On the diversity-multiplexing tradeoff of secret-key agreement over multiple-antenna channels
Zorgui, Marwen
2014-09-01
We consider secret-key agreement with public discussion over Rayleigh fading quasi-static channels. First, the secret-key diversity gain and the secret-key multiplexing gain are defined. Then, the secret-key diversity multiplexing tradeoff (DMT) is established. The eavesdropper is shown to \\'steal\\' only transmit antennas. We show that likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information (CSI) at the transmitter (CSI-T). This insensitivity of secret-key DMT toward CSI-T highlights a fundamental difference between secret-key agreement and the wiretap channel whose secret DMT depends crucially on CSI-T. Several secret-key DMT-achieving schemes are presented in case of full CSI-T.
On the diversity-multiplexing tradeoff of secret-key agreement over multiple-antenna channels
Zorgui, Marwen; Rezki, Zouheir; Alomair, Basel; Alouini, Mohamed-Slim
2014-01-01
We consider secret-key agreement with public discussion over Rayleigh fading quasi-static channels. First, the secret-key diversity gain and the secret-key multiplexing gain are defined. Then, the secret-key diversity multiplexing tradeoff (DMT) is established. The eavesdropper is shown to 'steal' only transmit antennas. We show that likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information (CSI) at the transmitter (CSI-T). This insensitivity of secret-key DMT toward CSI-T highlights a fundamental difference between secret-key agreement and the wiretap channel whose secret DMT depends crucially on CSI-T. Several secret-key DMT-achieving schemes are presented in case of full CSI-T.
Secure diversity-multiplexing tradeoff of zero-forcing transmit scheme at finite-SNR
Rezki, Zouheir
2012-04-01
In this paper, we address the finite Signal-to-Noise Ratio (SNR) Diversity-Multiplexing Tradeoff (DMT) of the Multiple Input Multiple Output (MIMO) wiretap channel, where a Zero-Forcing (ZF) transmit scheme, that intends to send the secret information in the orthogonal space of the eavesdropper channel, is used. First, we introduce the secrecy multiplexing gain at finite-SNR that generalizes the definition at high-SNR. Then, we provide upper and lower bounds on the outage probability under secrecy constraint, from which secrecy diversity gain estimates of ZF are derived. Through asymptotic analysis, we show that the upper bound underestimates the secrecy diversity gain, whereas the lower bound is tight at high-SNR, and thus its related diversity gain estimate is equal to the actual asymptotic secrecy diversity gain of the MIMO wiretap channel. © 2012 IEEE.
The Diversity-Multiplexing Tradeoff of Secret-Key Agreement over Multiple-Antenna Channels
Zorgui, Marwen; Rezki, Zouheir; Alomair, Basel; Alouini, Mohamed-Slim
2015-01-01
We study the problem of secret-key agreement between two legitimate parties, Alice and Bob, in presence an of eavesdropper Eve. There is a public channel with unlimited capacity that is available to the legitimate parties and is also observed by Eve. Our focus is on Rayleigh fading quasi-static channels. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge of their channels. We study the system in the high-power regime. First, we define the secret-key diversity gain and the secret-key multiplexing gain. Second, we establish the secret-key diversity multiplexing tradeoff (DMT) under no channel state information (CSI) at the transmitter (CSI-T). The eavesdropper is shown to “steal” only transmit antennas. We show that, likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information at the transmitter. This insensitivity of secret-key DMT toward CSI-T features a fundamental difference between secret-key agreement and the wiretap channel, in which secret DMT depends heavily on CSI-T. Finally, we present several secret-key DMT-achieving schemes in case of full CSI-T. We argue that secret DMT-achieving schemes are also key DMT-achieving. Moreover, we show formally that artificial noise (AN), likewise zero-forcing (ZF), is DMT-achieving. We also show that the public feedback channel improves the outage performance without having any effect on the DMT.
The Diversity-Multiplexing Tradeoff of Secret-Key Agreement over Multiple-Antenna Channels
Zorgui, Marwen
2015-10-26
We study the problem of secret-key agreement between two legitimate parties, Alice and Bob, in presence an of eavesdropper Eve. There is a public channel with unlimited capacity that is available to the legitimate parties and is also observed by Eve. Our focus is on Rayleigh fading quasi-static channels. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge of their channels. We study the system in the high-power regime. First, we define the secret-key diversity gain and the secret-key multiplexing gain. Second, we establish the secret-key diversity multiplexing tradeoff (DMT) under no channel state information (CSI) at the transmitter (CSI-T). The eavesdropper is shown to “steal” only transmit antennas. We show that, likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information at the transmitter. This insensitivity of secret-key DMT toward CSI-T features a fundamental difference between secret-key agreement and the wiretap channel, in which secret DMT depends heavily on CSI-T. Finally, we present several secret-key DMT-achieving schemes in case of full CSI-T. We argue that secret DMT-achieving schemes are also key DMT-achieving. Moreover, we show formally that artificial noise (AN), likewise zero-forcing (ZF), is DMT-achieving. We also show that the public feedback channel improves the outage performance without having any effect on the DMT.
Rezki, Zouheir
2011-06-01
In this paper, we address the finite Signal-to-Noise Ratio (SNR) Diversity-Multiplexing Tradeoff (DMT) of the Multiple Input Multiple Output (MIMO) wiretap channel, where a Zero-Forcing (ZF) transmit scheme, that intends to send the secret information in the orthogonal space of the eavesdropper channel, is used. First, we introduce the secret multiplexing gain at finite-SNR that generalizes the definition at high-SNR. Then, we provide upper and lower bounds on the outage probability under secrecy constraint, from which secret diversity gain estimates of ZF are derived. Through asymptotic analysis, we show that the upper bound underestimates the secret diversity gain, whereas the lower bound is tight at high-SNR, and thus its related diversity gain estimate is equal to the actual asymptotic secret diversity gain of the Multiple-Input Multiple-Output (MIMO) wiretap channel. © 2011 IEEE.
Diversity and Multiplexing Technologies by 3D Beams in Polarized Massive MIMO Systems
Directory of Open Access Journals (Sweden)
Xin Su
2016-01-01
Full Text Available Massive multiple input, multiple output (M-MIMO technologies have been proposed to scale up data rates reaching gigabits per second in the forthcoming 5G mobile communications systems. However, one of crucial constraints is a dimension in space to implement the M-MIMO. To cope with the space constraint and to utilize more flexibility in 3D beamforming (3D-BF, we propose antenna polarization in M-MIMO systems. In this paper, we design a polarized M-MIMO (PM-MIMO system associated with 3D-BF applications, where the system architectures for diversity and multiplexing technologies achieved by polarized 3D beams are provided. Different from the conventional 3D-BF achieved by planar M-MIMO technology to control the downtilted beam in a vertical domain, the proposed PM-MIMO realizes 3D-BF via the linear combination of polarized beams. In addition, an effective array selection scheme is proposed to optimize the beam-width and to enhance system performance by the exploration of diversity and multiplexing gains; and a blind channel estimation (BCE approach is also proposed to avoid pilot contamination in PM-MIMO. Based on the Long Term Evolution-Advanced (LTE-A specification, the simulation results finally confirm the validity of our proposals.
Zou, Li; Wang, Le; Zhao, Shengmei
2017-10-01
Atmospheric turbulence (AT) induced crosstalk can significantly impair the performance of free-space optical (FSO) communication link using orbital angular momentum (OAM) multiplexing. In this paper, we propose a spatial diversity (SD) turbulence mitigation scheme in an OAM-multiplexed FSO communication link. First, we present a SD mitigation model for the OAM-multiplexed FSO communication link under AT. Then we present a SD combining technique based on equal gain to enhance AT tolerance of the OAM-multiplexed FSO communication link. The numerical results show that performance of the OAM-multiplexed communication link has greatly improved by the proposed scheme. When the turbulence strength Cn2 is 5 × 10-15m - 2 / 3, the transmission distance is 1000 m and the channel signal-to-noise ratio (SNR) is 20 dB, the bit-error-rate (BER) performance of four spatial multiplexed OAM modes lm = + 1 , + 2 , + 3 , + 4 are 3 fold increase in comparison with those results without the proposed scheme. The proposed scheme is a promising direction for compensating the interference caused by AT in the OAM-multiplexed FSO communication link.
On the ARQ protocols over the Z-interference channels: Diversity-multiplexing-delay tradeoff
Nafea, Mohamed S.; Hamza, D.; Seddik, Karim G.; Nafie, Mohamed; Gamal, Hesham El
2012-01-01
We characterize the achievable three-dimensional tradeoff between diversity, multiplexing, and delay of the single antenna Automatic Retransmission reQuest (ARQ) Z-interference channel. Non-cooperative and cooperative ARQ protocols are adopted under
Beyond Multiplexing Gain in Large MIMO Systems
DEFF Research Database (Denmark)
Cakmak, Burak; Müller, Ralf R.; Fleury, Bernard Henri
growth (multiplexing gain). Even when the channel entries are i.i.d. the deviation from the linear growth is significant. We also find an additive property of the deviation for a concatenated MIMO system. Finally, we quantify the deviation of the large SNR capacity from the exact capacity and find...
Directory of Open Access Journals (Sweden)
Jinwoo Kim
2017-01-01
Full Text Available A fundamental performance trade-off of multicell multiuser multiple-input multiple-output (MU-MIMO systems is explored for achieving intercell and intracell interference-free conditions. In particular, we analyze the three-dimensional diversity-multiplexing-nulling trade-off (DMNT among the diversity order (i.e., the slope of the error performance curve, multiplexing order (i.e., the number of users that are simultaneously served by MU-MIMO, and nulling order (i.e., the number of users with zero interference in a victim cell. This trade-off quantifies the performance of MU-MIMO in terms of its diversity and multiplexing order, while nulling the intercell interference toward the victim cell in the neighbor. First, we design a precoding matrix to mitigate both intercell and intracell interference for a linear precoding-based MU-MIMO system. Then, the trade-off relationship is obtained by analyzing the distribution of the signal-to-noise ratio (SNR at the user terminals. Furthermore, we demonstrate how DMNT can be applied to estimate the long-term throughput for each mobile station, which allows for determining the optimal number of multiplexing order and throughput loss due to the interference nulling.
On the ARQ protocols over the Z-interference channels: Diversity-multiplexing-delay tradeoff
Nafea, Mohamed S.
2012-07-01
We characterize the achievable three-dimensional tradeoff between diversity, multiplexing, and delay of the single antenna Automatic Retransmission reQuest (ARQ) Z-interference channel. Non-cooperative and cooperative ARQ protocols are adopted under these assumptions. Considering no cooperation exists, we study the achievable tradeoff of the fixed-power split Han-Kobayashi (HK) approach. Interestingly, we demonstrate that if the second user transmits the common part only of its message in the event of its successful decoding and a decoding failure at the first user, communication is improved over that achieved by keeping or stopping the transmission of both the common and private messages. Under cooperation, two special cases of the HK are considered for static and dynamic decoders. The difference between the two decoders lies in the ability of the latter to dynamically choose which HK special-case decoding to apply. Cooperation is shown to dramatically increase the achievable first user diversity. © 2012 IEEE.
