Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

OpenAIRE

Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

[Synthesis and degradation of hyaluronic acid by bacteria of Streptococcus genus].

Science.gov (United States)

Beloded, A V; Samoĭlenko, I I; Tsepilov, R N

2010-01-01

Modern data on metabolism of hyaluronic acid by bacteria from Streptococcus genus are presented. Several species of bacteria forming capsule from hyaluronic acid, which is analogous to glycosaminoglycan of vertebrates, are considered. Different aspects of hyaluronic acid synthesis are described: biochemical synthesis pathway, genetic basis, regulation of expression of genes belonging to hyaluronic acid synthesis operon. Biological role and physiologic importance of hyaluronic acid for bacteria, including its role in overcoming immune barrier by pathogenic species, are discussed. Process of depolymerization of hyaluronic acid in presence of hyaluronatlyases secreted by certain streptococci is considered. Characteristic of streptococcal enzyme hyaluronatlyase, its mechanism of catalytic effect, and biological function are presented.

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

Radiolytic degradation of sorbic acid in isolated systems

International Nuclear Information System (INIS)

Thakur, B.R.; Trehan, I.R.; Arya, S.S.

1990-01-01

Effect of Co(60) gamma-irradiation on stability of sorbic acid (SA) in solutions, dough and chapaties has been investigated. SA was highly susceptible to radiolytic degradation in aqueous systems. Rate of degradation decreased with rise in pH. Sugars, hydrocolloids except pectin, citric acid, lactic acid, malic acid, arginine and threonine, catalyzed degradation while oxalic acid, maleic acid, Cu2+, nitrite, nitrate and phthalate had protective effects. SA was more stable in alcohols and vegetable oils than in aqueous solutions. In wheat flour radiolytic degradation of SA was less at lower moisture. Relatively SA was more stable in chapaties than in dough. Gelatinization and addition of oil in dough reduced degradation of SA

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Gibberellic acid promoting phytic acid degradation in germinating soybean under calcium lactate treatment.

Science.gov (United States)

Hui, Qianru; Wang, Mian; Wang, Pei; Ma, Ya; Gu, Zhenxin; Yang, Runqiang

2018-01-01

Phytic acid as a phosphorus storage vault provides phosphorus for plant development. It is an anti-nutritional factor for humans and some animals. However, its degradation products lower inositol phosphates have positive effects on human health. In this study, the effect of gibberellic acid (GA) on phytic acid degradation under calcium lactate (Ca) existence was investigated. The results showed that Ca + GA treatment promoted the growth status, hormone metabolism and phytic acid degradation in germinating soybean. At the same time, the availability of phosphorus, the activity of phytic acid degradation-associated enzyme and phosphoinositide-specific phospholipase C (PI-PLC) increased. However, the relative genes expression of phytic acid degradation-associated enzymes did not vary in accordance with their enzymes activity. The results revealed that GA could mediate the transport and function of calcium and a series of physiological and biochemical changes to regulate phytic acid degradation of soybean sprouts. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator

Directory of Open Access Journals (Sweden)

Reiss Monika

2008-11-01

Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

Science.gov (United States)

Narang, Atul; Oehler, Stefan

2017-05-01

The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

In vitro Degradation of Butanediamine-Grafted Poly(DL-Lactic acids)

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

The degradation of butanediamine-grafted poly(DL-lactic acid) polymers (BDPLAs) in vitro together with PDLLA and maleic anhydride-grafted poly(DL-lactic acid) polymers (MPLAs) was investigated by observation of the changes of the pH value of incubation media, and weight loss ratio during degradation duration of 12 weeks. The results reveal that the acidity of PDLLA degradation products was weakened or neutralized by grafting butanediamine onto PDLLA. A uniform degradation of BDPLAs was observed in comparison with an acidity-induced auto-accelerating degradation featured by PDLLA and MPLAs. The biodegradation behaviors of BDPLAs can be adjusted by controlling the content of BDA. BDPLAs might be a new derivative of PDLLA-based biodegradable materials for medical applications without acidity-caused irritations and acidity-induced auto-accelerating degradation behavior as that of PDLLA.

Stochastic simulations of the tetracycline operon

Science.gov (United States)

2011-01-01

Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

Stochastic simulations of the tetracycline operon

Directory of Open Access Journals (Sweden)

Kaznessis Yiannis N

2011-01-01

Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Strategy of Pseudomonas pseudoalcaligenes C70 for effective degradation of phenol and salicylate.

Directory of Open Access Journals (Sweden)

Merike Jõesaar

Full Text Available Phenol- and naphthalene-degrading indigenous Pseudomonas pseudoalcaligenes strain C70 has great potential for the bioremediation of polluted areas. It harbours two chromosomally located catechol meta pathways, one of which is structurally and phylogenetically very similar to the Pseudomonas sp. CF600 dmp operon and the other to the P. stutzeri AN10 nah lower operon. The key enzymes of the catechol meta pathway, catechol 2,3-dioxygenase (C23O from strain C70, PheB and NahH, have an amino acid identity of 85%. The metabolic and regulatory phenotypes of the wild-type and the mutant strain C70ΔpheB lacking pheB were evaluated. qRT-PCR data showed that in C70, the expression of pheB- and nahH-encoded C23O was induced by phenol and salicylate, respectively. We demonstrate that strain C70 is more effective in the degradation of phenol and salicylate, especially at higher substrate concentrations, when these compounds are present as a mixture; i.e., when both pathways are expressed. Moreover, NahH is able to substitute for the deleted PheB in phenol degradation when salicylate is also present in the growth medium. The appearance of a yellow intermediate 2-hydroxymuconic semialdehyde was followed by the accumulation of catechol in salicylate-containing growth medium, and lower expression levels and specific activities of the C23O of the sal operon were detected. However, the excretion of the toxic intermediate catechol to the growth medium was avoided when the growth medium was supplemented with phenol, seemingly due to the contribution of the second meta pathway encoded by the phe genes.

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

Science.gov (United States)

Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

2015-11-01

Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Effect of Polylactic Acid-Degradable Film Mulch on Soil Temperature and Cotton Yield

Directory of Open Access Journals (Sweden)

ZHANG Ni

2016-03-01

Full Text Available Concern on biodegradable plastic film is increasing because of pollution problems caused by the plastic films currently used. The objective of this field experiment is to evaluate the effect of two thicknesses of polyactic acid-degradable film on soil temperature and cotton yield. The results showed that small holes appeared in the polyactic acid-degradable film at 17~22 d after it was installed. Burst period appeared about 60 d after installation. Splits were observed in the polyactic acid-degradable film at 130 d after installation. Soil temperatures rose slowly under polyactic acid-degradable film during the cotton seedling stage. Daytime soil temperatures were 0.8℃ and 6.2℃ lower under 18μm and 15μm thick polyactic acid-degradable film than non-degradable plastic film(CK, respectively. Nighttime soil temperatures under the polyactic acid-degradable film were about 1℃ warmer than CK. There was no significant difference in cotton yields between the 18μm polyactic acid degradable film treatment and CK. In contrast, yields in the 15μm degradable plastic film treatment were 8.9% less than that in CK. This study indicated that 18μm polyactic acid degradable plastic film had good degradability and no negative effect on cotton growth. The 18μm polyactic acid degradable plastic film can replace ordinary plastic film in agricultural production.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

Effect of Eu(III) on the degradation of malic acid by Pseudomonas fluorescens

International Nuclear Information System (INIS)

Nankawa, T.; Ozaki, T.; Ohnuki, T.; Suzuki, Y.; Francis, A.J.

2005-01-01

Full text of publication follows: The transuranic elements, such as Am(III) and Cm(III), are highly toxic because they emit high-energy α particles and have long half-lives. To estimate their long-term environmental behavior, we need to elucidate degradation of actinide-organic complexes by microorganisms. We studied the biodegradation of Eu(III)-malic acid complexes by Pseudomonas fluorescens. Malic acid is ubiquitous in the environment and is one of the microbial metabolites that is part of the tri-carboxylic acid (TCA) cycle. Europium(III) is a good analogue for Am(III) and Cm(III). To investigate the effect of Eu(III) on the degradation of malic acid by P. fluorescens, we compared the degradation behavior of Eu(III)-malic acid complexes to that of Fe(III) and Al(III)-malic acid complexes. In the medium containing 1 mM malic acid and 0-0.5 mM Fe(III), malic acid was degraded completely. In the medium containing 1 mM malic acid and 0.05-0.5 mM Al(III), malic acid was degraded until the concentration of malic acid became equal to that of Al(III), indicating that Al(III)-malic acid complex with 1: 1 molar ratio was recalcitrant to biodegradation. In the medium containing 1 mM malic acid and 0.05-0.5 mM Eu(III), degradation of malic acid was not observed. The effect of metals on degradation of malic acid was in the order of Fe(III) < Al(III) < Eu(III). The stability constants of 1:1 Fe(III)-, Al(III)-, and Eu(III)-malic acid complexes are 7.1, 4.6, and 4.9, respectively. These results indicate that degradability of malic acid does not depend on the stability constants of metal-malic acid complexes. We found that 10 mM malic acid was degraded in the presence of 0.05 and 0.1 mM Eu(III) but 1 mM malic acid was not degraded in the presence of 0.05 and 0.1 mM Eu(III). The degradation rate of malic acid increased with a decreasing ratio of Eu(III) to malic acid. (authors)

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

Science.gov (United States)

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

Directory of Open Access Journals (Sweden)

Pelletier Eric

2010-10-01

Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

Poly(Aspartic Acid) Degradation by a Sphingomonas sp. Isolated from Freshwater

OpenAIRE

Tabata, Kenji; Kasuya, Ken-Ichi; Abe, Hideki; Masuda, Kozue; Doi, Yoshiharu

1999-01-01

A poly(aspartic acid) degrading bacterium (strain KT-1 [JCM10459]) was isolated from river water and identified as a member of the genus Sphingomonas. The isolate degraded only poly(aspartic acid)s of low molecular masses (

Main chain acid-degradable polymers for the delivery of bioactive materials

Science.gov (United States)

Frechet, Jean M. J. [Oakland, CA; Standley, Stephany M [Evanston, IL; Jain, Rachna [Milpitas, CA; Lee, Cameron C [Cambridge, MA

2012-03-20

Novel main chain acid degradable polymer backbones and drug delivery systems comprised of materials capable of delivering bioactive materials to cells for use as vaccines or other therapeutic agents are described. The polymers are synthesized using monomers that contain acid-degradable linkages cleavable under mild acidic conditions. The main chain of the resulting polymers readily degrade into many small molecules at low pH, but remain relatively stable and intact at physiological pH. The new materials have the common characteristic of being able to degrade by acid hydrolysis under conditions commonly found within the endosomal or lysosomal compartments of cells thereby releasing their payload within the cell. The materials can also be used for the delivery of therapeutics to the acidic regions of tumors and other sites of inflammation.

Water and UV degradable lactic acid polymers

Science.gov (United States)

Bonsignore, P.V.; Coleman, R.D.

1996-10-08

A water and UV light degradable copolymer is described made from monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

Influence of humic acid on the trichloroethene degradation by Dehalococcoides-containing consortium

International Nuclear Information System (INIS)

Hu Miao; Zhang Ying; Wang Zhigang; Jiang Zhao; Li Juan

2011-01-01

By taking an anaerobic Dehalococcoides-containing consortium (designated UC-1) as the research object, the influence of humic acid on the degradation of TCE by UC-1 was examined. The results indicated that (i) TCE was more rapidly degraded in the presence of humic acid compared with the control and the TCE removal efficiencies increased with the increase of concentrations of humic acid; and (ii) at the end of experiments, in the presence of humic acid, much more ethene was produced compared with the control, whereas less VC was accumulated in the medium. Presumably, humic acid improves the activity of organisms in dechlorinating populations resulting in more ethene accumulated in the medium, and (iii) the degradation of TCE stimulated by humic acid by UC-1 might be a biotic process or an abiotic process. Thus, humic acid could influence the degradation of TCE by UC-1 directly via enhancing electron transfer between UC-1 and TCE. This work is a preliminary step for accelerating the degradation of TCE in the groundwater environment using a kind of natural organic matter - humic acid.

Influence of humic acid on the trichloroethene degradation by Dehalococcoides-containing consortium

Energy Technology Data Exchange (ETDEWEB)

Hu Miao [School of Resources Environment, Northeast Agricultural University, Harbin 150030 (China); Zhang Ying, E-mail: zhangyinghr@hotmail.com [School of Resources Environment, Northeast Agricultural University, Harbin 150030 (China); Wang Zhigang; Jiang Zhao; Li Juan [School of Resources Environment, Northeast Agricultural University, Harbin 150030 (China)

2011-06-15

By taking an anaerobic Dehalococcoides-containing consortium (designated UC-1) as the research object, the influence of humic acid on the degradation of TCE by UC-1 was examined. The results indicated that (i) TCE was more rapidly degraded in the presence of humic acid compared with the control and the TCE removal efficiencies increased with the increase of concentrations of humic acid; and (ii) at the end of experiments, in the presence of humic acid, much more ethene was produced compared with the control, whereas less VC was accumulated in the medium. Presumably, humic acid improves the activity of organisms in dechlorinating populations resulting in more ethene accumulated in the medium, and (iii) the degradation of TCE stimulated by humic acid by UC-1 might be a biotic process or an abiotic process. Thus, humic acid could influence the degradation of TCE by UC-1 directly via enhancing electron transfer between UC-1 and TCE. This work is a preliminary step for accelerating the degradation of TCE in the groundwater environment using a kind of natural organic matter - humic acid.

Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

Science.gov (United States)

Crawford, I P; Han, C Y; Silverman, M

1991-01-01

The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

NARCIS (Netherlands)

Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

2005-01-01

Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

Humic Acid Degradation by ZnO Photocatalyst

Directory of Open Access Journals (Sweden)

Sekartaji Putri A.

2016-01-01

Full Text Available Humic acid (HA is universally present in soils and natural water resources in a yellow-brown form. HA can react with chlorine during drinking water treatment and produce disinfection byproducts (DBPs, such as trihalomethanes (THMs and haloacetic acids (HAAs, which are harmful for health. Therefore, HA has to be eliminated from water environment. The photocatalysis is an effective alternative solution for the degradation of HA in a water environment. This research aims to degrade HA from water environment. The rapid degradation of HA, using zinc oxide nanoparticles, irradiated by ultraviolet light (ZnO/UV, is investigated. The optimum conditions of pertinent factors, which include the light wavelength (UV-A and UV-C, and light intensity, HA concentration, ZnO dose, and contact time are investigated at neutral pH conditions, considered for drinking water treatment. HA degradation efficiency reached more than 80% after 60 min for both types of irradiation in optimum conditions of 0.3 g/L ZnO dose in 180 min of contact time. Comparisons for degradation efficiency under UV-A and UV-C irradiation indicate that UV-C has higher efficiency, up to 150 min of contact time. The reusability of catalyst is performed for three reuses and still revealed effective for beneficial commercial applications.

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Enhancement of carboxylic acid degradation with sulfate radical generated by persulfate activation.

Science.gov (United States)

Criquet, J; Nebout, P; Karpel Vel Leitner, N

2010-01-01

The aim of this work was to investigate the generation of sulfate radical for the removal of two carboxylic acids in aqueous solution: acetic and citric acids. From photochemical and radiolytic processes, kinetics of the degradation of these two carboxylic acids was studied as a function of the pH of the solution. It was shown that the maximum of acetic acid degradation occurred at pH 5. Above this pH, competitive reactions with the carbon mineralized inhibit the reaction of with the solute. In the case of citric acid, pH has only a little effect on the kinetic of citric acid degradation. The determination of mineralization yields shows several differences depending on carboxylic acids and pH. The degradation of both carboxylic acids was also studied in the radiolysis process whether with or without persulfate addition. A comparison of the processes of sulfate radical production is presented.

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Effects of organic acids, amino acids and ethanol on the radio-degradation of patulin in an aqueous model system

International Nuclear Information System (INIS)

Yun, Hyejeong; Lim, Sangyong; Jo, Cheorun; Chung, Jinwoo; Kim, Soohyun; Kwon, Joong-Ho; Kim, Dongho

2008-01-01

The effects of organic acids, amino acids, and ethanol on the radio-degradation of patulin by gamma irradiation in an aqueous model system were investigated. The patulin, dissolved in distilled water at a concentration of 50 ppm, was practically degraded by the gamma irradiation at the dose of 1.0 kGy, while 33% of the patulin remained in apple juice. In the aqueous model system, the radio-degradation of patulin was partially inhibited by the addition of organic acids, amino acids, and ethanol. The proportions of remaining patulin after irradiation with the dose of 1.0 kGy in the 1% solution of malic acid, citric acid, lactic acid, acetic acid, ascorbic acid, and ethanol were 31.4%, 2.3%, 31.2%, 6.1%, 50.8%, and 12.5%, respectively. During 30 days of storage, the remaining patulin was reduced gradually in the solution of ascorbic acid and malic acid compared to being stable in other samples. The amino acids, serine, threonine, and histidine, inhibited the radio-degradation of patulin. In conclusion, it was suggested that 1 kGy of gamma irradiation (recommended radiation doses for radicidation and/or quarantine in fruits) is effective for the reduction of patulin, but the nutritional elements should be considered because the radio-degradation effects are environment dependent

Biologically Safe Poly(l-lactic acid) Blends with Tunable Degradation Rate: Microstructure, Degradation Mechanism, and Mechanical Properties.

Science.gov (United States)

Oyama, Hideko T; Tanishima, Daisuke; Ogawa, Ryohei

2017-04-10

Although poly(l-lactic acid) (PLLA) is reputed to be biodegradable in the human body, its hydrophobic nature lets it persist for ca. 5.5 years. This study demonstrates that biologically safe lactide copolymers, poly(aspartic acid-co-l-lactide) (PAL) and poly(malic acid-co-l-lactide) (PML), dispersed in the PLLA function as detonators (triggers) for its hydrolytic degradation under physiological conditions. The copolymers significantly enhance hydrolysis, and consequently, the degradation rate of PLLA becomes easily tunable by controlling the amounts of PAL and PML. The present study elucidates the effects of uniaxial drawing on the structural development, mechanical properties, and hydrolytic degradation under physiological conditions of PLLA blend films. At initial degradation stages, the mass loss was not affected by uniaxial drawing; however, at late degradation stages, less developed crystals as well as amorphous chains were degradable at low draw ratio (DR), whereas not only highly developed crystals but also the oriented amorphous chains became insensitive to hydrolysis at high DR. Our work provides important molecular level results that demonstrate that biodegradable materials can have superb mechanical properties and also disappear in a required time under physiological conditions.

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

Varying Conditions for Hexanoic Acid Degradation with BioTiger™

Energy Technology Data Exchange (ETDEWEB)

Foreman, Koji [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Milliken, Charles [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Brigmon, Robin [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-07-27

BioTiger™ (BT) is a consortium of 12 bacteria designed for petroleum waste biodegradation. BT is currently being studied and could be considered for bioremediation of the Athabasca oil sands refineries in Canada and elsewhere. The run-off ponds from the petroleum extraction processes, called tailings ponds, are a mixture of polycyclic aromatic hydrocarbons, naphthenic acids, hydrocarbons, toxic chemicals like heavy metals, water, and sand. Due to environmental regulations the oil industry would like to separate and degrade the hazardous chemical species from the tailings ponds while recycling the water. It has been shown that BT at 30 C° is able to completely degrade 10 mM hexanoic acid (HA) co-metabolically with 0.2% yeast extract (w/v) in 48 hours when starting at 0.4 OD 600nm. After establishing this stable degradation capability, variations were tested to explore the wider parameters of BT activity in temperature, pH, intermediate degradation, co-metabolic dependence, and transfer stability. Due to the vast differences in temperature at various points in the refineries, a wide range of temperatures were assessed. The results indicate that BT retains the ability to degrade HA, a model surrogate for tailings pond contaminants, at temperatures ranging from 15°C to 35°C. Hexanamide (HAM) was shown to be an intermediate generated during the degradation of HA in an earlier work and HAM is completely degraded after 48 hours, indicating that HAM is not the final product of HA degradation. Various replacements for yeast extract were attempted. Glucose, a carbon source; casein amino acids, a protein source; additional ammonia, mimicking known media; and additional phosphate with Wolffe’s vitamins and minerals all showed no significant degradation of HA compared to control. Decreasing the yeast extract concentration (0.05%) demonstrated limited but significant degradation. Finally, serial inoculations of BT were performed to determine the stability of degradation

Anaerobic degradation of linoleic oleic acids

Energy Technology Data Exchange (ETDEWEB)

Lalman, J.A.; Bagley, D.M.

1999-07-01

The anaerobic degradation of linoleic (C18:2) and oleic (C18:1) acids was examined in batch experiments. By-product distribution depended on both the type of long chain fatty acid added and initial substrate concentration. Major by-products were palmitic (C16), myristic (C14) and acetic acids. Trace quantities of palmitoleic (C16:1) and lauric (C12) acids were observed together with larger amounts of palmitic (C16), myristic (C14) and hexanoic (C6) acids in cultures incubated with 100 mg/L linoleic (C18:2) acid. Bio-hydrogenation of C18 fatty acids was not necessary for the {beta}-oxidation mechanism to proceed. Aceticlastic methanogenic inhibition was observed in cultures inoculated with greater than 50 mg/L linoleic (C18:2) acid. In cultures incubated with greater than 50 mg/L oleic (C18:1) acid, aceticlastic methanogenic inhibition was observed for a short time period.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Experimental and modeling study of Portland cement paste degradation in boric acid

International Nuclear Information System (INIS)

Benakli, A.; Chomat, L.; Le Bescop, P.; Wall, J.

2015-01-01

In the framework of Spent Fuel Pools (SFP) lifetime studies, an investigation of the Portland cement degradation in boric acid has been requested by the Electric Power Research Institute. The main goal of this study is to identify the physico-chemical degradation mechanisms involved in boric acid media. Both experimental and modeling approaches are considered. Concerning degradation experiments, sample of cement paste are immersed during three and nine months in a boric acid solution at 2400 ppm that is periodically renewed. Boric acid concentration has been chosen to be representative of SFP solution. Results will be confronted with reactive transport numerical calculations performed by the reactive transport code HYTEC associated with a dedicated extended database called Thermoddem. The analysis of degradation solution revealed a main ions release mechanism driven by diffusion especially for calcium, nitrate, sodium and sulfate. Leaching behavior of magnesium seems to be more complex. Decalcification is the major degradation process involved, even if a non-negligible contribution of further cations (Mg 2+ , Na + ) and anions (SO 4 2- ) has been noticed. Analysis of degradation soution also revealed that kinetic of Portland cement paste degradation in boric acid is higher than in pure water, regarding the degraded depths measured and calcium leaching rate. This observation has been confirmed by solid characterization. Microstructure analysis of degraded Portland cement paste showed a global porosity increase in the degraded zone that might be mainly attributed to Portlandite dissolution. An Ettringite reprecipitation in the degraded zone has been suspected but could also be Ettringite-like phases containing boron. The analysis techniques used did not allow us to differentiate it, and no others specific mineral phases containing boron has been identified. Profile pattern by XRD analysis allowed us to identify four zones composing the degraded Portland cement paste

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

Influence of water solubility, side chain degradability and side chain configuration on the degradation of phthalic acid esters under methanogenic conditions

Energy Technology Data Exchange (ETDEWEB)

Alnervik, M.

1996-12-31

Water solubility and degradability of side chains estrifying phthalic acid are factors possible to influence the degradation of phthalic acid esters (PAEs). To investigate the importance of these factors degradation of butyl 2-ethylhexyl phthalate (BEHP), bis(2-ethylhexyl) phthalate (DEHP), dibutyl phthalate (DBP), dihexyl phthalate (DHP), dioctyl phthalate (DOP) and didecyl phthalate (DDP) were examined under methanogenic conditions as well as was the degradability of the alcohols estrifying these PAEs. We also investigated if the degradation of resistant PAEs could be stimulated by the addition of a degradable PAE. Synthesis of degradation intermediates and two methods for PAE analyses are presented. The investigation showed that all alcohols were degraded to methane and carbon dioxide and that the degradation of PAE occurred in incubations amended with BBP, BEHP, DHP and DBP, whilst DEHP, DOP and DDP were unaffected throughout the experimental period. BBP added to incubations with DEHP, could not stimulate DEHP degradation. In conclusion, the degradability of alcohols estrifying phthalic acid in this study does not affect the anaerobic degradability of PAEs. Water solubility of a PAE can not be rejected as a factor limiting phthalate degradation under methanogenic conditions. Anaerobic degradation of persistent PAEs can not be stimulated by mixing it with a degradable phthalate. 23 refs, 11 figs, 2 tabs

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

Science.gov (United States)

Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

2017-01-15

The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Chemical composition and ruminal degradation kinetics of crude protein and amino acids, and intestinal digestibility of amino acids from tropical forages

Directory of Open Access Journals (Sweden)

Lidia Ferreira Miranda

2012-03-01

Full Text Available The objective of this research was to determine the chemical composition and ruminal degradation of the crude protein (CP, total and individual amino acids of leaves from tropical forages: perennial soybean (Neonotonia wightii, cassava (Manihot esculenta, leucaena (Leucaena leucocephala and ramie (Boehmeria nivea, and to estimate the intestinal digestibility of the rumen undegradable protein (RUDP and individual amino acids of leaves from the tropical forages above cited, but including pigeon pea (Cajanus cajan. Three nonlactating Holstein cows were used to determine the in situ ruminal degradability of protein and amino acids from leaves (6, 18 and 48 hours of ruminal incubation. For determination of the intestinal digestibility of RUDP, the residue from ruminal incubation of the materials was used for 18 hours. A larger concentration of total amino acids for ramie and smaller for perennial soybean were observed; however, they were very similar in leucaena and cassava. Leucine was the essential amino acid of greater concentration, with the exception of cassava, which exhibited a leucine concentration 40.45% smaller. Ramie showed 14.35 and 22.31% more lysine and methionine, respectively. The intestinal digestibility of RUDP varied from 23.56; 47.87; 23.48; 25.69 and 10.86% for leucaena, perennial soybean, cassava, ramie and pigeon pea, respectively. The individual amino acids of tropical forage disappeared in different extensions in the rumen. For the correct evaluation of those forages, one should consider their composition of amino acids, degradations and intestinal digestibility, once the amino acid composition of the forage does not reflect the amino acid profiles that arrived in the small intestine. Differences between the degradation curves of CP and amino acids indicate that degradation of amino acids cannot be estimated through the degradation curve of CP, and that amino acids are not degraded in a similar degradation profile.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

Kinetic study on the photocatalytic degradation of salicylic acid using ZnO catalyst

International Nuclear Information System (INIS)

Nageswara Rao, A.; Sivasankar, B.; Sadasivam, V.

2009-01-01

The photocatalytic degradation of salicylic acid was studied by a batch process using ZnO as the catalyst on irradiation with UV light. The effect of process parameters such as pH, catalyst loading and initial concentration of salicylic acid on the extent of degradation was investigated. The degradation of salicylic acid was found to be effective in the neutral pH range. The optimum catalyst loading was observed at 2.0 g/L. The process followed first order kinetics and the apparent rate constant decreased with increase in the initial concentration of salicylic acid. The mechanism for the degradation of salicylic acid could be explained on the basis of Langmuir-Hinshelwood mechanism. The complete mineralization of salicylic acid was observed in the presence of ZnO photocatalyst. The ZnO was found to be quite stable and undergoes photocorrosion only to a negligible extent.

Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.

Science.gov (United States)

Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng

2016-09-01

Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus.

A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

Science.gov (United States)

Kim, Dae Hun; Ko, Kwan Soo

2015-07-01

To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

Varying Conditions for Hexanoic Acid Degradation with BioTigerTM

International Nuclear Information System (INIS)

Foreman, Koji; Milliken, Charles; Brigmon, Robin

2016-01-01

BioTiger TM (BT) is a consortium of 12 bacteria designed for petroleum waste biodegradation. BT is currently being studied and could be considered for bioremediation of the Athabasca oil sands refineries in Canada and elsewhere. The run-off ponds from the petroleum extraction processes, called tailings ponds, are a mixture of polycyclic aromatic hydrocarbons, naphthenic acids, hydrocarbons, toxic chemicals like heavy metals, water, and sand. Due to environmental regulations the oil industry would like to separate and degrade the hazardous chemical species from the tailings ponds while recycling the water. It has been shown that BT at 30 C° is able to completely degrade 10 mM hexanoic acid (HA) co-metabolically with 0.2% yeast extract (w/v) in 48 hours when starting at 0.4 OD 600nm. After establishing this stable degradation capability, variations were tested to explore the wider parameters of BT activity in temperature, pH, intermediate degradation, co-metabolic dependence, and transfer stability. Due to the vast differences in temperature at various points in the refineries, a wide range of temperatures were assessed. The results indicate that BT retains the ability to degrade HA, a model surrogate for tailings pond contaminants, at temperatures ranging from 15°C to 35°C. Hexanamide (HAM) was shown to be an intermediate generated during the degradation of HA in an earlier work and HAM is completely degraded after 48 hours, indicating that HAM is not the final product of HA degradation. Various replacements for yeast extract were attempted. Glucose, a carbon source; casein amino acids, a protein source; additional ammonia, mimicking known media; and additional phosphate with Wolffe's vitamins and minerals all showed no significant degradation of HA compared to control. Decreasing the yeast extract concentration (0.05%) demonstrated limited but significant degradation. Finally, serial inoculations of BT were performed to determine the stability of

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Abscisic acid-regulated protein degradation causes osmotic stress-induced accumulation of branched-chain amino acids in Arabidopsis thaliana.

Science.gov (United States)

Huang, Tengfang; Jander, Georg

2017-10-01

Whereas proline accumulates through de novo biosynthesis in plants subjected to osmotic stress, leucine, isoleucine, and valine accumulation in drought-stressed Arabidopsis thaliana is caused by abscisic acid-regulated protein degradation. In response to several kinds of abiotic stress, plants greatly increase their accumulation of free amino acids. Although stress-induced proline increases have been studied the most extensively, the fold-increase of other amino acids, in particular branched-chain amino acids (BCAAs; leucine, isoleucine, and valine), is often higher than that of proline. In Arabidopsis thaliana (Arabidopsis), BCAAs accumulate in response to drought, salt, mannitol, polyethylene glycol, herbicide treatment, and nitrogen starvation. Plants that are deficient in abscisic acid signaling accumulate lower amounts of BCAAs, but not proline and most other amino acids. Previous bioinformatic studies had suggested that amino acid synthesis, rather than protein degradation, is responsible for the observed BCAA increase in osmotically stressed Arabidopsis. However, whereas treatment with the protease inhibitor MG132 decreased drought-induced BCAA accumulation, inhibition of BCAA biosynthesis with the acetolactate synthase inhibitors chlorsulfuron and imazapyr did not. Additionally, overexpression of BRANCHED-CHAIN AMINO ACID TRANSFERASE2 (BCAT2), which is upregulated in response to osmotic stress and functions in BCAA degradation, decreased drought-induced BCAA accumulation. Together, these results demonstrate that BCAA accumulation in osmotically stressed Arabidopsis is primarily the result of protein degradation. After relief of the osmotic stress, BCAA homeostasis is restored over time by amino acid degradation involving BCAT2. Thus, drought-induced BCAA accumulation is different from that of proline, which is accumulated due to de novo synthesis in an abscisic acid-independent manner and remains elevated for a more prolonged period of time after removal of

Neutron scattering and HPLC study on L-ascorbic acid and its degradation

International Nuclear Information System (INIS)

Bellocco, E.; Barreca, D.; Lagana, G.; Leuzzi, U.; Migliardo, F.; Torre, R. La; Galli, G.; Galtieri, A.; Minutoli, L.; Squadrito, F.

2008-01-01

The present paper shows a systematic dynamic and kinetic study on L-ascorbic acid and its degradation at high temperature. The neutron scattering study allows, through the behavior of quasi-elastic neutron scattering (QENS) spectra, to characterize the diffusive dynamics of L-ascorbic acid in water mixtures. Ascorbic acid undergoes degradation process at high temperature, but the presence of trehalose in solution markedly avoids ascorbic acid loss enhancing its t 1/2 (half life time), as determined by high performance liquid chromatography (HPLC)

What makes ribosome-mediated transcriptional attenuation sensitive to amino acid limitation?

Directory of Open Access Journals (Sweden)

Johan Elf

2005-06-01

Full Text Available Ribosome-mediated transcriptional attenuation mechanisms are commonly used to control amino acid biosynthetic operons in bacteria. The mRNA leader of such an operon contains an open reading frame with "regulatory" codons, cognate to the amino acid that is synthesized by the enzymes encoded by the operon. When the amino acid is in short supply, translation of the regulatory codons is slow, which allows transcription to continue into the structural genes of the operon. When amino acid supply is in excess, translation of regulatory codons is rapid, which leads to termination of transcription. We use a discrete master equation approach to formulate a probabilistic model for the positioning of the RNA polymerase and the ribosome in the attenuator leader sequence. The model describes how the current rate of amino acid supply compared to the demand in protein synthesis (signal determines the expression of the amino acid biosynthetic operon (response. The focus of our analysis is on the sensitivity of operon expression to a change in the amino acid supply. We show that attenuation of transcription can be hyper-sensitive for two main reasons. The first is that its response depends on the outcome of a race between two multi-step mechanisms with synchronized starts: transcription of the leader of the operon, and translation of its regulatory codons. The relative change in the probability that transcription is aborted (attenuated can therefore be much larger than the relative change in the time it takes for the ribosome to read a regulatory codon. The second is that the general usage frequencies of codons of the type used in attenuation control are small. A small percentage decrease in the rate of supply of the controlled amino acid can therefore lead to a much larger percentage decrease in the rate of reading a regulatory codon. We show that high sensitivity further requires a particular choice of regulatory codon among several synonymous codons for the

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Quantitative analysis of Loperamide hydrochloride in the presence its acid degradation products

Directory of Open Access Journals (Sweden)

Savić Ivana M.

