; Chen, J S; Johnson, J L
1988-01-01
The nifH gene encodes the iron protein (component II) of the nitrogenase complex. We have previously shown the presence in Clostridium pasteurianum of two nifH-like sequences in addition to the nifH1 gene which codes for a protein identical to the isolated iron protein. In the present study, we report that there are at least five nifH-like sequences in C. pasteurianum. DNA sequencing data indicate that the six nifH (nifH1) and nifH-like (nifH2, nifH3, nifH4, nifH5 and nifH6) sequences are not...
International Nuclear Information System (INIS)
Penfold, Mark; Miao Zhenhua; Wang Yu; Haggerty, Shannon; Schleiss, Mark R.
2003-01-01
Cytomegaloviruses encode homologs of cellular immune effector proteins, including chemokines (CKs) and CK receptor-like G protein-coupled receptors (GPCRs). Sequence of the guinea pig cytomegalovirus (GPCMV) genome identified an open reading frame (ORF) which predicted a 101 amino acid (aa) protein with homology to the macrophage inflammatory protein (MIP) subfamily of CC (β) CKs, designated GPCMV-MIP. To assess functionality of this CK, recombinant GPCMV-MIP was expressed in HEK293 cells and assayed for its ability to bind to and functionally interact with a variety of GPCRs. Specific signaling was observed with the hCCR1 receptor, which could be blocked with hMIP -1α in competition experiments. Migration assays revealed that GPCMV-MIP was able to induce chemotaxis in hCCR1-L1.2 cells. Antisera raised against a GST-MIP fusion protein immunoprecipitated species of ∼12 and 10 kDa from GPCMV-inoculated tissue culture lysates, and convalescent antiserum from GPCMV-infected animals was immunoreactive with GST-MIP by ELISA assay. These results represent the first substantive in vitro characterization of a functional CC CK encoded by a cytomegalovirus
Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis
DEFF Research Database (Denmark)
Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata
2000-01-01
The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...
Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2
Directory of Open Access Journals (Sweden)
Yang Jie
2017-01-01
Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K
2001-01-24
We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.
International Nuclear Information System (INIS)
Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.
1989-01-01
Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes
Bacteria obtained from a sequencing batch reactor that are capable of growth on dehydroabietic acid.
Mohn, W W
1995-01-01
Eleven isolates capable of growth on the resin acid dehydroabietic acid (DhA) were obtained from a sequencing batch reactor designed to treat a high-strength process stream from a paper mill. The isolates belonged to two groups, represented by strains DhA-33 and DhA-35, which were characterized. In the bioreactor, bacteria like DhA-35 were more abundant than those like DhA-33. The population in the bioreactor of organisms capable of growth on DhA was estimated to be 1.1 x 10(6) propagules per...
Synaptotagmin gene content of the sequenced genomes
Directory of Open Access Journals (Sweden)
Craxton Molly
2004-07-01
Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Hernández, M Luisa; Sicardo, M Dolores; Martínez-Rivas, José M
2016-01-01
Linolenic acid is a polyunsaturated fatty acid present in plant lipids, which plays key roles in plant metabolism as a structural component of storage and membrane lipids, and as a precursor of signaling molecules. The synthesis of linolenic acid is catalyzed by two different ω-3 fatty acid desaturases, which correspond to microsomal- (FAD3) and chloroplast- (FAD7 and FAD8) localized enzymes. We have investigated the specific contribution of each enzyme to the linolenic acid content in olive fruit. With that aim, we isolated two different cDNA clones encoding two ω-3 fatty acid desaturases from olive (Olea europaea cv. Picual). Sequence analysis indicates that they code for microsomal (OepFAD3B) and chloroplast (OepFAD7-2) ω-3 fatty acid desaturase enzymes, different from the previously characterized OekFAD3A and OekFAD7-1 genes. Functional expression in yeast of the corresponding OepFAD3A and OepFAD3B cDNAs confirmed that they encode microsomal ω-3 fatty acid desaturases. The linolenic acid content and transcript levels of olive FAD3 and FAD7 genes were measured in different tissues of Picual and Arbequina cultivars, including mesocarp and seed during development and ripening of olive fruit. Gene expression and lipid analysis indicate that FAD3A is the gene mainly responsible for the linolenic acid present in the seed, while FAD7-1 and FAD7-2 contribute mostly to the linolenic acid present in the mesocarp and, therefore, in the olive oil. These results also indicate the relevance of lipid trafficking between the endoplasmic reticulum and chloroplast in determining the linolenic acid content of membrane and storage lipids in oil-accumulating photosynthetic tissues. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.