Analysis and Evaluation of Performance Gains and Tradeoffs for Massive MIMO Systems
Directory of Open Access Journals (Sweden)
Saba Qasim Jabbar
2016-09-01
Full Text Available Massive MIMO technique offers significant performance gains for the future of wireless communications via improving the spectral efficiency, energy efficiency and the channel quality with simple linear processing such as maximum-ratio transmission (MRT or zero-forcing (ZF by providing each user a large degree of freedom. In this paper, the system performance gains are studied in a multi-cell downlink massive MIMO system under the main considerations such as perfect channel estimation, imperfect channel estimation and the effect of interference among cells due to pilot sequences contamination. Then, mathematical expressions are derived for these gains i.e., spatial multiplexing gain, array gain and spatial diversity gain. After that, essential tradeoffs among these gains are considered under the effect of non-orthogonal interference, these tradeoffs are: spatial diversity gain vs. spatial multiplexing gain and array gain vs. spatial multiplexing gain. Simulation results show that the unbounded number of base station antennas boosts the array gain through concentrating the energy to spatial directions where users are sited, hence diminishing loss in array gain due to pilot contamination. The simulation results reveal also that massive MIMO strengthens the spatial multiplexing gain through increasing the number of served users via the same system resources in spite the effect of inter-cell interference. Finally, the spatial diversity gain is measured in term of outage probability and the simulation results show that raising the number of antennas will improve the outage probability. Meanwhile increasing the number of served users will lead to degrade the outage probability per user due to non-orthogonal interference from other cells.
Yang, Liang
2013-06-01
This paper considers a multiuser spectrum sharing (SS) multiple-input multiple-output (MIMO) system with zero-forcing (ZF) operating in a Rayleigh fading environment. We provide an asymptotic sum-rate analysis to investigate the effects of different parameters on the multiuser diversity gain. For a ZF SS spatial multiplexing system with scheduling, the asymptotic sum-rate scales like Nt log2(Q(Nt Np√K - 1)/N t), where Np denotes the number of antennas of primary receiver, Q is the interference temperature, and K represents the number of secondary transmitters. © 2013 IEEE.
Directory of Open Access Journals (Sweden)
Liolis Konstantinos P
2007-01-01
Full Text Available This paper investigates the applicability of multiple-input multiple-output (MIMO technology to satellite communications at the Ku-band and above. After introducing the possible diversity sources to form a MIMO matrix channel in a satellite environment, particular emphasis is put on satellite diversity. Two specific different topics from the field of MIMO technology applications to satellite communications at these frequencies are further analyzed: (i capacity improvement achieved by MIMO spatial multiplexing systems and (ii interference mitigation achieved by MIMO diversity systems employing receive antenna selection. In the first case, a single-user capacity analysis of a satellite MIMO spatial multiplexing system is presented and a useful analytical closed form expression is derived for the outage capacity achieved. In the second case, a satellite MIMO diversity system with receive antenna selection is considered, adjacent satellite cochannel interference on its forward link is studied and an analytical model predicting the interference mitigation achieved is presented. In both cases, an appropriate physical MIMO channel model is assumed which takes into account the propagation phenomena related to the frequencies of interest, such as clear line-of-sight operation, high antenna directivity, the effect of rain fading, and the slant path lengths difference. Useful numerical results obtained through the analytical expressions derived are presented to compare the performance of multi-satellite MIMO systems to relevant single-input single-output (SISO ones.
Directory of Open Access Journals (Sweden)
Rahul Vaze
2009-01-01
Full Text Available Multihop relay channels use multiple relay stages, each with multiple relay nodes, to facilitate communication between a source and destination. Previously, distributed space-time codes were proposed to maximize the achievable diversity-multiplexing tradeoff; however, they fail to achieve all the points of the optimal diversity-multiplexing tradeoff. In the presence of a low-rate feedback link from the destination to each relay stage and the source, this paper proposes an end-to-end antenna selection (EEAS strategy as an alternative to distributed space-time codes. The EEAS strategy uses a subset of antennas of each relay stage for transmission of the source signal to the destination with amplifying and forwarding at each relay stage. The subsets are chosen such that they maximize the end-to-end mutual information at the destination. The EEAS strategy achieves the corner points of the optimal diversity-multiplexing tradeoff (corresponding to maximum diversity gain and maximum multiplexing gain and achieves better diversity gain at intermediate values of multiplexing gain, versus the best-known distributed space-time coding strategies. A distributed compress and forward (CF strategy is also proposed to achieve all points of the optimal diversity-multiplexing tradeoff for a two-hop relay channel with multiple relay nodes.
Design considerations for a transparent mode group diversity multiplexing link
Tsekrekos, C.; Martinez, A.; Huijskens, Frans; Koonen, A.M.J.
2006-01-01
Mode group diversity multiplexing (MGDM) is an optical multiple-input-multiple-output technique that aims at creating independent communication channels over a multimode fiber, using subsets of propagating modes. This letter deals with the analysis of an MGDM point-to-point link, transparent to the
Capacity analysis of spectrum sharing spatial multiplexing MIMO systems
Yang, Liang
2014-12-01
This paper considers a spectrum sharing (SS) multiple-input multiple-output (MIMO) system operating in a Rayleigh fading environment. First the capacity of a single-user SS spatial multiplexing system is investigated in two scenarios that assume different receivers. To explicitly show the capacity scaling law of SS MIMO systems, some approximate capacity expressions for the two scenarios are derived. Next, we extend our analysis to a multiple user system with zero-forcing receivers (ZF) under spatially-independent scheduling and analyze the sum-rate. Furthermore, we provide an asymptotic sum-rate analysis to investigate the effects of different parameters on the multiuser diversity gain. Our results show that the secondary system with a smaller number of transmit antennas Nt and a larger number of receive antennas Nr can achieve higher capacity at lower interference temperature Q, but at high Q the capacity follows the scaling law of the conventional MIMO systems. However, for a ZF SS spatial multiplexing system, the secondary system with small Nt and large Nr can achieve the highest capacity throughout the entire region of Q. For a ZF SS spatial multiplexing system with scheduling, the asymptotic sum-rate scales like Ntlog2(Q(KNtNp-1)/Nt), where Np denotes the number of antennas of the primary receiver and K represents the number of secondary transmitters.
Secure diversity-multiplexing tradeoff of zero-forcing transmit scheme at finite-SNR
Rezki, Zouheir; Alouini, Mohamed-Slim
2012-01-01
information in the orthogonal space of the eavesdropper channel, is used. First, we introduce the secrecy multiplexing gain at finite-SNR that generalizes the definition at high-SNR. Then, we provide upper and lower bounds on the outage probability under
Developmental gains in visuospatial memory predict gains in mathematics achievement.
Directory of Open Access Journals (Sweden)
Yaoran Li
Full Text Available Visuospatial competencies are related to performance in mathematical domains in adulthood, but are not consistently related to mathematics achievement in children. We confirmed the latter for first graders and demonstrated that children who show above average first-to-fifth grade gains in visuospatial memory have an advantage over other children in mathematics. The study involved the assessment of the mathematics and reading achievement of 177 children in kindergarten to fifth grade, inclusive, and their working memory capacity and processing speed in first and fifth grade. Intelligence was assessed in first grade and their second to fourth grade teachers reported on their in-class attentive behavior. Developmental gains in visuospatial memory span (d = 2.4 were larger than gains in the capacity of the central executive (d = 1.6 that in turn were larger than gains in phonological memory span (d = 1.1. First to fifth grade gains in visuospatial memory and in speed of numeral processing predicted end of fifth grade mathematics achievement, as did first grade central executive scores, intelligence, and in-class attentive behavior. The results suggest there are important individual differences in the rate of growth of visuospatial memory during childhood and that these differences become increasingly important for mathematics learning.
Developmental gains in visuospatial memory predict gains in mathematics achievement.
Li, Yaoran; Geary, David C
2013-01-01
Visuospatial competencies are related to performance in mathematical domains in adulthood, but are not consistently related to mathematics achievement in children. We confirmed the latter for first graders and demonstrated that children who show above average first-to-fifth grade gains in visuospatial memory have an advantage over other children in mathematics. The study involved the assessment of the mathematics and reading achievement of 177 children in kindergarten to fifth grade, inclusive, and their working memory capacity and processing speed in first and fifth grade. Intelligence was assessed in first grade and their second to fourth grade teachers reported on their in-class attentive behavior. Developmental gains in visuospatial memory span (d = 2.4) were larger than gains in the capacity of the central executive (d = 1.6) that in turn were larger than gains in phonological memory span (d = 1.1). First to fifth grade gains in visuospatial memory and in speed of numeral processing predicted end of fifth grade mathematics achievement, as did first grade central executive scores, intelligence, and in-class attentive behavior. The results suggest there are important individual differences in the rate of growth of visuospatial memory during childhood and that these differences become increasingly important for mathematics learning.
Developmental Gains in Visuospatial Memory Predict Gains in Mathematics Achievement
Li, Yaoran; Geary, David C.
2013-01-01
Visuospatial competencies are related to performance in mathematical domains in adulthood, but are not consistently related to mathematics achievement in children. We confirmed the latter for first graders and demonstrated that children who show above average first-to-fifth grade gains in visuospatial memory have an advantage over other children in mathematics. The study involved the assessment of the mathematics and reading achievement of 177 children in kindergarten to fifth grade, inclusive, and their working memory capacity and processing speed in first and fifth grade. Intelligence was assessed in first grade and their second to fourth grade teachers reported on their in-class attentive behavior. Developmental gains in visuospatial memory span (d = 2.4) were larger than gains in the capacity of the central executive (d = 1.6) that in turn were larger than gains in phonological memory span (d = 1.1). First to fifth grade gains in visuospatial memory and in speed of numeral processing predicted end of fifth grade mathematics achievement, as did first grade central executive scores, intelligence, and in-class attentive behavior. The results suggest there are important individual differences in the rate of growth of visuospatial memory during childhood and that these differences become increasingly important for mathematics learning. PMID:23936154
On the capacity of MIMO-OFDM based diversity and spatial multiplexing in Radio-over-Fiber system
El Yahyaoui, Moussa; El Moussati, Ali; El Zein, Ghaïs
2017-11-01
This paper proposes a realistic and global simulation to predict the behavior of a Radio over Fiber (RoF) system before its realization. In this work we consider a 2 × 2 Multiple-Input Multiple-Output (MIMO) Orthogonal Frequency Division Multiplexing (OFDM) RoF system at 60 GHz. This system is based on Spatial Diversity (SD) which increases reliability (decreases probability of error) and Spatial Multiplexing (SMX) which increases data rate, but not necessarily reliability. The 60 GHz MIMO channel model employed in this work based on a lot of measured data and statistical analysis named Triple-S and Valenzuela (TSV) model. To the authors best knowledge; it is the first time that this type of TSV channel model has been employed for 60 GHz MIMO-RoF system. We have evaluated and compared the performance of this system according to the diversity technique, modulation schemes, and channel coding rate for Line-Of-Sight (LOS) desktop environment. The SMX coded is proposed as an intermediate system to improve the Signal to Noise Ratio (SNR) and the data rate. The resulting 2 × 2 MIMO-OFDM SMX system achieves a higher data rate up to 70 Gb/s with 64QAM and Forward Error Correction (FEC) limit of 10-3 over 25-km fiber transmission followed by 3-m wireless transmission using 7 GHz bandwidth of millimeter wave band.