2009-01-01

Full Text Available The aim of this work was to develop a new RP-HPLC method for the determination of loperamide hydrochloride in the presence of its acid degradation products. Separation of loperamide from degradation products was performed using ZORBAX Eclipse XDB C-18, column with a mobile phase consisting of 0.1% sodium-octansulphonate, 0.05% triethylamine, 0.1% ammonium hydroxide in water:acetonitrile (45:55 v/v. The mobile phase was adjusted to pH 3.2 with phosphoric acid. The method showed high sensitivity with good linearity over the concentration range of 10 to 100 μg cm-3. The method was successfully applied to the analysis of a pharmaceutical formulation (Loperamide, Zdravlje-Actavis, Serbia containing loperamide hydrochloride with excellent recovery. The loperamide hydrochloride degradation during acid hydrolysis and kinetics investigation was carried out in hydrochloric acid solutions of 0.1, 1.0 and 1.5 mol dm-3, at different temperatures (25 and 40°C, by monitoring the parent compound itself. The first order reaction of loperamide degradation in acid solution was determined. The activation energy was estimated from the Arrhenius plot and it was found to be 38.81 kJ mol-1 at 40°C. The developed procedure was successfully applied for the rapid determination of loperamide hydrochloride in pharmaceutical formulation (Loperamide, Zdravlje-Actavis, Serbia and in the presence of its acid degradation products.

Degradation of gas-liquid gliding arc discharge on Acid Orange II

International Nuclear Information System (INIS)

Yan, J.H.; Liu, Y.N.; Bo, Zh.; Li, X.D.; Cen, K.F.

2008-01-01

The effects of pH value, initial concentration of dye solution and temperature on the degradation efficiency of Acid Orange II (AO7) using gas-liquid gliding arc discharge were investigated. The influences of pH value and temperature on degradation efficiency were not apparent. Increasing initial solution concentration caused the decrease of degradation rate and the increase of absolute degradation quantity. Considering energy efficiency and absolute degradation quantity, the gas-liquid gliding arc discharge is fit for treating high concentration organic wastewater. A possible mineralization pathway was proposed through the analysis of intermediate products detected by gas chromatograph coupled with mass spectrophotometer (GC-MS) and ion chromatograph (IC). Hydroxyl radicals reacted with the azo linkage-bearing carbon of a hydroxy-substituted ring, leading to the cleavage of -C-N- and degradation of AO7. The solution biodegradability was significantly improved (BOD 5 /COD from 0.02 to 0.43). The toxicity of intermediate products was lower than that of the initial Acid Orange II

Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

Science.gov (United States)

Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

2015-10-23

The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

Science.gov (United States)

Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

2017-05-01

Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

[Degradation of urea and ethyl carbamate in Chinese Rice wine by recombinant acid urease].

Science.gov (United States)

Zhou, Jianli; Kang, Zhen; Liu, Qingtao; Du, Guocheng; Chen, Jian

2016-01-01

Ethyl carbamate (EC) as a potential carcinogen commonly exists in traditional fermented foods. It is important eliminate urea that is the precursors of EC in many fermented foods, including Chinese Rice wine. On the basis of achieving high-level overexpression of food-grade ethanol-resistant acid urease, we studied the hydrolysis of urea and EC with the recombinant acid urease. Recombinant acid urease showed degraded urea in both the simulated system with ethanol and Chinese Rice wine (60 mg/L of urea was completely degraded within 25 h), indicating that the recombinant enzyme is suitable for the elimination of urea in Chinese Rice wine. Although recombinant acid urease also has degradation catalytic activity on EC, no obvious degradation of EC was observed. Further investigation results showed that the Km value for urea and EC of the recombinant acid urease was 0.7147 mmol/L and 41.32 mmol/L, respectively. The results provided theoretical foundation for realizing simultaneous degradation of urea and EC.

Neutron scattering and HPLC study on L-ascorbic acid and its degradation

Energy Technology Data Exchange (ETDEWEB)

Bellocco, E. [Department of Organic and Biological Chemistry, University of Messina, Messina (Italy)], E-mail: bellocco@isengard.unime.it; Barreca, D.; Lagana, G.; Leuzzi, U. [Department of Organic and Biological Chemistry, University of Messina, Messina (Italy); Migliardo, F.; Torre, R. La; Galli, G. [Department of Physics, University of Messina, Messina (Italy); Galtieri, A. [Department of Organic and Biological Chemistry, University of Messina, Messina (Italy); Minutoli, L.; Squadrito, F. [Department of Clinical and Experimental Medicine and Pharmacology, University of Messina, Messina (Italy)

2008-04-18

The present paper shows a systematic dynamic and kinetic study on L-ascorbic acid and its degradation at high temperature. The neutron scattering study allows, through the behavior of quasi-elastic neutron scattering (QENS) spectra, to characterize the diffusive dynamics of L-ascorbic acid in water mixtures. Ascorbic acid undergoes degradation process at high temperature, but the presence of trehalose in solution markedly avoids ascorbic acid loss enhancing its t{sub 1/2} (half life time), as determined by high performance liquid chromatography (HPLC)

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

Science.gov (United States)

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Enzymatic oxalic acid regulation correlated with wood degradation in four brown-rot fungi

Science.gov (United States)

Anne Christine Steenkjær Hastrup; Frederick Green III; Patricia K. Lebow; Bo Jensen

2012-01-01

Oxalic acid is a key component in the initiation of brown-rot decay and it has been suggested that it plays multiple roles during the degradation process. Oxalic acid is accumulated to varying degrees among brown-rot fungi; however, details on active regulation are scarce. The accumulation of oxalic acid was measured in this study from wood degraded by the four brown-...

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

Degradation of chitosan hydrogel dispersed in dilute carboxylic acids by solution plasma and evaluation of anticancer activity of degraded products

Science.gov (United States)

Chokradjaroen, Chayanaphat; Rujiravanit, Ratana; Theeramunkong, Sewan; Saito, Nagahiro

2018-01-01

Chitosan is a polysaccharide that has been extensively studied in the field of biomedicine, especially its water-soluble degraded products called chitooligosaccharides (COS). In this study, COS were produced by the degradation of chitosan hydrogel dispersed in a dilute solution (i.e., 1.55 mM) of various kinds of carboxylic acids using a non-thermal plasma technology called solution plasma (SP). The degradation rates of chitosan were influenced by the type of carboxylic acids, depending on the interaction between chitosan and each carboxylic acid. After SP treatment, the water-soluble degraded products containing COS could be easily separated from the water-insoluble residue of chitosan hydrogel by centrifugation. The production yields of the COS were mostly higher than 55%. Furthermore, the obtained COS products were evaluated for their inhibitory effect as well as their selectivity against human lung cancer cells (H460) and human lung normal cells (MRC-5).

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Recovery of acid-degraded tributyl phosphate by solvent extraction

International Nuclear Information System (INIS)

Young, G.C.; Holladay, D.W.

1981-01-01

During nuclear fuel reprocessing the organic solvent becomes loaded with various acidic degradation products, which can be effectively removed through solvent extraction. Studies have been made with a small bench-scale solvent extraction system to optimize such parameters as pH of aqueous phase, phase ratio, residence time, flow rates, and temperature. The necessary decontamination factors have been obtained for various degradation products during continuous solvent extraction in one stage, with the aqueous phase being recycled. The aqueous phase contains compounds that can be degraded to gases to minimize waste disposal problems

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Nanobiocatalytic Degradation of Acid Orange 7

Science.gov (United States)

Hastings, Jason

The catalytic properties of various metal nanoparticles have led to their use in environmental remediation applications. However, these remediation strategies are limited by their ability to deliver catalytic nanoparticles and a suitable electron donor to large treatment zones. Clostridium pasteurianum BC1 cells, loaded with bio-Pd nanoparticles, were used to effectively catalyze the reductive degradation and removal of Acid Orange 7 (AO7), a model azo compound. Hydrogen produced fermentatively by the C. pasteurianum BC1 acted as the electron donor for the process. Pd-free bacterial cultures or control experiments conducted with heat-killed cells showed limited reduction of AO7. Experiments also showed that the in situ biological production of H2 by C. pasteurianum BC1 was essential for the degradation of AO7, which suggests a novel process where the in situ microbial production of hydrogen is directly coupled to the catalytic bio-Pd mediated reduction of AO7. The differences in initial degradation rate for experiments conducted using catalyst concentrations of 1ppm Pd and 5ppm Pd and an azo dye concentration of 100ppm AO7 was 0.39 /hr and 1.94 /hr respectively, demonstrating the importance of higher concentrations of active Pd(0). The degradation of AO7 was quick as demonstrated by complete reductive degradation of 50ppm AO7 in 2 hours in experiments conducted using a catalyst concentration of 5ppm Pd. Dye degradation products were analyzed via Gas Chromatograph-Mass Spectrometer (GCMS), High Performance Liquid Chromatography (HPLC), UltraViolet-Visible spectrophotometer (UV-Vis) and Matrix-Assisted Laser Desorption/Ionization (MALDI) spectrometry. The presence of 1-amino 2-naphthol, one of the hypothesized degradation products, was confirmed using mass spectrometry.

Photo-degradation of clofibric acid by ultraviolet light irradiation at 185 nm.

Science.gov (United States)

Li, Wenzhen; Lu, Shuguang; Chen, Nuo; Gu, Xiaogang; Qiu, Zhaofu; Fan, Ji; Lin, Kuangfei

2009-01-01

As a metabolite of lipid regulators, clofibric acid (CA) was investigated in this study for its ultraviolet (UV) degradation at monochromatic wavelength of 185 nm using Milli-Q water and sewage treatment plant (STP) effluent. The effects of CA initial concentration, solution pH, humic acid (HA), nitrate and bicarbonate anions on CA degradation performances were evaluated. All CA degradation patterns well fitted the pseudo-first-order kinetic model. The results showed that OH generated from water photolysis by UV185 irradiation was involved, resulting in indirect CA photolysis but contributed less to the whole CA removal when compared to the main direct photolysis process. Acid condition favored slightly to CA degradation and other constituents in solution, such as HA (5.0-100.0 mg L(-1)), nitrate and bicarbonate anions (1.0x10(-3) mol L(-1) and 0.1 mol L(-1)), had negative effects on CA degradation. When using real STP effluent CA degradation could reach 97.4% (without filtration) and 99.3% (with filtration) after 1 hr irradiation, showing its potential mean in pharmaceuticals removal in UV disinfection unit. Mineralization tests showed that rapid chloride ion release happened, resulting in no chlorinated intermediates accumulation, and those non-chlorinated intermediate products could further be nearly completely degraded to CO2 and H2O after 6 hrs.

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Electrochemical degradation of clofibric acid in water by anodic oxidation

Energy Technology Data Exchange (ETDEWEB)

Sires, Ignasi [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Cabot, Pere Lluis [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Centellas, Francesc [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Garrido, Jose Antonio [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Rodriguez, Rosa Maria [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Arias, Conchita [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain); Brillas, Enric [Laboratori de Ciencia i Tecnologia Electroquimica de Materials, Departament de Quimica Fisica, Facultat de Quimica, Universitat de Barcelona, Marti i Franques 1-11, 08028 Barcelona (Spain)]. E-mail: brillas@ub.edu

2006-10-05

Aqueous solutions containing the metabolite clofibric acid (2-(4-chlorophenoxy)-2-methylpropionic acid) up to close to saturation in the pH range 2.0-12.0 have been degraded by anodic oxidation with Pt and boron-doped diamond (BDD) as anodes. The use of BDD leads to total mineralization in all media due to the efficient production of oxidant hydroxyl radical ({center_dot}OH). This procedure is then viable for the treatment of wastewaters containing this compound. The effect of pH, apparent current density, temperature and metabolite concentration on the degradation rate, consumed specific charge and mineralization current efficiency has been investigated. Comparative treatment with Pt yields poor decontamination with complete release of stable chloride ion. When BDD is used, this ion is oxidized to Cl{sub 2}. Clofibric acid is more rapidly destroyed on Pt than on BDD, indicating that it is more strongly adsorbed on the Pt surface enhancing its reaction with {center_dot}OH. Its decay kinetics always follows a pseudo-first-order reaction and the rate constant for each anode increases with increasing apparent current density, being practically independent of pH and metabolite concentration. Aromatic products such as 4-chlorophenol, 4-chlorocatechol, 4-chlororesorcinol, hydroquinone, p-benzoquinone and 1,2,4-benzenetriol are detected by gas chromatography-mass spectrometry (GC-MS) and reversed-phase chromatography. Tartronic, maleic, fumaric, formic, 2-hydroxyisobutyric, pyruvic and oxalic acids are identified as generated carboxylic acids by ion-exclusion chromatography. These acids remain stable in solution using Pt, but they are completely converted into CO{sub 2} with BDD. A reaction pathway for clofibric acid degradation involving all these intermediates is proposed.

Electrochemical degradation of clofibric acid in water by anodic oxidation

International Nuclear Information System (INIS)

Sires, Ignasi; Cabot, Pere Lluis; Centellas, Francesc; Garrido, Jose Antonio; Rodriguez, Rosa Maria; Arias, Conchita; Brillas, Enric

2006-01-01

Aqueous solutions containing the metabolite clofibric acid (2-(4-chlorophenoxy)-2-methylpropionic acid) up to close to saturation in the pH range 2.0-12.0 have been degraded by anodic oxidation with Pt and boron-doped diamond (BDD) as anodes. The use of BDD leads to total mineralization in all media due to the efficient production of oxidant hydroxyl radical (·OH). This procedure is then viable for the treatment of wastewaters containing this compound. The effect of pH, apparent current density, temperature and metabolite concentration on the degradation rate, consumed specific charge and mineralization current efficiency has been investigated. Comparative treatment with Pt yields poor decontamination with complete release of stable chloride ion. When BDD is used, this ion is oxidized to Cl 2 . Clofibric acid is more rapidly destroyed on Pt than on BDD, indicating that it is more strongly adsorbed on the Pt surface enhancing its reaction with ·OH. Its decay kinetics always follows a pseudo-first-order reaction and the rate constant for each anode increases with increasing apparent current density, being practically independent of pH and metabolite concentration. Aromatic products such as 4-chlorophenol, 4-chlorocatechol, 4-chlororesorcinol, hydroquinone, p-benzoquinone and 1,2,4-benzenetriol are detected by gas chromatography-mass spectrometry (GC-MS) and reversed-phase chromatography. Tartronic, maleic, fumaric, formic, 2-hydroxyisobutyric, pyruvic and oxalic acids are identified as generated carboxylic acids by ion-exclusion chromatography. These acids remain stable in solution using Pt, but they are completely converted into CO 2 with BDD. A reaction pathway for clofibric acid degradation involving all these intermediates is proposed

Convergent synthesis of degradable dendrons based on L-malic acid

DEFF Research Database (Denmark)

Meyhoff, Ulrich; Riber, Ulla; Boas, Ulrik

2015-01-01

New degradable polyester dendrons based on the cellular tricarboxylic acid cycle component L-malic acid were synthesized up to the third generation by convergent synthesis. The dendron wedges could be introduced in a stepwise, highly regioselective fashion. HMBC-NMR revealed that the C1-carbonyl...

Degradation of L-Ascorbic Acid in the Amorphous Solid State.

Science.gov (United States)

Sanchez, Juan O; Ismail, Yahya; Christina, Belinda; Mauer, Lisa J

2018-03-01

Ascorbic acid degradation in amorphous solid dispersions was compared to its degradation in the crystalline state. Physical blends and lyophiles of ascorbic acid and polymers (pectins and polyvinylpyrrolidone [PVP]) were prepared initially at 50:50 (w/w), with further studies using the polymer that best inhibited ascorbic acid crystallization in the lyophiles in 14 vitamin : PVP ratios. Samples were stored in controlled environments (25 to 60 °C, 0% to 23% RH) for 1 mo and analyzed periodically to track the physical appearance, change in moisture content, physical state (powder x-ray diffraction and polarized light microscopy), and vitamin loss (high performance liquid chromatography) over time. The glass transition temperatures of select samples were determined using differential scanning calorimetry, and moisture sorption profiles were generated. Ascorbic acid in the amorphous form, even in the glassy amorphous state, was more labile than in the crystalline form in some formulations at the highest storage temperature. Lyophiles stored at 25 and 40 °C and those in which ascorbic acid had crystallized at 60 °C (≥70% ascorbic acid : PVP) had no significant difference in vitamin loss (P > 0.05) relative to physical blend controls, and the length of storage had little effect. At 60 °C, amorphous ascorbic acid lyophiles (≤60% ascorbic acid : PVP) lost significantly more vitamin (P vitamin loss significantly increased over time. In these lyophiles, vitamin degradation also significantly increased (P vitamins are naturally present or added at low concentrations and production practices may promote amorphization of the vitamin. Vitamin C is one of the most unstable vitamins in foods. This study documents that amorphous ascorbic acid is less stable than crystalline ascorbic acid in some environments (for example, higher temperatures within 1 wk), especially when the vitamin is present at low concentrations in a product. These findings increase the understanding of

A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

Directory of Open Access Journals (Sweden)

Enrico eMuhr

2016-01-01

Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

THERMAL DEGRADATION OF THERMOTROPIC LIQUID CRYSTALLINE TERPOLYESTERS BASED ON VANILLIC ACID, p-HYDROXYBENZOIC ACID AND POLY(ETHYLENE TEREPHTHALATE)

Institute of Scientific and Technical Information of China (English)

LI Xingui; HUANG Meirong; GUAN Guihe; SUN Tong

1993-01-01

Nine thermotropic liquid crystalline terpolyesters based on vanillic acid(V), p-hydroxybenzoic acid(H) and poly(ethylene terephthalate)(E) were investigated by thermogravimetry to ascertain their thermostability and the kinetic parameters for thermal degradation. Overall activation energy data of the degradation had been calculated over the range 5～70% weight loss. The temperatures and the activation energy of the degradation lie in the ranges of 384～394 ℃ at a heating rate of 1 ℃/min and 176～205 KJ/mol at the weight loss of 5%, respectively, which suggests that the terpolyesters have good thermostability.

Modeling the degradation of Portland cement pastes by biogenic organic acids

International Nuclear Information System (INIS)

De Windt, Laurent; Devillers, Philippe

2010-01-01

Reactive transport models can be used to assess the long-term performance of cement-based materials subjected to biodegradation. A bioleaching test (with Aspergillus niger fungi) applied to ordinary Portland cement pastes during 15 months is modeled with HYTEC. Modeling indicates that the biogenic organic acids (acetic, butyric, lactic and oxalic) strongly accelerate hydrate dissolution by acidic hydrolysis whilst their complexation of aluminum has an effect on the secondary gel stability only. The deepest degradation front corresponds to portlandite dissolution and decalcification of calcium silicate hydrates. A complex pattern of sulfate phases dissolution and precipitation takes place in an intermediate zone. The outermost degraded zone consists of alumina and silica gels. The modeling accurateness of calcium leaching, pH evolution and degradation thickness is consistently enhanced whilst considering increase of diffusivity in the degraded zones. Precipitation of calcium oxalate is predicted by modeling but was hindered in the bioleaching reactor.

Physical fertility of degraded acid sands in South-eastern Nigeria ...

African Journals Online (AJOL)

We evaluated the physical fertility of degraded and undegraded acid sands in Akwa Ibom State, South-eastern Nigeria. The soils were similar in texture, being predominantly sandy, averaging 90.1% in degraded and 89.9% in undegraded soil. Bulk density averaged 1.50g/cm3 and 1.45g/cm3, while macropores averaged ...

Thermal degradation kinetics of polylactic acid/acid fabricated cellulose nanocrystal based bionanocomposites.

Science.gov (United States)

Monika; Dhar, Prodyut; Katiyar, Vimal

2017-11-01

Cellulose nanocrystals (CNC) are fabricated from filter paper (as cellulosic source) by acid hydrolysis using different acids such as sulphuric (H 2 SO 4 ), phosphoric (H 3 PO 4 ), hydrochloric (HCl) and nitric (HNO 3 ) acid. The resulting acid derived CNC are melt mixed with Polylactic acid (PLA) using extruder at 180°C. Thermogravimetric (TGA) result shows that increase in 10% and 50% weight loss (T 10 , T 50 ) temperature for PLA-CNC film fabricated with HNO 3 , H 3 PO 4 and HCl derived CNC have improved thermal stability in comparison to H 2 SO 4 -CNC. Nonisothermal kinetic studies are carried out with modified-Coats-Redfern (C-R), Ozawa-Flynn-Wall (OFW) and Kissinger method to predict the kinetic and thermodynamic parameters. Subsequently prediction of these parameter leads to the proposal of thermal induced degradation mechanism of nanocomposites using Criado method. The distribution of E a calculated from OFW model are (PLA-H 3 PO 4 -CNC: 125-139 kJmol -1 ), (PLA-HNO 3 -CNC: 126-145 kJmol -1 ), (PLA-H 2 SO 4 -CNC: 102-123 kJmol -1 ) and (PLA-HCl-CNC: 140-182 kJmol -1 ). This difference among E a for the decomposition of PLA-CNC bionanocomposite is probably due to various acids used in this study. The E a calculated by these two methods are found in consonance with that observed from Kissinger method. Further, hyphenated TG-Fourier transform infrared spectroscopy (FTIR) result shows that gaseous products such as CO 2 , CO, lactide, aldehydes and other compounds are given off during the thermal degradation of PLA-CNC nanocomposite. Copyright © 2017 Elsevier B.V. All rights reserved.

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

"Click" synthesis of fatty acid derivatives as fast-degrading polyanhydride precursors.

Science.gov (United States)

Lluch, Cristina; Lligadas, Gerard; Ronda, Joan C; Galià, Marina; Cadiz, Virginia

2011-09-01

Fast-degrading linear and branched polyanhydrides are obtained by melt-condensation of novel di- and tri-carboxylic acid monomers based on oleic and undecylenic acid synthesized using photoinitiated thiol-ene click chemistry. (1)H NMR spectroscopy, size exclusion chromatography, differential scanning calorimetry, thermogravimetric analysis, and FT-IR spectroscopy have been used to fully characterize these polymers. The hydrolytic degradation of these polymers was studied by means of weight loss, anhydride bond loss, and changes in molecular weight, showing fast degrading properties. Drug release studies from the synthesized polyanhydrides have also been conducted, using rhodamine B as a hydrophobic model drug, to evaluate the potential of these polymers in biomedical applications. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cathepsin B-sensitive polymers for compartment-specific degradation and nucleic acid release.

Science.gov (United States)

Chu, David S H; Johnson, Russell N; Pun, Suzie H

2012-02-10

Degradable cationic polymers are desirable for in vivo nucleic acid delivery because they offer significantly decreased toxicity over non-degradable counterparts. Peptide linkers provide chemical stability and high specificity for particular endopeptidases but have not been extensively studied for nucleic acid delivery applications. In this work, enzymatically degradable peptide-HPMA copolymers were synthesized by RAFT polymerization of HPMA with methacrylamido-terminated peptide macromonomers, resulting in polymers with low polydispersity and near quantitative incorporation of peptides. Three peptide-HPMA copolymers were evaluated: (i) pHCathK(10), containing peptides composed of the linker phe-lys-phe-leu (FKFL), a substrate of the endosomal/lysosomal endopeptidase cathepsin B, connected to oligo-(L)-lysine for nucleic acid binding, (ii) pHCath(D)K(10), containing the FKFL linker with oligo-(D)-lysine, and (iii) pH(D)Cath(D)K(10), containing all (D) amino acids. Cathepsin B degraded copolymers pHCathK(10) and pHCath(D)K(10) within 1 h while no degradation of pH(D)Cath(D)K(10) was observed. Polyplexes formed with pHCathK(10) copolymers show DNA release by 4 h of treatment with cathepsin B; comparatively, polyplexes formed with pHCath(D)K(10) and pH(D)Cath(D)K(10) show no DNA release within 8 h. Transfection efficiency in HeLa and NIH/3T3 cells were comparable between the copolymers but pHCathK(10) was less toxic. This work demonstrates the successful application of peptide linkers for degradable cationic polymers and DNA release. Copyright © 2011 Elsevier B.V. All rights reserved.

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Modeling the degradation kinetics of ascorbic acid.

Science.gov (United States)

Peleg, Micha; Normand, Mark D; Dixon, William R; Goulette, Timothy R

2018-06-13

Most published reports on ascorbic acid (AA) degradation during food storage and heat preservation suggest that it follows first-order kinetics. Deviations from this pattern include Weibullian decay, and exponential drop approaching finite nonzero retention. Almost invariably, the degradation rate constant's temperature-dependence followed the Arrhenius equation, and hence the simpler exponential model too. A formula and freely downloadable interactive Wolfram Demonstration to convert the Arrhenius model's energy of activation, E a , to the exponential model's c parameter, or vice versa, are provided. The AA's isothermal and non-isothermal degradation can be simulated with freely downloadable interactive Wolfram Demonstrations in which the model's parameters can be entered and modified by moving sliders on the screen. Where the degradation is known a priori to follow first or other fixed order kinetics, one can use the endpoints method, and in principle the successive points method too, to estimate the reaction's kinetic parameters from considerably fewer AA concentration determinations than in the traditional manner. Freeware to do the calculations by either method has been recently made available on the Internet. Once obtained in this way, the kinetic parameters can be used to reconstruct the entire degradation curves and predict those at different temperature profiles, isothermal or dynamic. Comparison of the predicted concentration ratios with experimental ones offers a way to validate or refute the kinetic model and the assumptions on which it is based.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

[Simulated study of algal fatty acid degradation in hypoxia seawater-sediment interface along China coastal area].

Science.gov (United States)

Sui, Wei-Wei; Ding, Hai-Bing; Yang, Gui-Peng; Lu, Xiao-Lan; Li, Wen-Juan; Sun, Li-Qun

2013-11-01

Series of laboratory incubation experiments were conducted to simulate degradation of organic matter in sediment-seawater interface in hypoxia enviroments along China coastal area. Under four different redox conditions (oxygen saturation: 100%, 50%, 25% and 0%), degradations of seveal biomarkers originated from Skeletonema costatum, a typical red tide alage along China coastal area were tracked. By analyzing concentrations of four fatty acid biomarkers [14:0, 16:0, 16:1(7) and 20:5] obtained at various sampling time, results showed that their concentrations decreased significantly after 2-3 weeks' incubation. Then, their concentrations changed very slowly or very little. However, degradation of the four fatty acids varied dramatically in different incubation systems. Fatty acids 14:0, 16:1(7) and 20:5 were degraded completely in all incubation systems after two-month incubation, but 25% to 35% of 16:0 was reserved in the systems. Based on multi-G model, degradations of the four fatty acids were quantively described. The results indicated that all four fatty acids had fast-degraded and slow-degraded fractions. Their degradation rate constants (k(av)) ranged from 0.079 to 0.84 d(-1). The fastest degradation of 14:0 and 16:1 (7) occurred under 25% oxygen concentrations. For these two compounds, in the fastest degradation system, their k(av), values were 2.3 folds and 1.7 folds higher than those in the slowest degradation system [50% oxygen saturation for 14:0 and 100% oxygen saturation for 16:1(7)] respectively. The 16:0 was degraded fastest under the anoxic condition and slowest under the 50% oxygen saturation. The ratio of the two k(av)s was 2.1. The k(av)s of 20:5 had a positive relationship with oxygen saturations. Results of this study suggested that besides oxgen saturations, structure and features of organic compounds, roles of microbe in the envrioments and etc. might affect degradations of fatty acids in S. costatum in hypoxia sediment-seawater interface

Degradation Behaviour of Gamma Irradiated Poly(Acrylic Acid)-graft-Chitosan Superabsorbent Hydrogel

Science.gov (United States)

Ria Barleany, Dhena; Ilhami, Alpin; Yusuf Yudanto, Dea; Erizal

2018-03-01

A series of superabsorbent hydrogels were prepared from chitosan and partially neutralized acrylic acid at room temperature by gamma irradiation technique. The effect of irradiation and chitosan addition to the degradation behaviour of polymer were investigated. The gel content, swelling capacity, Equillibrium Degree of Swelling (EDS), Fourier Transform Infra Red (FTIR), and Scanning Electron Microscopy (SEM) study were also performed. Natural degradation in soil and thermal degradation by using of TGA analysis were observed. The variation of chitosan compositions were 0.5, 1, 1.5, and 2 g and the total irradiation doses were 5, 10, 15, and 20 kGy. The highest water capacity of 583.3 g water/g dry hydrogel was resulted from 5 kGy total irradiation dose and 0,5 g addition of chitosan. From the thermal degradation evaluation by using of TGA analysis showed that irradiation dose did not give a significant influence to the degradation rate. The rate of thermal degradation was ranged between 2.42 to 2.55 mg/min. In the natural test of degradation behaviour by using of soil medium, the hydrogel product with chitosan addition was found to have better degradability compared with the poly(acrylic acid) polymer without chitosan.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

Science.gov (United States)

Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

2016-05-18

Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

Degradation of 3-phenoxybenzoic acid by a Bacillus sp.

Directory of Open Access Journals (Sweden)

Shaohua Chen

Full Text Available 3-Phenoxybenzoic acid (3-PBA is of great environmental concern with regards to endocrine disrupting activity and widespread occurrence in water and soil, yet little is known about microbial degradation in contaminated regions. We report here that a new bacterial strain isolated from soil, designated DG-02, was shown to degrade 95.6% of 50 mg·L(-1 3-PBA within 72 h in mineral salt medium (MSM. Strain DG-02 was identified as Bacillus sp. based on the morphology, physio-biochemical tests and 16S rRNA sequence. The optimum conditions for 3-PBA degradation were determined to be 30.9°C and pH 7.7 using response surface methodology (RSM. The isolate converted 3-PBA to produce 3-(2-methoxyphenoxy benzoic acid, protocatechuate, phenol, and 3,4-dihydroxy phenol, and subsequently transformed these compounds with a q(max, K(s and K(i of 0.8615 h(-1, 626.7842 mg·L(-1 and 6.7586 mg·L(-1, respectively. A novel microbial metabolic pathway for 3-PBA was proposed on the basis of these metabolites. Inoculation of strain DG-02 resulted in a higher degradation rate on 3-PBA than that observed in the non-inoculated soil. Moreover, the degradation process followed the first-order kinetics, and the half-life (t(1/2 for 3-PBA was greatly reduced as compared to the non-inoculated control. This study highlights an important potential application of strain DG-02 for the in situ bioremediation of 3-PBA contaminated environments.

Kinetics of Maleic Acid and Aluminum Chloride Catalyzed Dehydration and Degradation of Glucose

Energy Technology Data Exchange (ETDEWEB)

Zhang, Ximing; Hewetson, Barron B.; Mosier, Nathan S.

2015-04-16

We report the positive effect of maleic acid, a dicarboxylic acid, on the selectivity of hexose dehydration to 5-hydroxymethyfurfural (HMF) and subsequent hydrolysis to levulinic and formic acids. We also describe the kinetic analysis of a Lewis acid (AlCl3) alone and in combination with HCl or maleic acid to catalyze the isomerization of glucose to fructose, dehydration of fructose to HMF, hydration of HMF to levulinic and formic acids, and degradation of these compounds to humins. The results show that AlCl3 significantly enhances the rate of glucose conversion to HMF and levulinic acid in the presence of both maleic acid and HCl. In addition, the degradation of HMF to humins, rather than levulinic and formic acids, is reduced by 50% in the presence of maleic acid and AlCl3 compared to HCl combined with AlCl3. The results suggest different reaction mechanisms for the dehydration of glucose and rehydration of HMF between maleic acid and HCl.

Ionizing radiation induced degradation of salicylic acid in aqueous solution

Science.gov (United States)

Albarrán, Guadalupe; Mendoza, Edith

2018-06-01

The radiation-induced degradation of salicylic acid (SA-) in aqueous solutions (1.0 and 0.1 mmol dm-3) saturated with N2O or air or without oxygen were studied. Irradiation was carried out using a cobalt-60 source. With a 1 mmol dm-3 solution saturated with N2O a seemingly total degradation occurred at about 18 kGy, although small quantities of 2,3-dihydroxybenzoic acid, catechol and 2,5-dihydroxybenzoic acid were present at that dose at concentrations of 67, 22 and 6 μmol dm-3 respectively. Under air and when free oxygen, the three radiolytic products were present at 18.54 kGy while SA- was destroyed only to 90% and 62%, respectively. In the case of 0.1 mmol dm-3 SA- solutions, the acid was degraded at 3.5 kGy if the solution contained N2O, at 5.8 kGy in air and at 7 kGy without oxygen. The concentration of the radiolytic products increased with increasing dose and after a maximum they decreased. The oxidation was followed by measuring the chemical oxygen demand; the slopes were 0.48 and 0.11, 0.21 and 0.07, 0.15 and 0.03 mmol dm-3 kGy-1 for 1.0 and 0.10 mmol dm-3 solutions saturated with N2O or air or without oxygen, respectively.

Selective degradation of ibuprofen and clofibric acid in two model river biofilm systems.

Science.gov (United States)

Winkler, M; Lawrence, J R; Neu, T R

2001-09-01

A field survey indicated that the Elbe and Saale Rivers were contaminated with both clofibric acid and ibuprofen. In Elbe River water we could detect the metabolite hydroxy-ibuprofen. Analyses of the city of Saskatoon sewage effluent discharged to the South Saskatchewan river detected clofibric acid but neither ibuprofen nor any metabolite. Laboratory studies indicated that the pharmaceutical ibuprofen was readily degraded in a river biofilm reactor. Two metabolites were detected and identified as hydroxy- and carboxy-ibuprofen. Both metabolites were observed to degrade in the biofilm reactors. However, in human metabolism the metabolite carboxy-ibuprofen appears and degrades second whereas the opposite occurs in biofilm systems. In biofilms the pharmacologically inactive stereoisomere of ibuprofen is degraded predominantly. In contrast, clofibric acid was not biologically degraded during the experimental period of 21 days. Similar results were obtained using biofilms developed using waters from either the South Saskatchewan or Elbe River. In a sterile reactor no losses of ibuprofen were observed. These results suggested that abiotic losses and adsorption played only a minimal role in the fate of the pharmaceuticals in the river biofilm reactors.

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Anaerobic degradation of veratrylglycerol-beta-guaiacyl ether and guaiacoxyacetic acid by mixed rumen bacteria.

OpenAIRE

Chen, W; Supanwong, K; Ohmiya, K; Shimizu, S; Kawakami, H

1985-01-01

Veratrylglycerol-beta-guaiacyl ether (0.2 g/liter), a lignin model compound, was found to be degraded by mixed rumen bacteria in a yeast extract medium under strictly anaerobic conditions to the extent of 19% within 24 h. Guaiacoxyacetic acid, 2-(o-methoxyphenoxy)ethanol, vanillic acid, and vanillin were detected as degradation products of veratrylglycerol-beta-guaiacyl ether by thin-layer chromatography, gas chromatography, and gas chromatography-mass spectrometry. Guaiacoxyacetic acid (0.25...