DEFF Research Database (Denmark)
Gibbon, Timothy Braidwood; Osadchiy, Alexey Vladimirovich; Kjær, Rasmus
2009-01-01
Gain transients can severely hamper the upstream network performance in wavelength division multiplexed (WDM) access networks featuring erbium doped fiber amplifiers (EDFAs) or Raman amplification. We experimentally demonstrate for the first time using 10 Gb/s fiber transmission bit error rate...... measurements how a near-saturated semiconductor optical amplifier (SOA) can be used to control these gain transients. An SOA is shown to reduce the penalty of transients originating in an EDFA from 2.3 dB to 0.2 dB for 10 Gb/s transmission over standard single mode fiber using a 231-1 PRBS pattern. The results...... suggest that a single SOA integrated within a WDM receiver at the metro node could offer a convenient all-optical solution for upstream transient controlin WDM access networks....
Competence with fractions predicts gains in mathematics achievement.
Bailey, Drew H; Hoard, Mary K; Nugent, Lara; Geary, David C
2012-11-01
Competence with fractions predicts later mathematics achievement, but the codevelopmental pattern between fractions knowledge and mathematics achievement is not well understood. We assessed this codevelopment through examination of the cross-lagged relation between a measure of conceptual knowledge of fractions and mathematics achievement in sixth and seventh grades (N=212). The cross-lagged effects indicated that performance on the sixth grade fractions concepts measure predicted 1-year gains in mathematics achievement (ß=.14, pmathematics achievement did not predict gains on the fractions concepts measure (ß=.03, p>.50). In a follow-up assessment, we demonstrated that measures of fluency with computational fractions significantly predicted seventh grade mathematics achievement above and beyond the influence of fluency in computational whole number arithmetic, performance on number fluency and number line tasks, central executive span, and intelligence. Results provide empirical support for the hypothesis that competence with fractions underlies, in part, subsequent gains in mathematics achievement. Copyright © 2012 Elsevier Inc. All rights reserved.
Developmental Gains in Visuospatial Memory Predict Gains in Mathematics Achievement
Li, Yaoran; Geary, David C.
2013-01-01
Visuospatial competencies are related to performance in mathematical domains in adulthood, but are not consistently related to mathematics achievement in children. We confirmed the latter for first graders and demonstrated that children who show above average first-to-fifth grade gains in visuospatial memory have an advantage over other children in mathematics. The study involved the assessment of the mathematics and reading achievement of 177 children in kindergarten to fifth grade, inclusiv...
Diversity-Multiplexing Trade-off for Coordinated Direct and Relay Schemes
DEFF Research Database (Denmark)
Thai, Chan; Popovski, Petar; De Carvalho, Elisabeth
2013-01-01
The recent years have brought a significant body of research on wireless Two-Way Relaying (TWR), where the use of network coding brings an evident advantage in terms of data rates. Yet, TWR scenarios represent only a special case and it is of interest to devise similar techniques in more general...... Direct/Relay (CDR) schemes, which involve two flows, of a direct and a relayed user. In this paper we characterize a CDR scheme by deriving/bounding the Diversity-Multiplexing Trade-off (DMT) function. Two cases are considered. In the first case a transmitter knows the Channel State Information (CSI...
A novel multiplex bead-based platform highlights the diversity of extracellular vesicles.
Koliha, Nina; Wiencek, Yvonne; Heider, Ute; Jüngst, Christian; Kladt, Nikolay; Krauthäuser, Susanne; Johnston, Ian C D; Bosio, Andreas; Schauss, Astrid; Wild, Stefan
2016-01-01
The surface protein composition of extracellular vesicles (EVs) is related to the originating cell and may play a role in vesicle function. Knowledge of the protein content of individual EVs is still limited because of the technical challenges to analyse small vesicles. Here, we introduce a novel multiplex bead-based platform to investigate up to 39 different surface markers in one sample. The combination of capture antibody beads with fluorescently labelled detection antibodies allows the analysis of EVs that carry surface markers recognized by both antibodies. This new method enables an easy screening of surface markers on populations of EVs. By combining different capture and detection antibodies, additional information on relative expression levels and potential vesicle subpopulations is gained. We also established a protocol to visualize individual EVs by stimulated emission depletion (STED) microscopy. Thereby, markers on single EVs can be detected by fluorophore-conjugated antibodies. We used the multiplex platform and STED microscopy to show for the first time that NK cell-derived EVs and platelet-derived EVs are devoid of CD9 or CD81, respectively, and that EVs isolated from activated B cells comprise different EV subpopulations. We speculate that, according to our STED data, tetraspanins might not be homogenously distributed but may mostly appear as clusters on EV subpopulations. Finally, we demonstrate that EV mixtures can be separated by magnetic beads and analysed subsequently with the multiplex platform. Both the multiplex bead-based platform and STED microscopy revealed subpopulations of EVs that have been indistinguishable by most analysis tools used so far. We expect that an in-depth view on EV heterogeneity will contribute to our understanding of different EVs and functions.
Diversity-Multiplexing Trade-off for Coordinated Relayed Uplink and Direct Downlink Transmissions
DEFF Research Database (Denmark)
Thai, Chan; Popovski, Petar; Sun, Fan
2013-01-01
Abstract—There are two basic principles used in wireless network coding to design throughput-efficient schemes: (1) aggregation of communication flows and (2) interference is embraced and subsequently cancelled or mitigated. These principles inspire design of Coordinated Direct/Relay (CDR) schemes......, where each basic transmission involves two flows to a direct and a relayed user. Considering a scenario with relayed uplink and direct downlink, we analyze the Diversity-Multiplexing Tradeoff (DMT) calculating either the exact value or both upper/lower bounds. The CDR scheme is shown to have a higher...
Kaarlejärvi, Elina; Eskelinen, Anu; Olofsson, Johan
2017-09-04
Climate warming is altering the diversity of plant communities but it remains unknown which species will be lost or gained under warming, especially considering interactions with other factors such as herbivory and nutrient availability. Here, we experimentally test effects of warming, mammalian herbivory and fertilization on tundra species richness and investigate how plant functional traits affect losses and gains. We show that herbivory reverses the impact of warming on diversity: in the presence of herbivores warming increases species richness through higher species gains and lower losses, while in the absence of herbivores warming causes higher species losses and thus decreases species richness. Herbivores promote gains of short-statured species under warming, while herbivore removal and fertilization increase losses of short-statured and resource-conservative species through light limitation. Our results demonstrate that both rarity and traits forecast species losses and gains, and mammalian herbivores are essential for preventing trait-dependent extinctions and mitigate diversity loss under warming and eutrophication.Warming can reduce plant diversity but it is unclear which species will be lost or gained under interacting global changes. Kaarlejärvi et al. manipulate temperature, herbivory and nutrients in a tundra system and find that herbivory maintains diversity under warming by reducing species losses and promoting gains.
Directory of Open Access Journals (Sweden)
Arda Halu
Full Text Available Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.
Halu, Arda; Mondragón, Raúl J; Panzarasa, Pietro; Bianconi, Ginestra
2013-01-01
Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.
Diversity Performance Analysis on Multiple HAP Networks
Dong, Feihong; Li, Min; Gong, Xiangwu; Li, Hongjun; Gao, Fengyue
2015-01-01
One of the main design challenges in wireless sensor networks (WSNs) is achieving a high-data-rate transmission for individual sensor devices. The high altitude platform (HAP) is an important communication relay platform for WSNs and next-generation wireless networks. Multiple-input multiple-output (MIMO) techniques provide the diversity and multiplexing gain, which can improve the network performance effectively. In this paper, a virtual MIMO (V-MIMO) model is proposed by networking multiple HAPs with the concept of multiple assets in view (MAV). In a shadowed Rician fading channel, the diversity performance is investigated. The probability density function (PDF) and cumulative distribution function (CDF) of the received signal-to-noise ratio (SNR) are derived. In addition, the average symbol error rate (ASER) with BPSK and QPSK is given for the V-MIMO model. The system capacity is studied for both perfect channel state information (CSI) and unknown CSI individually. The ergodic capacity with various SNR and Rician factors for different network configurations is also analyzed. The simulation results validate the effectiveness of the performance analysis. It is shown that the performance of the HAPs network in WSNs can be significantly improved by utilizing the MAV to achieve overlapping coverage, with the help of the V-MIMO techniques. PMID:26134102
Diversity Performance Analysis on Multiple HAP Networks
Directory of Open Access Journals (Sweden)
Feihong Dong
2015-06-01
Full Text Available One of the main design challenges in wireless sensor networks (WSNs is achieving a high-data-rate transmission for individual sensor devices. The high altitude platform (HAP is an important communication relay platform for WSNs and next-generation wireless networks. Multiple-input multiple-output (MIMO techniques provide the diversity and multiplexing gain, which can improve the network performance effectively. In this paper, a virtual MIMO (V-MIMO model is proposed by networking multiple HAPs with the concept of multiple assets in view (MAV. In a shadowed Rician fading channel, the diversity performance is investigated. The probability density function (PDF and cumulative distribution function (CDF of the received signal-to-noise ratio (SNR are derived. In addition, the average symbol error rate (ASER with BPSK and QPSK is given for the V-MIMO model. The system capacity is studied for both perfect channel state information (CSI and unknown CSI individually. The ergodic capacity with various SNR and Rician factors for different network configurations is also analyzed. The simulation results validate the effectiveness of the performance analysis. It is shown that the performance of the HAPs network in WSNs can be significantly improved by utilizing the MAV to achieve overlapping coverage, with the help of the V-MIMO techniques.
Interferometric crosstalk suppression using polarization multiplexing technique and an SOA
DEFF Research Database (Denmark)
Liu, Fenghai; Xueyan, Zheng; Pedersen, Rune Johan Skullerud
2000-01-01
Interferometric crosstalk can be greatly suppressed at 10Gb/s and 20Gb/s by using a gain saturated SOA and a polarization multiplexing technique that eliminates impairments like waveform and extinction ratio degradation from the SOA.......Interferometric crosstalk can be greatly suppressed at 10Gb/s and 20Gb/s by using a gain saturated SOA and a polarization multiplexing technique that eliminates impairments like waveform and extinction ratio degradation from the SOA....
Child academic achievement in association with pre-pregnancy obesity and gestational weight gain.
Pugh, Sarah J; Hutcheon, Jennifer A; Richardson, Gale A; Brooks, Maria M; Himes, Katherine P; Day, Nancy L; Bodnar, Lisa M
2016-06-01
Recent data suggest that children of mothers who are obese before pregnancy, or who gain too much weight during pregnancy, may be at an increased risk of cognitive impairments. Mother-infant dyads enrolled in a birth cohort study in Pittsburgh, Pennsylvania (1983-1986), were followed from early pregnancy to 14 years postpartum (n=574). Math, reading and spelling achievements were assessed at ages 6 and 10 years using the Wide Range Achievement Test-Revised, and at age 14 years using the Wechsler Individual Achievement Test Screener. Self-reported total GWG was converted to gestational age-standardised z-scores. Generalised estimating equations were used to estimate the effects of GWG and pre-pregnancy body mass index (BMI) on academic achievement at 6, 10 and 14 years, while adjusting for maternal race, child sex, parity, employment, family income, maternal intelligence, maternal depression, pre-pregnancy BMI (in GWG models only) and the home environment. The mean (SD) BMI was 23.4 (5.7) kg/m(2) and the mean (SD) GWG reported at delivery was 14.4 (5.9) kg. There was a significant non-linear association between pre-pregnancy BMI and an offspring's academic achievement. At 6, 10 and 14 years, an offspring's academic scores were inversely associated with pre-pregnancy BMI beyond 22 kg/m(2). High GWG (>1 SD) was associated with approximately 4-point lower reading (adjusted β (adjβ) -3.75, 95% CI -7.1 to -0.4) and spelling scores (adjβ -3.90, 95% CI -7.8 to -0.2), compared with GWG -1 to +1 SD. Future studies in larger and socioeconomically diverse populations are needed to confirm maternal weight and weight gain as causal determinants of a child's academic skills, and whether this effect persists into adulthood. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Best Practices for Achieving High, Rapid Reading Gains
Carbo, Marie
2008-01-01
The percentage of students who read at the proficient level on the National Assessment of Educational Progress (NAEP) has not improved, and is appallingly low. In order for students to achieve high reading gains and become life-long readers, reading comprehension and reading enjoyment must be the top two goals. This article presents several…
Multiplexed Engineering in Biology.
Rogers, Jameson K; Church, George M
2016-03-01
Biotechnology is the manufacturing technology of the future. However, engineering biology is complex, and many possible genetic designs must be evaluated to find cells that produce high levels of a desired drug or chemical. Recent advances have enabled the design and construction of billions of genetic variants per day, but evaluation capacity remains limited to thousands of variants per day. Here we evaluate biological engineering through the lens of the design–build–test cycle framework and highlight the role that multiplexing has had in transforming the design and build steps. We describe a multiplexed solution to the ‘test’ step that is enabled by new research. Achieving a multiplexed test step will permit a fully multiplexed engineering cycle and boost the throughput of biobased product development by up to a millionfold.
Multiplexed Neurochemical Signaling by Neurons of the Ventral Tegmental Area
Barker, David J.; Root, David H.; Zhang, Shiliang; Morales, Marisela
2016-01-01
The ventral tegmental area (VTA) is an evolutionarily conserved structure that has roles in reward-seeking, safety-seeking, learning, motivation, and neuropsychiatric disorders such as addiction and depression. The involvement of the VTA in these various behaviors and disorders is paralleled by its diverse signaling mechanisms. Here we review recent advances in our understanding of neuronal diversity in the VTA with a focus on cell phenotypes that participate in ‘multiplexed’ neurotransmission involving distinct signaling mechanisms. First, we describe the cellular diversity within the VTA, including neurons capable of transmitting dopamine, glutamate or GABA as well as neurons capable of multiplexing combinations of these neurotransmitters. Next, we describe the complex synaptic architecture used by VTA neurons in order to accommodate the transmission of multiple transmitters. We specifically cover recent findings showing that VTA multiplexed neurotransmission may be mediated by either the segregation of dopamine and glutamate into distinct microdomains within a single axon or by the integration of glutamate and GABA into a single axon terminal. In addition, we discuss our current understanding of the functional role that these multiplexed signaling pathways have in the lateral habenula and the nucleus accumbens. Finally, we consider the putative roles of VTA multiplexed neurotransmission in synaptic plasticity and discuss how changes in VTA multiplexed neurons may relate to various psychopathologies including drug addiction and depression. PMID:26763116
Preliminary Assessment of Microwave Readout Multiplexing Factor
Energy Technology Data Exchange (ETDEWEB)
Croce, Mark Philip [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Koehler, Katrina Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rabin, Michael W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bennett, D. A. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Mates, J. A. B. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Gard, J. D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Becker, D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Schmidt, D. R. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Ullom, J. N. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States)
2017-01-23
Ultra-high resolution microcalorimeter gamma spectroscopy is a new non-destructive assay technology for measurement of plutonium isotopic composition, with the potential to reduce total measurement uncertainty to a level competitive with destructive analysis methods [1-4]. Achieving this level of performance in practical applications requires not only the energy resolution now routinely achieved with transition-edge sensor microcalorimeter arrays (an order of magnitude better than for germanium detectors) but also high throughput. Microcalorimeter gamma spectrometers have not yet achieved detection efficiency and count rate capability that is comparable to germanium detectors, largely because of limits from existing readout technology. Microcalorimeter detectors must be operated at low temperature to achieve their exceptional energy resolution. Although the typical 100 mK operating temperatures can be achieved with reliable, cryogen-free systems, the cryogenic complexity and heat load from individual readout channels for large sensor arrays is prohibitive. Multiplexing is required for practical systems. The most mature multiplexing technology at present is time-division multiplexing (TDM) [3, 5-6]. In TDM, the sensor outputs are switched by applying bias current to one SQUID amplifier at a time. Transition-edge sensor (TES) microcalorimeter arrays as large as 256 pixels have been developed for X-ray and gamma-ray spectroscopy using TDM technology. Due to bandwidth limits and noise scaling, TDM is limited to a maximum multiplexing factor of approximately 32-40 sensors on one readout line [8]. Increasing the size of microcalorimeter arrays above the kilopixel scale, required to match the throughput of germanium detectors, requires the development of a new readout technology with a much higher multiplexing factor.
Helicity multiplexed broadband metasurface holograms.
Wen, Dandan; Yue, Fuyong; Li, Guixin; Zheng, Guoxing; Chan, Kinlong; Chen, Shumei; Chen, Ming; Li, King Fai; Wong, Polis Wing Han; Cheah, Kok Wai; Pun, Edwin Yue Bun; Zhang, Shuang; Chen, Xianzhong
2015-09-10
Metasurfaces are engineered interfaces that contain a thin layer of plasmonic or dielectric nanostructures capable of manipulating light in a desirable manner. Advances in metasurfaces have led to various practical applications ranging from lensing to holography. Metasurface holograms that can be switched by the polarization state of incident light have been demonstrated for achieving polarization multiplexed functionalities. However, practical application of these devices has been limited by their capability for achieving high efficiency and high image quality. Here we experimentally demonstrate a helicity multiplexed metasurface hologram with high efficiency and good image fidelity over a broad range of frequencies. The metasurface hologram features the combination of two sets of hologram patterns operating with opposite incident helicities. Two symmetrically distributed off-axis images are interchangeable by controlling the helicity of the input light. The demonstrated helicity multiplexed metasurface hologram with its high performance opens avenues for future applications with functionality switchable optical devices.
Signal multiplexing scheme for LINAC
International Nuclear Information System (INIS)
Sujo, C.I.; Mohan, Shyam; Joshi, Gopal; Singh, S.K.; Karande, Jitendra
2004-01-01
For the proper operation of the LINAC some signals, RF (radio frequency) as well as LF (low frequency) have to be available at the Master Control Station (MCS). These signals are needed to control, calibrate and characterize the RF fields in the resonators. This can be achieved by proper multiplexing of various signals locally and then routing the selected signals to the MCS. A multiplexing scheme has been designed and implemented, which will allow the signals from the selected cavity to the MCS. High isolation between channels and low insertion loss for a given signal are important issues while selecting the multiplexing scheme. (author)
Group-Orthogonal Code-Division Multiplex: A Physical-Layer Enhancement for IEEE 802.11n Networks
Directory of Open Access Journals (Sweden)
Felip Riera-Palou
2010-01-01
Full Text Available The new standard for wireless local area networks (WLANs, named IEEE 802.11n, has been recently released. This new norm builds upon and remains compatible with the previous WLANs standards IEEE 802.11a/g while it is able to achieve transmission rates of up to 600 Mbps. These increased data rates are mainly a consequence of two important new features: (1 multiple antenna technology at transmission and reception, and (2 optional doubling of the system bandwidth thanks to the availability of an additional 20 MHz band. This paper proposes the use of Group-Orthogonal Code Division Multiplex (GO-CDM as a means to improve the performance of the 802.11n standard by further exploiting the inherent frequency diversity. It is explained why GO-CDM synergistically matches with the two aforementioned new features and the performance gains it can offer under different configurations is illustrated. Furthermore, the effects that group-orthogonal has on key implementation issues such as channel estimation, carrier frequency offset, and peak-to-average power ratio (PAPR are also considered.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
Daetwyler, Hans D; Hayden, Matthew J; Spangenberg, German C; Hayes, Ben J
2015-08-01
Doubled haploids are routinely created and phenotypically selected in plant breeding programs to accelerate the breeding cycle. Genomic selection, which makes use of both phenotypes and genotypes, has been shown to further improve genetic gain through prediction of performance before or without phenotypic characterization of novel germplasm. Additional opportunities exist to combine genomic prediction methods with the creation of doubled haploids. Here we propose an extension to genomic selection, optimal haploid value (OHV) selection, which predicts the best doubled haploid that can be produced from a segregating plant. This method focuses selection on the haplotype and optimizes the breeding program toward its end goal of generating an elite fixed line. We rigorously tested OHV selection breeding programs, using computer simulation, and show that it results in up to 0.6 standard deviations more genetic gain than genomic selection. At the same time, OHV selection preserved a substantially greater amount of genetic diversity in the population than genomic selection, which is important to achieve long-term genetic gain in breeding populations. Copyright © 2015 by the Genetics Society of America.
Signal-to-noise ratios of multiplexing spectrometers in high backgrounds
Knacke, R. F.
1978-01-01
Signal-to-noise ratios and the amount of multiplexing gain achieved with a Michelson spectrometer during detector and background noise are studied. Noise caused by the warm background is found in 10 and 20-micron atmospheric windows in high resolution Fourier spectroscopy. An equation is derived for the signal-to-noise ratio based on the number of channels, total time to obtain the complete spectrum, the signal power in one spectral element, and the detector noise equivalent power in the presence of negligible background. Similar expressions are derived for backgrounds yielding a noise equivalent power to a spectral element, and backgrounds having flat spectra in the frequency range under investigation.
Distributed MIMO chaotic radar based on wavelength-division multiplexing technology.
Yao, Tingfeng; Zhu, Dan; Ben, De; Pan, Shilong
2015-04-15
A distributed multiple-input multiple-output chaotic radar based on wavelength-division multiplexing technology (WDM) is proposed and demonstrated. The wideband quasi-orthogonal chaotic signals generated by different optoelectronic oscillators (OEOs) are emitted by separated antennas to gain spatial diversity against the fluctuation of a target's radar cross section and enhance the detection capability. The received signals collected by the receive antennas and the reference signals from the OEOs are delivered to the central station for joint processing by exploiting WDM technology. The centralized signal processing avoids precise time synchronization of the distributed system and greatly simplifies the remote units, which improves the localization accuracy of the entire system. A proof-of-concept experiment for two-dimensional localization of a metal target is demonstrated. The maximum position error is less than 6.5 cm.
Malik, Muhammad Talha
2014-09-01
We propose a new bit-interleaved coded modulation (BICM)-based cooperative communication system where different BICM modules can be optimized jointly considering the average signal to noise ratios of the direct and the two-hop Rayleigh fading channels. As such, the full benefit of BICM can be exploited in the context of cooperative communication. Our design considers cooperative communication systems with so called max-min relay selection scheme that has no loss in performance in terms of diversity- multiplexing trade off in orthogonal cooperation. The presented numerical results for rate 1/2 convolutional code with 8-ary pulse amplitude modulation equivalently 64-ary quadrature amplitude modulation show that the proposed design can offer gains up to 1.4 dB over the traditional BICM design for a target bit error rate of 10-6. Moreover the results show that the amount of gain depends on the relays\\' positions and increases with the number of relays available for selection.
Amphawan, Angela; Ghazi, Alaan; Al-dawoodi, Aras
2017-11-01
A free-space optics mode-wavelength division multiplexing (MWDM) system using Laguerre-Gaussian (LG) modes is designed using decision feedback equalization for controlling mode coupling and combating inter symbol interference so as to increase channel diversity. In this paper, a data rate of 24 Gbps is achieved for a FSO MWDM channel of 2.6 km in length using feedback equalization. Simulation results show significant improvement in eye diagrams and bit-error rates before and after decision feedback equalization.