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

Science.gov (United States)

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

2017-11-01

The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

Degradation of 2,4-dichlorophenoxyacetic acid in water by ozone-hydrogen peroxide process

Institute of Scientific and Technical Information of China (English)

YU Ying-hui; MA Jun; HOU Yan-jun

2006-01-01

This study reports an investigation into the degradation of 2,4-dichlorophenoxyacetic acid in bubble contactor column by O3/H2O2 process, which is widely used as a principal advanced oxidation process. The degradation of 2,4-dichlorophenoxyacetic acid was studied under different H2O2/O3 molar ratio and pH value. Meanwhile, TOC removal was investigated both in distilled water and tap water. The influences of ozone transfer and consumed hydrogen peroxide were also discussed. The degradation products and oxidation intermediates were identified by GC-MS and LC-MS. A possible reaction mechanism was thus proposed.

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Carbon Source-Dependent Inducible Metabolism of Veratryl Alcohol and Ferulic Acid in Pseudomonas putida CSV86

Science.gov (United States)

Mohan, Karishma

2017-01-01

ABSTRACT Pseudomonas putida CSV86 degrades lignin-derived metabolic intermediates, viz., veratryl alcohol, ferulic acid, vanillin, and vanillic acid, as the sole sources of carbon and energy. Strain CSV86 also degraded lignin sulfonate. Cell respiration, enzyme activity, biotransformation, and high-pressure liquid chromatography (HPLC) analyses suggest that veratryl alcohol and ferulic acid are metabolized to vanillic acid by two distinct carbon source-dependent inducible pathways. Vanillic acid was further metabolized to protocatechuic acid and entered the central carbon pathway via the β-ketoadipate route after ortho ring cleavage. Genes encoding putative enzymes involved in the degradation were found to be present at fer, ver, and van loci. The transcriptional analysis suggests a carbon source-dependent cotranscription of these loci, substantiating the metabolic studies. Biochemical and quantitative real-time (qRT)-PCR studies revealed the presence of two distinct O-demethylases, viz., VerAB and VanAB, involved in the oxidative demethylation of veratric acid and vanillic acid, respectively. This report describes the various steps involved in metabolizing lignin-derived aromatic compounds at the biochemical level and identifies the genes involved in degrading veratric acid and the arrangement of phenylpropanoid metabolic genes as three distinct inducible transcription units/operons. This study provides insight into the bacterial degradation of lignin-derived aromatics and the potential of P. putida CSV86 as a suitable candidate for producing valuable products. IMPORTANCE Pseudomonas putida CSV86 metabolizes lignin and its metabolic intermediates as a carbon source. Strain CSV86 displays a unique property of preferential utilization of aromatics, including for phenylpropanoids over glucose. This report unravels veratryl alcohol metabolism and genes encoding veratric acid O-demethylase, hitherto unknown in pseudomonads, thereby providing new insight into the

A genomic view on syntrophic versus non-syntrophic lifestyle in anaerobic fatty acid degrading communities

NARCIS (Netherlands)

Worm, P.; Koehorst, J.J.; Visser, M.; Sedano Nunez, V.T.; Schaap, P.J.; Plugge, C.M.; Sousa, D.Z.; Stams, A.J.M.

2014-01-01

In sulfate-reducing and methanogenic environments complex biopolymers are hydrolyzed and degraded by fermentative micro-organisms that produce hydrogen, carbon dioxide and short chain fatty acids. Degradation of short chain fatty acids can be coupled to methanogenesis or to sulfate-reduction. Here

α-Amino acid containing degradable polymers as functional biomaterials: rational design, synthetic pathway, and biomedical applications.

Science.gov (United States)

Sun, Huanli; Meng, Fenghua; Dias, Aylvin A; Hendriks, Marc; Feijen, Jan; Zhong, Zhiyuan

2011-06-13

Currently, biomedical engineering is rapidly expanding, especially in the areas of drug delivery, gene transfer, tissue engineering, and regenerative medicine. A prerequisite for further development is the design and synthesis of novel multifunctional biomaterials that are biocompatible and biologically active, are biodegradable with a controlled degradation rate, and have tunable mechanical properties. In the past decades, different types of α-amino acid-containing degradable polymers have been actively developed with the aim to obtain biomimicking functional biomaterials. The use of α-amino acids as building units for degradable polymers may offer several advantages: (i) imparting chemical functionality, such as hydroxyl, amine, carboxyl, and thiol groups, which not only results in improved hydrophilicity and possible interactions with proteins and genes, but also facilitates further modification with bioactive molecules (e.g., drugs or biological cues); (ii) possibly improving materials biological properties, including cell-materials interactions (e.g., cell adhesion, migration) and degradability; (iii) enhancing thermal and mechanical properties; and (iv) providing metabolizable building units/blocks. In this paper, recent developments in the field of α-amino acid-containing degradable polymers are reviewed. First, synthetic approaches to prepare α-amino acid-containing degradable polymers will be discussed. Subsequently, the biomedical applications of these polymers in areas such as drug delivery, gene delivery and tissue engineering will be reviewed. Finally, the future perspectives of α-amino acid-containing degradable polymers will be evaluated.

Glycerol-plasticised silk membranes made using formic acid are ductile, transparent and degradation-resistant.

Science.gov (United States)

Allardyce, Benjamin J; Rajkhowa, Rangam; Dilley, Rodney J; Redmond, Sharon L; Atlas, Marcus D; Wang, Xungai

2017-11-01

Regenerated silk fibroin membranes tend to be brittle when dry. The use of plasticisers such as glycerol improve membrane ductility, but, when combined with aqueous processing, can lead to a higher degradation rate than solvent-annealed membranes. This study investigated the use of formic acid as the solvent with glycerol to make deformable yet degradation-resistant silk membranes. Here we show that membranes cast using formic acid had low light scattering, with a diffuse transmittance of less than 5% over the visible wavelengths, significantly lower than the 20% transmittance of aqueous derived silk/glycerol membranes. They had 64% β-sheet content and lost just 30% of the initial silk weight over 6h when tested with an accelerated enzymatic degradation assay, in comparison the aqueous membranes completely degraded within this timeframe. The addition of glycerol also improved the maximum elongation of formic acid derived membranes from under 3% to over 100%. They also showed good cytocompatibility and supported the adhesion and migration of human tympanic membrane keratinocytes. Formic acid based, silk/glycerol membranes may be of great use in medical applications such as repair of tympanic membrane perforation or ocular applications where transparency and resistance to enzymatic degradation are important. Copyright © 2017 Elsevier B.V. All rights reserved.

Enhanced degradation of Herbicide Isoproturon in wheat rhizosphere by salicylic acid.

Science.gov (United States)

Lu, Yi Chen; Zhang, Shuang; Miao, Shan Shan; Jiang, Chen; Huang, Meng Tian; Liu, Ying; Yang, Hong

2015-01-14

This study investigated the herbicide isoproturon (IPU) residues in soil, where wheat was cultivated and sprayed with salicylic acid (SA). Provision of SA led to a lower level of IPU residues in rhizosphere soil compared to IPU treatment alone. Root exudation of tartaric acid, malic acid, and oxalic acids was enhanced in rhizosphere soil with SA-treated wheat. We examined the microbial population (e.g., biomass and phospholipid fatty acid), microbial structure, and soil enzyme (catalase, phenol oxidase, and dehydrogenase) activities, all of which are associated with soil activity and were activated in rhizosphere soil of SA-treated wheat roots. We further assessed the correlation matrix and principal component to figure out the association between the IPU degradation and soil activity. Finally, six IPU degraded products (derivatives) in rhizosphere soil were characterized using ultraperformance liquid chromatography with a quadrupole-time-of-flight tandem mass spectrometer (UPLC/Q-TOF-MS/MS). A relatively higher level of IPU derivatives was identified in soil with SA-treated wheat than in soil without SA-treated wheat plants.

Mapping intermediate degradation products of poly(lactic-co-glycolic acid) in vitro.

Science.gov (United States)

Li, Jian; Nemes, Peter; Guo, Ji

2018-04-01

There is widespread interest in using absorbable polymers, such as poly(lactic-co-glycolic acid) (PLGA), as components in the design and manufacture of new-generation drug eluting stents (DES). PLGA undergoes hydrolysis to progressively degrade through intermediate chemical entities to simple organic acids that are ultimately absorbed by the human body. Understanding the composition and structure of these intermediate degradation products is critical not only to elucidate polymer degradation pathways accurately, but also to assess the safety and performance of absorbable cardiovascular implants. However, analytical approaches to determining the intermediate degradation products have yet to be established and evaluated in a standard or regulatory setting. Hence, we developed a methodology using electrospray ionization mass spectrometry to qualitatively and quantitatively describe intermediate degradation products generated in vitro from two PLGA formulations commonly used in DES. Furthermore, we assessed the temporal evolution of these degradation products using time-lapse experiments. Our data demonstrated that PLGA degradation products via heterogeneous cleavage of ester bonds are modulated by multiple intrinsic and environmental factors, including polymer chemical composition, degradants solubility in water, and polymer synthesis process. We anticipate the methodologies and outcomes presented in this work will elevate the mechanistic understanding of comprehensive degradation profiles of absorbable polymeric devices, and facilitate the design and regulation of cardiovascular implants by supporting the assessments of the associated biological response to degradation products. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 1129-1137, 2018. © 2017 Wiley Periodicals, Inc.

Muscle protein degradation and amino acid metabolism during prolonged knee-extensor exercise in humans

DEFF Research Database (Denmark)

Van Hall, Gerrit; Saltin, B; Wagenmakers, A J

1999-01-01

to a substantial increase in net muscle protein degradation, and that a lowering of the starting muscle glycogen content leads to a further increase. The carbon atoms of the branched-chain amino acids (BCAA), glutamate, aspartate and asparagine, liberated by protein degradation, and the BCAA and glutamate......The aim of this study was to investigate whether prolonged one-leg knee-extensor exercise enhances net protein degradation in muscle with a normal or low glycogen content. Net amino acid production, as a measure of net protein degradation, was estimated from leg exchange and from changes...... in the concentrations of amino acids that are not metabolized in skeletal muscle. Experiments were performed at rest and during one-leg knee-extensor exercise in six subjects having one leg with a normal glycogen content and the other with a low glycogen content. Exercise was performed for 90 min at a workload of 60...

LC/MS/MS identification of some folic acid degradation products after E-beam irradiation

International Nuclear Information System (INIS)

Araújo, M.M.; Marchioni, E.; Zhao, M.; Kuntz, F.; Di Pascoli, T.; Villavicencio, A.L.C.H.; Bergaentzle, M.

2012-01-01

Folates belong to the B vitamin group based on the parental compound folic acid (FA). They are involved in important biochemical processes like DNA synthesis and repair. FA is composed of a pteridine ring, p-aminobenzoic acid and glutamate moieties. The human metabolism is not able to synthesize folates and therefore obtain them from diet. FA, a synthetic vitamin, is used as a food fortificant because of its low price, relative stability and increased bioavailability compared to natural folate forms. FA is known to be a sensitive compound easily degradable in aqueous solution by ultraviolet and visible light towards various by-products. Irradiation is a process for preservation of foods that uses accelerated electrons, gamma rays or X-rays. Irradiation is proposed for the treatment of various food products, eliminating or reducing pathogens and insects, increasing the storage time and replacing chemical fumigants. This study concerns the identification of degradation products of FA after E-beam irradiation. FA aqueous solutions were irradiated with a Van de Graaff electrons beam accelerator (2 MeV, 100 μA current, 20 cm scan width, dose rate about 2 kGy/s). Applied doses were between 0 (control) and 10.0 kGy. Absorbed doses were monitored with FWT 60.00 radiochromic dosimeters. - Highlights: ► We investigated the degradation of folic acid aqueous solution after electron beam treatment. ► Radiation doses over 5 kGy promote huge folic acid degradation and appearance of several degradation products. ► PCA, PABA and pABGA, already known folic acid degradation products, are formed due to E-beam treatment. ► Xanthopterin, a new radio-induced breakdown product, is formed after irradiation treatment.

Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

Science.gov (United States)

Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

2018-04-16

Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

The earthworm Aporrectodea caliginosa stimulates abundance and activity of phenoxyalkanoic acid herbicide degraders

Science.gov (United States)

Liu, Ya-Jun; Zaprasis, Adrienne; Liu, Shuang-Jiang; Drake, Harold L; Horn, Marcus A

2011-01-01

2-Methyl-4-chlorophenoxyacetic acid (MCPA) is a widely used phenoxyalkanoic acid (PAA) herbicide. Earthworms represent the dominant macrofauna and enhance microbial activities in many soils. Thus, the effect of the model earthworm Aporrectodea caliginosa (Oligochaeta, Lumbricidae) on microbial MCPA degradation was assessed in soil columns with agricultural soil. MCPA degradation was quicker in soil with earthworms than without earthworms. Quantitative PCR was inhibition-corrected per nucleic acid extract and indicated that copy numbers of tfdA-like and cadA genes (both encoding oxygenases initiating aerobic PAA degradation) in soil with earthworms were up to three and four times higher than without earthworms, respectively. tfdA-like and 16S rRNA gene transcript copy numbers in soil with earthworms were two and six times higher than without earthworms, respectively. Most probable numbers (MPNs) of MCPA degraders approximated 4 × 105 gdw−1 in soil before incubation and in soil treated without earthworms, whereas MPNs of earthworm-treated soils were approximately 150 × higher. The aerobic capacity of soil to degrade MCPA was higher in earthworm-treated soils than in earthworm-untreated soils. Burrow walls and 0–5 cm depth bulk soil displayed higher capacities to degrade MCPA than did soil from 5–10 cm depth bulk soil, expression of tfdA-like genes in burrow walls was five times higher than in bulk soil and MCPA degraders were abundant in burrow walls (MPNs of 5 × 107 gdw−1). The collective data indicate that earthworms stimulate abundance and activity of MCPA degraders endogenous to soil by their burrowing activities and might thus be advantageous for enhancing PAA degradation in soil. PMID:20740027

A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

Science.gov (United States)

Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

2014-01-01

The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

Science.gov (United States)

Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

2010-07-01

Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

Degradation of clofibric acid in UV/chlorine disinfection process: kinetics, reactive species contribution and pathways.

Science.gov (United States)

Tang, Yuqing; Shi, Xueting; Liu, Yongze; Feng, Li; Zhang, Liqiu

2018-02-01

As a potential endocrine disruptor, clofibric acid (CA) was investigated in this study for its degradation kinetics and pathways in UV/chlorine process. The results showed that CA in both UV photolysis and UV/chlorine processes could be degraded via pseudo-first-order kinetics, while it almost could not be degraded in the dark chlorination process. The observed rate constant ( k obs ) in UV photolysis was 0.0078 min -1, and increased to 0.0107 min -1 combining with 0.1 mM chlorine. The k obs increased to 0.0447 min -1 with further increasing the chlorine dosage from 0.1 to 1.0 mM, and reached a plateau at higher dosage (greater than 1.0 mM). The higher k obs was obtained at acid solution rather than basic solution. Moreover, the calculated contributions of radical species to k obs indicated that the HO• contributed significantly to CA degradation in acidic conditions, while the reactive chlorine species and UV direct photolysis dominated in neutral and basic solution. The degradation of CA was slightly inhibited in the presence of [Formula: see text] (1 ∼ 50 mM), barely affected by the presence of Cl - (1 ∼ 200 mM) and greatly suppressed by humic acid (0 ∼ 5 mg l -1 ). Thirteen main degradation intermediates and three degradation pathways of CA were identified during UV/chlorine process.

Degradable polyphosphazene/poly(alpha-hydroxyester) blends: degradation studies.

Science.gov (United States)

Ambrosio, Archel M A; Allcock, Harry R; Katti, Dhirendra S; Laurencin, Cato T

2002-04-01

Biomaterials based on the polymers of lactic acid and glycolic acid and their copolymers are used or studied extensively as implantable devices for drug delivery, tissue engineering and other biomedical applications. Although these polymers have shown good biocompatibility, concerns have been raised regarding their acidic degradation products, which have important implications for long-term implantable systems. Therefore, we have designed a novel biodegradable polyphosphazene/poly(alpha-hydroxyester) blend whose degradation products are less acidic than those of the poly(alpha-hydroxyester) alone. In this study, the degradation characteristics of a blend of poly(lactide-co-glycolide) (50:50 PLAGA) and poly[(50% ethyl glycinato)(50% p-methylphenoxy) phosphazene] (PPHOS-EG50) were qualitatively and quantitatively determined with comparisons made to the parent polymers. Circular matrices (14mm diameter) of the PLAGA, PPHOS-EG50 and PLAGA-PPHOS-EG50 blend were degraded in non-buffered solutions (pH 7.4). The degraded polymers were characterized for percentage mass loss and molecular weight and the degradation medium was characterized for acid released in non-buffered solutions. The amounts of neutralizing base necessary to bring about neutral pH were measured for each polymer or polymer blend during degradation. The poly(phosphazene)/poly(lactide-co-glycolide) blend required significantly less neutralizing base in order to bring about neutral solution pH during the degradation period studied. The results indicated that the blend degraded at a rate intermediate to that of the parent polymers and that the degradation products of the polyphosphazene neutralized the acidic degradation products of PLAGA. Thus, results from these in vitro degradation studies suggest that the PLAGA-PPHOS-EG50 blend may provide a viable improvement to biomaterials based on acid-releasing organic polymers.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

In situ ruminal degradation of phytic acid in formaldehyde treated rice bran

NARCIS (Netherlands)

Martin-Tereso, J.; Gonzalez, A.; Laar, van H.; Burbara, C.; Pedrosa, M.; Mulder, K.; Hartog, den L.A.; Verstegen, M.W.A.

2009-01-01

Rice bran has a very high content of phytic acid (IP6), which is a nutritional antagonist of Ca. Microbial phytase degrades IP6, but ruminal degradation of nutrients can be reduced by formaldehyde treatment. Milk fever in dairy cows can be prevented by reducing available dietary Ca to stimulate Ca

Anaerobic degradation of benzene by enriched consortia with humic acids as terminal electron acceptors

Energy Technology Data Exchange (ETDEWEB)

Cervantes, Francisco J., E-mail: fjcervantes@ipicyt.edu.mx [Division de Ciencias Ambientales, Instituto Potosino de Investigacion Cientifica y Tecnologica (IPICyT), Camino a la Presa San Jose 2055, Col. Lomas 4a. Seccion, San Luis Potosi, SLP, 78216 Mexico (Mexico); Mancilla, Ana Rosa; Toro, E. Emilia Rios-del [Division de Ciencias Ambientales, Instituto Potosino de Investigacion Cientifica y Tecnologica (IPICyT), Camino a la Presa San Jose 2055, Col. Lomas 4a. Seccion, San Luis Potosi, SLP, 78216 Mexico (Mexico); Alpuche-Solis, Angel G.; Montoya-Lorenzana, Lilia [Division de Biologia Molecular, Instituto Potosino de Investigacion Cientifica y Tecnologica (IPICyT), Camino a la Presa San Jose 2055, Col. Lomas 4a. Seccion, San Luis Potosi, SLP, 78216 Mexico (Mexico)

2011-11-15

Highlights: {yields} Enriched consortia were able to couple the anaerobic degradation of benzene to the reduction of humic acids. {yields} Electron-equivalents derived from anaerobic benzene oxidation were highly recovered as reduced humic acids. {yields} Several species from classes {beta}-, {delta}- and {gamma}-Proteobacteria were enriched during the anaerobic degradation of benzene. - Abstract: The anaerobic degradation of benzene coupled to the reduction of humic acids (HA) was demonstrated in two enriched consortia. Both inocula were able to oxidize benzene under strict anaerobic conditions when the humic model compound, anthraquinone-2,6-disulfonate (AQDS), was supplied as terminal electron acceptor. An enrichment culture originated from a contaminated soil was also able to oxidize benzene linked to the reduction of highly purified soil humic acids (HPSHA). In HPSHA-amended cultures, 9.3 {mu}M of benzene were degraded, which corresponds to 279 {+-} 27 micro-electron equivalents ({mu}Eq) L{sup -1}, linked to the reduction of 619 {+-} 81 {mu}Eq L{sup -1} of HPSHA. Neither anaerobic benzene oxidation nor reduction of HPSHA occurred in sterilized controls. Anaerobic benzene oxidation did not occur in soil incubations lacking HPSHA. Furthermore, negligible reduction of HPSHA occurred in the absence of benzene. The enrichment culture derived from this soil was dominated by two {gamma}-Proteobacteria phylotypes. A benzene-degrading AQDS-reducing enrichment originated from a sediment sample showed the prevalence of different species from classes {beta}-, {delta}- and {gamma}-Proteobacteria. The present study provides clear quantitative demonstration of anaerobic degradation of benzene coupled to the reduction of HA.

Anaerobic degradation of benzene by enriched consortia with humic acids as terminal electron acceptors

International Nuclear Information System (INIS)

Cervantes, Francisco J.; Mancilla, Ana Rosa; Toro, E. Emilia Rios-del; Alpuche-Solis, Angel G.; Montoya-Lorenzana, Lilia

2011-01-01

Highlights: → Enriched consortia were able to couple the anaerobic degradation of benzene to the reduction of humic acids. → Electron-equivalents derived from anaerobic benzene oxidation were highly recovered as reduced humic acids. → Several species from classes β-, δ- and γ-Proteobacteria were enriched during the anaerobic degradation of benzene. - Abstract: The anaerobic degradation of benzene coupled to the reduction of humic acids (HA) was demonstrated in two enriched consortia. Both inocula were able to oxidize benzene under strict anaerobic conditions when the humic model compound, anthraquinone-2,6-disulfonate (AQDS), was supplied as terminal electron acceptor. An enrichment culture originated from a contaminated soil was also able to oxidize benzene linked to the reduction of highly purified soil humic acids (HPSHA). In HPSHA-amended cultures, 9.3 μM of benzene were degraded, which corresponds to 279 ± 27 micro-electron equivalents (μEq) L -1 , linked to the reduction of 619 ± 81 μEq L -1 of HPSHA. Neither anaerobic benzene oxidation nor reduction of HPSHA occurred in sterilized controls. Anaerobic benzene oxidation did not occur in soil incubations lacking HPSHA. Furthermore, negligible reduction of HPSHA occurred in the absence of benzene. The enrichment culture derived from this soil was dominated by two γ-Proteobacteria phylotypes. A benzene-degrading AQDS-reducing enrichment originated from a sediment sample showed the prevalence of different species from classes β-, δ- and γ-Proteobacteria. The present study provides clear quantitative demonstration of anaerobic degradation of benzene coupled to the reduction of HA.

Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Biosynthesis, degradation, and pharmacological importance of the fatty acid amides

Science.gov (United States)

Farrell, Emma K.; Merkler, David J.

2008-01-01

The identification of two biologically active fatty acid amides, N-arachidonoylethanolamine (anandamide) and oleamide, has generated a great deal of excitement and stimulated considerable research. However, anandamide and oleamide are merely the best-known and best-understood members of a much larger family of biologically-occurring fatty acid amides. In this review, we will outline which fatty acid amides have been isolated from mammalian sources, detail what is known about how these molecules are made and degraded in vivo, and highlight their potential for the development of novel therapeutics. PMID:18598910

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Oxidative degradation of salicylic acid by sprayed WO{sub 3} photocatalyst

Energy Technology Data Exchange (ETDEWEB)

Mohite, S.V.; Rajpure, K.Y., E-mail: rajpure@yahoo.com

2015-10-15

Highlights: • The photoactivity of sprayed WO{sub 3} thin film. • Photoelectrocatalytic degradation of salicylic acid. • Reaction kinetics and mineralization of pollutants by COD. - Abstract: The WO{sub 3} thin films were deposited using spray pyrolysis technique. The prepared WO{sub 3} thin films were characterized using photoelectrochemical (PEC), X-ray diffraction, atomic force microscopy (AFM), and UV–vis absorbance spectroscopy techniques. PEC measurements of WO{sub 3} films deposited at different deposition temperatures were carried out to study photoresponse. The maximum photocurrent (I{sub ph} = 261 μA/cm{sup 2}) was observed for the film deposited at the 225 °C. The monoclinic crystal structure of WO{sub 3} has been confirmed from X-ray diffraction studies. AFM studies were used to calculate particle size and average roughness of the films. Optical absorbance was studied to estimate the bandgap energy of WO{sub 3} thin film which was about 2.65 eV. The photoelectrocatalytic activity of WO{sub 3} film was studied by degradation of salicylic acid with reducing concentrations as function of reaction time. The WO{sub 3} photocatalyst degraded salicylic acid to about 67.14% with significant reduction in chemical oxygen demand (COD) value.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Science.gov (United States)

2012-01-01

Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

Microwave-assisted degradation of acid orange using a conjugated polymer, polyaniline, as catalyst

Directory of Open Access Journals (Sweden)

Ufana Riaz

2014-01-01

Full Text Available Microwave-assisted photocatalytic degradation of dyes is one of the emerging technologies for waste water remediation. Microwave effectively accelerates photocatalytic degradation, when microwave electrodeless lamp (MEL substitutes traditional UV lamp as light source. This setup can be extremely simplified if MEL and photocatalyst can be replaced by a catalyst which can work under microwave irradiation in the absence of any light source. The present work reports for the first time degradation of acid orange 7 (AO under microwave irradiation using polyaniline (PANI as catalyst in the absence of any UV lamp as light source. The degradation/decolourization was carried out in neutral acidic and basic media and was monitored spectrophotometrically to evaluate the ability of microwave irradiation to degrade AO. Microwave irradiation showed excellent performance as it completely decolourizes AO dye solution in 10 min. With the advantages of low cost and rapid processing, this novel catalyst is expected to gain promising application in the treatment of various dyestuff wastewaters on a large scale.

Fluorescence Spectroscopy Applied to Monitoring Biodiesel Degradation: Correlation with Acid Value and UV Absorption Analyses.

Science.gov (United States)

Vasconcelos, Maydla Dos Santos; Passos, Wilson Espíndola; Lescanos, Caroline Honaiser; Pires de Oliveira, Ivan; Trindade, Magno Aparecido Gonçalves; Caires, Anderson Rodrigues Lima; Muzzi, Rozanna Marques

2018-01-01

The techniques used to monitor the quality of the biodiesel are intensely discussed in the literature, partly because of the different oil sources and their intrinsic physicochemical characteristics. This study aimed to monitor the thermal degradation of the fatty acid methyl esters of Sesamum indicum L. and Raphanus sativus L. biodiesels (SILB and RSLB, resp.). The results showed that both biodiesels present a high content of unsaturated fatty acids, ∼84% (SILB) and ∼90% (RSLB). The SILB had a high content of polyunsaturated linoleic fatty acid (18  :  2), about 49%, and the oleic monounsaturated (18  :  1), ∼34%. On the other hand, RSLB presented a considerable content of linolenic fatty acid (18  :  3), ∼11%. The biodiesel samples were thermal degraded at 110°C for 48 hours, and acid value, UV absorption, and fluorescence spectroscopy analysis were carried out. The results revealed that both absorption and fluorescence presented a correlation with acid value as a function of degradation time by monitoring absorptions at 232 and 270 nm as well as the emission at 424 nm. Although the obtained correlation is not completely linear, a direct correlation was observed in both cases, revealing that both properties can be potentially used for monitoring the biodiesel degradation.

Fluorescence Spectroscopy Applied to Monitoring Biodiesel Degradation: Correlation with Acid Value and UV Absorption Analyses

Directory of Open Access Journals (Sweden)

Maydla dos Santos Vasconcelos

2018-01-01

Full Text Available The techniques used to monitor the quality of the biodiesel are intensely discussed in the literature, partly because of the different oil sources and their intrinsic physicochemical characteristics. This study aimed to monitor the thermal degradation of the fatty acid methyl esters of Sesamum indicum L. and Raphanus sativus L. biodiesels (SILB and RSLB, resp.. The results showed that both biodiesels present a high content of unsaturated fatty acids, ∼84% (SILB and ∼90% (RSLB. The SILB had a high content of polyunsaturated linoleic fatty acid (18  :  2, about 49%, and the oleic monounsaturated (18  :  1, ∼34%. On the other hand, RSLB presented a considerable content of linolenic fatty acid (18  :  3, ∼11%. The biodiesel samples were thermal degraded at 110°C for 48 hours, and acid value, UV absorption, and fluorescence spectroscopy analysis were carried out. The results revealed that both absorption and fluorescence presented a correlation with acid value as a function of degradation time by monitoring absorptions at 232 and 270 nm as well as the emission at 424 nm. Although the obtained correlation is not completely linear, a direct correlation was observed in both cases, revealing that both properties can be potentially used for monitoring the biodiesel degradation.

Pantothenic acid biosynthesis in zymomonas

Energy Technology Data Exchange (ETDEWEB)

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

2014-07-01

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

Analysis of hydroxycinnamic acid degradation in Agrobacterium fabrum reveals a coenzyme A-dependent, beta-oxidative deacetylation pathway.

Science.gov (United States)

Campillo, Tony; Renoud, Sébastien; Kerzaon, Isabelle; Vial, Ludovic; Baude, Jessica; Gaillard, Vincent; Bellvert, Floriant; Chamignon, Cécile; Comte, Gilles; Nesme, Xavier; Lavire, Céline; Hommais, Florence

2014-06-01

The soil- and rhizosphere-inhabiting bacterium Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to have species-specific genes involved in ferulic acid degradation. Here, we characterized, by genetic and analytical means, intermediates of degradation as feruloyl coenzyme A (feruloyl-CoA), 4-hydroxy-3-methoxyphenyl-β-hydroxypropionyl-CoA, 4-hydroxy-3-methoxyphenyl-β-ketopropionyl-CoA, vanillic acid, and protocatechuic acid. The genes atu1416, atu1417, and atu1420 have been experimentally shown to be necessary for the degradation of ferulic acid. Moreover, the genes atu1415 and atu1421 have been experimentally demonstrated to be essential for this degradation and are proposed to encode a phenylhydroxypropionyl-CoA dehydrogenase and a 4-hydroxy-3-methoxyphenyl-β-ketopropionic acid (HMPKP)-CoA β-keto-thiolase, respectively. We thus demonstrated that the A. fabrum hydroxycinnamic degradation pathway is an original coenzyme A-dependent β-oxidative deacetylation that could also transform p-coumaric and caffeic acids. Finally, we showed that this pathway enables the metabolism of toxic compounds from plants and their use for growth, likely providing the species an ecological advantage in hydroxycinnamic-rich environments, such as plant roots or decaying plant materials.

Acid-degradable and bioerodible modified polyhydroxylated materials

Energy Technology Data Exchange (ETDEWEB)

Frechet, Jean M. J.; Bachelder, Eric M.; Beaudette, Tristan T.; Broaders, Kyle E.

2017-05-09

Compositions and methods of making a modified polyhydroxylated polymer comprising a polyhydroxylated polymer having reversibly modified hydroxyl groups, whereby the hydroxyl groups are modified by an acid-catalyzed reaction between a polydroxylated polymer and a reagent such as acetals, aldehydes, vinyl ethers and ketones such that the modified polyhydroxylated polymers become insoluble in water but freely soluble in common organic solvents allowing for the facile preparation of acid-sensitive materials. Materials made from these polymers can be made to degrade in a pH-dependent manner. Both hydrophobic and hydrophilic cargoes were successfully loaded into particles made from the present polymers using single and double emulsion techniques, respectively. Due to its ease of preparation, processability, pH-sensitivity, and biocompatibility, of the present modified polyhydroxylated polymers should find use in numerous drug delivery applications.

Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

Science.gov (United States)

Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

2016-11-08

Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

[Degradation of Acid Orange 7 with Persulfate Activated by Silver Loaded Granular Activated Carbon].

Science.gov (United States)

Wang, Zhong-ming; Huang, Tian-yin; Chen, Jia-bin; Li, Wen-wei; Zhang, Li-ming

2015-11-01

Granular activated carbon with silver loaded as activator (Ag/GAC) was prepared using impregnation method. N2 adsorption, scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD) were adopted to characterize the Ag/GAC, showing that silver was successfully loaded on granular activated carbon. The oxidation degradation of acid orange 7 (AO7) by the Ag/GAC activated by persulfate (PS) was investigated at ambient temperature. The influences of factors such as Ag loading, PS or Ag/GAC dosages and initial pH on the degradation of AO7 were evaluated. The results demonstrated that the degradation rate of AO7 could reach more than 95.0% after 180 min when the Ag loading content, PS/AO7 molar ratio, the Ag/GAC dosage were 12.7 mg x g(-1), 120: 1, 1.0 g x L(-1), respectively. The initial pH had significant effect on the AO7 degradation, with pH 5.0 as the optimal pH for the degradation of AO7. The possible degradation pathway was proposed for the AO7 degradation by using UV-visible spectroscopy and gas chromatography-mass spectrometry (GG/MS). The azo bond and naphthalene ring in the AO7 were destroyed during the degradation, with phthalic acid and acetophenone as the main degradation products.

Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

Science.gov (United States)

Cortes, Teresa; Cox, Robert Ashley

2015-04-01

Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

Electrochemical assisted photocatalytic degradation of salicylic acid with highly ordered TiO{sub 2} nanotube electrodes

Energy Technology Data Exchange (ETDEWEB)

Zhang, Qian [The State Key Laboratory of Multiphase Flow in Power Engineering, Xi’an Jiaotong University, Xi’an 710049 (China); Zhu, Jinwei [China Aerospace Science and Technology Corporation Fourty-fourth Research Institution (China); Wang, Ying; Feng, Jiangtao [Department of Environmental Science and Engineering, Xi’an Jiaotong University, Xi’an 710049 (China); Yan, Wei, E-mail: yanwei@mail.xjtu.edu.cn [The State Key Laboratory of Multiphase Flow in Power Engineering, Xi’an Jiaotong University, Xi’an 710049 (China); Department of Environmental Science and Engineering, Xi’an Jiaotong University, Xi’an 710049 (China); Xu, Hao, E-mail: xuhao@mail.xjtu.edu.cn [Department of Environmental Science and Engineering, Xi’an Jiaotong University, Xi’an 710049 (China)

2014-07-01

To explore the kinetics of photoelectrocatalytic degradation of salicylic acid, one of the important PPCPs, highly ordered TiO{sub 2} nanotube arrays (NTs) were prepared by the electrochemical anodization and characterized with scanning electron microscopy and X-ray diffraction techniques. The effect of TiO{sub 2} NTs properties, bias potential, initial salicylic acid concentration and solution pH on the degradation efficiency was studied and carefully analyzed. The results revealed that the salicylic acid degradation follows quasi-first order kinetics in the photoelectrocatalytic process, and the fastest decay kinetics was achieved in acidic environment (pH 2). The result was further interpreted through the electrochemical impedance spectroscopy. It is confirmed that the electrochemical assisted photocatalysis is a synergetic approach to combat stable organic substances with improved efficiency.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

Directory of Open Access Journals (Sweden)

Xiaoyu Wang

Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

Science.gov (United States)

Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

2016-05-01

Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

DEFF Research Database (Denmark)

Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

2014-01-01

We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

Degradation of 2,4,5-trichlorophenoxyacetic acid in aqueous solution by 60Co-γ irradiation

International Nuclear Information System (INIS)

Liu Yuanxia; Yu Yuan; Bao Huaying

2010-01-01

2,4,5-trichlorophenoxyacetic acid(2,4,5-T) is one kind of phenoxy-hydroxy-acid herbicides, also is one kind of Endocrine Disrupting Chemicals. The degradation of 2,4,5-T in aqueous solution by 60 Co-γ irradiation was investigated in the paper. The degradation effect of different influencing factors, such as absorbed dose and irradiation aura, was studied respectively. The degradation products were preliminarily analyzed by High Performance Liquid Chromatography, UV-Vis spectrophotometer and Ion Chromatography. The results showed that 2,4,5-T could be effectively degraded in aqueous solutions by 60 Co-γ irradiation. Meanwhile, the Chloride ion was detected in the solution, whose concentration increased with the growth of absorbed dose. It was found that although both e-aq and ·OH originated from water radiolysis could eliminate 2,4,5-T, the dechlorination effect and the degradation products were different. (authors)

Hydrothermal synthesis spherical TiO2 and its photo-degradation property on salicylic acid

International Nuclear Information System (INIS)

Guo Wenlu; Liu Xiaolin; Huo Pengwei; Gao Xun; Wu Di; Lu Ziyang; Yan Yongsheng

2012-01-01

Anatase TiO 2 spheres have been prepared using hydrothermal synthesis. The prepared spheres were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The TiO 2 consisted of well-defined spheres with size of 3-5 μm. The photocatalytic activity of spherical TiO 2 was determined by degradation of salicylic acid under visible light irradiation. It was revealed that the degradation rate of the spherical TiO 2 which was processed at 150 °C for 48 h could reach 81.758%. And the kinetics of photocatalytic degradation obeyed first-order kinetic, which the rate constant value was 0.01716 S -1 of the salicylic acid onto TiO 2 (temperature: 150, time: 48 h). The kinetics of adsorption followed the pseudo-second-order model and the rate constant was 1.2695 g mg -1 of the salicylic acid onto TiO 2 (temperature: 150, time: 48 h).

Characterization of the complete uric acid degradation pathway in the fungal pathogen Cryptococcus neoformans.

Directory of Open Access Journals (Sweden)

I Russel Lee

Full Text Available Degradation of purines to uric acid is generally conserved among organisms, however, the end product of uric acid degradation varies from species to species depending on the presence of active catabolic enzymes. In humans, most higher primates and birds, the urate oxidase gene is non-functional and hence uric acid is not further broken down. Uric acid in human blood plasma serves as an antioxidant and an immune enhancer; conversely, excessive amounts cause the common affliction gout. In contrast, uric acid is completely degraded to ammonia in most fungi. Currently, relatively little is known about uric acid catabolism in the fungal pathogen Cryptococcus neoformans even though this yeast is commonly isolated from uric acid-rich pigeon guano. In addition, uric acid utilization enhances the production of the cryptococcal virulence factors capsule and urease, and may potentially modulate the host immune response during infection. Based on these important observations, we employed both Agrobacterium-mediated insertional mutagenesis and bioinformatics to predict all the uric acid catabolic enzyme-encoding genes in the H99 genome. The candidate C. neoformans uric acid catabolic genes identified were named: URO1 (urate oxidase, URO2 (HIU hydrolase, URO3 (OHCU decarboxylase, DAL1 (allantoinase, DAL2,3,3 (allantoicase-ureidoglycolate hydrolase fusion protein, and URE1 (urease. All six ORFs were then deleted via homologous recombination; assaying of the deletion mutants' ability to assimilate uric acid and its pathway intermediates as the sole nitrogen source validated their enzymatic functions. While Uro1, Uro2, Uro3, Dal1 and Dal2,3,3 were demonstrated to be dispensable for virulence, the significance of using a modified animal model system of cryptococcosis for improved mimicking of human pathogenicity is discussed.

Mild MPP+ exposure impairs autophagic degradation through a novel lysosomal acidity-independent mechanism.

Science.gov (United States)

Miyara, Masatsugu; Kotake, Yaichiro; Tokunaga, Wataru; Sanoh, Seigo; Ohta, Shigeru

2016-10-01

Parkinson's disease (PD) is the second most common neurodegenerative disorder, but its underlying cause remains unknown. Although recent studies using PD-related neurotoxin MPP + suggest autophagy involvement in the pathogenesis of PD, the effect of MPP + on autophagic processes under mild exposure, which mimics the slow progressive nature of PD, remains largely unclear. We examined the effect of mild MPP + exposure (10 and 200 μM for 48 h), which induces a more slowly developing cell death, on autophagic processes and the mechanistic differences with acute MPP + toxicity (2.5 and 5 mM for 24 h). In SH-SY5Y cells, mild MPP + exposure predominantly inhibited autophagosome degradation, whereas acute MPP + exposure inhibited both autophagosome degradation and basal autophagy. Mild MPP + exposure reduced lysosomal hydrolase cathepsin D activity without changing lysosomal acidity, whereas acute exposure decreased lysosomal density. Lysosome biogenesis enhancers trehalose and rapamycin partially alleviated mild MPP + exposure induced impaired autophagosome degradation and cell death, but did not prevent the pathogenic response to acute MPP + exposure, suggesting irreversible lysosomal damage. We demonstrated impaired autophagic degradation by MPP + exposure and mechanistic differences between mild and acute MPP + toxicities. Mild MPP + toxicity impaired autophagosome degradation through novel lysosomal acidity-independent mechanisms. Sustained mild lysosomal damage may contribute to PD. We examined the effects of MPP + on autophagic processes under mild exposure, which mimics the slow progressive nature of Parkinson's disease, in SH-SY5Y cells. This study demonstrated impaired autophagic degradation through a reduction in lysosomal cathepsin D activity without altering lysosomal acidity by mild MPP + exposure. Mechanistic differences between acute and mild MPP + toxicity were also observed. Sustained mild damage of lysosome may be an underlying cause of Parkinson

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

2015-01-01

ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

2015-08-01

In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

Poly(ethylene glycol) (PEG)-lactic acid nanocarrier-based degradable hydrogels for restoring the vaginal microenvironment

Science.gov (United States)

Rajan, Sujata Sundara; Turovskiy, Yevgeniy; Singh, Yashveer; Chikindas, Michael L.; Sinko, Patrick J.

2014-01-01

Women with bacterial vaginosis (BV) display reduced vaginal acidity, which make them susceptible to associated infections such as HIV. In the current study, poly(ethylene glycol) (PEG) nanocarrier-based degradable hydrogels were developed for the controlled release of lactic acid in the vagina of BV-infected women. PEG-lactic acid (PEG-LA) nanocarriers were prepared by covalently attaching lactic acid to 8-arm PEG-SH via cleavable thioester bonds. PEG-LA nanocarriers with 4 copies of lactic acid per molecule provided controlled release of lactic acid with a maximum release of 23% and 47% bound lactic acid in phosphate buffered saline (PBS, pH 7.4) and acetate buffer (AB, pH 4.3), respectively. The PEG nanocarrier-based hydrogels were formed by cross-linking the PEG-LA nanocarriers with 4-arm PEG-NHS via degradable thioester bonds. The nanocarrier-based hydrogels formed within 20 min under ambient conditions and exhibited an elastic modulus that was 100-fold higher than the viscous modulus. The nanocarrier-based degradable hydrogels provided controlled release of lactic acid for several hours; however, a maximum release of only 10%–14% bound lactic acid was observed possibly due to steric hindrance of the polymer chains in the cross-linked hydrogel. In contrast, hydrogels with passively entrapped lactic acid showed burst release with complete release within 30 min. Lactic acid showed antimicrobial activity against the primary BV pathogen Gardnerella vaginalis with a minimum inhibitory concentration (MIC) of 3.6 mg/ml. In addition, the hydrogels with passively entrapped lactic acid showed retained antimicrobial activity with complete inhibition G. vaginalis growth within 48 h. The results of the current study collectively demonstrate the potential of PEG nanocarrier-based hydrogels for vaginal administration of lactic acid for preventing and treating BV. PMID:25223229

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Reaction pathway of the degradation of the p-hydroxybenzoic acid by sulfate radical generated by ionizing radiations

International Nuclear Information System (INIS)

Criquet, Justine; Leitner, Nathalie Karpel Vel

2015-01-01

The degradation of p-hydroxybenzoic acid (HBA) in aqueous solutions by ionizing radiation was studied. The phenolic pollutant was easily removed by the electron beam irradiation, as more than 80% of the initial 100 µM introduced was degraded for a dose of 600 Gy. It was shown that the addition of persulfate, producing the sulfate radical as additional reactive species, induced a change in the reaction pathway. LC–MS analyses were performed in order to identify the different by-products formed. In the absence of persulfate, the main by-product formed was 3,4-dihydroxybenzoic acid, while in presence of persulfate, 1,4-benzoquinone was detected and the hydroxylated by-products were not present. A reaction pathway of HBA degradation by hydroxyl and sulfate radicals was proposed from the identification of the chemical structure of the different by-products detected. The influences of pH and dissolved oxygen were also studied. A high decline of HBA degradation was observed at pH 11 compared to pH 4.5, this decrease was minimized in the presence of persulfate. The dissolved oxygen concentration was found to be a limiting parameter of HBA degradation, however an excess of dissolved oxygen in solution did not improve the degradation to a large extent. - Highlights: • p-Hydroxybenzoic acid (HBA) is easily removed by e-beam irradiation. • The sulfate radicals formed from persulfate induce loss of the benzoic acid skeleton. • The dissolved oxygen concentration is a limiting parameter of the HBA degradation. • The effect of pH is minimized in presence of persulfate

Degradation of protein translation machinery by amino acid starvation-induced macroautophagy

DEFF Research Database (Denmark)

Gretzmeier, Christine; Eiselein, Sven; Johnson, Gregory R.

2017-01-01

, unbiased approaches relying on quantitative mass spectrometry-based proteomics. Macroautophagy is induced by rapamycin treatment, and by amino acid and glucose starvation in differentially, metabolically labeled cells. Protein dynamics are linked to image-based models of autophagosome turnover. Depending...... on the inducing stimulus, protein as well as organelle turnover differ. Amino acid starvation-induced macroautophagy leads to selective degradation of proteins important for protein translation. Thus, protein dynamics reflect cellular conditions in the respective treatment indicating stimulus-specific pathways...

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Degradation of Poly (lactic acid under Simulated Landfill Conditions

Directory of Open Access Journals (Sweden)

Chomnutcha Boonmee

2017-03-01

Full Text Available In this study, the physical and chemical properties change of poly(lactic acid after burying in the mixture of soil and sludge under thermophilic (61 °C oxygen limited conditions were investigated using various analytical techniques. The environmental factors under these setting conditions and microbial activities accelerated the degradation process of PLA. Under tested conditions, PLA loss their weight about 90% at the burying time of 90 days. During the degradation process, PLA samples were continuously broken to small fragile fragments and showed the size less than 1 mm at the end of degradation test. Change of the surface morphology change was revealed by scanning electron microscopy (SEM. Many pores, cracks and irregular roughness were presented on the PLA surface. Thermal decomposition was decreased from 387.8 to 289.2 °C. The percentage of carbon content in molecular structure decreased from 49.46% to 45.42%. In addition, the Fourier transformed infrared spectroscopy (FTIR revealed the change of ester bonds. This study can be used for developing PLA waste management process.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Experimental investigation of coating degradation during simultaneous acid and erosive particle exposure

DEFF Research Database (Denmark)

Møller, Victor Buhl; Dam-Johansen, Kim; Frankær, Sarah Maria

When used in industrial processes, such as stirred acid leaching in the mineral industry, thermoset coatings are exposed to a combination of aggressive chemicals and erosive particlewear. While each exposure condition has been studied separately, no research has been presented on the effects...... of a simultaneous exposure. To investigate this, a pilot-scale stirred acid leaching tank, containing erosive particles and acidic solutions, has been designed and constructed. Resin types considered are amine-cured novolac epoxy and vinyl ester. Transient coating degradation is mapped through visual inspection...

Polylactic acid coating on a biodegradable magnesium alloy: An in vitro degradation study by electrochemical impedance spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Alabbasi, Alyaa; Liyanaarachchi, S.; Kannan, M. Bobby, E-mail: bobby.mathan@jcu.edu.au

2012-09-30

Polylactic acid (PLA) was coated on a biodegradable magnesium alloy, AZ91, using spin coating technique for temporary implant applications. The degradation behaviour of the coated alloy samples was evaluated using electrochemical impedance spectroscopy (EIS) method in simulated body fluid (SBF). EIS results suggested that the PLA coating enhanced the degradation resistance of the alloy significantly. Increase in the PLA coating thickness was found to increase the degradation resistance, but resulted in poor adhesion. Long-term EIS experiments of the PLA coated samples suggested that their degradation resistance gradually decreased with increase in SBF exposure time. However, the degradation resistance of the PLA coated samples was significantly higher than that of the bare metal even after a 48 h exposure to SBF. - Highlights: Black-Right-Pointing-Pointer Polylactic acid (PLA) was coated on a magnesium-based alloy. Black-Right-Pointing-Pointer PLA coating enhanced the in vitro degradation resistance of the alloy. Black-Right-Pointing-Pointer Increase in the PLA coating thickness improved the alloy degradation resistance. Black-Right-Pointing-Pointer Thin film PLA coating exhibited both good degradation resistance and adhesion.

Polylactic acid coating on a biodegradable magnesium alloy: An in vitro degradation study by electrochemical impedance spectroscopy

International Nuclear Information System (INIS)

Alabbasi, Alyaa; Liyanaarachchi, S.; Kannan, M. Bobby

2012-01-01

Polylactic acid (PLA) was coated on a biodegradable magnesium alloy, AZ91, using spin coating technique for temporary implant applications. The degradation behaviour of the coated alloy samples was evaluated using electrochemical impedance spectroscopy (EIS) method in simulated body fluid (SBF). EIS results suggested that the PLA coating enhanced the degradation resistance of the alloy significantly. Increase in the PLA coating thickness was found to increase the degradation resistance, but resulted in poor adhesion. Long-term EIS experiments of the PLA coated samples suggested that their degradation resistance gradually decreased with increase in SBF exposure time. However, the degradation resistance of the PLA coated samples was significantly higher than that of the bare metal even after a 48 h exposure to SBF. - Highlights: ► Polylactic acid (PLA) was coated on a magnesium-based alloy. ► PLA coating enhanced the in vitro degradation resistance of the alloy. ► Increase in the PLA coating thickness improved the alloy degradation resistance. ► Thin film PLA coating exhibited both good degradation resistance and adhesion.

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

From labdanes to drimanes. Degradation of the side chain of dihydrozamoranic acid.

Science.gov (United States)

Rodilla, Jesús M L; Díez, D; Urones, J G; Rocha, Pedro M

2004-04-30

A new route for the degradation of the saturated side chain of dihydrozamoranic acid has been devised, giving an advanced intermediate, compound 14, useful for the synthesis of insect antifeedants such as warburganal and polygodial.

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

Degradation of Acid Orange 7 in an Atmospheric-Pressure Plasma-Solution System (Gliding Discharge)

International Nuclear Information System (INIS)

NI Mingjiang; YANG Huan; CHEN Tong; ZHANG Hao; WU Angjian; DU Changming; LI Xiaodong

2015-01-01

In this work, a plasma-solution system was applied to the degradation of Acid Orange 7 (AO7). The effects of initial concentration and type of feed gases (air, oxygen, nitrogen or argon) were studied. As the initial concentration increased from 100 mg/L to 160 mg/L, the discolouration rate of AO7 decreased from 99.3% to 95.9%, whereas the COD removal rate decreased from 37.9% to 22.6%. Air provided the best discolouration and COD removal rates (99.3% and 37.9%, respectively). In the presence of a zero-valent iron (ZVI) catalyst, the AO7 COD removal rate increased to 76.4%. The degradation products were analysed by a GC-MS, revealing that the degradation of the dye molecule was initiated through the cleavage of the -N=N- bond before finally being converted to organic acids. (paper)

Degradation of trans-ferulic acid in acidic aqueous medium by anodic oxidation, electro-Fenton and photoelectro-Fenton

Energy Technology Data Exchange (ETDEWEB)

Flores, Nelly; Sirés, Ignasi; Garrido, José Antonio; Centellas, Francesc; Rodríguez, Rosa María; Cabot, Pere Lluís; Brillas, Enric, E-mail: brillas@ub.edu

2016-12-05

Highlights: • trans-Ferulic acid degradation by EAOPs using a stirred BDD/air-diffusion cell. • Slow substrate abatement and poor mineralization by AO-H{sub 2}O{sub 2}. • 98% Mineralization by PEF, but with rapid and similar substrate decay than by EF. • Quicker degradation by SPEF due to the more potent photolytic action of sunlight. • Reaction pathway with four primary aromatic products and three final carboxylic acids. - Abstract: Solutions of pH 3.0 containing trans-ferulic acid, a phenolic compound in olive oil mill wastewater, have been comparatively degraded by anodic oxidation with electrogenerated H{sub 2}O{sub 2} (AO-H{sub 2}O{sub 2}), electro-Fenton (EF) and photoelectro-Fenton (PEF). Trials were performed with a BDD/air-diffusion cell, where oxidizing ·OH was produced from water discharge at the BDD anode and/or in the solution bulk from Fenton’s reaction between cathodically generated H{sub 2}O{sub 2} and added catalytic Fe{sup 2+}. The substrate was very slowly removed by AO-H{sub 2}O{sub 2}, whereas it was very rapidly abated by EF and PEF, at similar rate in both cases, due to its fast reaction with ·OH in the bulk. The AO-H{sub 2}O{sub 2} process yielded a slightly lower mineralization than EF, which promoted the accumulation of barely oxidizable products like Fe(III) complexes. In contrast, the fast photolysis of these latter species under irradiation with UVA light in PEF led to an almost total mineralization with 98% total organic carbon decay. The effect of current density and substrate concentration on the performance of all treatments was examined. Several solar PEF (SPEF) trials showed its viability for the treatment of wastewater containing trans-ferulic acid at larger scale. Four primary aromatic products were identified by GC–MS analysis of electrolyzed solutions, and final carboxylic acids like fumaric, acetic and oxalic were detected by ion-exclusion HPLC. A reaction sequence for trans-ferulic acid mineralization

Biodegradation of dimethyl phthalate by Sphingomonas sp. isolated from phthalic-acid-degrading aerobic granules.

Science.gov (United States)

Zeng, Ping; Moy, Benjamin Yan-Pui; Song, Yong-Hui; Tay, Joo-Hwa

2008-10-01

Phthalic acid esters (PAEs) contamination in water, air, and soil is one of the major environmental concerns in many countries. Besides the PAE biodegradation process, the PAE degrading bacteria have become one of the focuses of study. This study reports the successful isolation of one kind of indigenous bacterium PA-02 from phthalic acid (PA)-degrading aerobic granules. Based on its 16S ribosomal DNA sequence, isolate PA-02 was identified as Sphingomonas genus with 100% similarity to Sphingomonas sp. strain D84532. Strain PA-02 was a Gram-negative, rod-shaped bacterium with strong auto-aggregation ability. In particular, the strain PA-02 possessed PAE-degrading ability without acclimation. Results of growth tests showed that strain PA-02 could degrade dimethyl phthalate (DMP), dibutyl phthalate, and diethylhexyl phthalate. The specific degradation rates of DMP and PA were concentration-dependent with maximum values of 0.4 g-DMP g(-1) biomass h(-1) and 1.3 g-PA g(-1) biomass h(-1), respectively. Kinetic studies also revealed that PA-02 was robust under high concentrations of DMP and PA. Even when the PA concentration was increased to 1,000.0 mg l(-1), the specific PA degradation rate was about 0.25 g-PA g(-1) biomass h(-1). The corresponding value for DMP was 0.067 g-DMP g(-1) biomass h(-1) at 1,000 mg l(-1).

The role of nanoparticulate agglomerates in TiO{sub 2} photocatalysis: degradation of oxalic acid

Energy Technology Data Exchange (ETDEWEB)

Ivanova, Irina [Leibniz Universitaet Hannover, Institut fuer Technische Chemie (Germany); Mendive, Cecilia B., E-mail: cbmendive@mdp.edu.ar [Universidad Nacional de Mar del Plata, Facultad de Ciencias Exactas y Naturales, Departamento de Química (Argentina); Bahnemann, Detlef [Leibniz Universitaet Hannover, Institut fuer Technische Chemie (Germany)

2016-07-15

The simultaneous bimodal study of the photocatalytic oxalic acid degradation by aqueous TiO{sub 2} suspensions revealed that particular systems possess the capacity to protect a certain amount of oxalic acid from oxidation, thus hindering, to some extent, the photocatalytic reaction. While measurements of the oxalic acid concentration in the bulk liquid phase indicated full photocatalytic degradation; in situ pH-stat measurements allowed the quantification of the amount of oxalic acid remaining in the part of the nanoparticulate agglomerates where light could apparently not access. An explanation for this phenomenon takes into account the possibility of the formation of TiO{sub 2} agglomerates in which these molecules are hidden from the effect of the light, thus being protected from photocatalytic degradation. Studies of different TiO{sub 2} materials with different particle sizes allowed a deeper exploration of this phenomenon. In addition, because this property of encapsulating pollutant molecules by photocatalytic systems is found to be a reversible phenomenon, P25 appears to be more convenient and advantageous as compared to the use of large surface area photocatalysts.Graphical AbstractFig.: Deaggregation of TiO{sub 2} particle agglomerates upon UV illumination.

Degradation characteristics of 2,4-dichlorophenoxyacetic acid in electro-biological system

Energy Technology Data Exchange (ETDEWEB)

Zhang, JingLi, E-mail: jinglizhangczp@126.com [Tianjin Key Laboratory of Aquatic Science and Technology, Tianjin Institute of Urban Construction, Tianjin 300384 (China); Cao, ZhanPing; Zhang, HongWei [School of Environmental and Chemical Engineering, Tianjin Polytechnic University, Tianjin 300387 (China); Zhao, LianMei [Tianjin Key Laboratory of Aquatic Science and Technology, Tianjin Institute of Urban Construction, Tianjin 300384 (China); Sun, XuDong; Mei, Feng [School of Environmental and Chemical Engineering, Tianjin Polytechnic University, Tianjin 300387 (China)

2013-11-15

Highlights: • The 2,4-D reductive degradation was studied in an electro-biological system. • The electric auxiliary accelerates 2,4-D microbial degradation. • A electron transfer is achieved between the electrode, bacteria and the pollutants. • The paper provides a promising way for the degradation of persistent organics. -- Abstract: The reductive degradation of 2,4-dichlorophenoxyacetic acid (2,4-D) was studied in an electro-biological system, a biological system and an electric catalytic system, respectively. Electrochemical characteristics were monitored by cyclic voltammetry and the intermediate products of 2,4-D degradation were determined by high speed liquid chromatography (HPLC). The results showed that all 2,4-D degradations in the three systems conformed to the kinetics characteristics of one-order reaction, and the degradation kinetics constants were 28.74 × 10{sup −2} h{sup −1}, 19.73 × 10{sup −2} h{sup −1} and 3.54 × 10{sup −2} h{sup −1}, respectively. The kinetics constant in the electro-biological system was higher than the sum in the other two systems by 19%. The electrochemical assistance provided the electrons and accelerated the electron transfer rate in the microbial degradation of 2,4-D. The degradation resulted from the microbial reduction strengthened by the electrochemical assistance. The electron transfer existed between the electrode, cytochrome, NAD and the pollutants. A long-range electron transfer process could be achieved on the multi-phase interfaces between the electrode, bacteria and the pollutants.

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

Degradation of 3-phenoxybenzoic acid by a filamentous fungus Aspergillus oryzae M-4 strain with self-protection transformation.

Science.gov (United States)

Zhu, Yuanting; Li, Jianlong; Yao, Kai; Zhao, Nan; Zhou, Kang; Hu, Xinjie; Zou, Likou; Han, Xinfeng; Liu, Aiping; Liu, Shuliang

2016-11-01

A novel filamentous fungus M-4 strain was isolated from soy sauce koji and identified as Aspergillus oryzae (Collection number: CGMCC 11645) on the basis of morphological characteristics and internal transcribed spacer sequence. M-4 could degrade 80.62 % of 3-phenoxybenzoic acid (3-PBA; 100 mg L -1 ) within 5 days. 3-PBA degradation occurred in accordance with first-order kinetics. The degradation metabolites of 3-PBA were identified through high-performance liquid chromatography-mass spectrometry (HPLC-MS). Relevant enzymatic activities and substrate utilization were also investigated, which indicated that M-4 could effectively degrade the intermediates of 3-PBA. Base on analysis of these metabolites, a novel biochemical pathway for the degradation of 3-PBA was proposed. There exists a mutual transformation between 3-phenoxy-benzyl alcohol and 3-PBA, which was firstly reported about the degradation of 3-PBA and may be attributed to self-protection transformation of M-4; subsequently, 3-PBA was gradually transformed into phenol, 3-hydroxy-5-phenoxy benzoic acid, protocatechuic acid and gallic acid. The safety of M-4 was evaluated via an acute toxicity test in vivo. The biodegradation ability of M-4 without toxic effects reveals that this fungus may be likely to be used for eliminating 3-PBA from contaminated environment or fermented foods.

From Labdanes to Drimanes. Degradation of the Side Chain of Dihydrozamoranic Acid.

Directory of Open Access Journals (Sweden)

Pedro M. Rocha

2004-04-01

Full Text Available A new route for the degradation of the saturated side chain of dihydrozamoranic acid has been devised, giving an advanced intermediate, compound 14, useful for the synthesis of insect antifeedants such as warburganal and polygodial.

Syntrophomonas zehnderi sp. nov., an anaerobe that degrades long-chain fatty acids in co-culture with Methanobacterium formicicum.

Science.gov (United States)

Sousa, Diana Z; Smidt, Hauke; Alves, M Madalena; Stams, Alfons J M

2007-03-01

An anaerobic, mesophilic, syntrophic fatty-acid-oxidizing bacterium, designated strain OL-4(T), was isolated as a co-culture with Methanobacterium formicicum DSM 1535(NT) from an anaerobic expanded granular sludge bed reactor used to treat an oleate-based effluent. Strain OL-4(T) degraded oleate, a mono-unsaturated fatty acid, and straight-chain fatty acids C(4 : 0)-C(18 : 0) in syntrophic association with Methanobacterium formicicum DSM 1535(NT). Even-numbered fatty acids were degraded to acetate and methane whereas odd-numbered fatty acids were degraded to acetate, propionate and methane. Branched-chain fatty acids were not degraded. The bacterium could not grow axenically with any other substrate tested and therefore is considered to be obligately syntrophic. Fumarate, sulfate, thiosulfate, sulfur and nitrate could not serve as electron acceptors for strain OL-4(T) to degrade oleate or butyrate. Cells of strain OL-4(T) were curved rods, formed spores and showed a variable response to Gram staining. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain OL-4(T) was most closely related to the fatty-acid-oxidizing, syntrophic bacterium Syntrophomonas sp. TB-6 (95 % similarity), Syntrophomonas wolfei subsp. wolfei DSM 2245(T) (94 % similarity) and Syntrophomonas erecta DSM 16215(T) (93 % similarity). In addition to this moderate similarity, phenotypic and physiological characteristics, such as obligate syntrophy, spore formation and utilization of a broader substrate range, differentiated strain OL-4(T) from these Syntrophomonas species. Therefore strain OL-4(T) represents a novel species, for which the name Syntrophomonas zehnderi sp. nov. is proposed. The type strain is OL-4(T) (=DSM 17840(T)=JCM 13948(T)).

Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements.

Science.gov (United States)

Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H

2014-02-01

A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

Isonicotinic acid-ligated cobalt (II phthalocyanine-modified titania as photocatalyst for benzene degradation via fluorescent lamp

Directory of Open Access Journals (Sweden)

Joey Andrew A. Valinton

2016-06-01

Full Text Available The utilization of bis(isonicotinic acidphthalocyaninatocobalt (II [CoPc(isa2] incorporated on TiO2 has been studied as a photocatalyst to degrade benzene vapor under fluorescent lamp (indoor light conditions. The photocatalytic activity of [CoPc(isa2]-TiO2 compared to TiO2 showed an increase in the extent of degradation. The axial isonicotinic acid ligand attached to CoPc improved the degradation rate of benzene as compared with unligated CoPc-TiO2 which may be attributed to the enhancement of electronic structure in the complex due to the additional isonicotinic acid ligand and its possible attachment to the TiO2 surface through the carboxylic acid moiety. Therefore, covalently-linked CoPc(isa2 to TiO2 can enhance the extent of photodegradation of benzene and other common volatile organic compounds under indoor lighting conditions.

msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

2015-02-01

Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

FT-IR study of gamma-radiation induced degradation of polyvinyl alcohol (PVA) and PVA/humic acids blends

International Nuclear Information System (INIS)

Ilcin, M.; Hola, O.; Bakajova, B.; Kucerik, J.

2010-01-01

Samples of pure polyvinyl alcohol (PVA) and PVA doped with humic acids were exposed to gamma radiation. Gamma rays induced the degradation of the pure polymer. Degradation changes were observed using ATR FT-IR equipment. Dehydration, double bond creation, and their subsequent oxidation (surrounding atmosphere was air) were found out. Also, other degradation reactions (e.g. chain scission, cyclization) occur simultaneously. Formation of C=C and C=O bonds is apparent from FT-IR spectra. In contrast the presence of humic acids in the PVA sample showed stabilizing effect on PVA structure within the concentration range 0.5-10%. (author)

stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

Science.gov (United States)

Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

2015-07-07

Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

Science.gov (United States)

Kim, Moonjeong; Kim, Kwang-Sun

2017-07-06

The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of major degradation products of 5-aminosalicylic acid formed in aqueous solutions and in pharmaceuticals

DEFF Research Database (Denmark)

Jensen, J.; Cornett, Claus; Olsen, C. E.

1992-01-01

of polymeric species by oxidative self-coupling of 5-ASA moieties. These results indicate that the degradation of 5-ASA follows the same mechanism as observed for the autooxidation of 4-aminophenol and 1,4-phenylenediamine. Some of the identified degradation products were found in 5-ASA......The formation of four major degradation products of 5-aminosalicylic acid (5-ASA) in buffered solutions at pH 7.0 was demonstrated by gradient HPLC analysis. The isolation and structural elucidation of the resulting degradation products showed that the degradation of 5-ASA led to the formation...

Acidic nanoparticles are trafficked to lysosomes and restore an acidic lysosomal pH and degradative function to compromised ARPE-19 cells.

Directory of Open Access Journals (Sweden)

Gabriel C Baltazar

Full Text Available Lysosomal enzymes function optimally in acidic environments, and elevation of lysosomal pH can impede their ability to degrade material delivered to lysosomes through autophagy or phagocytosis. We hypothesize that abnormal lysosomal pH is a key aspect in diseases of accumulation and that restoring lysosomal pH will improve cell function. The propensity of nanoparticles to end up in the lysosome makes them an ideal method of delivering drugs to lysosomes. This study asked whether acidic nanoparticles could traffic to lysosomes, lower lysosomal pH and enhance lysosomal degradation by the cultured human retinal pigmented epithelial cell line ARPE-19. Acidic nanoparticles composed of poly (DL-lactide-co-glycolide (PLGA 502 H, PLGA 503 H and poly (DL-lactide (PLA colocalized to lysosomes of ARPE-19 cells within 60 min. PLGA 503 H and PLA lowered lysosomal pH in cells compromised by the alkalinizing agent chloroquine when measured 1 hr. after treatment, with acidification still observed 12 days later. PLA enhanced binding of Bodipy-pepstatin-A to the active site of cathepsin D in compromised cells. PLA also reduced the cellular levels of opsin and the lipofuscin-like autofluorescence associated with photoreceptor outer segments. These observations suggest the acidification produced by the nanoparticles was functionally effective. In summary, acid nanoparticles lead to a rapid and sustained lowering of lysosomal pH and improved degradative activity.

Hydrothermal synthesis spherical TiO{sub 2} and its photo-degradation property on salicylic acid

Energy Technology Data Exchange (ETDEWEB)

Guo Wenlu, E-mail: liu287856624@163.com [School of Biology and Chemical Engineering, Jiangsu University of Science and Technology, Mengxi Road 2, Zhenjiang 212003 (China); Liu Xiaolin [School of Biology and Chemical Engineering, Jiangsu University of Science and Technology, Mengxi Road 2, Zhenjiang 212003 (China); Huo Pengwei; Gao Xun; Wu Di; Lu Ziyang; Yan Yongsheng [School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang 212013 (China)

2012-07-01

Anatase TiO{sub 2} spheres have been prepared using hydrothermal synthesis. The prepared spheres were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The TiO{sub 2} consisted of well-defined spheres with size of 3-5 {mu}m. The photocatalytic activity of spherical TiO{sub 2} was determined by degradation of salicylic acid under visible light irradiation. It was revealed that the degradation rate of the spherical TiO{sub 2} which was processed at 150 Degree-Sign C for 48 h could reach 81.758%. And the kinetics of photocatalytic degradation obeyed first-order kinetic, which the rate constant value was 0.01716 S{sup -1} of the salicylic acid onto TiO{sub 2} (temperature: 150, time: 48 h). The kinetics of adsorption followed the pseudo-second-order model and the rate constant was 1.2695 g mg{sup -1} of the salicylic acid onto TiO{sub 2} (temperature: 150, time: 48 h).

Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

OpenAIRE

Chung, T; Resnik, E; Stueland, C; LaPorte, D C

1993-01-01

Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

Science.gov (United States)

Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

2016-01-01

The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer.

Science.gov (United States)

Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V

2016-05-13

Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Effect of perfluorosulfonic acid membrane equivalent weight on degradation under accelerated stress conditions

International Nuclear Information System (INIS)

Rodgers, Marianne P.; Pearman, Benjamin P.; Mohajeri, Nahid; Bonville, Leonard J.; Slattery, Darlene K.