Immunization of Epidemics in Multiplex Networks
Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo
2014-01-01
Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks. PMID:25401755
Immunization of epidemics in multiplex networks.
Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo
2014-01-01
Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks.
A novel IPTV program multiplex access system to EPON
Xu, Xian; Liu, Deming; He, Wei; Lu, Xi
2007-11-01
With the rapid development of high speed networks, such as Ethernet Passive Optical Network (EPON), traffic patterns in access networks have evolved from traditional text-oriented service to the mixed text-, voice- and video- based services, leading to so called "Triple Play". For supporting IPTV service in EPON access network infrastructure, in this article we propose a novel IPTV program multiplex access system to EPON, which enables multiple IPTV program source servers to seamlessly access to IPTV service access port of optical line terminal (OLT) in EPON. There are two multiplex schemes, namely static multiplex scheme and dynamic multiplex scheme, in implementing the program multiplexing. Static multiplex scheme is to multiplex all the IPTV programs and forward them to the OLT, regardless of the need of end-users. While dynamic multiplex scheme can dynamically multiplex and forward IPTV programs according to what the end-users actually demand and those watched by no end-user would not be multiplexed. By comparing these two schemes, a reduced traffic of EPON can be achieved by using dynamic multiplex scheme, especially when most end-users are watching the same few IPTV programs. Both schemes are implemented in our system, with their hardware and software designs described.
Frequency-domain multiplex with eight-input SQUID and readout electronics over 1MHz
International Nuclear Information System (INIS)
Masui, K.; Takei, Y.; Ikeda, H.; Kimura, S.; Mitsuda, K.; Yamasaki, N.Y.
2006-01-01
In a magnetic summation method, TES and SQUID driving circuits are isolated and thus small crosstalk and stray impedance are expected. Since a FLL circuit with a large bandwidth and a small noise level is required for a SQUID, we designed and produced an electronics to meet our design of multiplexing with an 8-input SQUID. The FLL circuit achieved an open loop-gain bandwidth product of 8MHz with 1m wire length, which is enough for a TES to be operated with a bias current of 70μA, and a noise level of 30pA/Hz
Energy Technology Data Exchange (ETDEWEB)
Takei, Y; Yamasaki, N Y; Hirakoso, W; Kimura, S; Mitsuda, K, E-mail: takei@astro.isas.jaxa.j [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Sagamihara, 229-8510 (Japan)
2009-11-15
A microcalorimeter array based on a transition-edge sensor (TES) thermometer is a promising imaging spectrometer for use in future x-ray astronomy missions. A TES microcalorimeter achieves {approx}<5 eV energy resolution and an array of >100 pixels also provides a moderate imaging capability. For a large format array, signal multiplexing at the low temperature stage is mandatory in order to reduce heat loads from cold stage preamplifiers and through wirings. We are developing frequency division multiplexing (FDM). In FDM, each TES is ac-biased with a different carrier frequency. Signals from several pixels are summed and then read out by one dc SQUID (superconducting quantum interference device). The maximum number of multiplexed pixels is limited by the bandwidth of a SQUID in a flux-locked loop. Assuming 1 m cable length between the room temperature and the cold stage, the bandwidth is only <1 MHz with a standard flux-locked loop, due to the delay and phase shift of wirings. We report our development of baseband feedback, a new feedback scheme that overcomes the bandwidth limitation. In baseband feedback, the signal ({approx}<10 kHz) from the TES is sent back to the SQUID after the phase of carrier frequency ({approx}1 MHz) has been adjusted. We demonstrated open-loop gain of 8 for 10 kHz signal at 5 MHz carrier frequency, which indicates the possibility of {approx}40-pixel multiplexing of the TES signal.
Immunization of epidemics in multiplex networks.
Directory of Open Access Journals (Sweden)
Dawei Zhao
Full Text Available Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted immunization and layer node-based random (targeted immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF networks.
Directory of Open Access Journals (Sweden)
Amphawan Angela
2017-01-01
Full Text Available A free-space optics mode-wavelength division multiplexing (MWDM system using Laguerre-Gaussian (LG modes is designed using decision feedback equalization for controlling mode coupling and combating inter symbol interference so as to increase channel diversity. In this paper, a data rate of 24 Gbps is achieved for a FSO MWDM channel of 2.6 km in length using feedback equalization. Simulation results show significant improvement in eye diagrams and bit-error rates before and after decision feedback equalization.
An improved empirical model for diversity gain on Earth-space propagation paths
Hodge, D. B.
1981-01-01
An empirical model was generated to estimate diversity gain on Earth-space propagation paths as a function of Earth terminal separation distance, link frequency, elevation angle, and angle between the baseline and the path azimuth. The resulting model reproduces the entire experimental data set with an RMS error of 0.73 dB.
Large resistive 2D Micromegas with genetic multiplexing and some imaging applications
Bouteille, S.; Attié, D.; Baron, P.; Calvet, D.; Magnier, P.; Mandjavidze, I.; Procureur, S.; Riallot, M.
2016-10-01
The performance of the first large resistive Micromegas detectors with 2D readout and genetic multiplexing is presented. These detectors have a 50 × 50cm2 active area and are equipped with 1024 strips both in X- and Y-directions. The same genetic multiplexing pattern is applied on both coordinates, resulting in the compression of signals on 2 × 61 readout channels. Four such detectors have been built at CERN, and extensively tested with cosmics. The resistive strip film allows for very high gain operation, compensating for the charge spread on the 2 dimensions as well as the S / N loss due to the huge, 1 nF input capacitance. This film also creates a significantly different signal shape in the X- and Y-coordinates due to the charge evacuation along the resistive strips. All in all a detection efficiency above 95% is achieved with a 1 cm drift gap. Though not yet optimal, the measured 300 μm spatial resolution allows for very precise imaging in the field of muon tomography, and some applications of these detectors are presented.
Real-time ESI-MS of enzymatic conversion: impact of organic solvents and multiplexing.
Scheerle, Romy K; Grassmann, Johanna; Letzel, Thomas
2012-01-01
Different enzymatic assays were characterized systematically by real-time electrospray ionization mass spectrometry (ESI-MS) in the presence of organic solvents as well as in multiplex approaches and in a combination of both. Typically, biological enzymatic reactions are studied in aqueous solutions, since most enzymes show their full activity solely in aqueous solutions. However, in recent years, the use of organic solvents in combination with enzymatic reactions has gained increasing interest due to biotechnological advantages in chemical synthesis, development of online coupled setups screening for enzyme regulatory compounds, advantages regarding mass spectrometric detection and others. In the current study, the influence of several common organic solvents (methanol, ethanol, isopropanol, acetone, acetonitrile) on enzymatic activity (hen egg white lysozyme, chitinase, α-chymotrypsin, elastase from human neutrophils and porcine pancreas, acetylcholinesterase) was tested. Moreover, multiplexing is a promising approach enabling fast and cost-efficient screening methods, e.g. for determination of inhibitors in complex mixtures or in the field of biomedical research. Although in multiplexed setups the enzymatic activity may be affected by the presence of other substrates and/or enzymes, the expected advantages possibly will predominate. To investigate those effects, we measured multiple enzymatic assays simultaneously. For all conducted measurements, the conversion rate of the substrate(s) was calculated, which reflects the enzymatic activity. The results provide an overview about the susceptibility of the selected enzymes towards diverse factors and a reference point for many applications in analytical chemistry and biotechnology.
Genetic diversity and selection gain in the physic nut (Jatropha curcas).
Brasileiro, B P; Silva, S A; Souza, D R; Santos, P A; Oliveira, R S; Lyra, D H
2013-07-08
The use of efficient breeding methods depends on knowledge of genetic control of traits to be improved. We estimated genetic parameters, selection gain, and genetic diversity in physic nut half-sib families, in order to provide information for breeding programs of this important biofuel species. The progeny test included 20 half-sib families in 4 blocks and 10 plants per plot. The mean progeny heritability values were: 50% for number of bunches, 47% for number of fruits, 35% for number of seeds, 6% for stem diameter, 26% for number of primary branches, 14% for number of secondary branches, 66% for plant height, and 25% for survival of the plants, demonstrating good potential for early selection in plant height, number of branches, and number of fruits per plant. In the analysis of genetic diversity, genotypes were divided into 4 groups. Genotypes 18, 19, 20, and 8 clustered together and presented the highest means for the vegetative and production. Lower means were observed in the 17, 12, 13, and 9 genotypes from the same group. We detected genetic variability in this population, with high heritability estimates and accuracy, demonstrating the possibility of obtaining genetic gains for vegetative characters and production at 24 months after planting.
Optical gain in colloidal quantum dots achieved with direct-current electrical pumping
Lim, Jaehoon; Park, Young-Shin; Klimov, Victor I.
2018-01-01
Chemically synthesized semiconductor quantum dots (QDs) can potentially enable solution-processable laser diodes with a wide range of operational wavelengths, yet demonstrations of lasing from the QDs are still at the laboratory stage. An important challenge--realization of lasing with electrical injection--remains unresolved, largely due to fast nonradiative Auger recombination of multicarrier states that represent gain-active species in the QDs. Here we present population inversion and optical gain in colloidal nanocrystals realized with direct-current electrical pumping. Using continuously graded QDs, we achieve a considerable suppression of Auger decay such that it can be outpaced by electrical injection. Further, we apply a special current-focusing device architecture, which allows us to produce high current densities (j) up to ~18 A cm-2 without damaging either the QDs or the injection layers. The quantitative analysis of electroluminescence and current-modulated transmission spectra indicates that with j = 3-4 A cm-2 we achieve the population inversion of the band-edge states.
Diversity of Salmonella isolates from central Florida surface waters.
McEgan, Rachel; Chandler, Jeffrey C; Goodridge, Lawrence D; Danyluk, Michelle D
2014-11-01
Identification of Salmonella serotypes is important for understanding the environmental diversity of the genus Salmonella. This study evaluates the diversity of Salmonella isolates recovered from 165 of 202 Central Florida surface water samples and investigates whether the serotype of the environmental Salmonella isolates can be predicted by a previously published multiplex PCR assay (S. Kim, J. G. Frye, J. Hu, P. J. Fedorka-Cray, R. Gautom, and D. S. Boyle, J. Clin. Microbiol. 44:3608-3615, 2006, http://dx.doi.org/10.1128/JCM.00701-06). Multiplex PCR was performed on 562 Salmonella isolates (as many as 36 isolates per water sample) to predict serotypes. Kauffmann-White serogrouping was used to confirm multiplex PCR pattern groupings before isolates were serotyped, analyzed by pulsed-field gel electrophoresis, and assayed for antimicrobial susceptibility. In 41.2% of the Salmonella-positive water samples, all Salmonella isolates had identical multiplex PCR patterns; in the remaining 58.8%, two or more multiplex PCR patterns were identified. Within each sample, isolates with matching multiplex PCR patterns had matching serogroups. The multiplex patterns of 495 isolates (88.1%) did not match any previously reported pattern. The remaining 68 isolates matched reported patterns but did not match the serotypes for those patterns. The use of the multiplex PCR allowed the number of isolates requiring further analysis to be reduced to 223. Thirty-three Salmonella enterica serotypes were identified; the most frequent included serotypes Muenchen, Rubislaw, Anatum, Gaminara, and IV_50:z4,z23:-. A majority (141/223) of Salmonella isolates clustered into one genotypic group. Salmonella isolates in Central Florida surface waters are serotypically, genotypically, and phenotypically (in terms of antimicrobial susceptibility) diverse. While isolates could be grouped as different or potentially the same using multiplex PCR, the multiplex PCR pattern did not predict the Salmonella
Shift-Peristrophic Multiplexing for High Density Holographic Data Storage
Directory of Open Access Journals (Sweden)
Zenta Ushiyama
2014-03-01
Full Text Available Holographic data storage is a promising technology that provides very large data storage capacity, and the multiplexing method plays a significant role in increasing this capacity. Various multiplexing methods have been previously researched. In the present study, we propose a shift-peristrophic multiplexing technique that uses spherical reference waves, and experimentally verify that this method efficiently increases the data capacity. In the proposed method, a series of holograms is recorded with shift multiplexing, in which the recording material is rotated with its axis perpendicular to the material’s surface. By iterating this procedure, multiplicity is shown to improve. This method achieves more than 1 Tbits/inch2 data density recording. Furthermore, a capacity increase of several TB per disk is expected by maximizing the recording medium performance.
Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.
Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D
2010-10-01
Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.
Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels
Zafar, Ammar
2013-05-21
We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.
Miniaturized high-temperature superconducting multiplexer with cascaded quadruplet structure
Xu, Zhang; Jingping, Liu; Shaolin, Yan; Lan, Fang; Bo, Zhang; Xinjie, Zhao
2015-06-01
In this paper, compact high temperature superconducting (HTS) multiplexers are presented for satellite communication applications. The first multiplexer consists of an input coupling node and three high-order bandpass filters, which is named triplexer. The node is realized by a loop microstrip line instead of conventional T-junction to eliminate the redundant susceptance due to combination of three filters. There are two eight-pole band-pass filters and one ten-pole band-pass filter with cascaded quadruplet structure for realizing high isolation. Moreover, the triplexer is extended to a multiplexer with six channels so as to verify the expansibility of the suggested approach. The triplexer is fabricated using double-sided YBa2Cu3O7 thin films on a 38 × 25 mm2 LaAlO3 substrate. The experimental results, when compared with those ones from the T-junction multiplexer, show that our multiplexer has lower insertion loss, smaller sizes and higher isolation between any two channels. Also, good agreement has been achieved between simulations and measurements, which illustrate the effectiveness of our methods for the design of high performance HTS multiplexers.
Orthogonal Multi-Carrier DS-CDMA with Frequency-Domain Equalization
Tanaka, Ken; Tomeba, Hiromichi; Adachi, Fumiyuki
Orthogonal multi-carrier direct sequence code division multiple access (orthogonal MC DS-CDMA) is a combination of orthogonal frequency division multiplexing (OFDM) and time-domain spreading, while multi-carrier code division multiple access (MC-CDMA) is a combination of OFDM and frequency-domain spreading. In MC-CDMA, a good bit error rate (BER) performance can be achieved by using frequency-domain equalization (FDE), since the frequency diversity gain is obtained. On the other hand, the conventional orthogonal MC DS-CDMA fails to achieve any frequency diversity gain. In this paper, we propose a new orthogonal MC DS-CDMA that can obtain the frequency diversity gain by applying FDE. The conditional BER analysis is presented. The theoretical average BER performance in a frequency-selective Rayleigh fading channel is evaluated by the Monte-Carlo numerical computation method using the derived conditional BER and is confirmed by computer simulation of the orthogonal MC DS-CDMA signal transmission.
Phoenix II energy extraction and angular multiplexing experiments
International Nuclear Information System (INIS)
Hoffman, J.M.; Hays, G.N.
1981-08-01
The energy extraction efficiency as a function of input intensity has been determined from a large-volume HF amplifier. For an input intensity of 4 x 10 6 W/cm 2 , 1080 Joules was extracted from the amplifier. This corresponded to an energy extraction efficiency of 0.90. At the highest H 2 /F 2 /O 2 pressures used, 1700 Joules was obtained from this system when used in an oscillator configuration. These results also show evidence that energy extraction at low input intensities in large-volume HF amplifiers is strongly influenced by parasitic oscillations. The results also indicate that, for a long-pulse HF amplifier (60-nsec electron beam), the timing between the amplifier and oscillator to achieve optimum operating conditions is not very critical. This same amplifier, used in conjunction with a short-pulse, good-beam-quality oscillator-preamplifier chain, has also been used to evaluate pulse compression using angular multiplexing. Using two sequential 24-nsec pulses, the essential elements of angular multiplexing have been evaluated as a function of interpulse separation time. Included are energy extraction efficiency, overall temporal pulse distortion, leading-edge contrast-ratio distortion, and suppression of amplified spontaneous emission relative to a single, long-duration input pulse. For appropriate interpulse delay time, we show that distortionless amplification is possible with energy-extraction efficiency the same as is obtained using a single input beam having a pulse width equal to the duration of the amplifier gain
DEFF Research Database (Denmark)
Zheng, Xueyan; Liu, Fenghai; Wolfson, David
2000-01-01
Noise suppression at 10 Gbit/s and 20 Gbit/s is demonstrated using a gain saturated semiconductor optical amplifier (SOA) and a polarization multiplexing technique, where no impairments like waveform distortion and extinction ratio degradation caused by the gain saturation of the SOA appear. More...
Recent Progress in Space-Division Multiplexed Transmission Technologies
DEFF Research Database (Denmark)
Morioka, Toshio
2013-01-01
Recent development of transmission technologies based on space-division multiplexing is described with future perspectives including a recent achievement of one Pb/s transmission in a single strand of fiber....
Opinion formation on multiplex scale-free networks
Nguyen, Vu Xuan; Xiao, Gaoxi; Xu, Xin-Jian; Li, Guoqi; Wang, Zhen
2018-01-01
Most individuals, if not all, live in various social networks. The formation of opinion systems is an outcome of social interactions and information propagation occurring in such networks. We study the opinion formation with a new rule of pairwise interactions in the novel version of the well-known Deffuant model on multiplex networks composed of two layers, each of which is a scale-free network. It is found that in a duplex network composed of two identical layers, the presence of the multiplexity helps either diminish or enhance opinion diversity depending on the relative magnitudes of tolerance ranges characterizing the degree of openness/tolerance on both layers: there is a steady separation between different regions of tolerance range values on two network layers where multiplexity plays two different roles, respectively. Additionally, the two critical tolerance ranges follow a one-sum rule; that is, each of the layers reaches a complete consensus only if the sum of the tolerance ranges on the two layers is greater than a constant approximately equaling 1, the double of the critical bound on a corresponding isolated network. A further investigation of the coupling between constituent layers quantified by a link overlap parameter reveals that as the layers are loosely coupled, the two opinion systems co-evolve independently, but when the inter-layer coupling is sufficiently strong, a monotonic behavior is observed: an increase in the tolerance range of a layer causes a decline in the opinion diversity on the other layer regardless of the magnitudes of tolerance ranges associated with the layers in question.
Multiplex congruence network of natural numbers.
Yan, Xiao-Yong; Wang, Wen-Xu; Chen, Guan-Rong; Shi, Ding-Hua
2016-03-31
Congruence theory has many applications in physical, social, biological and technological systems. Congruence arithmetic has been a fundamental tool for data security and computer algebra. However, much less attention was devoted to the topological features of congruence relations among natural numbers. Here, we explore the congruence relations in the setting of a multiplex network and unveil some unique and outstanding properties of the multiplex congruence network. Analytical results show that every layer therein is a sparse and heterogeneous subnetwork with a scale-free topology. Counterintuitively, every layer has an extremely strong controllability in spite of its scale-free structure that is usually difficult to control. Another amazing feature is that the controllability is robust against targeted attacks to critical nodes but vulnerable to random failures, which also differs from ordinary scale-free networks. The multi-chain structure with a small number of chain roots arising from each layer accounts for the strong controllability and the abnormal feature. The multiplex congruence network offers a graphical solution to the simultaneous congruences problem, which may have implication in cryptography based on simultaneous congruences. Our work also gains insight into the design of networks integrating advantages of both heterogeneous and homogeneous networks without inheriting their limitations.
Computer Games for the Math Achievement of Diverse Students
Kim, Sunha; Chang, Mido
2010-01-01
Although computer games as a way to improve students' learning have received attention by many educational researchers, no consensus has been reached on the effects of computer games on student achievement. Moreover, there is lack of empirical research on differential effects of computer games on diverse learners. In response, this study…
Programming cells by multiplex genome engineering and accelerated evolution.
Wang, Harris H; Isaacs, Farren J; Carr, Peter A; Sun, Zachary Z; Xu, George; Forest, Craig R; Church, George M
2009-08-13
The breadth of genomic diversity found among organisms in nature allows populations to adapt to diverse environments. However, genomic diversity is difficult to generate in the laboratory and new phenotypes do not easily arise on practical timescales. Although in vitro and directed evolution methods have created genetic variants with usefully altered phenotypes, these methods are limited to laborious and serial manipulation of single genes and are not used for parallel and continuous directed evolution of gene networks or genomes. Here, we describe multiplex automated genome engineering (MAGE) for large-scale programming and evolution of cells. MAGE simultaneously targets many locations on the chromosome for modification in a single cell or across a population of cells, thus producing combinatorial genomic diversity. Because the process is cyclical and scalable, we constructed prototype devices that automate the MAGE technology to facilitate rapid and continuous generation of a diverse set of genetic changes (mismatches, insertions, deletions). We applied MAGE to optimize the 1-deoxy-D-xylulose-5-phosphate (DXP) biosynthesis pathway in Escherichia coli to overproduce the industrially important isoprenoid lycopene. Twenty-four genetic components in the DXP pathway were modified simultaneously using a complex pool of synthetic DNA, creating over 4.3 billion combinatorial genomic variants per day. We isolated variants with more than fivefold increase in lycopene production within 3 days, a significant improvement over existing metabolic engineering techniques. Our multiplex approach embraces engineering in the context of evolution by expediting the design and evolution of organisms with new and improved properties.
Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays
Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.
2010-02-01
An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.
DEFF Research Database (Denmark)
Yang, Jian; Pivnenko, Sergey; Laitinen, Tommi
2010-01-01
This paper presents measurement results of diversity gain and radiation efficiency by using three different measurement techniques: reverberation chamber, spherical near-field anechoic chamber, and multi-probe anechoic chamber. The results are measured over a large 2–8 GHz bandwidth which...
Iacovacci, Jacopo; Rahmede, Christoph; Arenas, Alex; Bianconi, Ginestra
2016-10-01
Recently it has been recognized that many complex social, technological and biological networks have a multilayer nature and can be described by multiplex networks. Multiplex networks are formed by a set of nodes connected by links having different connotations forming the different layers of the multiplex. Characterizing the centrality of the nodes in a multiplex network is a challenging task since the centrality of the node naturally depends on the importance associated to links of a certain type. Here we propose to assign to each node of a multiplex network a centrality called Functional Multiplex PageRank that is a function of the weights given to every different pattern of connections (multilinks) existent in the multiplex network between any two nodes. Since multilinks distinguish all the possible ways in which the links in different layers can overlap, the Functional Multiplex PageRank can describe important non-linear effects when large relevance or small relevance is assigned to multilinks with overlap. Here we apply the Functional Page Rank to the multiplex airport networks, to the neuronal network of the nematode C. elegans, and to social collaboration and citation networks between scientists. This analysis reveals important differences existing between the most central nodes of these networks, and the correlations between their so-called pattern to success.
International Nuclear Information System (INIS)
Gorshkov, V.A.; Kuznetsov, A.N.
1980-01-01
In systems of signal recording from several parallel spectrometric channels one can considerably reduce the total apparatus volume using a special unit - an analog multiplexer. A description of the multiplexer in the CAMAC system on the base of fast linear gating circuits which allows one analog-to-code converter to attend four spectrometric channels is given. On the example of the 4-channel spectrometer the logics of interaction of the multiple with analog-to-digital coxernver and signal recorder is shown. Electrical and functional multiplexer flow-sheets are given and its main characteristics are presented
Time multiplexing for increased FOV and resolution in virtual reality
Miñano, Juan C.; Benitez, Pablo; Grabovičkić, Dejan; Zamora, Pablo; Buljan, Marina; Narasimhan, Bharathwaj
2017-06-01
We introduce a time multiplexing strategy to increase the total pixel count of the virtual image seen in a VR headset. This translates into an improvement of the pixel density or the Field of View FOV (or both) A given virtual image is displayed by generating a succession of partial real images, each representing part of the virtual image and together representing the virtual image. Each partial real image uses the full set of physical pixels available in the display. The partial real images are successively formed and combine spatially and temporally to form a virtual image viewable from the eye position. Partial real images are imaged through different optical channels depending of its time slot. Shutters or other schemes are used to avoid that a partial real image be imaged through the wrong optical channels or at the wrong time slot. This time multiplexing strategy needs real images be shown at high frame rates (>120fps). Available display and shutters technologies are discussed. Several optical designs for achieving this time multiplexing scheme in a compact format are shown. This time multiplexing scheme allows increasing the resolution/FOV of the virtual image not only by increasing the physical pixel density but also by decreasing the pixels switching time, a feature that may be simpler to achieve in certain circumstances.
Ngware, Moses W.; Ciera, James; Musyoka, Peter K.; Oketch, Moses
2015-01-01
This paper examines the contribution of quality mathematics teaching to student achievement gains. Quality of mathematics teaching is assessed through teacher demonstration of the five strands of mathematical proficiency, the level of cognitive task demands, and teacher mathematical knowledge. Data is based on 1907 grade 6 students who sat for the…
Batshon, Hussam G; Djordjevic, Ivan; Schmidt, Ted
2010-09-13
We propose a subcarrier-multiplexed four-dimensional LDPC bit-interleaved coded modulation scheme that is capable of achieving beyond 480 Gb/s single-channel transmission rate over optical channels. Subcarrier-multiplexed four-dimensional LDPC coded modulation scheme outperforms the corresponding dual polarization schemes by up to 4.6 dB in OSNR at BER 10(-8).
Characteristics of Multiplexed Grooved Nozzles for High Flow Rate Electrospray
International Nuclear Information System (INIS)
Kim, Kyoung Tae; Kim, Woo Jin; Kim, Sang Soo
2007-01-01
The electrospray operated in the cone-jet mode can generate highly charged micro droplets in an almost uniform size at flow rates. Therefore, the multiplexing system which can retain the characteristics of the cone-jet mode is inevitable for the electrospray application. This experiment reports the multiplexed grooved nozzle system with the extractor. The effects of the grooves and the extractor on the performance of the electrospray were evaluated through experiments. Using the grooved nozzle, the stable cone-jet mode can be achieved at the each groove in the grooved mode. Furthermore, the number of nozzles per unit area is increased by the extractor. The multiplexing density is 12 jets per cm 2 at 30 mm distance from the nozzle tip to the ground plate. The multiplexing system for the high flow rate electrospray is realized with the extractor which can diminish the space charge effect without sacrificing characteristics of the cone-jet mode
Statistical Multiplexing of Computations in C-RAN with Tradeoffs in Latency and Energy
DEFF Research Database (Denmark)
Kalør, Anders Ellersgaard; Agurto Agurto, Mauricio Ignacio; Pratas, Nuno
2017-01-01
frame duration, then this may result in additional access latency and limit the energy savings. In this paper we investigate the tradeoff by considering two extreme time-scales for the resource multiplexing: (i) long-term, where the computational resources are adapted over periods much larger than...... the access frame durations; (ii) short-term, where the adaption is below the access frame duration.We develop a general C-RAN queuing model that models the access latency and show, for Poisson arrivals, that long-term multiplexing achieves savings comparable to short-term multiplexing, while offering low...
Three mode Er3+ ring-doped fiber amplifier for mode-division multiplexed transmission
Jung, Y.; Kang, Q.; Sleiffer, V.A.J.M.; Inan, B.; Kuschnerov, M.; Veljanovski, V.; Corbett, B.; Winfield, R.; Li, Z.; Teh, P.S.; Dhar, A.; Sahu, J.K.; Poletti, F.; Alam, S.U.; Richardson, D.J.
2013-01-01
We successfully fabricate three-mode erbium doped fiber with a confined Er3+ doped ring structure and experimentally characterize the amplifier performance with a view to mode-division multiplexed (MDM) transmission. The differential modal gain was effectively mitigated by controlling the relative
Demonstration of Time Domain Multiplexed Readout for Magnetically Coupled Calorimeters
Porst, J.-P.; Adams, J. S.; Balvin, M.; Bandler, S.; Beyer, J.; Busch, S. E.; Drung, D.; Seidel, G. M.; Smith, S. J.; Stevenson, T. R.
2012-01-01
Magnetically coupled calorimeters (MCC) have extremely high potential for x-ray applications due to the inherent high energy resolution capability and being non-dissipative. Although very high energy-resolution has been demonstrated, until now there has been no demonstration of multiplexed read-out. We report on the first realization of a time domain multiplexed (TDM) read-out. While this has many similarities with TDM of transition-edge-sensors (TES), for MGGs the energy resolution is limited by the SQUID read-out noise and requires the well established scheme to be altered in order to minimize degradation due to noise aliasing effects. In cur approach, each pixel is read out by a single first stage SQUID (SQ1) that is operated in open loop. The outputs of the SQ1 s are low-pass filtered with an array of low cross-talk inductors, then fed into a single-stage SQUID TD multiplexer. The multiplexer is addressed from room temperature and read out through a single amplifier channel. We present results achieved with a new detector platform. Noise performance is presented and compared to expectations. We have demonstrated multiplexed X-ray spectroscopy at 5.9keV with delta_FWHM=10eV. In an optimized setup, we show it is possible to multiplex 32 detectors without significantly degrading the Intrinsic detector resolution.
Mitra, Abhishek; Skrzypczak, Magdalena; Ginalski, Krzysztof; Rowicka, Maga
2015-01-01
Sequencing microRNA, reduced representation sequencing, Hi-C technology and any method requiring the use of in-house barcodes result in sequencing libraries with low initial sequence diversity. Sequencing such data on the Illumina platform typically produces low quality data due to the limitations of the Illumina cluster calling algorithm. Moreover, even in the case of diverse samples, these limitations are causing substantial inaccuracies in multiplexed sample assignment (sample bleeding). Such inaccuracies are unacceptable in clinical applications, and in some other fields (e.g. detection of rare variants). Here, we discuss how both problems with quality of low-diversity samples and sample bleeding are caused by incorrect detection of clusters on the flowcell during initial sequencing cycles. We propose simple software modifications (Long Template Protocol) that overcome this problem. We present experimental results showing that our Long Template Protocol remarkably increases data quality for low diversity samples, as compared with the standard analysis protocol; it also substantially reduces sample bleeding for all samples. For comprehensiveness, we also discuss and compare experimental results from alternative approaches to sequencing low diversity samples. First, we discuss how the low diversity problem, if caused by barcodes, can be avoided altogether at the barcode design stage. Second and third, we present modified guidelines, which are more stringent than the manufacturer's, for mixing low diversity samples with diverse samples and lowering cluster density, which in our experience consistently produces high quality data from low diversity samples. Fourth and fifth, we present rescue strategies that can be applied when sequencing results in low quality data and when there is no more biological material available. In such cases, we propose that the flowcell be re-hybridized and sequenced again using our Long Template Protocol. Alternatively, we discuss how
Directory of Open Access Journals (Sweden)
Abhishek Mitra
Full Text Available Sequencing microRNA, reduced representation sequencing, Hi-C technology and any method requiring the use of in-house barcodes result in sequencing libraries with low initial sequence diversity. Sequencing such data on the Illumina platform typically produces low quality data due to the limitations of the Illumina cluster calling algorithm. Moreover, even in the case of diverse samples, these limitations are causing substantial inaccuracies in multiplexed sample assignment (sample bleeding. Such inaccuracies are unacceptable in clinical applications, and in some other fields (e.g. detection of rare variants. Here, we discuss how both problems with quality of low-diversity samples and sample bleeding are caused by incorrect detection of clusters on the flowcell during initial sequencing cycles. We propose simple software modifications (Long Template Protocol that overcome this problem. We present experimental results showing that our Long Template Protocol remarkably increases data quality for low diversity samples, as compared with the standard analysis protocol; it also substantially reduces sample bleeding for all samples. For comprehensiveness, we also discuss and compare experimental results from alternative approaches to sequencing low diversity samples. First, we discuss how the low diversity problem, if caused by barcodes, can be avoided altogether at the barcode design stage. Second and third, we present modified guidelines, which are more stringent than the manufacturer's, for mixing low diversity samples with diverse samples and lowering cluster density, which in our experience consistently produces high quality data from low diversity samples. Fourth and fifth, we present rescue strategies that can be applied when sequencing results in low quality data and when there is no more biological material available. In such cases, we propose that the flowcell be re-hybridized and sequenced again using our Long Template Protocol. Alternatively
Park, Kihong
2011-12-01
We consider optical wireless communication which can be utilized for illumination and communication by relying on lighting devices. Due to the limited bandwidth of optical sources, it is challenging to achieve high data rate in optical wireless systems. In order to obtain a multiplexing gain and high spectral efficiency, we design an optical multi-input multi-output (MIMO) system utilizing a singular value decomposition-based spatial multiplexing and adaptive modulation. We note that the conventional allocation method in radio frequency MIMO channels cannot be applied directly to the optical intensity channels. In this paper, we generalize the result of power allocation method in [1] for arbitrary number of transmit and receive antennas in optical wireless MIMO systems. Based on three constraints, namely, the nonnegativity, the aggregate optical power, and the bit error rate requirement, we propose a novel method to allocate the optical power, the offset value, and the modulation size for maximum sum rate. From some selected simulation results, we show that our proposed allocation method gives a better spectral efficiency than the method that allocates the optical power equally for each data stream. © 2011 IEEE.