2013-01-01

The equivalent weight of proton exchange membranes has a large effect on their properties and can impact performance and durability in hydrogen fuel cells. For example, increasing the EW increases the crystallinity of perfluorosulfonic acid membranes, while water content and glass transition temperature decrease. The length of the sulfonic acid side chain also impacts membrane properties. Perfluorosulfonic acid membranes with shorter sulfonic acid side chains, though they exhibit similar gas permeability, have been shown to have higher crystallinity, higher glass transition temperature, slightly lower water content, and lower proton conductivity than membranes with longer sulfonic acid side chains for a given EW. Although many reports have investigated cell performance for membranes as a function of low EW and side chains length, their impact on cell durability is not well understood. Because side chain attack by radicals formed during fuel cell operation is a major source of membrane degradation, it is reasonable to hypothesize that membranes with lower EW and, therefore, more sulfonic acid side chains, would have lower durability. This study evaluates membrane degradation for cells containing PFSA membranes with 750 EW, 950 EW, and 1100 EW. The 750 EW membrane contained short sulfonic acid side-chains while the 950 EW and 1100 EW membranes were Nafion ® -based with long sulfonic acid side-chains. Membranes were tested in fuel cells for 100 h under open circuit voltage, at 90 °C and 30% relative humidity. Diagnostic tests conducted on the cells included hydrogen crossover, fluoride emission, catalyst electrochemical surface area, posttest membrane scanning electron microscopy/transmission electron microscopy evaluation, and defect identification in membranes. The 950 EW cell had the highest decay metrics including fluoride emission, voltage decay, loss in ECA, and loss in cell performance. In all cases, the 1100 EW cell showed the lowest degradation. This has

The characterization of mechanical and surface properties of poly (glycerol-sebacate-lactic acid) during degradation in phosphate buffered saline

Energy Technology Data Exchange (ETDEWEB)

Sun Zhijie [Center for biomedical Materials and Engineering, Harbin Engineering University, Harbin 150001 (China)], E-mail: zhijiesun2005@yahoo.com.cn; Wu Lan; Lu Xili; Meng Zhaoxu; Zheng Yufeng [Center for biomedical Materials and Engineering, Harbin Engineering University, Harbin 150001 (China); Dong Deli [Department of Pharmacology, Harbin Medical University, Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150081 (China)

2008-11-15

The present study synthesized a poly (glycerol-sebacate-lactic acid) (PGSL) with 1:1:0.5 mole ratio of glycerol, sebacate and lactic acid and investigated the degradation characteristics of the polymer in phosphate buffered saline (PBS) at 37 deg. C in vitro by means of mass loss tests, geometry, differential scanning calorimeter (DSC) measurements, tensile analysis and scanning electron microscopy (SEM). The maintained geometry, linear mass loss, and minor crack formation on the surface during degradation characterized both the bulk degradation and surface erosion of the polymer. By day 30 of degradation, the mass lost reached 16%. The elastic modulus, tensile strength and elongation at breakage of PGSL were correlative to the period of degradation.

Prediction of the ageing of commercial lager beer during storage based on the degradation of iso-α-acids.

Science.gov (United States)

Blanco, Carlos A; Nimubona, Dieudonné; Caballero, Isabel

2014-08-01

Iso-α-acids and their chemically modified variants are responsible for the bitterness of beer and play a disproportionately large role in the final quality of beer. The current study was undertaken to predict the degradation of commercial lager beers related to changes in the concentration of trans-iso-α-acids during storage by using high-pressure liquid chromatography. In the analysed beers the concentration of isohumulone (average concentration 28 mg L(-1)) was greater than that of isocohumulone (20 mg L(-1)) and isoadhumulone (10 mg L(-1)). The kinetic parameters, activation energy and rate constant, of the trans-iso-α-acids were calculated. In the case of dark beers, the activation energy for the degradation of trans-isocohumulones was found to be higher than for trans-isohumulones and trans-isoadhumulones, whereas in pale and alcohol-free beers activation energies for the degradation of the three trans isomers were similar. The loss of iso-α-acids can be calculated using the activation energy of the degradation of trans-iso-α-acids and the temperature profile of the accelerated ageing. The results obtained in the investigation can be used in the beer industry to predict the alteration of the bitterness of beer during storage. © 2013 Society of Chemical Industry.

Novel extracellular PHB depolymerase from Streptomyces ascomycinicus: PHB copolymers degradation in acidic conditions.

Directory of Open Access Journals (Sweden)

Javier García-Hidalgo

Full Text Available The ascomycin-producer strain Streptomyces ascomycinicus has been proven to be an extracellular poly(R-3-hydroxybutyrate (PHB degrader. The fkbU gene, encoding a PHB depolymerase (PhaZ Sa , has been cloned in E. coli and Rhodococcus sp. T104 strains for gene expression. Gram-positive host Rhodococcus sp. T104 was able to produce and secrete to the extracellular medium an active protein form. PhaZ Sa was purified by two hydrophobic interaction chromatographic steps, and afterwards was biochemically as well as structurally characterized. The enzyme was found to be a monomer with a molecular mass of 48.4 kDa, and displayed highest activity at 45°C and pH 6, thus being the first PHB depolymerase from a gram-positive bacterium presenting an acidic pH optimum. The PHB depolymerase activity of PhaZ Sa was increased in the presence of divalent cations due to non-essential activation, and also in the presence of methyl-β-cyclodextrin and PEG 3350. Protein structure was analyzed, revealing a globular shape with an alpha-beta hydrolase fold. The amino acids comprising the catalytic triad, Ser(131-Asp(209-His(269, were identified by multiple sequence alignment, chemical modification of amino acids and site-directed mutagenesis. These structural results supported the proposal of a three-dimensional model for this depolymerase. PhaZ Sa was able to degrade PHB, but also demonstrated its ability to degrade films made of PHB, PHBV copolymers and a blend of PHB and starch (7∶3 proportion wt/wt. The features shown by PhaZ Sa make it an interesting candidate for industrial applications involving PHB degradation.

Novel extracellular PHB depolymerase from Streptomyces ascomycinicus: PHB copolymers degradation in acidic conditions.

Science.gov (United States)

García-Hidalgo, Javier; Hormigo, Daniel; Arroyo, Miguel; de la Mata, Isabel

2013-01-01

The ascomycin-producer strain Streptomyces ascomycinicus has been proven to be an extracellular poly(R)-3-hydroxybutyrate (PHB) degrader. The fkbU gene, encoding a PHB depolymerase (PhaZ Sa ), has been cloned in E. coli and Rhodococcus sp. T104 strains for gene expression. Gram-positive host Rhodococcus sp. T104 was able to produce and secrete to the extracellular medium an active protein form. PhaZ Sa was purified by two hydrophobic interaction chromatographic steps, and afterwards was biochemically as well as structurally characterized. The enzyme was found to be a monomer with a molecular mass of 48.4 kDa, and displayed highest activity at 45°C and pH 6, thus being the first PHB depolymerase from a gram-positive bacterium presenting an acidic pH optimum. The PHB depolymerase activity of PhaZ Sa was increased in the presence of divalent cations due to non-essential activation, and also in the presence of methyl-β-cyclodextrin and PEG 3350. Protein structure was analyzed, revealing a globular shape with an alpha-beta hydrolase fold. The amino acids comprising the catalytic triad, Ser(131)-Asp(209)-His(269), were identified by multiple sequence alignment, chemical modification of amino acids and site-directed mutagenesis. These structural results supported the proposal of a three-dimensional model for this depolymerase. PhaZ Sa was able to degrade PHB, but also demonstrated its ability to degrade films made of PHB, PHBV copolymers and a blend of PHB and starch (7∶3 proportion wt/wt). The features shown by PhaZ Sa make it an interesting candidate for industrial applications involving PHB degradation.

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

OpenAIRE

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

Uncovering the Lactobacillus plantarum WCFS1 Gallate Decarboxylase Involved in Tannin Degradation

Science.gov (United States)

Jiménez, Natalia; Curiel, José Antonio; Reverón, Inés; de las Rivas, Blanca

2013-01-01

Lactobacillus plantarum is a lactic acid bacterium able to degrade tannins by the subsequent action of tannase and gallate decarboxylase enzymes. The gene encoding tannase had previously been identified, whereas the gene encoding gallate decarboxylase is unknown. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of gallic-acid induced L. plantarum extracts showed a 54-kDa protein which was absent in the uninduced cells. This protein was identified as Lp_2945, putatively annotated UbiD. Homology searches identified ubiD-like genes located within three-gene operons which encoded the three subunits of nonoxidative aromatic acid decarboxylases. L. plantarum is the only bacterium in which the lpdC (lp_2945) gene and the lpdB and lpdD (lp_0271 and lp_0272) genes are separated in the chromosome. Combination of extracts from recombinant Escherichia coli cells expressing the lpdB, lpdC, and lpdC genes demonstrated that LpdC is the only protein required to yield gallate decarboxylase activity. However, the disruption of these genes in L. plantarum revealed that the lpdB and lpdC gene products are essential for gallate decarboxylase activity. Similar to L. plantarum tannase, which exhibited activity only in esters derived from gallic and protocatechuic acids, purified His6-LpdC protein from E. coli showed decarboxylase activity against gallic and protocatechuic acids. In contrast to the tannase activity, gallate decarboxylase activity is widely present among lactic acid bacteria. This study constitutes the first genetic characterization of a gallate decarboxylase enzyme and provides new insights into the role of the different subunits of bacterial nonoxidative aromatic acid decarboxylases. PMID:23645198

Clofibric acid degradation in UV254/H2O2 process: effect of temperature.

Science.gov (United States)

Li, Wenzhen; Lu, Shuguang; Qiu, Zhaofu; Lin, Kuangfei

2010-04-15

The degradation of clofibric acid (CA) in UV(254)/H(2)O(2) process under three temperature ranges, i.e. T1 (9.0-11.5 degrees C), T2 (19.0-21.0 degrees C) and T3 (29.0-30.0 degrees C) was investigated. The effects of solution constituents including NO(3)(-) and HCO(3)(-) anions, and humic acid (HA) on CA degradation were evaluated in Milli-Q waters. CA degradation behaviors were simulated with the pseudo-first-order kinetic model and the apparent rate constant (k(ap)) and half-life time (t(1/2)) were calculated. The results showed that higher temperature would favor CA degradation, and CA degradation was taken place mostly by indirect oxidation through the formation of OH radicals in UV(254)/H(2)O(2) process. In addition, the effects of both NO(3)(-) and HCO(3)(-) anions at two selected concentrations (1.0x10(-3) and 0.1 mol L(-1)) and HA (20 mg L(-1)) on CA degradation were investigated. The results showed that HA had negative effect on CA degradation, and this effect was much more apparent under low temperature condition. On the other hand, the inhibitive effect on CA degradation at both lower and higher concentrations of bicarbonate was observed, and this inhibitive effect was much more apparent at higher bicarbonate concentration and lower temperature condition. While, at higher nitrate concentration the inhibitive effect on CA degradation under three temperature ranges was observed, and with the temperature increase this negative effect was apparently weakened. However, at lower nitrate concentration a slightly positive effect on CA degradation was found under T2 and T3 conditions. Moreover, when using a real wastewater treatment plant (WWTP) effluent spiked with CA over 99% of CA removal could be achieved under 30 degrees C within only 15 min compared with 40 and 80 min under 20 and 10 degrees C respectively, suggesting a significant promotion in CA degradation under higher temperature condition. Therefore, it can be concluded that temperature plays an

Efficient photocatalytic degradation of perfluorooctanoic acid by a wide band gap p-block metal oxyhydroxide InOOH

Science.gov (United States)

Xu, Jingjing; Wu, Miaomiao; Yang, Jingwen; Wang, Zhengmei; Chen, Mindong; Teng, Fei

2017-09-01

In this work, we prepared a new wide band gap semiconductor, p-block metal oxyhydroxide InOOH, which exhibits efficient activity for perfluorooctanoic acid (PFOA) degradation under mild conditions and UV light irradiation. The apparent rate constant for PFOA degradation by InOOH is 27.6 times higher than that for P25 titania. Results show that ionized PFOA (C7F15COO-) can be adsorbed much more efficiently on the surface of InOOH than P25. Then, the adsorbed C7F15COO- can be decomposed directly by photo-generated holes to form C7F15COOrad radicals. This process is the key step for the photocalytic degradation of PFOA. Major degradation intermediates, fluoride ions and perfluorinated carboxylic acids (PFCAs) with shorter chain lengths were detected during PFOA degradation. A possible pathway for photocatalytic degradation of PFOA is proposed based on the experimental results. Therefore, this studies indicates a potential new material and method for the efficient treatment of PFCA pollutants under mild conditions.

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

Science.gov (United States)

Boyd, D A; Mulvey, M R

2013-02-01

To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Co-metabolic formation of substituted phenylacetic acids by styrene-degrading bacteria

Directory of Open Access Journals (Sweden)

Michel Oelschlägel

2015-06-01

The styrene-degrading strains Rhodococcus opacus 1CP, Pseudomonas fluorescens ST, and the novel isolates Sphingopyxis sp. Kp5.2 and Gordonia sp. CWB2 were investigated with respect to their applicability to co-metabolically produce substituted phenylacetic acids. Isolates were found to differ significantly in substrate tolerance and biotransformation yields. Especially, P. fluorescens ST was identified as a promising candidate for the production of several phenylacetic acids. The biotransformation of 4-chlorostyrene with cells of strain ST was shown to be stable over a period of more than 200 days and yielded about 38 mmolproduct gcelldryweight−1 after nearly 350 days. Moreover, 4-chloro-α-methylstyrene was predominantly converted to the (S-enantiomer of the acid with 40% enantiomeric excess.

Natural Formation and Degradation of Chloroacetic Acids and Volatile Organochlorines in Forest Soil

Czech Academy of Sciences Publication Activity Database

Laturnus, F.; Fahimi, I.; Gryndler, Milan; Hartmann, A.; Heal, M. R.; Matucha, M.; Schöler, H. F.; Schroll, R.; Svensson, T.

2005-01-01

Roč. 12, č. 4 (2005), s. 233-244 ISSN 0944-1344 Institutional research plan: CEZ:AV0Z50200510 Keywords : chloroacetic acids * degradation * fores decline Subject RIV: EE - Microbiology, Virology Impact factor: 1.518, year: 2005

Agdc1p - a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans.

Science.gov (United States)

Meier, Anna K; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (K m -0.7 ± 0.2 mM, k cat -42.0 ± 8.2 s -1 ) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (K m -3.2 ± 0.2 mM, k cat -44.0 ± 3.2 s -1 ). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δ agdc1 ] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis -muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be

Degradation of 2,4-dichlorophenoxyacetic acid by a halotolerant strain of Penicillium chrysogenum: antibiotic production.

Science.gov (United States)

Ferreira-Guedes, Sumaya; Mendes, Benilde; Leitão, Ana Lúcia

2012-01-01

The extensive use of pesticides in agriculture has prompted intensive research on chemical and biological methods in order to protect contamination of water and soil resources. In this paper the degradation of the pesticide 2,4-dichlorophenoxyacetic acid by a Penicillium chrysogenum strain previously isolated from a salt mine was studied in batch cultures. Co-degradation of 2,4-dichlorophenoxyacetic acid with additives such as sugar and intermediates of pesticide metabolism was also investigated. Penicillium chrysogenum in solid medium was able to grow at concentrations up to 1000 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D) with sucrose. Meanwhile, supplementation of the solid medium with glucose and lactose led to fungal growth at concentrations up to 500 mg/L of herbicide. Batch cultures of 2,4-D at 100 mg/L were developed under aerobic conditions with the addition of glucose, lactose and sucrose, showing sucrose as the best additional carbon source. The 2,4-D removal was quantified by liquid chromatography. The fungus was able to use 2,4-D as the sole carbon and energy source under 0%, 2% and 5.9% NaCl. The greatest 2,4-D degradation efficiency was found using alpha-ketoglutarate and ascorbic acid as co-substrates under 2% NaCl at pH 7. Penicillin production was evaluated in submerged cultures by bioassay, and higher amounts of beta-lactam antibiotic were produced when the herbicide was alone. Taking into account the ability of P. chrysogenum CLONA2 to degrade aromatic compounds, this strain could be an interesting tool for 2,4-D herbicide remediation in saline environments.

Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Elasri, Mohamed O

2014-06-11

Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

Organic matter degradation in Chilean sediments - following nature's own degradation experiment

DEFF Research Database (Denmark)

Langerhuus, Alice Thoft; Niggemann, Jutta; Lomstein, Bente Aagaard

ORGANIC MATTER DEGRADATION IN CHILEAN SEDIMENTS – FOLLOWING NATURE’S OWN DEGRADATION EXPERIMENT Degradation of sedimentary organic matter was studied at two stations from the shelf of the Chilean upwelling region. Sediment cores were taken at 1200 m and 800 m water depth and were 4.5 m and 7.5 m...... in length, respectively. The objective of this study was to assess the degradability of the organic matter from the sediment surface to the deep sediments. This was done by analysing amino acids (both L- and D-isomers) and amino sugars in the sediment cores, covering a timescale of 15.000 years. Diagenetic...... indicators (percentage of carbon and nitrogen present as amino acid carbon and nitrogen, the ratio between a protein precursor and its non-protein degradation product and the percentage of D-amino acids) revealed ongoing degradation in these sediments, indicating that microorganisms were still active in 15...

An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

Science.gov (United States)

Branny, P; de la Torre, F; Garel, J R

1998-04-01

The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

Oxidative degradation of acid doped polybenzimidazole membranes and fuel cell durability in the presence of ferrous ions

DEFF Research Database (Denmark)

Liao, Jianhui; Yang, Jingshuai; Li, Qingfeng

2013-01-01

Phosphoric acid doped polybenzimidazole membranes have been explored as proton exchange membranes for high temperature polymer electrolyte membrane fuel cells. Long-term durability of the membrane is of critical concern and has been evaluated by accelerated degradation tests under Fenton conditions...... of the polymer. Fuel cell durability tests with contaminations of ferrous ions did show considerable performance degradation, however, primarily due to the catalyst deterioration rather than the membrane degradation........ In this study effects of phosphoric acid and ferrous ions were investigated by measurements of the weight loss, intrinsic viscosity and size exclusion chromatography (SEC) of the polymer membranes. Ferrous ions resulted in, as expected, catalytic formation of peroxide radicals and hence the accelerated polymer...

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Unknown

[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

An approach for degradation of grape seed and skin proanthocyanidin polymers into oligomers by sulphurous acid.

Science.gov (United States)

Luo, Lanxin; Cui, Yan; Cheng, Jinhui; Fang, Bairui; Wei, Zongmin; Sun, Baoshan

2018-08-01

To develop an efficient method for degradation of grape seed and skin proanthocyanidins polymers into oligomers, an optimized sulphurous acid degradation conditions for grape seed with the temperature of 60 °C, reaction time of 60 min and sample-sulphurous acid ratio of 1:0.2, and for grape skin with the temperature of 40 °C, reaction time of 60 min and sample-sulphurous acid ratio of 1:0.2, were established. Afterwards, HSCCC and prep-HPLC were used to fractionate and isolate individual proanthocyanidin oligomers from the degradation products. Total of ten dimeric or trimeric procyanidins were obtained, and most of them presented high yield (from 0.7 mg to 13.6 mg per run in grape seed and from 0.5 mg to 4.1 mg per run in grape skin) and high purity (over 90%). The proposed method provides a new way for large preparation of oligomeric proanthocyanidins from naturally abundant and wasted polymeric ones. Copyright © 2018 Elsevier Ltd. All rights reserved.

Microbial dynamics in anaerobic enrichment cultures degrading di-n-butyl phthalic acid ester

DEFF Research Database (Denmark)

Trably, Eric; Batstone, Damien J.; Christensen, Nina

2008-01-01

losses were observed in the sterile controls (20-22%), substantial DBP biodegradation was found in the enrichment cultures (90-99%). In addition, significant population changes were observed. The dominant bacterial species in the DBP-degrading cultures was affiliated to Soehngenia saccharolytica...... in enrichment cultures degrading phthalic acid esters under methanogenic conditions. A selection pressure was applied by adding DBP at 10 and 200 mg L(-1) in semi-continuous anaerobic reactors. The microbial dynamics were monitored using single strand conformation polymorphism (SSCP). While only limited abiotic...

Molecular characterization of an enzyme that degrades neuromodulatory fatty-acid amides.

Science.gov (United States)

Cravatt, B F; Giang, D K; Mayfield, S P; Boger, D L; Lerner, R A; Gilula, N B

1996-11-07

Endogenous neuromodulatory molecules are commonly coupled to specific metabolic enzymes to ensure rapid signal inactivation. Thus, acetylcholine is hydrolysed by acetylcholine esterase and tryptamine neurotransmitters like serotonin are degraded by monoamine oxidases. Previously, we reported the structure and sleep-inducing properties of cis-9-octadecenamide, a lipid isolated from the cerebrospinal fluid of sleep-deprived cats. cis-9-Octadecenamide, or oleamide, has since been shown to affect serotonergic systems and block gap-junction communication in glial cells (our unpublished results). We also identified a membrane-bound enzyme activity that hydrolyses oleamide to its inactive acid, oleic acid. We now report the mechanism-based isolation, cloning and expression of this enzyme activity, originally named oleamide hydrolase, from rat liver plasma membranes. We also show that oleamide hydrolase converts anandamide, a fatty-acid amide identified as the endogenous ligand for the cannabinoid receptor, to arachidonic acid, indicating that oleamide hydrolase may serve as the general inactivating enzyme for a growing family of bioactive signalling molecules, the fatty-acid amides. Therefore we will hereafter refer to oleamide hydrolase as fatty-acid amide hydrolase, in recognition of the plurality of fatty-acid amides that the enzyme can accept as substrates.

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A NodD-like protein activates transcription of genes involved with naringenin degradation in a flavonoid-dependent manner in Herbaspirillum seropedicae.

Science.gov (United States)

Wassem, R; Marin, A M; Daddaoua, A; Monteiro, R A; Chubatsu, L S; Ramos, J L; Deakin, W J; Broughton, W J; Pedrosa, F O; Souza, E M

2017-03-01

Herbaspirillum seropedicae is an associative, endophytic non-nodulating diazotrophic bacterium that colonises several grasses. An ORF encoding a LysR-type transcriptional regulator, very similar to NodD proteins of rhizobia, was identified in its genome. This nodD-like gene, named fdeR, is divergently transcribed from an operon encoding enzymes involved in flavonoid degradation (fde operon). Apigenin, chrysin, luteolin and naringenin strongly induce transcription of the fde operon, but not that of the fdeR, in an FdeR-dependent manner. The intergenic region between fdeR and fdeA contains several generic LysR consensus sequences (T-N 11 -A) and we propose a binding site for FdeR, which is conserved in other bacteria. DNase I foot-printing revealed that the interaction with the FdeR binding site is modified by the four flavonoids that stimulate transcription of the fde operon. Moreover, FdeR binds naringenin and chrysin as shown by isothermal titration calorimetry. Interestingly, FdeR also binds in vitro to the nod-box from the nodABC operon of Rhizobium sp. NGR234 and is able to activate its transcription in vivo. These results show that FdeR exhibits two features of rhizobial NodD proteins: nod-box recognition and flavonoid-dependent transcription activation, but its role in H. seropedicae and related organisms seems to have evolved to control flavonoid metabolism. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Degradation of hyaluronic acid, poly- and monosaccharides, and model compounds by hypochlorite

DEFF Research Database (Denmark)

Hawkins, C L; Davies, Michael Jonathan

1998-01-01

the site(s) of HOCl/ClO- attack, the intermediates formed, or the mechanism(s) of polymer degradation. In this study reaction of HOCl/ClO- with amides, sugars, polysaccharides, and hyaluronic acid has been monitored by UV-visible (220-340 nm) and EPR spectroscopy. UV-visible experiments have shown...

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

Science.gov (United States)

Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

2014-01-01

Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

Science.gov (United States)

Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

2001-04-01

We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

Directory of Open Access Journals (Sweden)

Arkin Adam P

2006-01-01

Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

Degradation and contamination of perfluorinated sulfonic acid membrane due to swelling-dehydration cycles

DEFF Research Database (Denmark)

Andersen, Shuang Ma; Morgen, Per; Skou, Eivind Morten

Formation of sulfonic anhydride S-O-S (from the condensation of sulfonic acids) was known one of the important degradation mechanisms [i] for Nafion membrane under hydrothermal aging condition, which is especially critical for hydrogen fuel cells. Similar mechanism would also have be desirable...... to the membrane degradation in direct methanol fuel cells (DMFCs), where liquid water has direct contact with the electrolyte. An ex-situ experiment was established with swelling-dehydration cycles on the membrane. However, formation of sulfonic anhydride was not detected during the entire treatment; instead...

Thermal degradation kinetics of ascorbic acid, thiamine and riboflavin in rosehip (Rosa canina L nectar

Directory of Open Access Journals (Sweden)

Çetin KADAKAL

2017-10-01

Full Text Available Abstract In this paper, the loss of L-ascorbic acid, thiamine and riboflavin in rosehip nectar with the heating periods (0, 5, 10, 15, 20 and 30 min at temperatures ranging from 70 to 95 °C is analyzed and experimental results are presented. Firstly, dried rosehip fruits were processed to rosehip nectar and then thermal treatment is performed. Liquid chromatographic (HPLC method was used for the analysis of the contents of L-ascorbic acid, thiamine and riboflavin and examined compounds are thoroughly separated within 25 min. During thermal processing, degradation of L-ascorbic acid, thiamine and riboflavin in rosehip nectar were fitted to a first-order reaction kinetic model. Arrhenius relationship was used for the description of temperature dependence of reaction. Activation energies for L-ascorbic acid, thiamine and riboflavin between 70 to 95 ºC were found to be 55.30, 36.38 and 37.15 kJ/mol, respectively. To the best of the author’s knowledge, due to lack of study on the thermal degradation of L-ascorbic acid, thiamine and riboflavin in rosehip nectar, this manuscript will be the first reported study to enable future analysis.

Heterogeneous photocatalytic degradation of p-toluenesulfonic acid using concentrated solar radiation in slurry photoreactor

International Nuclear Information System (INIS)

Kamble, Sanjay P.; Sawant, Sudhir B.; Pangarkar, Vishwas G.

2007-01-01

In this work, the photocatalytic degradation (PCD) of p-toluenesulfonic acid (p-TSA) in batch reactor using concentrated solar radiation was investigated. The effect of the various operating parameters such as initial concentration of substrate, catalyst loading, solution pH and types of ions on photocatalytic degradation has been studied in a batch reactor to derive the optimum conditions. The rate of photocatalytic degradation was found to be maximum at the self pH (pH 3.34) of p-TSA. It was also observed that in the presence of anions and cations, the rate of PCD decreases drastically. The kinetics of photocatalytic degradation of p-TSA was studied. The PCD of p-TSA was also carried at these optimized conditions in a bench scale slurry bubble column reactor using concentrated solar radiation

Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

Science.gov (United States)

Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

2015-11-17

rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

Science.gov (United States)

Dixit, R; Trivedi, P K; Nath, P; Sane, P V

1999-09-01

Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

Transport and degradation of 2-14C abscicine acid in the coleus rehneltianus berger sprout

International Nuclear Information System (INIS)

Klaska, A.

1979-01-01

1 μg ABA-2- 14 C aqueous solution was injected into the youngest or into a fully grown leaf of young and older coleus plants. The activity quantity in the various sprout parts is investigated after 2, 24 and 72 h; as well as which labelled substances other than abscisic acid (ABA) occur. The activity in the ethanol extracts was detected with the help of liquid scintillation measurements. Thin layer chromatography and gas chromatography were used to characterize the radioactive substances. The results show that ABA is degraded into three metabolites which are characterized by their relative Rsub(F) values using chromatography with LM 2 as substance 0.2, 0.5a, 0.5b and 0.8. Comparing with the literature shows that it could be 6'-hydroxy methyl ABA, ABA glucoside, phaseic acid and dihydrophaseic acid. Young and old leaves in older plants have the same ability to degrade ABA taking the occurence of the 0.8 metabolite as standard. The degradation in younger plants is firstly very slight. However, within 72 h the ability of ABA degradation is induced in older leaves of younger plants, so that finally the degradation rate is as big as in older plants. Activity is essentially exported by adult leaves of older plants. The basipetal transport is considerably greater than the acropetal one. Results show that mainly ABA is transported in the acropetal test, whereas ABA and fraction 0.5 are transported in the basipetal direction. A reversed transport direction is observed after applying ABA to a young leaf. The transport basipetal is polarized in the first two hours, after 72 hours of transport there is a definite acropetal polarity. (orig./MG) [de

Radiolytic degradation of gallic acid and its derivatives in aqueous solution

International Nuclear Information System (INIS)

Melo, R.; Leal, J.P.; Takacs, E.; Wojnarovits, L.

2009-01-01

Polyphenols, like gallic acid (GA) released in the environment in larger amount, by inducing some unwanted oxidations, may constitute environmental hazard: their concentration in wastewater should be controlled. Radiolytic degradation of GA was investigated by pulse radiolysis and final product techniques in dilute aqueous solution. Subsidiary measurements were made with 3,4,5-trimethoxybenzoic acid (TMBA) and 3,4,5-trihydroxy methylbenzoate (MGA). The hydroxyl radical and hydrogen atom intermediates of water radiolysis react with the solute molecules yielding cyclohexadienyl radicals. The radicals formed in GA and MGA solutions in acid/base catalyzed water elimination decay to phenoxyl radicals. This reaction is not observed in TMBA solution. The hydrated electron intermediate of water decomposition adds to the carbonyl oxygen, the anion thus formed protonates on the ring forming cyclohexadienyl radical or on the carbonyl group forming carbonyl centred radical. The GA intermediates formed during reaction with primary water radicals in presence of oxygen transform to non-aromatic molecules, e.g., to aliphatic carboxylic acids.

Radiolytic degradation of gallic acid and its derivatives in aqueous solution

Energy Technology Data Exchange (ETDEWEB)

Melo, R. [Instituto Tecnologico e Nuclear, UCQR, Estrada Nacional No. 10, Apartado 21, 2686-953, Sacavem (Portugal); Leal, J.P. [Instituto Tecnologico e Nuclear, UCQR, Estrada Nacional No. 10, Apartado 21, 2686-953, Sacavem (Portugal); Centro Quimica e Bioquimica, Faculdade de Ciencias da Universidade de Lisboa, 1749-016 Lisboa (Portugal); Takacs, E., E-mail: takacs@iki.kfki.hu [Institute of Isotopes, Hungarian Academy of Sciences, P.O. Box 77, H-1525 Budapest (Hungary); Wojnarovits, L. [Institute of Isotopes, Hungarian Academy of Sciences, P.O. Box 77, H-1525 Budapest (Hungary)

2009-12-30

Polyphenols, like gallic acid (GA) released in the environment in larger amount, by inducing some unwanted oxidations, may constitute environmental hazard: their concentration in wastewater should be controlled. Radiolytic degradation of GA was investigated by pulse radiolysis and final product techniques in dilute aqueous solution. Subsidiary measurements were made with 3,4,5-trimethoxybenzoic acid (TMBA) and 3,4,5-trihydroxy methylbenzoate (MGA). The hydroxyl radical and hydrogen atom intermediates of water radiolysis react with the solute molecules yielding cyclohexadienyl radicals. The radicals formed in GA and MGA solutions in acid/base catalyzed water elimination decay to phenoxyl radicals. This reaction is not observed in TMBA solution. The hydrated electron intermediate of water decomposition adds to the carbonyl oxygen, the anion thus formed protonates on the ring forming cyclohexadienyl radical or on the carbonyl group forming carbonyl centred radical. The GA intermediates formed during reaction with primary water radicals in presence of oxygen transform to non-aromatic molecules, e.g., to aliphatic carboxylic acids.

Agdc1p – a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula adeninivorans

Directory of Open Access Journals (Sweden)

Anna K. Meier

2017-09-01

Full Text Available Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid, are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (Km −0.7 ± 0.2 mM, kcat −42.0 ± 8.2 s−1 than to protocatechuic acid (3,4-dihydroxybenzoic acid (Km −3.2 ± 0.2 mM, kcat −44.0 ± 3.2 s−1. Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δagdc1] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis-muconic acid. However, the protocatechuic acid catabolism via Agdc1p to

Agdc1p – a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans

Science.gov (United States)

Meier, Anna K.; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (Km −0.7 ± 0.2 mM, kcat −42.0 ± 8.2 s−1) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (Km −3.2 ± 0.2 mM, kcat −44.0 ± 3.2 s−1). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δagdc1] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis-muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be

Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

Science.gov (United States)

Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

2016-01-01

An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

Volatile fatty acid degradation kinetics in anaerobic process; Cinetica de la degradacion de acidos grasos volatiles en procesos anaerobios

Energy Technology Data Exchange (ETDEWEB)

Riscado, S.; Osuna, B.; Iza, J.; Ruiz, E. [Universidad del Pais Vasco. Bilbao (Spain)

1998-10-01

While searching for the optimal substrate load for anaerobic toxicity assays, the inhibition caused by the propionic acid has been addressed. Lab scale experiments have been carried out to assess the effects of different loads and acid ratios. Results bad been subjected to kinetic analysis and show the degradation follows a first order kinetic, and acetic is easier to degrade than propionic acid. The optimal load for a 100 ml vial assay is composed of 158 mg COD of the 3:1:1 HAc:HPr:HBu mixture. (Author) 9 refs.

Different Spectrophotometric Methods for Simultaneous Determination of Trelagliptin and Its Acid Degradation Product

Science.gov (United States)

Hassan, Mostafa A.; Zaghary, Wafaa A.

2018-01-01

New spectrophotometric and chemometric methods were carried out for the simultaneous assay of trelagliptin (TRG) and its acid degradation product (TAD) and applied successfully as a stability indicating assay to recently approved Zafatek® tablets. TAD was monitored using TLC to ensure complete degradation. Furthermore, HPLC was used to confirm dealing with one major acid degradation product. The proposed methods were developed by manipulating zero-order, first-derivative, and ratio spectra of TRG and TAD using simultaneous equation, first-derivative, and mean-centering methods, respectively. Using Spectra Manager II and Minitab v.14 software, the absorbance at 274 nm–260.4 nm, amplitudes at 260.4 nm–274.0 nm, and mean-centered values at 287.6 nm–257.2 nm were measured against methanol as a blank for TRG and TAD, respectively. Linearity and the other validation parameters were acceptable at concentration ranges of 5–50 μg/mL and 2.5–25 μg/mL for TRG and TAD, respectively. Using one-way analysis of variance (ANOVA), the optimized methods were compared and proved to be accurate for the simultaneous assay of TRG and TAD. PMID:29629213

Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

Science.gov (United States)

Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

2014-01-01

Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

Degradation of Acid Orange 7 Dye in Two Hybrid Plasma Discharge Reactors

Science.gov (United States)

Shen, Yongjun; Lei, Lecheng; Zhang, Xingwang; Ding, Jiandong

2014-11-01

To get an optimized pulsed electrical plasma discharge reactor and to increase the energy utilization efficiency in the removal of pollutants, two hybrid plasma discharge reactors were designed and optimized. The reactors were compared via the discharge characteristics, energy transfer efficiency, the yields of the active species and the energy utilization in dye wastewater degradation. The results showed that under the same AC input power, the characteristics of the discharge waveform of the point-to-plate reactor were better. Under the same AC input power, the two reactors both had almost the same peak voltage of 22 kV. The peak current of the point-to-plate reactor was 146 A, while that of the wire-to-cylinder reactor was only 48.8 A. The peak powers of the point-to-plate reactor and the wire-to-cylinder reactor were 1.38 MW and 1.01 MW, respectively. The energy per pulse of the point-to-plate reactor was 0.2221 J, which was about 29.4% higher than that of the wire-to-cylinder reactor (0.1716 J). To remove 50% Acid Orange 7 (AO7), the energy utilizations of the point-to-plate reactor and the wire-to-cylinder reactor were 1.02 × 10-9 mol/L and 0.61 × 10-9 mol/L, respectively. In the point-to-plate reactor, the concentration of hydrogen peroxide in pure water was 3.6 mmol/L after 40 min of discharge, which was higher than that of the wire-to-cylinder reactor (2.5 mmol/L). The concentration of liquid phase ozone in the point-to-plate reactor (5.7 × 10-2 mmol/L) was about 26.7% higher than that in the wire-to-cylinder reactor (4.5 × 10-2 mmol/L). The analysis results of the variance showed that the type of reactor and reaction time had significant impacts on the yields of the hydrogen peroxide and ozone. The main degradation intermediates of AO7 identified by gas chromatography and mass spectrometry (GCMS) were acetic acid, maleic anhydride, p-benzoquinone, phenol, benzoic acid, phthalic anhydride, coumarin and 2-naphthol. Proposed degradation pathways were

Degradation of Acid Orange 7 Dye in Two Hybrid Plasma Discharge Reactors

International Nuclear Information System (INIS)

Shen Yongjun; Ding Jiandong; Lei Lecheng; Zhang Xingwang

2014-01-01

To get an optimized pulsed electrical plasma discharge reactor and to increase the energy utilization efficiency in the removal of pollutants, two hybrid plasma discharge reactors were designed and optimized. The reactors were compared via the discharge characteristics, energy transfer efficiency, the yields of the active species and the energy utilization in dye wastewater degradation. The results showed that under the same AC input power, the characteristics of the discharge waveform of the point-to-plate reactor were better. Under the same AC input power, the two reactors both had almost the same peak voltage of 22 kV. The peak current of the point-to-plate reactor was 146 A, while that of the wire-to-cylinder reactor was only 48.8 A. The peak powers of the point-to-plate reactor and the wire-to-cylinder reactor were 1.38 MW and 1.01 MW, respectively. The energy per pulse of the point-to-plate reactor was 0.2221 J, which was about 29.4% higher than that of the wire-to-cylinder reactor (0.1716 J). To remove 50% Acid Orange 7 (AO7), the energy utilizations of the point-to-plate reactor and the wire-to-cylinder reactor were 1.02 × 10 −9 mol/L and 0.61 × 10 −9 mol/L, respectively. In the point-to-plate reactor, the concentration of hydrogen peroxide in pure water was 3.6 mmol/L after 40 min of discharge, which was higher than that of the wire-to-cylinder reactor (2.5 mmol/L). The concentration of liquid phase ozone in the point-to-plate reactor (5.7 × 10 −2 mmol/L) was about 26.7% higher than that in the wire-to-cylinder reactor (4.5 × 10 −2 mmol/L). The analysis results of the variance showed that the type of reactor and reaction time had significant impacts on the yields of the hydrogen peroxide and ozone. The main degradation intermediates of AO7 identified by gas chromatography and mass spectrometry (GCMS) were acetic acid, maleic anhydride, p-benzoquinone, phenol, benzoic acid, phthalic anhydride, coumarin and 2-naphthol. Proposed degradation

Investigation of the impact of trace elements on anaerobic volatile fatty acid degradation using a fractional factorial experimental design.

Science.gov (United States)

Jiang, Ying; Zhang, Yue; Banks, Charles; Heaven, Sonia; Longhurst, Philip

2017-11-15

The requirement of trace elements (TE) in anaerobic digestion process is widely documented. However, little is understood regarding the specific requirement of elements and their critical concentrations under different operating conditions such as substrate characterisation and temperature. In this study, a flask batch trial using fractional factorial design is conducted to investigate volatile fatty acids (VFA) anaerobic degradation rate under the influence of the individual and combined effect of six TEs (Co, Ni, Mo, Se, Fe and W). The experiment inoculated with food waste digestate, spiked with sodium acetate and sodium propionate both to 10 g/l. This is followed by the addition of a selection of the six elements in accordance with a 2 6-2 fractional factorial principle. The experiment is conducted in duplicate and the degradation of VFA is regularly monitored. Factorial effect analysis on the experimental results reveals that within these experimental conditions, Se has a key role in promoting the degradation rates of both acetic and propionic acids; Mo and Co are found to have a modest effect on increasing propionic acid degradation rate. It is also revealed that Ni shows some inhibitory effects on VFA degradation, possibly due to its toxicity. Additionally, regression coefficients for the main and second order effects are calculated to establish regression models for VFA degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Science.gov (United States)

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

Silage fermentation and ruminal degradation of stylo prepared with lactic acid bacteria and cellulase.

Science.gov (United States)

Li, Mao; Zhou, Hanlin; Zi, Xuejuan; Cai, Yimin

2017-10-01

In order to improve the silage fermentation of stylo (Stylosanthes guianensis) in tropical areas, stylo silages were prepared with commercial additives Lactobacillus plantarum Chikuso-1 (CH1), L. rhamnasus Snow Lact L (SN), Acremonium cellulase (CE) and their combination as SN+CE or CH1 + CE, and the fermentation quality, chemical composition and ruminal degradation of these silages were studied. Stylo silages treated with lactic acid bacteria (LAB) or cellulase, the pH value and NH 3 -N ⁄ total-N were significantly (P fermentation and ruminal degradation than SN+CE treatment. The results confirmed that LAB or LAB plus cellulase treatment could improve the fermentation quality, chemical composition and ruminal degradation of stylo silage. Moreover, the combined treatment with LAB and cellulase may have beneficial synergistic effects on ruminal degradation. © 2017 Japanese Society of Animal Science.

RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

Science.gov (United States)

Pérez-Oseguera, Angeles; Cevallos, Miguel A

2013-11-01

Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

Directory of Open Access Journals (Sweden)

Terezinha Knöbl

2006-06-01

Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

Photocatalytic degradation of clofibric acid, carbamazepine and iomeprol using conglomerated TiO2 and activated carbon in aqueous suspension.

Science.gov (United States)

Ziegmann, Markus; Frimmel, Fritz H

2010-01-01

The combination of powdered activated carbon (PAC) and TiO(2) has been tested for synergistic/antagonistic effects in the photocatalytic degradation of carbamazepine, clofibric acid and iomeprol. Synergistic effects are thought to be caused by rapid adsorption on the PAC surface followed by diffusion to the TiO(2) surface and photocatalytic degradation. The Freundlich constant K(F) was used for comparing the sorption properties of the three substances and it was found that K(F) for clofibric acid was 3 times lower than for carbamazepine and iomeprol, regardless of the kind of PAC used. A PAC with a distinct tendency to form conglomerates was selected so that a high percentage of the PAC surface was in direct proximity to the TiO(2) surface. The photocatalytic degradation of the pharmaceutically active compounds studied followed pseudo-first order kinetics. Synergistic effects only occurred for clofibric acid (factor 1.5) and an inverse relationship between adsorption affinity and synergistic effects was found. High affinity of the target substances to the PAC surface seemed to be counterproductive for the photocatalytic degradation.

Associations of Pseudomonas species and forage grasses enhance degradation of chlorinated benzoic acids in soil

Energy Technology Data Exchange (ETDEWEB)

Siciliano, S. D.

1998-12-01

Using chlorinated benzoic acid (CBA) as a model compound, this study attempted to show that microorganisms and plants can be used as bioremediation agents to clean up contaminated soil sites in a cost effective and environmentally friendly manner. CBA was used because it is present in soils contaminated with polychlorinated biphenyls (PCBs), or chlorinated pesticides. Sixteen forage grasses were screened in combination with 12 bacterial inoculants for their ability to promote the degradation of CBA in soil. Five associations of plants and bacteria were found to degrade CBA to a greater extent than plants without bacterial inoculants. Bacterial inoculants were shown to stimulate CBA degradation by altering the microbial community present on the root surface and thereby increasing the ability of this community to degrade CBA.

Mass spectrometry of oil sands naphthenic acids : degradation in OSPW and wetland plants

Energy Technology Data Exchange (ETDEWEB)

Headley, J. [Environment Canada, Saskatoon, SK (Canada). Water Science and Technology Directorate

2009-07-01

This presentation discussed mass spectrometry of oil sands naphthenic acids and the degradation in OSPW and wetland plants. It presented background information on the Athabasca oil sands and naphthenic acids which involve a mixture of alkanes and cycloalkane carboxylic acids with aliphatic side chains. The presentation also discussed mass spectrometry with electrospray operating in negative ion modes. Loop injection, external standard methods and solid phase extraction were reviewed along with improved analysis by removing background ions. Other topics that were presented included hydroponic test systems and wetland plant toxicity, growth and transpiration. It was concluded that dissipation included species containing oxygen, ozone, O{sub 4}, and O{sub 5}. tabs., figs.

Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

International Nuclear Information System (INIS)

Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

1988-01-01

The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

The effect of natural iron oxide and oxalic acid on the photocatalytic degradation of isoproturon: a kinetics and analytical study.

Science.gov (United States)

Boucheloukh, H; Remache, W; Parrino, F; Sehili, T; Mechakra, H

2017-05-17

The photocatalytic degradation of isoproturon, a persistent toxic herbicide, was investigated in the presence of natural iron oxide and oxalic acid and under UV irradiation. The influence of the relevant parameters such as the pH and the iron oxide and oxalic acid concentrations has been studied. The presence of natural iron oxide and oxalic acid in the system effectively allow the degradation of isoproturon, whereas the presence of t-butyl alcohol adversely affects the phototransformation of the target pollutant, thus indicating that an OH radical initiated the degradation mechanism. The degradation mechanism of isoproturon was investigated by means of GC-MS analysis. Oxidation of both the terminal N-(CH 3 ) 2 and isopropyl groups is the initial process leading to N-monodemethylated (NHCH 3 ), N-formyl (N(CH 3 )CHO), and CHCH 3 OH as the main intermediates. The substitution of the isopropyl group by an OH group is also observed as a side process.

Nucleolytic degradation of homologous and heterologous deoxyribonucleic acid molecules at the surface of competent pneumococci

International Nuclear Information System (INIS)

Seto, H.; Lopez, R.; Garrigan, O.; Tomasz, A.

1975-01-01

Competent pneumococci can catalyze the rapid and quantitative degradation of extracellular deoxyribonucleic acid (DNA) molecules through the activity of surface-located nucleases (endo- and, possibly, exonucleases as well). Both homologous and heterologous DNAs are degraded by a mechanism that seems to involve a cyclic process: (i) attachment of DNA to the cell surface followed by (ii) nucleolytic attack, and (iii) release to the medium. Processes (ii) and (iii) are both inhibited by ethylenediaminetetraacetate. Whereas surface nuclease activity is specific for competent cells, the bulk of this activity is not coupled to irreversible DNA uptake (deoxyribonuclease-resistant binding). Pneumococcal DNA treated with ultraviolet irradiation or nitrous acid (cross-linking) is selectively impaired in the ability to irreversibly bind to competent cells, whereas reversible binding is normal. (U.S.)

Degradation of self-compacting concrete (SCC) due to sulfuric acid attack: Experiment investigation on the effect of high volume fly ash content

Science.gov (United States)

Kristiawan, S. A.; Sunarmasto; Tyas, G. P.

2016-02-01

Concrete is susceptible to a variety of chemical attacks. In the sulfuric acid environment, concrete is subjected to a combination of sulfuric and acid attack. This research is aimed to investigate the degradation of self-compacting concrete (SCC) due to sulfuric acid attack based on measurement of compressive strength loss and diameter change. Since the proportion of SCC contains higher cement than that of normal concrete, the vulnerability of this concrete to sulfuric acid attack could be reduced by partial replacement of cement with fly ash at high volume level. The effect of high volume fly ash at 50-70% cement replacement levels on the extent of degradation owing to sulfuric acid will be assessed in this study. It can be shown that an increase in the utilization of fly ash to partially replace cement tends to reduce the degradation as confirmed by less compressive strength loss and diameter change. The effect of fly ash to reduce the degradation of SCC is more pronounced at a later age.

Modification and restriction of T-even bacteriophages. In vitro degradation of deoxyribonucleic acid containing 5-hydroxymethylctosine.

Science.gov (United States)

Fleischman, R A; Cambell, J L; Richardson, C C

1976-03-25

Using the single-stranded circular DNA of bacteriophage fd as template, double-stranded circular DNA has been prepared in vitro with either 5-hydroxymethylcytosine ([hmdC]DNA) or cytosine ([dC]DNA) in the product strand. Extracts prepared from Escherichia coli cells restrictive to T-even phage containing nonglucosylated DNA degrade [hmdC]DNA to acid-soluble material in vitro, but do not degrade [dC]dna. In contrast, extracts prepared from E. coli K12 rglA- rglB-, a strain permissive to T-even phage containing nonglucosylated DNA, do not degrade [hmdC]DNA or [dC]DNA. In addition, glucosylation of the [hmdC]DNA renders it resistant to degradation by extracts from restrictive strains. The conversion of [hmdC]DNA to acid-soluble material in vitro consists of an HmCyt-specific endonucleolytic cleavage requiring the presence of the RglB gene product to form a linear molecule, followed by a non-HmCyt-specific hydrolysis of the linear DNA to acid-soluble fragments, catalyzed in part by exonuclease V. The RglB protein present in extracts of E. coli K12 rglA- rglB+ has been purified 200-fold by complementation with extracts from E. coli K12 rglA- rglB-. The purified RglB protein does not contain detectable HmCyt-specific endonuclease or exonuclease activity. In vitro endonucleolytic cleavage of [hmdC]DNA thus requires additional factors present in cell extracts.

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Polymer Film-Based Screening and Isolation of Polylactic Acid (PLA)-Degrading Microorganisms.

Science.gov (United States)

Kim, Mi Yeon; Kim, Changman; Moon, Jungheun; Heo, Jinhee; Jung, Sokhee P; Kim, Jung Rae

2017-02-28

Polylactic acid (PLA) has been highlighted as an alternative renewable polymer for the replacement of petroleum-based plastic materials, and is considered to be biodegradable. On the other hand, the biodegradation of PLA by terminal degraders, such as microorganisms, requires a lengthy period in the natural environment, and its mechanism is not completely understood. PLA biodegradation studies have been conducted using mainly undefined mixed cultures, but only a few bacterial strains have been isolated and examined. For further characterization of PLA biodegradation, in this study, the PLA-degrading bacteria from digester sludge were isolated and identified using a polymer film-based screening method. The enrichment of sludge on PLA granules was conducted with the serial transference of a subculture into fresh media for 40 days, and the attached biofilm was inoculated on a PLA film on an agar plate. 3D optical microscopy showed that the isolates physically degraded the PLA film due to bacterial degradation. 16S rRNA gene sequencing identified the microbial colonies to be Pseudomonas sp. MYK1 and Bacillus sp. MYK2. The two isolates exhibited significantly higher specific gas production rates from PLA biodegradation compared with that of the initial sludge inoculum.

Ligand-functionalized degradable polyplexes formed by cationic poly(aspartic acid)-grafted chitosan-cyclodextrin conjugates

Science.gov (United States)

Song, Hai-Qing; Li, Rui-Quan; Duan, Shun; Yu, Bingran; Zhao, Hong; Chen, Da-Fu; Xu, Fu-Jian

2015-03-01

Polypeptide-based degradable polyplexes attracted considerable attention in drug delivery systems. Polysaccharides including cyclodextrin (CD), dextran, and chitosan (CS) were readily grafted with cationic poly(aspartic acid)s (PAsps). To further enhance the transfection performances of PAsp-based polyplexes, herein, different types of ligand (folic acid, FA)-functionalized degradable polyplexes were proposed based on the PAsp-grafted chitosan-cyclodextrin conjugate (CCPE), where multiple β-CDs were tied on a CS chain. The FA-functionalized CCPE (i.e., CCPE-FA) was obtained via a host-guest interaction between the CD units of CCPE and the adamantane (Ad) species of Ad-modified FA (Ad-FA). The resulting CCPE/pDNA, CCPE-FA/pDNA, and ternary CCPE-FA/CCPE/pDNA (prepared by layer-by-layer assembly) polyplexes were investigated in detail using different cell lines. The CCPE-based polyplexes displayed much higher transfection efficiencies than the CS-based polyplexes reported earlier by us. The ternary polyplexes of CCPE-FA/CCPE/pDNA produced excellent gene transfection abilities in the folate receptor (FR)-positive tumor cells. This work would provide a promising means to produce highly efficient polyplexes for future gene therapy applications.Polypeptide-based degradable polyplexes attracted considerable attention in drug delivery systems. Polysaccharides including cyclodextrin (CD), dextran, and chitosan (CS) were readily grafted with cationic poly(aspartic acid)s (PAsps). To further enhance the transfection performances of PAsp-based polyplexes, herein, different types of ligand (folic acid, FA)-functionalized degradable polyplexes were proposed based on the PAsp-grafted chitosan-cyclodextrin conjugate (CCPE), where multiple β-CDs were tied on a CS chain. The FA-functionalized CCPE (i.e., CCPE-FA) was obtained via a host-guest interaction between the CD units of CCPE and the adamantane (Ad) species of Ad-modified FA (Ad-FA). The resulting CCPE/pDNA, CCPE

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

Science.gov (United States)

Chowdhury, Nilkanta; Bagchi, Angshuman

2017-07-01

Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

Degradation of unglazed rough graphite-aluminium solar absorber surfaces in simulated acid and neutral rain

International Nuclear Information System (INIS)

Konttinen, P.; Lund, P.D.; Salo, T.

2005-01-01

Degradation mechanisms of unglazed solar absorber surfaces based on aluminium substrate were studied. Rough graphite-aluminium surfaces were total-immersion subjected to aerated and de-aerated simulated neutral and acid rain. Test conditions were based on calculated absorber stagnation temperature and global rain acidity measurements. Changes in optical properties, elemental composition and sample mass were examined by spectrometry, energy dispersive X-ray spectrometry and thermogravimetry, respectively. The absorbers exhibited almost no degradation at pH value of 3.5. At pH 5.5 alumina on the surface hydrated significantly degrading the optical properties of the surfaces severely in most cases. Therefore these absorber surfaces can not be recommended to be used in non-glazed applications if they are exposed to rain with pH exceeding ∼ 3.5-4.5. The total-immersion test needs to be developed further as the test results exhibited poor temperature and time dependency thus preventing accurate service lifetime estimates. Still, these tests were useful in determining favourable and non-favourable operating conditions for the absorber surfaces based on aluminium substrate. (author)

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

Kinetic study of photocatalytic degradation of carbamazepine, clofibric acid, iomeprol and iopromide assisted by different TiO2 materials--determination of intermediates and reaction pathways.

Science.gov (United States)

Doll, Tusnelda E; Frimmel, Fritz H

2004-02-01

The light-induced degradation of clofibric acid, carbamazepine, iomeprol and iopromide under simulated solar irradiation has been investigated in aqueous solutions suspended with different TiO2 materials (P25 and Hombikat UV100). Kinetic studies showed that P25 had a better photocatalytic activity for clofibric acid and carbamazepine than Hombikat UV100. For photocatalytic degradation of iomeprol Hombikat UV100 was more suitable than P25. The results can be explained by the higher adsorption capacity of Hombikat UV100 for iomeprol. The study also focuses on the identification and quantification of possible degradation products. The degradation process was monitored by determination of sum parameters and inorganic ions. In case of clofibric acid various aromatic and aliphatic degradation products have been identified and quantified. A possible multi-step degradation scheme for clofibric acid is proposed. This study proves the high potential of the photocatalytic oxidation process to transform and mineralize environmentally relevant pharmaceuticals and contrast media in water.

The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

Science.gov (United States)

Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

2014-12-01

The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Directory of Open Access Journals (Sweden)

Løvdal Irene S

2012-03-01

Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

Science.gov (United States)

2012-01-01

Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

Performance Degradation Tests of Phosphoric Acid Doped Polybenzimidazole Membrane Based High Temperature Polymer Electrolyte Membrane Fuel Cells

DEFF Research Database (Denmark)

Zhou, Fan; Araya, Samuel Simon; Grigoras, Ionela

2015-01-01

Degradation tests of two phosphoric acid (PA) doped PBI membrane based HT-PEM fuel cells were reported in this paper to investigate the effects of start/stop and the presence of methanol in the fuel to the performance degradation of the HT-PEM fuel cell. Continuous tests with pure dry H2 and meth...

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Scanning electron microscopic study of the hydrolytic degradation of poly(glycolic acid) suture

International Nuclear Information System (INIS)

Chu, C.C.; Campbell, N.D.

1982-01-01

This article reports the morphological observations on the surface changes of poly-(glycolic acid) sutures which have been exposed to various dosages of gamma irradiation (0, 2.5, 5.0, 10, 20 and 40 Mrad) and duration of immersion (0, 7, 14, 28, 48, 60, and 90 days) in a physiological saline buffer. The most important gross morphological characteristics of PGA suture hydrolytic degradation is the formation of surface cracks on the filaments. The regularity of the surface cracks increased with an increase in the gamma irradiation and the duration of hydrolysis. Surface cracks were not observed in irradiated sutures that had not been subjected to hydrolytic degradation. The arrangement of the surface cracks, their orientation on the filaments, and the direction of crack propagation provide very useful information for depicting the mechanism of hydrolytic degradation in this class of fibrous material. The microfibrillar model of fiber structure has been used as the basis for the proposed degradation mechanism of PGA in vitro. It is believed that hydrolysis occurs initially in the amorphous regions sandwiched between two crystalline zones, as tie-chain segments, free chain ends, and chain folds in these regions degrade into fragments. As degradation proceeds, the size of the fragments reaches the stage at which they can be dissolved into the buffer medium. This dissolution removes the fragments from the amorphous regions, and surface cracks appeared

Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

Directory of Open Access Journals (Sweden)

Keyhani Nemat O

2004-06-01

Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

Preparation, Cell Compatibility and Degradability of Collagen-Modified Poly(lactic acid

Directory of Open Access Journals (Sweden)

Miaomiao Cui

2015-01-01

Full Text Available Poly(lactic acid (PLA was modified using collagen through a grafting method to improve its biocompatibility and degradability. The carboxylic group at the open end of PLA was transferred into the reactive acylchlorided group by a reaction with phosphorus pentachloride. Then, collagen-modified PLA (collagen-PLA was prepared by the reaction between the reactive acylchlorided group and amino/hydroxyl groups on collagen. Subsequently, the structure of collagen-PLA was confirmed by Fourier transform infrared spectroscopy, fluorescein isothiocyanate-labeled fluorescence spectroscopy, X-ray photoelectron spectroscopy, and DSC analyses. Finally, some properties of collagen-PLA, such as hydrophilicity, cell compatibility and degradability were characterized. Results showed that collagen had been grafted onto the PLA with 5% graft ratio. Water contact angle and water absorption behavior tests indicated that the hydrophilicity of collagen-PLA was significantly higher than that of PLA. The cell compatibility of collagen-PLA with mouse embryonic fibroblasts (3T3 was also significantly better than PLA in terms of cell morphology and cell proliferation, and the degradability of PLA was also improved after introducing collagen. Results suggested that collagen-PLA was a promising candidate for biomedical applications.

Effect of ultrasonic degradation of hyaluronic acid extracted from rooster comb on antioxidant and antiglycation activities.

Science.gov (United States)

Hafsa, Jawhar; Chaouch, Mohamed Aymen; Charfeddine, Bassem; Rihouey, Christophe; Limem, Khalifa; Le Cerf, Didier; Rouatbi, Sonia; Majdoub, Hatem

2017-12-01

Recently, low-molecular-weight hyaluronic acid (LMWHA) has been reported to have novel features, such as free radical scavenging activities, antioxidant activities and dietary supplements. In this study, hyaluronic acid (HA) was extracted from rooster comb and LMWHA was obtained by ultrasonic degradation in order to assess their antioxidant and antiglycation activities. Molecular weight (Mw) and the content of glucuronic acid (GlcA) were used as the index for comparison of the effect of ultrasonic treatment. The effects on the structure were determined by ultraviolet (UV) spectra and Fourier transform infrared spectra (FTIR). The antioxidant activity was determined by three analytical assays (DPPH, NO and TBARS), and the inhibitory effect against glycated-BSA was also assessed. The GlcA content of HA and LMWHA was estimated at about 48.6% and 47.3%, respectively. The results demonstrate that ultrasonic irradiation decreases the Mw (1090-181 kDa) and intrinsic viscosity (1550-473 mL/g), which indicate the cleavage of the glycosidic bonds. The FTIR and UV spectra did not significantly change before and after degradation. The IC 50 value of HA and LWMHA was 1.43, 0.76 and 0.36 mg/mL and 1.20, 0.89 and 0.17 mg/mL toward DPPH, NO and TBARS, respectively. Likewise LMWHA exhibited significant inhibitory effects on the AGEs formation than HA. The results demonstrated that the ultrasonic irradiation did not damage and change the chemical structure of HA after degradation; furthermore, decreasing Mw and viscosity of LMWHA after degradation may enhance the antioxidant and antiglycation activity.

Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

Science.gov (United States)

Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

2015-05-01

Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

DEFF Research Database (Denmark)

Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

2015-01-01

encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

Effects of Calcium Lignosulfonate and Silicic Acid on Ammonium Nitrate Degradation

Directory of Open Access Journals (Sweden)

Ahmet Ozan Gezerman

2014-01-01

Full Text Available Ammonium nitrate salts are the most commonly used nitrogenous fertilizers in industry. However, storage of ammonium nitrate is problematic, since its initial properties can decline because of environmental factors, leading to large economic losses. In this study, in order to prevent the caking and degradation of ammonium nitrate, an alternative composition with additional calcium lignosulfonate and silicic acid was studied. The resulting fertilizer was analyzed by screening analysis, ion chromatography, and electron microscopy methods.

Bacterial populations and environmental factors controlling cellulose degradation in an acidic Sphagnum peat.

Science.gov (United States)

Pankratov, Timofey A; Ivanova, Anastasia O; Dedysh, Svetlana N; Liesack, Werner

2011-07-01

Northern peatlands represent a major global carbon store harbouring approximately one-third of the global reserves of soil organic carbon. A large proportion of these peatlands consists of acidic Sphagnum-dominated ombrotrophic bogs, which are characterized by extremely low rates of plant debris decomposition. The degradation of cellulose, the major component of Sphagnum-derived litter, was monitored in long-term incubation experiments with acidic (pH 4.0) peat extracts. This process was almost undetectable at 10°C and occurred at low rates at 20°C, while it was significantly accelerated at both temperature regimes by the addition of available nitrogen. Cellulose breakdown was only partially inhibited in the presence of cycloheximide, suggesting that bacteria participated in this process. We aimed to identify these bacteria by a combination of molecular and cultivation approaches and to determine the factors that limit their activity in situ. The indigenous bacterial community in peat was dominated by Alphaproteobacteria and Acidobacteria. The addition of cellulose induced a clear shift in the community structure towards an increase in the relative abundance of the Bacteroidetes. Increasing temperature and nitrogen availability resulted in a selective development of bacteria phylogenetically related to Cytophaga hutchinsonii (94-95% 16S rRNA gene sequence similarity), which densely colonized microfibrils of cellulose. Among isolates obtained from this community only some subdivision 1 Acidobacteria were capable of degrading cellulose, albeit at a very slow rate. These Acidobacteria represent indigenous cellulolytic members of the microbial community in acidic peat and are easily out-competed by Cytophaga-like bacteria under conditions of increased nitrogen availability. Members of the phylum Firmicutes, known to be key players in cellulose degradation in neutral habitats, were not detected in the cellulolytic community enriched at low pH. © 2011 Society for

Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

Science.gov (United States)

Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

2014-01-01

Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Evaluate the role of organic acids in the protection of ligands from radiolytic degradation

Energy Technology Data Exchange (ETDEWEB)

Miller, Anneka [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mezyk, Stehpen [Idaho National Lab. (INL), Idaho Falls, ID (United States); Peterman, Dean [Idaho National Lab. (INL), Idaho Falls, ID (United States)

2016-08-01

In the Advanced TALSPEAK process, the bis(2-ethylhexyl)phosphoric acid (HDEHP) extractant used in the traditional TALSPEAK process is replaced by the extractant 2-ethylhexylphosphonic acid mono-2-ethylhexyl ester (HEH[EHP]). In addition, the aqueous phase complexant and buffer used in traditional TALSPEAK is replaced with the combination of N-(2-hydroxyethyl)ethylenediamine-N,N’,N’-triacetic acid (HEDTA) and citric acid. In order to evaluate the possible impacts of gamma radiolysis upon the efficacy of the Advanced TALSPEAK flowsheet, aqueous and organic phases corresponding to the extraction section of the proposed flowsheet were irradiated in the INL test loop under an ambient atmosphere. The results of these studies conducted at INL, led INL researchers to conclude that the scarcity of values of rate constants for the reaction of hydroxyl radical with the components of the Advanced TALSPEAK process chemistry was severely limiting the interpretation of the results of radiolysis studies performed at the INL. In this work, the rate of reaction of hydroxyl radical with citric acid at several pH values was measured using a competitive pulse radiolysis technique. This report describes those results and is written in completion of milestone M3FT-16IN030102028, the goal of which was to evaluate the role of organic acids in the protection of ligands from radiolytic degradation. The results reported here demonstrate the importance of obtaining hydroxyl radical reaction rate data for the conditions that closely resemble actual solution conditions expected to be used in an actual solvent extraction process. This report describes those results and is written in completion of milestone M3FT-16IN030102028, the goal of which was to evaluate the role of organic acids in the protection of ligands from radiolytic degradation.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Directory of Open Access Journals (Sweden)

Lindblad Peter

2008-04-01

Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

Forced degradation of mometasone furoate and development of two RP-HPLC methods for its determination with formoterol fumarate or salicylic acid

Directory of Open Access Journals (Sweden)

Ramzia I. El-Bagary

2016-05-01

Full Text Available Two simple, selective and precise stability-indicating reversed-phase liquid chromatographic methods were developed and validated for the determination of mometasone furoate in two binary mixtures, with formoterol fumarate (Mixture 1 and salicylic acid (Mixture 2. Also, a forced degradation study of mometasone furoate was carried out including acid and alkali hydrolysis, oxidation, thermal and photo-degradation. For mixture 1, the method was based on isocratic elution using a mobile phase consisting of (Acetonitrile: 3 mM Sodium lauryl sulfate (60:40, v/v at a flow rate of 1 ml min−1. Quantitation was achieved applying dual wavelength detection where mometasone furoate and its degradation products were detected at 247 nm and formoterol fumarate and its degradation product were detected at 214 nm at 30 °C. For mixture 2 and for the forced degradation study, separation was based on isocratic elution of mometasone furoate, its degradation products and salicylic acid on a reversed phase C8 column using a mobile phase consisting of acetonitrile:water:methanol:glacial acetic acid (60:30:10:0.1, v/v at a flow rate of 2 mL min−1. Quantitation was achieved with UV detection at 240 nm. In addition, products from alkaline forced degradation of mometasone furoate were verified by LC–MS. Linearity, accuracy and precision were found to be acceptable over the concentration range of 10–800 μg mL−1 and 5–60 μg mL−1 for mometasone furoate and formoterol fumarate, respectively and over the concentration range of 5–320 μg mL−1 and 20–1280 μg mL−1 for mometasone furoate and salicylic acid, respectively. The two proposed methods could be successfully applied for the routine analysis of the studied drugs in their pharmaceutical preparations without any preliminary separation step.

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

Science.gov (United States)

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

Degradation of microbial polyesters.

Science.gov (United States)

Tokiwa, Yutaka; Calabia, Buenaventurada P

2004-08-01

Microbial polyhydroxyalkanoates (PHAs), one of the largest groups of thermoplastic polyesters are receiving much attention as biodegradable substitutes for non-degradable plastics. Poly(D-3-hydroxybutyrate) (PHB) is the most ubiquitous and most intensively studied PHA. Microorganisms degrading these polyesters are widely distributed in various environments. Although various PHB-degrading microorganisms and PHB depolymerases have been studied and characterized, there are still many groups of microorganisms and enzymes with varying properties awaiting various applications. Distributions of PHB-degrading microorganisms, factors affecting the biodegradability of PHB, and microbial and enzymatic degradation of PHB are discussed in this review. We also propose an application of a new isolated, thermophilic PHB-degrading microorganism, Streptomyces strain MG, for producing pure monomers of PHA and useful chemicals, including D-3-hydroxycarboxylic acids such as D-3-hydroxybutyric acid, by enzymatic degradation of PHB.

Co-Metabolic Degradation of β-Cypermethrin and 3-Phenoxybenzoic Acid by Co-Culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4.

Science.gov (United States)

Zhao, Jiayuan; Chi, Yuanlong; Xu, Yingchao; Jia, Dongying; Yao, Kai

2016-01-01

The degradation efficiency of organic contaminants and their associated metabolites by co-culture of microbes is mainly limited by toxic intermediates from co-metabolic degradation. In this study, we investigated the degradation of β-cypermethrin (β-CY) and 3-phenoxybenzoic acid (3-PBA) by co-culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4, as well as the influences of β-CY and 3-PBA metabolites on their degradation and the growth of strains B-1 and M-4. Our results indicated that 100 mg/L β-CY was degraded by 78.85%, and 3-PBA concentration was 0.05 mg/L after 72 h. Compared with using only strain B-1, the half-life (t1/2) of β-CY by using the two strains together was shortened from 84.53 h to 38.54 h, and the yield coefficient of 3-PBA was decreased from 0.846 to 0.001. At 100 mg/L of 3-PBA and gallic acid, β-CY and 3-PBA degradation were only 17.68% and 40.45%, respectively. As the toxic intermediate derived from co-metabolic degradation of β-CY by strain B-1, 3-PBA was efficiently degraded by strain M-4, and gallic acid, as the toxic intermediate from co-metabolic degradation of 3-PBA by strain M-4, was efficiently degraded by strain B-1. These results provided a promising approach for efficient biodegradation of β-CY and 3-PBA.

Co-Metabolic Degradation of β-Cypermethrin and 3-Phenoxybenzoic Acid by Co-Culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4.

Directory of Open Access Journals (Sweden)

Jiayuan Zhao

Full Text Available The degradation efficiency of organic contaminants and their associated metabolites by co-culture of microbes is mainly limited by toxic intermediates from co-metabolic degradation. In this study, we investigated the degradation of β-cypermethrin (β-CY and 3-phenoxybenzoic acid (3-PBA by co-culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4, as well as the influences of β-CY and 3-PBA metabolites on their degradation and the growth of strains B-1 and M-4. Our results indicated that 100 mg/L β-CY was degraded by 78.85%, and 3-PBA concentration was 0.05 mg/L after 72 h. Compared with using only strain B-1, the half-life (t1/2 of β-CY by using the two strains together was shortened from 84.53 h to 38.54 h, and the yield coefficient of 3-PBA was decreased from 0.846 to 0.001. At 100 mg/L of 3-PBA and gallic acid, β-CY and 3-PBA degradation were only 17.68% and 40.45%, respectively. As the toxic intermediate derived from co-metabolic degradation of β-CY by strain B-1, 3-PBA was efficiently degraded by strain M-4, and gallic acid, as the toxic intermediate from co-metabolic degradation of 3-PBA by strain M-4, was efficiently degraded by strain B-1. These results provided a promising approach for efficient biodegradation of β-CY and 3-PBA.

Influence of humic acid addition on the degradation of pharmaceuticals by biofilms in effluent wastewater

DEFF Research Database (Denmark)

Tang, Kai; Escola Casas, Monica; Ooi, Gordon Tze Hoong

2017-01-01

in relation to the biodegradation of pharmaceuticals by suspended biofilm carriers adapted to polishing effluent water from a tertiary sewage treatment plant. Twelve out of 22 investigated pharmaceuticals were significantly biodegradable. The biodegradation rate constants of ten of those compounds were......The degradation of organic micropollutants in wastewater treatment is suspected to depend on co-degradation i.e. be dependent on concentrations of substrate. This complicates predicting and modelling their fate. The effect of humic acid, as a model for complex organic substrate, was investigated...

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

DENTINE CARIES: ACID-TOLERANT MICROORGANISMS AND ASPECTS ON COLLAGEN DEGRADATION.

Science.gov (United States)

Lager, Anders Hedenbjörk

2014-01-01

Dental caries is a common disease all over the world, despite the fact that it can be both effectively prevented and treated. It is driven by acids produced by oral microorganisms as a consequence of their metabolism of dietary carbohydrates. Given enough acid challenge, eventually the tooth enamel barrier will be broken down, and the carious lesion will extend into underlying hard tissue, forming a macroscopic cavity in the dentine. In comparison to biofilm on enamel, a dentine carious lesion provides a vastly different environment for the residing microorganisms. The environment influences the types and numbers of microorganisms that can colonize the dentine caries lesion. The overall aims for this thesis are to enumerate and further study microorganisms found in established dentine caries lesions and also to illuminate how host-derived proteolytic enzymes might contribute to this degradation, not only to better understand the caries process in dentine but also to find incitements for new methods to influence the natural progression of caries lesions. In Paper I, the numbers of remaining viable microorganisms after completed excavation using two excavation methods were investigated. Samples of carious dentine tissue were collected before and after excavation and cultivated on different agar media in different atmospheres. Analysis was performed by counting the number of colony-forming units (CFUs). Key findings: The number of remaining microorganisms after excavation was low for both methods, but some microorganisms always remained in the cavity floors even when the cavities were judged as caries free using normal clinical criteria. In Paper II, the acid tolerant microbiota in established dentine caries lesions was investigated. Samples were taken as in Paper I, but on three levels (superficial, center of lesion, floor of lesion after completed excavation). The samples were cultivated in anaerobic conditions on solid pH-selective agar media of different acidity

Strecker degradation of amino acids promoted by a camphor-derived sulfonamide

Directory of Open Access Journals (Sweden)

M. Fernanda N. N. Carvalho

2016-04-01

Full Text Available A camphor-derived sulfonimine with a conjugated carbonyl group, oxoimine 1 (O2SNC10H13O, reacts with amino acids (glycine, L-alanine, L-phenylalanine, L-leucine to form a compound O2SNC10H13NC10H14NSO2 (2 which was characterized by spectroscopic means (MS and NMR and supported by DFT calculations. The product, a single diastereoisomer, contains two oxoimine units connected by a –N= bridge, and thus has a structural analogy to the colored product Ruhemann´s purple obtained by the ninhydrin reaction with amino acids. A plausible reaction mechanism that involves zwitterions, a Strecker degradation of an intermediate imine and water-catalyzed tautomerizations was developed by means of DFT calculations on potential transition states.

Kinetics of degradation of ascorbic acid by cyclic voltammetry method

Directory of Open Access Journals (Sweden)

Grudić Veselinka V.

2015-01-01

Full Text Available Cyclic voltammetry was used to examine the kinetics of degradation of ascorbic acid (AA at different temperatures. It has been shown that the reduction of the concentration of AA in all temperatures follow the kinetics of the first order reaction. The rate constant of the oxidation reaction increases with temperature as follows: 5x10-5; 2x10-4; 1x10-3 and 3x10-3 min-1 at temperatures of 25°C, 35°C, 65°C and 90°C, respectively. The temperature dependence of the rate constant follows Arrhenius equation, and the value of activation energy of the reaction degradation is 48.2 kJ mol-1 . The effect of storage time at a temperature of 90 °C on AA content in fresh juice of green peppers was investigated. It was shown that AA oxidation reaction in the juice is also the first order reaction, while the lower rate constant in relation to the pure AA (5x10-3 min-1 indicates the influence of other substances present in peppers.

The effect of structure and a secondary carbon source on the microbial degradation of chlorophenoxy acids.

Science.gov (United States)

Evangelista, S; Cooper, D G; Yargeau, V

2010-05-01

Pseudomonas putida, Aspergillus niger, Bacillus subtilis, Pseudomonas fluorescens, Sphingomonas herbicidovorans and Rhodococcus rhodochrous growing on glucose in a medium containing one of three chlorophenoxy acids at a concentration of 0.1 g L(-1) (clofibric acid, (R)-2-(4-chloro-2-methylphenoxy)propionic acid (mecoprop or MCPP) and 4-chloro-2-methylphenoxyacetic acid (MCPA)) degraded these compounds to varying degrees; from nonmeasurable to almost complete removal. These results with the addition of glucose (2.5 g L(-1)) as an easy to use carbon source indicated the formation of metabolites different from results reported in the literature for growth studies in which the chlorophenoxy acid was the sole carbon source. The metabolite, 4-chloro-2-methylphenol, which had been reported previously, was only observed in trace amounts for MCPP and MCPA in the presence of S. herbicidovorans and glucose. In addition, three other compounds (M1, M3 and M4) were observed. It is suggested that these unidentified metabolites resulted from ring opening of the metabolite 4-chloro-2-methylphenol (M2). The rate of biodegradation of the chlorophenoxy acids was influenced by the degree of steric hindrance adjacent to the internal oxygen bond common to all three compounds. The most hindered compound, clofibric acid, was converted to ethyl clofibrate by R. rhodochrous but was not degraded by any microorganisms studied. The more accessible internal oxygen bonds of the other two chlorophenoxy acids, MCPP and MCPA, were readily broken by S. herbicidovorans. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

The effect of stochasticity on the lac operon: an evolutionary perspective.

Directory of Open Access Journals (Sweden)

Milan van Hoek

2007-06-01

Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

Degradation of thin poly(lactic acid) films: Characterization by capacitance–voltage, atomic force microscopy, scanning electron microscopy and contact-angle measurements

International Nuclear Information System (INIS)

Schusser, S.; Menzel, S.; Bäcker, M.; Leinhos, M.; Poghossian, A.; Wagner, P.; Schöning, M.J.

2013-01-01

For the development of new biopolymers and implantable biomedical devices with predicted biodegradability, simple, non-destructive, fast and inexpensive techniques capable for real-time in situ testing of the degradation kinetics of polymers are highly appreciated. In this work, a capacitive field-effect electrolyte–insulator–semiconductor (EIS) sensor has been applied for real-time in situ monitoring of degradation of thin poly(D,L-lactic acid) (PDLLA) films over a long-time period of one month. Generally, the polymer-modified EIS (PMEIS) sensor is capable of detecting any changes in the bulk, surface and interface properties of the polymer (e.g., thickness, coverage, dielectric constant, surface potential) induced by degradation processes. The time-dependent capacitance–voltage (C–V) characteristics of PMEIS structures were used as an indicator of the polymer degradation. To accelerate the PDLLA degradation, experiments were performed in alkaline buffer solution of pH 10.6. The results of these degradation measurements with the EIS sensor were verified by the detection of lactic acid (product of the PDLLA degradation) in the degradation medium. In addition, the micro-structural and morphological changes of the polymer surface induced by the polymer degradation have been systematically studied by means of scanning-electron microscopy, atomic-force microscopy, optical microscopy, and contact-angle measurements

Mechanism for enhanced degradation of clofibric acid in aqueous by catalytic ozonation over MnOx/SBA-15

International Nuclear Information System (INIS)

Sun, Qiangqiang; Wang, Yu; Li, Laisheng; Bing, Jishuai; Wang, Yingxin; Yan, Huihua

2015-01-01

Highlights: • Clofibric acid (CA) is efficiently mineralized by O 3 /MnO x /SBA-15. • Adsorption of CA and its intermediates on MnO x /SBA-15 is proved unimportant. • Initiation of hydroxyl radicals (·OH) is enhanced in O 3 /MnO x /SBA-15. • Uniformly distributed MnO x accounts for the high activity of MnO x /SBA-15. • Degradation routes of CA in ozonation alone and catalytic ozonation are proposed. - Abstract: Comparative experiments were conducted to investigate the catalytic ability of MnO x /SBA-15 for the ozonation of clofibric acid (CA) and its reaction mechanism. Compared with ozonation alone, the degradation of CA was barely enhanced, while the removal of TOC was significantly improved by catalytic ozonation (O 3 /MnO x /SBA-15). Adsorption of CA and its intermediates by MnO x /SBA-15 was proved unimportant in O 3 /MnO x /SBA-15 due to the insignificant adsorption of CA and little TOC variation after ceasing ozone in stopped-flow experiment. The more remarkably inhibition effect of sodium bisulfite (NaHSO 3 ) on the removal of TOC in catalytic ozonation than in ozonation alone elucidated that MnO x /SBA-15 facilitated the generation of hydroxyl radicals (·OH), which was further verified by electron spin-resonance spectroscopy (ESR). Highly dispersed MnO x on SBA-15 were believed to be the main active component in MnO x /SBA-15. Some intermediates were indentified and different degradation routes of CA were proposed in both ozonation alone and catalytic ozonation. The amounts of small molecular carboxylic acids (i.e., formic acid (FA), acetic acid (AA) and oxalic acid (OA)) generated in catalytic ozonation were lower than in ozonation alone, resulting from the generation of more ·OH

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

Science.gov (United States)

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

A STUDY ON THE DEGRADATION MECHANISM OF PHOTOCROSSLINKING PRODUCTS FORMED BY CYCLIZED POLYISOPRENE-DIAZIDE SYSTEM UNDER THE INFLUENCE OF ALKYL BENZENE SULFONIC ACIDS

Institute of Scientific and Technical Information of China (English)

HUANG Junlian; SUN Meng

1989-01-01

The degradation mechanism of photocrosslinking products formed by cyclized polyisoprene-diazide system under the influence of the different alkyl benzene sulfonic acids was studied. The effects ofalkyl chain length and the concentration of alkyl benzene sulfonic acids on the rate of degradation reaction were discussed. It was found that in the initial stage of degradation, the cyclicity ratio and the average fused ring number did not change considerably, but the percentage of uncyclized parts content varied significantly. The suitable mechanism was supposed.

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

Characterization and Genome Analysis of a Nicotine and Nicotinic Acid-Degrading Strain Pseudomonas putida JQ581 Isolated from Marine.

Science.gov (United States)

Li, Aiwen; Qiu, Jiguo; Chen, Dongzhi; Ye, Jiexu; Wang, Yuhong; Tong, Lu; Jiang, Jiandong; Chen, Jianmeng

2017-05-31

The presence of nicotine and nicotinic acid (NA) in the marine environment has caused great harm to human health and the natural environment. Therefore, there is an urgent need to use efficient and economical methods to remove such pollutants from the environment. In this study, a nicotine and NA-degrading bacterium-strain JQ581-was isolated from sediment from the East China Sea and identified as a member of Pseudomonas putida based on morphology, physio-biochemical characteristics, and 16S rDNA gene analysis. The relationship between growth and nicotine/NA degradation suggested that strain JQ581 was a good candidate for applications in the bioaugmentation treatment of nicotine/NA contamination. The degradation intermediates of nicotine are pseudooxynicotine (PN) and 3-succinoyl-pyridine (SP) based on UV, high performance liquid chromatography, and liquid chromatography-mass spectrometry analyses. However, 6-hydroxy-3-succinoyl-pyridine (HSP) was not detected. NA degradation intermediates were identified as 6-hydroxynicotinic acid (6HNA). The whole genome of strain JQ581 was sequenced and analyzed. Genome sequence analysis revealed that strain JQ581 contained the gene clusters for nicotine and NA degradation. This is the first report where a marine-derived Pseudomonas strain had the ability to degrade nicotine and NA simultaneously.

Effects of poly(L-lactide-ε-caprolactone) and magnesium hydroxide additives on physico-mechanical properties and degradation of poly(L-lactic acid).

Science.gov (United States)

Kang, Eun Young; Lih, Eugene; Kim, Ik Hwan; Joung, Yoon Ki; Han, Dong Keun

2016-01-01

Biodegradable poly(L-lactic acid) (PLLA) is one of the most widely used polymer in biomedical devices, but it still has limitations such as inherent brittleness and acidic degradation products. In this work, PLLA blends with poly(L-lactide-ε-caprolactone) (PLCL) and Mg(OH)2 were prepared by the thermal processing to improve their physico-mechanical and thermal properties. In addition, the neutralizing effect of Mg(OH)2 was evaluated by degradation study. The elongation of PLLA remarkably increased from 3 to 164.4 % and the glass transition temperature (Tg) of PLLA was slightly reduced from 61 to 52 °C by adding PLCL additive. Mg(OH)2 in polymeric matrix not only improved the molecular weight reduction and mechanical strength of PLLA, but also neutralized the acidic byproducts generated during polyester degradation. Therefore, the results demonstrated that the presence of PLCL and Mg(OH)2 additives in PLLA matrix could prevent the thermal decomposition and control degradation behavior of polyester.

Oxidation of 2,4-dichlorophenoxyacetic acid by ionizing radiation: degradation, detoxification and mineralization

Energy Technology Data Exchange (ETDEWEB)

Zona, Robert; Solar, Sonja E-mail: sonja.solar@univie.ac.at

2003-02-01

The gamma-radiation-induced degradation of 2,4-dichlorophenoxyacetic acid (2,4-D) was studied in aerated (A) and in during irradiation air saturated (AS) solutions. Whereas the decomposition rates were not influenced by AS, chloride elimination, detoxification as well as mineralization were significantly enhanced. In the range 50-500 {mu}mol dm{sup -3} 2,4-D, degradation showed proportionality to concentration, while chloride formation was successively retarded. The ratios of the pseudo first-order rate constants for degradation and chloride formation, k{sub de}/k{sub Cl}, increase in AS solutions from 1.4 (50 {mu}mol dm{sup -3}) to 2.7 (500 {mu}mol dm{sup -3}) and in A solutions from 1.4 to 3.3. In AS for total chloride release 0.7 kGy (50 {mu}mol dm{sup -3}) to 10 kGy (500 {mu}mol dm{sup -3}) were required, the reduction of organic carbon at 10 kGy was 95% (50 {mu}mol dm{sup -3}) and 50% (500 {mu}mol dm{sup -3}). Increase and decrease of toxicity during irradiation correlated well with formation and degradation of intermediate phenolic products. The doses for detoxification corresponded to those of total dehalogenation. The oxygen uptake was {approx}1.1 ppm 100 Gy{sup -1}. The presence of the inorganic components of Vienna drinking water affect the degradation parameters insignificantly.

Isolation and lipid degradation profile of Raoultella planticola strain 232-2 capable of efficiently catabolizing edible oils under acidic conditions.

Science.gov (United States)

Sugimori, Daisuke; Watanabe, Mika; Utsue, Tomohiro

2013-01-01

The lipids (fats and oils) degradation capabilities of soil microorganisms were investigated for possible application in treatment of lipids-contaminated wastewater. We isolated a strain of the bacterium Raoultella planticola strain 232-2 that is capable of efficiently catabolizing lipids under acidic conditions such as in grease traps in restaurants and food processing plants. The strain 232-2 efficiently catabolized a mixture (mixed lipids) of commercial vegetable oil, lard, and beef tallow (1:1:1, w/w/w) at 20-35 °C, pH 3-9, and 1,000-5,000 ppm lipid content. Highly effective degradation rate was observed at 35 °C and pH 4.0, and the 24-h degradation rate was 62.5 ± 10.5 % for 3,000 ppm mixed lipids. The 24-h degradation rate for 3,000 ppm commercial vegetable oil, lard, beef tallow, mixed lipids, and oleic acid was 71.8 %, 58.7 %, 56.1 %, 55.3 ± 8.5 %, and 91.9 % at pH 4 and 30 °C, respectively. R. planticola NBRC14939 (type strain) was also able to efficiently catabolize the lipids after repeated subculturing. The composition of the culture medium strongly influenced the degradation efficiency, with yeast extract supporting more complete dissimilation than BactoPeptone or beef extract. The acid tolerance of strain 232-2 is proposed to result from neutralization of the culture medium by urease-mediated decomposition of urea to NH(3). The rate of lipids degradation increased with the rates of neutralization and cell growth. Efficient lipids degradation using strain 232-2 has been achieved in the batch treatment of a restaurant wastewater.

Degradation of acetic acid with sulfate radical generated by persulfate ions photolysis.

Science.gov (United States)

Criquet, Justine; Leitner, Nathalie Karpel Vel

2009-09-01

The photolysis of S(2)O(8)(2-) was studied for the removal of acetic acid in aqueous solution and compared with the H(2)O(2)/UV system. The SO(4)(-) radicals generated from the UV irradiation of S(2)O(8)(2-) ions yield a greater mineralization of acetic acid than the ()OH radicals. Acetic acid is oxidized by SO(4)(-) radicals without significant formation of intermediate by-products. Increasing system pH results in the formation of ()OH radicals from SO(4)(-) radicals. Maximum acetic acid degradation occurred at pH 5. The results suggest that above this pH, competitive reactions with the carbon mineralized inhibit the reaction of the solute with SO(4)(-) and also ()OH radicals. Scavenging effects of two naturally occurring ions were tested; in contrast to HCO(3)(-) ions, the presence of Cl(-) ions enhances the efficiency of the S(2)O(8)(2-)/UV process towards the acetate removal. It is attributed to the formation of the Cl() radical and its great reactivity towards acetate.

Degradation mechanisms of poly (lactic-co-glycolic acid) films in vitro under static and dynamic environment

Institute of Scientific and Technical Information of China (English)

HUANG Ying-ying; QI Min; ZHANG Meng; LIU Hong-ze; YANG Da-zhi

2006-01-01

To understand their degradation mechanisms,PLGA (50:50) polymer films were prepared and eroded in the static and dynamic medium system. The degradation behavior was characterized through weight-average molecular weight change,mass loss,water uptake,etc. The results show that in dynamic system,significant mass loss begins until 10 d while mass loss does not begin until 30 d later,while weight-average molecular weight decreases observably at the beginning,and the appeasable mass loss happens in 20 d in static system,which suggests that the dynamic degradation rate is slower even than degradation in static medium. A mechanism was proposed that specimens in static medium take up water homogeneously and cause the polymer chains to degrade all over the specimen cross sections,which creates free carboxylic acid groups which lead to a decrease of pH value inside the swollen polymer and accelerate degradation of the polymer. While pH value inside polymer keeps constant in dynamic medium because of flowing of simulated medium,which make the hydrolytic cleavage of ester bonds inside specimen delayed.

Diurnal variation in degradation of phytic acid by plant phytase in the pig stomach

NARCIS (Netherlands)

Kemme, P.A.; Jongbloed, A.W.; Mroz, Z.; Beynen, A.C.

1998-01-01

The effects of plant phytase on the gastric degradation of phytic acid and digestibilities of DM and P, and their diurnal variation were evaluated in pigs from 90 to 115 kg BW fitted with simple duodenal T-cannulas. Three diets were fed to three pigs in four collection periods according to a

Structural Characterization of the Degradation Products of a Minor Natural Sweet Diterpene Glycoside Rebaudioside M under Acidic Conditions

Directory of Open Access Journals (Sweden)

Indra Prakash

2014-01-01

Full Text Available Degradation of rebaudioside M, a minor sweet component of Stevia rebaudiana Bertoni, under conditions that simulated extreme pH and temperature conditions has been studied. Thus, rebaudioside M was treated with 0.1 M phosphoric acid solution (pH 2.0 and 80 °C temperature for 24 h. Experimental results indicated that rebaudioside M under low pH and higher temperature yielded three minor degradation compounds, whose structural characterization was performed on the basis of 1D (1H-, 13C- & 2D (COSY, HSQC, HMBC NMR, HRMS, MS/MS spectral data as well as enzymatic and acid hydrolysis studies.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae

Science.gov (United States)

Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene...

Enantiomeric fractioning, degradation and metabolite formation of Mecoprop in subsoils with a phenoxy acid contamination history

DEFF Research Database (Denmark)

Frkova, Zuzana; Johansen, Anders; Karlson, Ulrich G.

2015-01-01

for their ability to degrade mecoprop under natural and amended conditions. Degradation of mecoprop was studied at elevated and environmentally relevant mecoprop concentrations as affected by nitrate and glucose at nitrate-reducing conditions and at a presence of oxygen (mimicking purging the soil with air. Results......As persistence and toxicity of the enantiomers of chiral pesticides are different a more comprehensive understanding of the fate of enantiomers of agrochemicals in the environment is necessary. Subsoils sampled vertically (2.5-6 m) at a site with a history of phenoxy acid contamination were used...... and enantioselectivity. Glucose hinders mecoprop degradation and changes the EF. Changing EF confirmed enzymatic dgradation of mecoprop in soils, which was well interpreted using the Michaelis-Menten kinetic model. The highest mecoprop degradation rate was measured in soils incubated at nitrate-reducing conditions...

Analysis and detection of the herbicides dimethenamid and flufenacet and their sulfonic and oxanilic acid degradates in natural water

Science.gov (United States)

Zimmerman, L.R.; Schneider, R.J.; Thurman, E.M.

2002-01-01

Dimethenamid [2-chloro-N-(2,4-dimethyl-3-thienyl)-N-(2-methoxy-1-methylethyl)acetamide] and flufenacet [N-(4-fluorophenyl)-N-(1-methylethyl)-2-(5-(trifluoromethyl)-1,3,4- thiadiazol-2-yl)oxy] were isolated by C-18 solid-phase extraction and separated from their ethanesulfonic acid (ESA) and oxanilic acid (OXA) degradates during their elution using ethyl acetate for the parent compound, followed by methanol for the polar degradates. The parent compounds were detected using gas chromatography-mass spectrometry in selected-ion mode. The ESA and OXA degradates were detected using high-performance liquid chromatography-electrospray mass spectrometry (HPLC-ESPMS) in negative-ion mode. The method detection limits for a 123-mL sample ranged from 0.01 to 0.07 μg/L. These methods are compatible with existing methods and thus allow for analysis of 17 commonly used herbicides and 18 of their degradation compounds with one extraction. In a study of herbicide transport near the mouth of the Mississippi River during 1999 and 2000, dimethenamid and its ESA and OXA degradates were detected in surface water samples during the annual spring flushes. For flufenacet, the only detections at the study site were for the ESA degradates in samples collected at the peak of the herbicide spring flush in 2000. The low frequency of detections in surface water likely is due to dimethenamid and flufenacet being relatively new herbicides. In addition, detectable amounts of the stable degradates have not been detected in ground water.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Mechanism of azo dye degradation in Advanced Oxidation Processes: Degradation of Sulfanilic Acid Azochromotrop and its parent compounds in aqueous solution by ionizing radiation

International Nuclear Information System (INIS)

Palfi, Tamas; Wojnarovits, Laszlo; Takacs, Erzsebet

2011-01-01

Mechanistic studies were made on hydroxyl radical and hydrated electron reaction with Sulfanilic Acid Azochromotrop (SPADNS) as model azo dye in dilute aqueous solution. SPADNS contains 4,5-dihydroxynaphthalene-2,7-disulfonic acid part and 4-sulfophenylazo group. To establish the details of the reaction mechanism the reactions of two simpler molecules without 4-sulfophenylazo part were also studied: one of them contained one (in position 4, II), the other two (in positions 4 and 5, III) -OH groups. Hydroxyl radicals react with these molecules with radical addition to the naphthalene-2,7-disulfonic acid part. The adduct hydroxycyclohexadienyl type radical decays in radical-radical reactions, or undergoes a (pH dependent) water elimination to yield naphthoxy radical. The radical decay takes place on the ms timescale. Degradation efficiencies are 0.6-0.8. Hydrated electron in the case of the two simpler molecules reacts with the rings, while in the case of dye with the azo bond. Electron scavenging is followed by protonation, this reaction in the case of II and III yields cyclohexadienyl, while with the dye hydrazo radical. The efficiency of degradation with II and III is 0.2-0.6, while for SPADNS it is close to 1.

Photocatalytic degradation of perfluorooctanoic acid with beta-Ga2O3 in anoxic aqueous solution.

Science.gov (United States)

Zhao, Baoxiu; Lv, Mou; Zhou, Li

2012-01-01

Perfluorooctanoic acid (PFOA) is a new-found hazardous persistent organic pollutant, and it is resistant to decomposition by hydroxyl radical (HO*) due to its stable chemical structure and the high electronegativity of fluorine. Photocatalytic reduction of PFOA with beta-Ga2O3 in anoxic aqueous solution was investigated for the first time, and the results showed that the photoinduced electron (e(cb-)) coming from the beta-Ga2O3 conduction band was the major degradation substance for PFOA, and shorter-chain perfluorinated carboxylic acids (PFCAs, CnF2n+i1COOH, 1 < or = n < or = 6) were the dominant products. Furthermore, the concentration of F- was measured by the IC technique and defluorination efficiency was calculated. After 3 hr, the photocatalytic degradation efficiency was 98.8% and defluorination efficiency was 31.6% in the presence of thiosulfate and bubbling N2. The degradation reaction followed first-order kinetics (k = 0.0239 min(-1), t1/2 = 0.48 hr). PFCAs (CnF2n+1COOH, 1 < or = n < or = 7) were detected and measured by LC-MS and LC-MS/MS methods. It was deduced that the probable photocatalytic degradation mechanism involves e(cb-) attacking the carboxyl of CnF2n+1COOH, resulting in decarboxylation and the generation of CnF2n+1*. The produced CnF2n+1* reacted with H2O, forming CnF2n+1OH, then CnF2n+1OH underwent HF loss and hydrolysis to form CnF2n+1COOH.

Mutational Analysis of the Escherichia coli melR Gene Suggests a Two-State Concerted Model To Explain Transcriptional Activation and Repression in the Melibiose Operon

OpenAIRE

Kahramanoglou, Christina; Webster, Christine L.; el-Robh, Mohamed Samir; Belyaeva, Tamara A.; Busby, Stephen J. W.

2006-01-01

Transcription of the Escherichia coli melAB operon is regulated by the MelR protein, an AraC family member whose activity is modulated by the binding of melibiose. In the absence of melibiose, MelR is unable to activate the melAB promoter but autoregulates its own expression by repressing the melR promoter. Melibiose triggers MelR-dependent activation of the melAB promoter and relieves MelR-dependent repression of the melR promoter. Twenty-nine single amino acid substitutions in MelR that res...

Pretreatment of lignocellulosic material with fungi capable of higher lignin degradation and lower carbohydrate degradation improves substrate acid hydrolysis and the eventual conversion to ethanol.

Science.gov (United States)

Kuhar, Sarika; Nair, Lavanya M; Kuhad, Ramesh Chander

2008-04-01

Phanerochaete chrysosporium, Pycnoporus cinnabarinus,and fungal isolates RCK-1 and RCK-3 were tested for their lignin degradation abilities when grown on wheat straw (WS) and Prosopis juliflora (PJ) under solid-state cultivation conditions. Fungal isolate RCK-1 degraded more lignin in WS (12.26% and 22.64%) and PJ (19.30% and 21.97%) and less holocellulose in WS (6.27% and 9.39%) and PJ (3.01% and 4.58%) after 10 and 20 days, respectively, than other fungi tested. Phanerochaete chrysosporium caused higher substrate mass loss and degraded more of holocellulosic content (WS: 55.67%; PJ: 48.89%) than lignin (WS: 18.89%; PJ: 20.20%) after 20 days. The fungal pretreatment of WS and PJ with a high-lignin-degrading and low-holocellulose-degrading fungus (fungal isolate RCK-1) for 10 days resulted in (i) reduction in acid load for hydrolysis of structural polysaccharides (from 3.5% to 2.5% in WS and from 4.5% to 2.5% in PJ), (ii) an increase in the release of fermentable sugars (from 30.27 to 40.82 g L(-1) in WS and from 18.18 to 26.00 g L(-1) in PJ), and (iii) a reduction in fermentation inhibitors (total phenolics) in acid hydrolysate of WS (from 1.31 to 0.63 g L(-1)) and PJ (from 2.05 to 0.80 g L(-1)). Ethanol yield and volumetric productivity from RCK-1-treated WS (0.48 g g(-1) and 0.54 g L(-1) h(-1), respectively) and PJ (0.46 g g(-1) and 0.33 g L(-1) h(-1), respectively) were higher than untreated WS (0.36 g g(-1) and 0.30 g L(-1) h(-1), respectively) and untreated PJ (0.42 g g(-1) and 0.21 g L(-1) h(-1), respectively).

Brucella abortus ure2 region contains an acid-activated urea transporter and a nickel transport system

Directory of Open Access Journals (Sweden)

García-Lobo Juan M

2010-04-01

Full Text Available Abstract Background Urease is a virulence factor that plays a role in the resistance of Brucella to low pH conditions, both in vivo and in vitro. Brucella contains two separate urease gene clusters, ure1 and ure2. Although only ure1 codes for an active urease, ure2 is also transcribed, but its contribution to Brucella biology is unknown. Results Re-examination of the ure2 locus showed that the operon includes five genes downstream of ureABCEFGDT that are orthologs to a nikKMLQO cluster encoding an ECF-type transport system for nickel. ureT and nikO mutants were constructed and analyzed for urease activity and acid resistance. A non-polar ureT mutant was unaffected in urease activity at neutral pH but showed a significantly decreased activity at acidic pH. It also showed a decreased survival rate to pH 2 at low concentration of urea when compared to the wild type. The nikO mutant had decreased urease activity and acid resistance at all urea concentrations tested, and this phenotype could be reverted by the addition of nickel to the growth medium. Conclusions Based on these results, we concluded that the operon ure2 codes for an acid-activated urea transporter and a nickel transporter necessary for the maximal activity of the urease whose structural subunits are encoded exclusively by the genes in the ure1 operon.

Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

Directory of Open Access Journals (Sweden)

T Sabari Sankar

2009-03-01

Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

The effect of different clays on the structure, morphology and degradation behavior of poly(lactic acid)

CSIR Research Space (South Africa)

Neppalli, R

2014-01-01

Full Text Available In this work, polylactic acid (PLA)-based nanocomposites filled with different kinds of clay were prepared and their structure, morphology and degradation behavior were compared. A similar degree of dispersion was achieved in the case of cationic...

Application of Sonocatalyst and Sonophotocatalyst for Degradation of Acid Red 14 in Aqueous Environment

Directory of Open Access Journals (Sweden)

Aref Shokri

2016-09-01

Full Text Available Background & Aims of the Study: Azo dyes are employed in industrial processes such as textile industry to create large quantities of colored sewages that have organic and non-organic materials. So, remediation of them is essential. In this project, degradation and mineralization of Acid red 14 (AR14 that is a mono Azo dye and widely used in the textile industries was investigated by Sonocatalysis and Sono photo catalyst in the presence of homogeneous (Fe3+ photo catalyst. Materials & Methods: This study is an experimental investigation on a laboratory scale. The study performed on synthetic wastewater that hold Acid red 14.The influence of operational parameters such as initial dye concentration and ultrasonic power on the sonochemical degradation was also studied. The optimization of variables was done by one factor at a time method. Results: The efficiency of the Sonophotocatalytic process with Fe3+ was higher than Sonocatalysis and photo catalyst processes alone. The combination of sonolysis, Fe3+ and  photo catalyst caused a highly synergistic effect and the synergy index obtained for Fe3+ Sono photo catalysis was 2.05. Chemical oxygen demand (COD analysis was used to study the degree of mineralization. After 180 min of reaction, the removal of COD was 15, 25.4 and 55.5% for UV/Fe3+, US/Fe3+ and UV/US/Fe3+ process, respectively. The degradation by photocatalysis and sonolysis followed pseudo first-order with respect to the concentration of AR14. Conclusions: The results showed that the Sono photo catalytic degradation and mineralization of AR14 in the presence of Fe3+ was synergistic, most likely because of the participation of Sono-Fenton and photo-Fenton reactions.

Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

DEFF Research Database (Denmark)

Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

1996-01-01

Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

Degradation of fructans and production of propionic acid by Bacteroides thetaiotaomicron are enhanced by shortage of amino acids

Directory of Open Access Journals (Sweden)

Signe eAdamberg

2014-12-01

Full Text Available Bacteroides thetaiotaomicron is commonly found in the human colon and stabilizes its ecosystem by the catabolism of various polysaccharides. A model of cross-talk between the metabolism of amino acids and fructans in B. thetaiotaomicron was proposed. The growth of B. thetaiotaomicron DSM 2079 in two defined media containing mineral salts and vitamins, and supplemented with either 20 or 2 amino acids, was studied in an isothermal microcalorimeter. The polyfructans inulin (from chicory and levan (synthesized using levansucrase from Pseudomonas syringae, two fructooligosaccharide preparations with different composition, sucrose and fructose were tested as substrates. The calorimetric power-time curves were substrate specific and typically multiauxic. A surplus of amino acids reduced the consumption of longer oligosaccharides (DP > 3. Bacterial growth was not detected either in the carbohydrate free medium containing amino acids or in the medium with inulin as a sole carbohydrate. In amino acid-restricted medium, fermentation leading to acetic acid formation was dominant at the beginning of growth (up to 24 h, followed by increased lactic acid production, and mainly propionic and succinic acids were produced at the end of fermentation. In the medium supplemented with 20 amino acids, the highest production of D-lactate (82 ± 33 mmol/gDW occurred in parallel with extensive consumption (up to 17 mmol/gDW of amino acids, especially Ser, Thr and Asp. The production of Ala and Glu was observed at growth on all substrates, and the production was enhanced under amino acid deficiency. The study revealed the influence of amino acids on fructan metabolism in B. thetaiotaomicron and showed that defined growth media are invaluable in elucidating quantitative metabolic profiles of the bacteria. Levan was shown to act as an easily degradable substrate for B. thetaiotaomicron. The effect of levan on balancing or modifying colon microbiota will be studied in

Kinetics of the Degradation of Anthocyanins, Phenolic Acids and Flavonols During Heat Treatments of Freeze-Dried Sour Cherry Marasca Paste

Directory of Open Access Journals (Sweden)

Zoran Zorić

2014-01-01

Full Text Available The effect of heating temperature (80–120 °C and processing time (5–50 min on the stability of anthocyanins (cyanidin-3-glucosylrutinoside, cyanidin-3-rutinoside and cyanidin- 3-glucoside, quercetin-3-glucoside and phenolic acids (chlorogenic, neochlorogenic, p-coumaric and ferulic acids in freeze-dried Marasca sour cherry pastes was studied. The degradation rates of individual anthocyanins, quercetin-3-glucoside and phenolic acids followed the first order reaction kinetics. Cyanidin-3-glucoside was found to be the most unstable among the anthocyanins, together with p-coumaric and neochlorogenic acids among other phenols. Activation energies for anthocyanin degradation ranged from 42 (cyanidin-3-glucosylrutinoside to 55 kJ/mol (cyanidin-3-glucoside, and for other phenols from 8.12 (chlorogenic acid to 27 kJ/mol (neochlorogenic acid. By increasing the temperature from 80 to 120 °C, the reaction rate constant of cyanidin-3-glucosylrutinoside increased from 2.2·10–2 to 8.5·10–2 min–1, of p-coumaric acid from 1.12·10–2 to 2.5·10–2 min–1 and of quercetin-3-glucoside from 1.5·10–2 to 2.6·10–2 min–1. The obtained results demonstrate that at 80°C the half-life of anthocyanins ranges from 32.10 min for cyanidin-3-glucosylrutinoside to 45.69 min for cyanidin-3-rutinoside, and of other phenolic compounds from 43.39 for neochlorogenic acid to 66.99 min for chlorogenic acid. The results show that the heating temperature and duration affect the anthocyanins considerably more than the other phenols in terms of degradation.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Christiansen, Gunna; Molin, S

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

Degradation behavior of hydroxyapatite/poly(lactic-co-glycolic) acid nanocomposite in simulated body fluid

International Nuclear Information System (INIS)

Liuyun, Jiang; Chengdong, Xiong; Lixin, Jiang; Lijuan, Xu

2013-01-01

Graphical abstract: In this manuscript, we initiated a systematic study to investigate the effect of HA on thermal properties, inner structure, reduction of mechanical strength, surface morphology and the surface deposit of n-HA/PLGA composite with respect to the soaking time. The results showed that n-HA played an important role in improving the degradation behavior of n-HA/PLGA composite, which can accelerate the degradation of n-HA/PLGA composite and endow it with bioactivity, after n-HA was detached from PLGA during the degradation, so that n-HA/PLGA composite may have a more promising prospect of the clinical application than pure PLGA as bone fracture internal fixation materials, and the results would be of reference significance to predict the in vivo degradation and biological properties. - Highlights: • Effect of n-HA on degradation behavior of n-HA/PLGA composite was investigated. • Degradation behaviors of n-HA/PLGA and PLGA were carried out in SBF for 6 months. • Viscosity, thermal properties, inner structure and bending strength were tested. • n-HA can accelerate the degradation and endows it with bioactivity. - Abstract: To investigate the effect of hydroxyapatite(HA) on the degradation behavior of hydroxyapatite/poly(lactic-co-glycolic) acid (HA/PLGA) nanocomposite, the degradation experiment of n-HA/PLGA composite and pure PLGA were carried out by soaking in simulated body fluid(SBF) at 37 °C for 1, 2, 4 and 6 months. The change of intrinsic viscosity, thermal properties, inner structure, bending strength reduction, surface morphology and the surface deposit of n-HA/PLGA composite and pure PLGA with respect to the soaking time were investigated by means of UbbeloHde Viscometer, differential scanning calorimeter (DSC), scanning electron microscope(SEM), electromechanical universal tester, a conventional camera and X-ray diffraction (XRD). The results showed that n-HA played an important role in improving the degradation behavior of n

Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

Science.gov (United States)

Deaner, Matthew; Holzman, Allison; Alper, Hal S

2018-04-16

Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Kinetic modeling of the photocatalytic degradation of clofibric acid in a slurry reactor.

Science.gov (United States)

Manassero, Agustina; Satuf, María Lucila; Alfano, Orlando Mario

2015-01-01

A kinetic study of the photocatalytic degradation of the pharmaceutical clofibric acid is presented. Experiments were carried out under UV radiation employing titanium dioxide in water suspension. The main reaction intermediates were identified and quantified. Intrinsic expressions to represent the kinetics of clofibric acid and the main intermediates were derived. The modeling of the radiation field in the reactor was carried out by Monte Carlo simulation. Experimental runs were performed by varying the catalyst concentration and the incident radiation. Kinetic parameters were estimated from the experiments by applying a non-linear regression procedure. Good agreement was obtained between model predictions and experimental data, with an error of 5.9 % in the estimations of the primary pollutant concentration.

MESOPOROUS ACID SOLID AS A CARRIER FOR METALLOCENE CATALYST IN ETHYLENE POLYMERIZATION AND A CATALYST IN CATALYTIC DEGRADATION OF POLYETHYLENE

Institute of Scientific and Technical Information of China (English)

Wen-xi Cheng; Li-ya Shi; Shi-yun Li; Hui Chen; Tao Tang

2007-01-01

The possibility of mesoporous acid solid as a carrier for metallocene catalyst in ethylene polymerization and catalyst for polyethylene(PE)catalytic degradation was investigated.Here,HMCM-41 and AlMCM-41.and mesoporous silicoaluminophosphate molecular sieves(SAPO1 and SAPO2)were synthesized and used as acid solid.Much more gases were produced during catalytic degradation in PE/acid solid mixtures via in situ polymerization than those via physical mixing.The particle size distribution results exhibited that the particle size of SAPO1 in the PE/SAO1 mixture via in situ polymerization was about 1/14 times of that of the original SAPO1 or SAPO1.supported metallocene catalyst.This work shows a novel technology for chemical recycling of polyolefin.

Rapid and Simultaneous Determination of Acetylsalicylic Acid, Paracetamol, and Their Degradation and Toxic Impurity Products by HPLC in Pharmaceutical Dosage Forms

OpenAIRE

AKAY, Cemal

2008-01-01

Aims: Determinations of drug impurity and drug degradation products are very important from both pharmacological and toxicological perspectives. Establishment of monitoring methods for impurities and degradation products during pharmaceutical development is necessary because of their potential toxicity. The aim of this study was to develop a rapid and simultaneous determination method for paracetamol and acetylsalicylic acid (ACA) and their degradation and toxic impurity products by high perf...

Reactivity of tributyl phosphate degradation products with nitric acid: Relevance to the Tomsk-7 accident

International Nuclear Information System (INIS)

Barney, G.S.; Cooper, T.D.

1995-01-01

The reaction of a degraded tributyl phosphate (TBP) solvent with nitric acid is thought to have caused the chemical explosion at the Tomsk-7 reprocessing plant at Tomsk, Russia in 1993. The estimated temperature of the organic layer was not high eneough to cause significant reaction of nitric acid with TBP or hydrocarbon diluent compounds. A more reactive organic compound was likely present in the organic layer that reacted with sufficient heat generation to raise the temperature to the point where an autocatalytic oxidation of the organic solvent was initiated. Two of the most likely reactive compounds that are present in degraded TBP solvents are n-butanol and n-butyl nitrate. The reactions of these compounds with nitric acid are the subject of this study. The objective of laboratory-scale tests was to identify chemical reactions that occur when n-butanol and n-butyl nitrate contact heated nitric acid solutions. Reaction products were identified and quantitified, the temperatures at which these reactions occur and heats of reaction were measured, and reaction variables (temperature, nitric acid concentration, organic concentration, and reaction time) were evaluated. Data showed that n-butyl nitrate is less reactive than n-butanol. An essentially complete oxidation reaction of n-butanol at 110-120 C produced four major reaction products. Mass spectrometry identified the major inorganic oxidation products for both n-butanol and n-butyl nitrate as nitric oxide and carbon dioxide. Calculated heats of reaction for n-butanol and n-butyl nitrate to form propionic acid, a major reaction product, are -1860 cal/g n-butanol and -953 cal/g n-butyl nitrate. These heats of reaction are significant and could have raised the temperature of the organic layer in the Tomsk-7 tank to the point where autocatalytic oxidation of other organic compounds present resulted in an explosion

Photoelectrocatalytic degradation of oxalic acid by spray deposited nanocrystalline zinc oxide thin films

International Nuclear Information System (INIS)

Shinde, S.S.; Shinde, P.S.; Sapkal, R.T.; Oh, Y.W.; Haranath, D.; Bhosale, C.H.; Rajpure, K.Y.

2012-01-01

Highlights: ► Influence of substrate temperature onto the physico-chemical properties. ► Photochemical, structural, luminescent, optoelectrical and thermal properties. ► The kinetics of oxalic acid degradation with reaction mechanism. ► Extent of mineralization by COD and TOC. - Abstract: The high quality nano-crystalline zinc oxide thin films are deposited onto corning glasses by spray pyrolysis technique. The influence of reaction temperature onto their photoelectrochemical, structural, morphological, optoelectronic, luminescence and thermal properties has been investigated. The structural characteristics studied by X-ray diffractometry has complemented by resistivity measurements and UV–Vis spectroscopy. The photoelectrochemical activity shows enhancement in short circuit current (I sc = 0.357 mA) and open circuit voltage (V oc = 0.48 V). Direct band gap calculated by considering R and T values of ZnO thin films increases from 3.14–3.21 eV exhibiting a slight blue shift in band edge. Three characteristic luminescence peaks having near band-edge, blue and green emission are observed in the photoluminescence spectra. The specific heat and thermal conductivity study shows the phonon conduction behavior is dominant in films. Photocatalytic degradation of oxalic acid followed with reaction mechanism by using zinc oxide photoelectrode under solar illumination has been investigated.

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

Regulation of phenylacetic acid uptake is sigma54 dependent in Pseudomonas putida CA-3.

LENUS (Irish Health Repository)

O' Leary, Niall D

2011-10-13

primer extension analysis. Comparative analyses of genomes encoding phenylacetyl CoA, (PACoA), catabolic operons identified a common association among styrene degradation linked PACoA catabolons in Pseudomonas species studied to date. Conclusions In summary, this is the first study to report RpoN dependent transcriptional activation of the PACoA catabolon paaL gene, encoding a transport protein essential for phenylacetic acid utilisation in P. putida CA-3. Bioinformatic analysis is provided to suggest this regulatory link may be common among styrene degrading Pseudomonads.

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

Mechanism for enhanced degradation of clofibric acid in aqueous by catalytic ozonation over MnOx/SBA-15.

Science.gov (United States)

Sun, Qiangqiang; Wang, Yu; Li, Laisheng; Bing, Jishuai; Wang, Yingxin; Yan, Huihua

2015-04-09

Comparative experiments were conducted to investigate the catalytic ability of MnO(x)/SBA-15 for the ozonation of clofibric acid (CA) and its reaction mechanism. Compared with ozonation alone, the degradation of CA was barely enhanced, while the removal of TOC was significantly improved by catalytic ozonation (O3/MnO(x)/SBA-15). Adsorption of CA and its intermediates by MnO(x)/SBA-15 was proved unimportant in O3/MnO(x)/SBA-15 due to the insignificant adsorption of CA and little TOC variation after ceasing ozone in stopped-flow experiment. The more remarkably inhibition effect of sodium bisulfite (NaHSO3) on the removal of TOC in catalytic ozonation than in ozonation alone elucidated that MnO(x)/SBA-15 facilitated the generation of hydroxyl radicals (OH), which was further verified by electron spin-resonance spectroscopy (ESR). Highly dispersed MnO(x) on SBA-15 were believed to be the main active component in MnO(x)/SBA-15. Some intermediates were indentified and different degradation routes of CA were proposed in both ozonation alone and catalytic ozonation. The amounts of small molecular carboxylic acids (i.e., formic acid (FA), acetic acid (AA) and oxalic acid (OA)) generated in catalytic ozonation were lower than in ozonation alone, resulting from the generation of more OH. Copyright © 2014 Elsevier B.V. All rights reserved.

Acceleration of the herbicide isoproturon degradation in wheat by glycosyltransferases and salicylic acid.

Science.gov (United States)

Lu, Yi Chen; Zhang, Shuang; Yang, Hong

2015-01-01

Isoproturon (IPU) is a herbicide widely used to prevent weeds in cereal production. Due to its extensive use in agriculture, residues of IPU are often detected in soils and crops. Overload of IPU to crops is associated with human health risks. Hence, there is an urgent need to develop an approach to mitigate its accumulation in crops. In this study, the IPU residues and its degradation products in wheat were characterized using ultra performance liquid chromatography-time of fight tandem-mass spectrometer/mass spectrometer (UPLC-TOF-MS/MS). Most detected IPU-derivatives were sugar-conjugated. Degradation and glycosylation of IPU-derivatives could be enhanced by applying salicylic acid (SA). While more sugar-conjugated IPU-derivatives were identified in wheat with SA application, lower levels of IPU were detected, indicating that SA is able to accelerate intracellular IPU catabolism. All structures of IPU-derivatives and sugar-conjugated products were characterized. Comparative data were provided with specific activities and gene expression of certain glucosyltransferases. A pathway with IPU degradation and glucosylation was discussed. Our work indicates that SA-accelerated degradation is practically useful for wheat crops growing in IPU-contaminated soils because such crops with SA application can potentially lower or minimize IPU accumulation in levels below the threshold for adverse effects. Copyright © 2014 Elsevier B.V. All rights reserved.

Chemical sporulation and germination: cytoprotective nanocoating of individual mammalian cells with a degradable tannic acid-FeIII complex

Science.gov (United States)

Lee, Juno; Cho, Hyeoncheol; Choi, Jinsu; Kim, Doyeon; Hong, Daewha; Park, Ji Hun; Yang, Sung Ho; Choi, Insung S.

2015-11-01

Individual mammalian cells were coated with cytoprotective and degradable films by cytocompatible processes maintaining the cell viability. Three types of mammalian cells (HeLa, NIH 3T3, and Jurkat cells) were coated with a metal-organic complex of tannic acid (TA) and ferric ion, and the TA-FeIII nanocoat effectively protected the coated mammalian cells against UV-C irradiation and a toxic compound. More importantly, the cell proliferation was controlled by programmed formation and degradation of the TA-FeIII nanocoat, mimicking the sporulation and germination processes found in nature.Individual mammalian cells were coated with cytoprotective and degradable films by cytocompatible processes maintaining the cell viability. Three types of mammalian cells (HeLa, NIH 3T3, and Jurkat cells) were coated with a metal-organic complex of tannic acid (TA) and ferric ion, and the TA-FeIII nanocoat effectively protected the coated mammalian cells against UV-C irradiation and a toxic compound. More importantly, the cell proliferation was controlled by programmed formation and degradation of the TA-FeIII nanocoat, mimicking the sporulation and germination processes found in nature. Electronic supplementary information (ESI) available: Experimental details, LSCM images, and SEM and TEM images. See DOI: 10.1039/c5nr05573c

Anaerobic bacterium that degrades fatty acids in syntrophic association with methanogens

Energy Technology Data Exchange (ETDEWEB)

McInerney, M J [Univ. of Illinois, Urbana; Bryant, M P; Pfennig, N

1979-01-01

A new species of anaerobic bacterium that degrades the even-numbered carbon fatty acids, butyrate, caproate and caprylate, to acetate and H/sub 2/ and the odd-numbered carbon fatty acids, valerate and heptanoate, to acetate, propionate and H/sub 2/ was obtained in coculture with either an H/sub 2/-utilizing methanogen or H/sub 2/-utilizing desulfovibrio. The organism could be grown only in syntrophic association with the H/sub 2/-utilizer and no other energy sources or combination of electron donor and acceptors were utilized. It was a Gram-negative helical rod with 2 to 8 flagella, about 20 nm in diameter, inserted in a linear fashion about 130 nm or more apart along the concave side of the cell. It grew with a generation time of 84 h in co-culture with Methanospirillum hungatii and was present in numbers of at least 4.5 x 10/sup -6/ per g of anaerobic digest or sludge.

Mechanical properties, morphology, and hydrolytic degradation behavior of polylactic acid / natural rubber blends

Science.gov (United States)

Buys, Y. F.; Aznan, A. N. A.; Anuar, H.

2018-01-01

Due to its biodegradability and renewability, polylactic acid (PLA) has been receiving enormous attention as a potential candidate to replace petroleum based polymers. However, PLA has limitation due to its inherent brittleness. In order to overcome this limitation, blending PLA with elastomeric materials such as natural rubber (NR) are commonly reported. In previous, several researches on PLA/NR blend had been reported, with most of them evaluated the mechanical properties. On the other hand, study of degradation behavior is significance of importance, as controlling materials degradation is required in some applications. This research studied the effect of blend composition on mechanical properties, morphology development, and hydrolytic degradation behavior of PLA/NR blends. Various compositions of PLA/NR blends were prepared by melt blending technique. Tensile test and impact test of the blends were performed to evaluate the mechanical properties. Addition of NR improved the elongation at break and impact strength of the blends, but reduced the tensile strength and stiffness of the specimens. Dynamic Mechanical Analysis (DMA) measurements of the blends displayed two peaks at temperature -70˚C which corresponded to T g of NR and 65˚C which corresponded to T g of PLA. Field Emission Scanning Electron Microscopy (FE-SEM) micrograph of 70/30 PLA/NR specimen also showed two distinct phases, which lead to indication that PLA/NR blends are immiscible. Hydrolytic degradation behavior was evaluated by measuring the remaining weight of the samples immersed in sodium hydroxide solution for a predetermined times. It was shown that the degradation behavior of PLA/NR blends is affected by composition of the blends, with 100 PLA and 70/30 PLA/NR blend showed the fastest degradation rate and 100 NR displayed the slowest one.

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Bioactivity and cytocompatibility of dicalcium phosphate/poly (amino acid) biocomposite with degradability

Energy Technology Data Exchange (ETDEWEB)

Zhang Yunfei [College of Chemistry, Sichuan University, Chengdu 610064 (China); Shan Wenpeng; Li Xiangde [Key Laboratory for Ultrafine Materials of Ministry of Education, East China University of Science and Technology, Shanghai 200237 (China); Wei Jie, E-mail: biomater2006@yahoo.com.cn [Key Laboratory for Ultrafine Materials of Ministry of Education, East China University of Science and Technology, Shanghai 200237 (China); Li Hong [College of Physical Science and Technology, Sichuan University, Chengdu 610064 (China); Ma Jian [Hospital of Stomatology, Tongji University, Shanghai 200072 (China); Yan Yonggang, E-mail: yan_yonggang@vip.163.com [College of Physical Science and Technology, Sichuan University, Chengdu 610064 (China)

2012-01-15

A bioactive composite of dicalcium phosphate (DCP) and poly (amino acid) (PAA) was fabricated, and the in vitro bioactivity, degradability, and cellular responses to the DCP/PAA composite (DPC) were investigated as compared to PAA. Apatite formation on DPC surfaces occurred after immersion into simulated body fluid (SBF) for 7 days, but not on the surface of PAA. The weight loss ratio of DPC could reach 18.6 {+-} 0.3 wt% after soaking into phosphate buffered saline (PBS) for 2 months, which was higher than PAA (11.0 {+-} 0.2 wt%). Cell attachment and proliferation of MG-63 cells on DPC was obviously higher than on PAA. Moreover, the cells spread and formed confluent layer on the DPC surfaces. The alkaline phosphatase activity (ALP) of the cells on DPC was significantly greater than PAA at day 5 and day 7. The results suggested that introducing DCP into PAA makes the composite bioactive and more degradable, and meanwhile enhances osteoblast-like cells attach, proliferation and osteogenic differentiation.

OH-radical induced degradation of hydroxybenzoic- and hydroxycinnamic acids and formation of aromatic products-A gamma radiolysis study

Energy Technology Data Exchange (ETDEWEB)

Krimmel, Birgit; Swoboda, Friederike [University of Vienna, Department of Nutritional Sciences, Section Radiation Biology (Austria); Solar, Sonja, E-mail: sonja.solar@univie.ac.a [University of Vienna, Department of Nutritional Sciences, Section Radiation Biology (Austria); Reznicek, Gottfried [Department of Pharmacognosy, Althanstrasse 14, A-1090 Vienna (Austria)

2010-12-15

The OH-radical induced degradation of hydroxybenzoic acids (HBA), hydroxycinnamic acids (HCiA) and methoxylated derivatives, as well as of chlorogenic acid and rosmarinic acid was studied by gamma radiolysis in aerated aqueous solutions. Primary aromatic products resulting from an OH-radical attachment to the ring (hydroxylation), to the position occupied by the methoxyl group (replacement -OCH{sub 3} by -OH) as well as to the propenoic acid side chain of the cinnamic acids (benzaldehyde formations) were analysed by HPLC-UV and LC-ESI-MS. A comparison of the extent of these processes is given for 3,4-dihydroxybenzoic acid, vanillic acid, isovanillic acid, syringic acid, cinnamic acid, 4-hydroxycinnamic acid, caffeic acid, ferulic acid, isoferulic acid, chlorogenic acid, and rosmarinic acid. For all cinnamic acids and derivatives benzaldehydes were significant oxidation products. With the release of caffeic acid from chlorogenic acid the cleavage of a phenolic glycoside could be demonstrated. Reaction mechanisms are discussed.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

Science.gov (United States)

Frías, José E; Flores, Enrique

2015-07-01

Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

Catalyst Degradation in High Temperature Proton Exchange Membrane Fuel Cells Based on Acid Doped Polybenzimidazole Membranes

DEFF Research Database (Denmark)

Cleemann, Lars Nilausen; Buazar, F.; Li, Qingfeng

2013-01-01

and multi‐walled carbon nanotubes were used as supports for electrode catalysts and evaluated in accelerated durability tests under potential cycling at 150 °C. Measurements of open circuit voltage, area specific resistance and hydrogen permeation through the membrane were carried out, indicating little...... contribution of the membrane degradation to the performance losses during the potential cycling tests. As the major mechanism of the fuel cell performance degradation, the electrochemical active area of the cathodic catalysts showed a steady decrease in the cyclic voltammetric measurements, which was also......Degradation of carbon supported platinum catalysts is a major failure mode for the long term durability of high temperature proton exchange membrane fuel cells based on phosphoric acid doped polybenzimidazole membranes. With Vulcan carbon black as a reference, thermally treated carbon black...

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

Science.gov (United States)

Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

2015-02-27

It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of lignocellulosic biomass thermal degradation and physiochemical structure: Effects of demineralization by diverse acid solutions

International Nuclear Information System (INIS)

Asadieraghi, Masoud; Wan Daud, Wan Mohd Ashri

2014-01-01

Highlights: • HF showed interesting results on EFB (empty fruit bunches) and PMF (palm mesocarp fibre) deashing. • HCl indicated maximum ash removal from PKS (palm kernel shell). • Significant pyrolysis reactions took place at ∼250 °C to ∼400 °C. • Inorganics played a considerable catalytic role during the biomasses pyrolysis. • Acid pretreatment introduced some impacts on the biomasses structure. - Abstract: To eliminate the negative impacts of inorganic constituents during biomass thermochemical processes, leaching method by different diluted acid solutions was chosen. The different palm oil biomass samples (palm kernel shell (PKS), empty fruit bunches (EFB) and palm mesocarp fiber (PMF)) were pretreated by various diluted acid solutions (H 2 SO 4 , HClO 4 , HF, HNO 3 , HCl). Acids with the highest degrees of demineralization were selected to investigate the dematerialization impacts on the biomass thermal characteristics and physiochemical structure. Thermogravimetric analysis coupled with mass spectroscopy (TGA-MS) and Fourier transform infrared spectroscopy (TGA-FTIR) were employed to examine the biomass thermal degradation. TGA and DTG (Derivative thermogravimetry) indicated that the maximum degradation temperatures increased after acid pretreatment due to the minerals catalytic effects. The main permanent evolved gases comprising H 2 , CO 2 , CO were detected online during analysis. The major permanent gases produced at the temperature range of 250–750 °C were attributed to the condensable vapors cracking and probably some secondary reactions. The physiochemical structure change of the acid-treated biomass samples was examined by using Brunauer Emmett Teller (BET) method, Scanning Electron Microscope (SEM) and FTIR. The pyrolysis kinetics of the different palm oil biomasses were investigated using first order reaction model

The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

NARCIS (Netherlands)

Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

2006-01-01

The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

Degradation rates and mechanisms of acid-resistant coatings in copper-leaching tanks

DEFF Research Database (Denmark)

Møller, Victor Buhl

coating where the lifetime was estimated to 1:6 ± 0:2 and 1:4 ± 0:1 years, respectively. Part IV A series of newly designed and constructed diffusion cells were used to measure sulfuric acid diffusion rates through the coatings. A mathematical model was developed to simulate the experimental data...... potential in the mineral industry has not yet been thoroughly investigated. This particular industry poses unique challenges, with high operational temperatures (around 75 °C) and combined acidicerosive environments. The use of organic coatings to protect tanks, pipes, and secondary exposure areas, may....... Part I An in-depth literature study was performed to uncover and review uses and limitations ofacid-resistant coatings in the chemical industry, with a comparison to alternative resistant materialsbased on metals and ceramics. In addition, coating degradation phenomena caused by acid exposure, were...

PEGylated single-walled carbon nanotubes activate neutrophils to increase production of hypochlorous acid, the oxidant capable of degrading nanotubes

Energy Technology Data Exchange (ETDEWEB)

Vlasova, Irina I., E-mail: irina.vlasova@yahoo.com [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Vakhrusheva, Tatyana V. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Sokolov, Alexey V.; Kostevich, Valeria A. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Research Institute for Experimental Medicine, Russian Academy of Medical Science, Saint Petersburg (Russian Federation); Gusev, Alexandr A.; Gusev, Sergey A. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Melnikova, Viktoriya I. [Institute of Developmental Biology, Russian Academy of Science, Moscow (Russian Federation); Lobach, Anatolii S. [Institute of Problems of Chemical Physics, Russian Academy of Science, Chernogolovka (Russian Federation)

2012-10-01

Perspectives for the use of carbon nanotubes in biomedical applications depend largely on their ability to degrade in the body into products that can be easily cleared out. Carboxylated single-walled carbon nanotubes (c-SWCNTs) were shown to be degraded by oxidants generated by peroxidases in the presence of hydrogen peroxide. In the present study we demonstrated that conjugation of poly(ethylene glycol) (PEG) to c-SWCNTs does not interfere with their degradation by peroxidase/H{sub 2}O{sub 2} system or by hypochlorite. Comparison of different heme-containing proteins for their ability to degrade PEG-SWCNTs has led us to conclude that the myeloperoxidase (MPO) product hypochlorous acid (HOCl) is the major oxidant that may be responsible for biodegradation of PEG-SWCNTs in vivo. MPO is secreted mainly by neutrophils upon activation. We hypothesize that SWCNTs may enhance neutrophil activation and therefore stimulate their own biodegradation due to MPO-generated HOCl. PEG-SWCNTs at concentrations similar to those commonly used in in vivo studies were found to activate isolated human neutrophils to produce HOCl. Both PEG-SWCNTs and c-SWCNTs enhanced HOCl generation from isolated neutrophils upon serum-opsonized zymosan stimulation. Both types of nanotubes were also found to activate neutrophils in whole blood samples. Intraperitoneal injection of a low dose of PEG-SWCNTs into mice induced an increase in percentage of circulating neutrophils and activation of neutrophils and macrophages in the peritoneal cavity, suggesting the evolution of an inflammatory response. Activated neutrophils can produce high local concentrations of HOCl, thereby creating the conditions favorable for degradation of the nanotubes. -- Highlights: ► Myeloperoxidase (MPO) product hypochlorous acid is able to degrade CNTs. ► PEGylated SWCNTs stimulate isolated neutrophils to produce hypochlorous acid. ► SWCNTs are capable of activating neutrophils in blood samples. ► Activation of

An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

Science.gov (United States)

Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

2014-10-01

The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Ultrasound-assisted MnO2 catalyzed homolysis of peracetic acid for phenol degradation: The assessment of process chemistry and kinetics

NARCIS (Netherlands)

Rokhina, E.V.; Makarova, K.; Lathinen, M.; Golovina, E.A.; As, van H.; Virkutyte, J.

2013-01-01

The combination of peracetic acid (PAA) and heterogeneous catalyst (MnO2) was used for the degradation of phenol in an aqueous solution in the presence of ultrasound irradiation (US). As a relevant source of free radicals (e.g. OH), peracetic acid was comprehensively studied by means of electron

Enzymatically and reductively degradable α-amino acid-based poly(ester amide)s: Synthesis, cell compatibility, and intracellular anticancer drug delivery

NARCIS (Netherlands)

Sun, H.; Cheng, Ru; Deng, Chao; Meng, Fenghua; Dias, Aylvin A.; Hendriks, Marc; Feijen, Jan; Zhong, Zhiyuan

2015-01-01

A novel and versatile family of enzymatically and reductively degradable α-amino acid-based poly(ester amide)s (SS-PEAs) were developed from solution polycondensation of disulfide-containing di-p-toluenesulfonic acid salts of bis-l-phenylalanine diesters (SS-Phe-2TsOH) with di-p-nitrophenyl adipate

Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

Science.gov (United States)

Ghosh, Semanti; Bagchi, Angshuman

2015-12-01

Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Exploring the Degradation of Gallotannins Catalyzed by Tannase Produced by Aspergillus niger GH1 for Ellagic Acid Production in Submerged and Solid-State Fermentation.

Science.gov (United States)

Chávez-González, Mónica L; Guyot, Sylvain; Rodríguez-Herrera, Raul; Prado-Barragán, Arely; Aguilar, Cristóbal N

2018-06-01

Due to great interest on producing bioactive compounds for functional foods and biopharmaceuticals, it is important to explore the microbial degradation of potential sources of target biomolecules. Gallotannins are polyphenols present in nature, an example of them is tannic acid which is susceptible to enzymatic hydrolysis. This hydrolysis is performed by tannase or tannin acyl hydrolase, releasing in this way, biomolecules with high-added value. In the present study, chemical profiles obtained after fungal degradation of tannic acid under two bioprocesses (submerged fermentation (SmF) and solid state fermentation (SSF)) were determined. In both fermentation systems (SmF and SSF), Aspergillus niger GH1 strain and tannic acid as a sole carbon source and inducer were used (the presence of tannic acid promotes production of enzyme tannase). In case of SSF, polyurethane foam (PUF) was used like as support of fermentation; culture medium only was used in case of submerged fermentation. Fermentation processes were monitored during 72 h; samples were taken kinetically every 8 h; and all extracts obtained were partially purified to obtain polyphenolic fraction and then were analyzed by liquid chromatography-mass spectrometry (LC-MS). Molecules like gallic acid and n-galloyl glucose were identified as intermediates in degradation of tannic acid; during SSF was identified ellagic acid production. The results obtained in this study will contribute to biotechnological production of ellagic acid.

Thermal properties of extruded injection-molded poly (lactic acid) and milkweed composites: degradation kinetics and enthalpic relaxation

Science.gov (United States)

Currently, most polymer composites utilize petroleum-based materials that are non-degradable and difficult to recycle or incur substantial cost for disposal. Green composites can be used in nondurable limited applications. In order to determine the degree of compatibility between Poly (lactic Acid...

Characterization of hydrolytic degradation of polylactic acid/rice hulls composites in water at different temperatures

Directory of Open Access Journals (Sweden)

2011-02-01

Full Text Available Hydrolytic degradations of polylactic acid/rice hulls (PLA/RH composites with various rice hulls contents due to water absorptions at 23, 51 and 69°C were investigated by studying the thermal properties, chemical composition, molecular weight, and morphology of the degraded products. The results have attested that the stability of PLA/RH composites in water depends slightly on rice hulls contents but it is significantly influenced by water temperature. Water absorption in 30 days at 23°C was between 0.87 and 9.25% depending on rice hull contents. However, at thermophilic temperatures, the water absorption and degradation of these products were increased significantly. Saturations were achieved in less than 25 and 9 days at 51°C and 69°C, respectively, while hydrolytic degradation was demonstrated by an increase in fragility and development of crystallinity. At 69°C, there were significant reductions of the decomposition and glass transition temperatures of the polymer by 13°C. These changes were associated with the reduction of the molecular weight of PLA from 153.1 kDa to ~10.7 kDa due to hydrolysis of its ester group.