High resolution multiplexed functional imaging in live embryos (Conference Presentation)
Xu, Dongli; Zhou, Weibin; Peng, Leilei
2017-02-01
Fourier multiplexed fluorescence lifetime imaging (FmFLIM) scanning laser optical tomography (FmFLIM-SLOT) combines FmFLIM and Scanning laser optical tomography (SLOT) to perform multiplexed 3D FLIM imaging of live embryos. The system had demonstrate multiplexed functional imaging of zebrafish embryos genetically express Foster Resonant Energy Transfer (FRET) sensors. However, previous system has a 20 micron resolution because the focused Gaussian beam diverges quickly from the focused plane, makes it difficult to achieve high resolution imaging over a long projection depth. Here, we present a high-resolution FmFLIM-SLOT system with achromatic Bessel beam, which achieves 3 micron resolution in 3D deep tissue imaging. In Bessel-FmFLIM-SLOT, multiple laser excitation lines are firstly intensity modulated by a Michelson interferometer with a spinning polygon mirror optical delay line, which enables Fourier multiplexed multi-channel lifetime measurements. Then, a spatial light modulator and a prism are used to transform the modulated Gaussian laser beam to an achromatic Bessel beam. The achromatic Bessel beam scans across the whole specimen with equal angular intervals as sample rotated. After tomography reconstruction and the frequency domain lifetime analysis method, both the 3D intensity and lifetime image of multiple excitation-emission can be obtained. Using Bessel-FmFLIM-SLOT system, we performed cellular-resolution FLIM tomography imaging of live zebrafish embryo. Genetically expressed FRET sensors in these embryo will allow non-invasive observation of multiple biochemical processes in vivo.
Feasibility of achieving gain in transition to the ground state of C VI at 3.4 nm
International Nuclear Information System (INIS)
Avitzour, Yoav; Suckewer, Szymon
2007-01-01
We present numerical studies of recombination gain in the transition to the ground state of H-like C (2→1 transition at λ=3.4 nm). It is shown that high gain (up to about 180 cm -1 ) can be achieved using currently available, relatively compact, laser technology. The model includes the ionization of the plasma by an ultraintense, ultrashort laser pulse, followed by plasma expansion, cooling, and recombination. Transient population inversion is generated during the recombination process. We investigate the behavior of the gain with respect to different plasma parameters and pump pulse parameters and explain how the different properties of the plasma and the pump pulse affect the gain
Valentin, Jose R.
1990-01-01
The principles of the multiplex gas chromatography (GC) technique, which is a possible candidate for chemical analysis of planetary atmospheres, are discussed. Particular attention is given to the chemical modulators developed by present investigators for multiplex GC, namely, the thermal-desorption, thermal-decomposition, and catalytic modulators, as well as to mechanical modulators. The basic technique of multiplex GC using chemical modulators and a mechanical modulator is demonstrated. It is shown that, with the chemical modulators, only one gas stream consisting of the carrier in combination with the components is being analyzed, resulting in a simplified instrument that requires relatively few consumables. The mechanical modulator demonstrated a direct application of multiplex GC for the analysis of gases in atmosphere of Titan at very low pressures.
Pei, Xiaojing; Yin, Haoyan; Lai, Tiancheng; Zhang, Junlong; Liu, Feng; Xu, Xiao; Li, Na
2018-01-16
The sensitive multiplexed detection of nucleic acids in a single sample by a simple manner is of pivotal importance for the diagnosis and therapy of human diseases. Herein, we constructed an automatic fluorescent nanoparticle (FNP) counting platform with a common fluorescence microscopic imaging setup for nonamplification multiplexed detection of attomoles of nucleic acids. Taking the advantages of the highly bright, multicolor emitting FNPs and magnetic separation, the platform enables sensitive multiplexed detection without the need for extra fluorescent labels. Quantification for multiplex DNAs, multiplex microRNAs (miRNA), as well as a DNA and miRNA mixture was achieved with a similar dynamic range, a limit of detection down to 5 amol (5 μL detection volume), and a 81-115% spike recovery from different biological sample matrices. In particular, the sensitivity for multiplex miRNA is by far among the highest without using amplification or the lock nucleic acid hybridization enhancement strategy. Results regarding miRNA-141 from four different cell lines were agreeable with those of the quantitative reverse transcription polymerase chain reaction. Simultaneous detection of miRNA-141 and miRNA-21 in four different cell lines yielded consistent results with publications, indicating the potential for monitoring multiplex miRNA expression associated with the collaborative regulation of important cellular events. This work expands the rule set of multiplex nucleic acid detection strategies and shows promising potential application in clinical diagnosis.
Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples
Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris
2002-01-01
A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951
Consideration for wavelength multiplexing versus time multiplexing in optical transport network
DEFF Research Database (Denmark)
Limal, Emmanuel; Stubkjær, Kristian Elmholdt
1999-01-01
We compare optical wavelength multiplexing and time multiplexing techniquesfor optical transport network by studying the space switch sizes of OXCs andtheir interfaces as a function of the fraction of add/drop traffic....
Arabaci, Murat; Djordjevic, Ivan B; Saunders, Ross; Marcoccia, Roberto M
2010-02-01
In order to achieve high-speed transmission over optical transport networks (OTNs) and maximize its throughput, we propose using a rate-adaptive polarization-multiplexed coded multilevel modulation with coherent detection based on component non-binary quasi-cyclic (QC) LDPC codes. Compared to prior-art bit-interleaved LDPC-coded modulation (BI-LDPC-CM) scheme, the proposed non-binary LDPC-coded modulation (NB-LDPC-CM) scheme not only reduces latency due to symbol- instead of bit-level processing but also provides either impressive reduction in computational complexity or striking improvements in coding gain depending on the constellation size. As the paper presents, compared to its prior-art binary counterpart, the proposed NB-LDPC-CM scheme addresses the needs of future OTNs, which are achieving the target BER performance and providing maximum possible throughput both over the entire lifetime of the OTN, better.
Extracting information from multiplex networks
Iacovacci, Jacopo; Bianconi, Ginestra
2016-06-01
Multiplex networks are generalized network structures that are able to describe networks in which the same set of nodes are connected by links that have different connotations. Multiplex networks are ubiquitous since they describe social, financial, engineering, and biological networks as well. Extending our ability to analyze complex networks to multiplex network structures increases greatly the level of information that is possible to extract from big data. For these reasons, characterizing the centrality of nodes in multiplex networks and finding new ways to solve challenging inference problems defined on multiplex networks are fundamental questions of network science. In this paper, we discuss the relevance of the Multiplex PageRank algorithm for measuring the centrality of nodes in multilayer networks and we characterize the utility of the recently introduced indicator function Θ ˜ S for describing their mesoscale organization and community structure. As working examples for studying these measures, we consider three multiplex network datasets coming for social science.
Directory of Open Access Journals (Sweden)
Galih Permana Putra
2017-01-01
Full Text Available Teknologi komunikasi nirkabel terus berkembang untuk memenuhi kebutuhan manusia akan koneksi informasi yang cepat, pengiriman data yang berkapasitas besar dan dapat diandalkan. Di dalam proses tersebut banyak sekali gangguan yang dapat mempengaruhi penurunan kinerja komunikasi diantaranya adalah multipath fading [1]. Multi Input Single Output (MISO merupakan salah satu teknik space diversity yang menggunakan banyak antena dengan tujuan untuk mengatasi multipath fading. Adapun pada proses transmisi digunakan teknik Orthogonal Frequency-Division Multiplexing (OFDM yang bertujuan memberikan keuntungan dalam hal efisiensi pada saat transmisi data dan mampu menghindari Inter Simbol Interference (ISI. Pada penelitian ini akan dibandingkan kinerja sistem MISO OFDM dan SISO OFDM yang akan disimulasikan dan di implementasikan pada modul Wireless Open Access Penelitian Platform (WARP untuk mengevaluasi kinerja BER sebagai fungsi dari daya pancar dan jarak variasi. Parameter yang digunakan di dalam pengukuran berdasarkan IEEE 802.11 a/g karena menggunakan frekuensi 2,4 Ghz. Terdapat dua skema pengukuran yaitu SISO OFDM dan MISO OFDM dengan variasi jarak 4,6 dan 8 meter dengan variasi daya pancar -35 s/d -4 dBm dengan peningkatan gain 5 kali secara berkala. Dari dua skema yang dilaksanakan dapat disimpulkan bahwa semakin jauh jarak antara pemancar dan penerima maka dibutuhkan penambahan gain untuk menjaga kualitas data yang dikirimkan. Disamping itu, terdapat perbedaan nilai gain untuk mencapai nilai BER = dibutuhkan penambahan gain = - 33 sedangkan pada SISO OFM dibutuhkan penambahan gain = -18.
Directory of Open Access Journals (Sweden)
Kor-jent van Dijk
2014-11-01
Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
High-Speed Turbo-TCM-Coded Orthogonal Frequency-Division Multiplexing Ultra-Wideband Systems
Directory of Open Access Journals (Sweden)
Wang Yanxia
2006-01-01
Full Text Available One of the UWB proposals in the IEEE P802.15 WPAN project is to use a multiband orthogonal frequency-division multiplexing (OFDM system and punctured convolutional codes for UWB channels supporting a data rate up to 480 Mbps. In this paper, we improve the proposed system using turbo TCM with QAM constellation for higher data rate transmission. We construct a punctured parity-concatenated trellis codes, in which a TCM code is used as the inner code and a simple parity-check code is employed as the outer code. The result shows that the system can offer a much higher spectral efficiency, for example, 1.2 Gbps, which is 2.5 times higher than the proposed system. We identify several essential requirements to achieve the high rate transmission, for example, frequency and time diversity and multilevel error protection. Results are confirmed by density evolution.
Effective admissions practices to achieve greater student diversity in dental schools.
Price, Shelia S; Grant-Mills, Donna
2010-10-01
In this chapter we describe the institutional and policy-level strategies that dental schools in the Pipeline, Profession, and Practice: Community-Based Dental Education program used to modify their admissions practices to increase the diversity of their student bodies. Schools developed and used clear statements recognizing the value of diversity. They incorporated recent U.S. Supreme Court rulings regarding educational diversity into their revised admissions practices; these rulings cited diversity as both a "compelling interest" and its use in only "narrowly tailored" circumstances. We make a case for admissions decisions based on a comprehensive evaluation that balances the quantitative and qualitative qualities of a candidate. It refutes the practice of overreliance on standardized tests by detailing the whole-file review process to measure merit and professional promise. Also described is a range of noncognitive variables (e.g., leadership, ability to sustain academic achievement with competing priorities, volunteerism, communication, social background, and disadvantaged status) that schools can take into consideration in admissions decisions. Admissions committees can tie this comprehensive review of candidates into the case for promoting cross-cultural understanding and enhanced competence to provide care to patients from diverse backgrounds. In addition, the chapter reviews the challenges schools face in developing admissions policies and procedures that reflect the university's mission for diversity. It addresses the importance of a diverse composition of the admissions committee. It also describes how tailored workshops and technical assistance for admissions committees can help schools improve their student diversity and how admissions committees can engage in a process of periodic review of their diversity objectives in relationship to the school's mission.
A monolithic charge multiplexer with 0.5% accuracy
International Nuclear Information System (INIS)
Lewis, J.; McPherson, G.M.; Morrissey, M.C.; Thompson, J.C.; Tucker, A.W.
1990-01-01
This paper describes a 16 channel monolithic charge multiplexer providing a close tolerance, low cost, low power solution to the problem of handling the signals from detectors with large numbers of channels. Outputs may be wire-orred to increase the degree of multiplexing. A system designed with this chip and with suitable close tolerance processing downstream will have a gain match of ±0.5% and a front end chip cost of approximately $1 per channel. The chip is fabricated in CMOS technology and the test of a 1500 channel system has demonstrated the feasibility of CMOS in this context. The chip produces a prompt sum of the charges from the 16 signal sources and integrates and stores the individual charges for later serial readout. A single network provides amplifier bias and releases area to facilitate optimum noise performance and signal handling. Amplifier and bias network design together with p-well screens to isolate storage capacitors from the substrate provide the power line rejection essential in systems generating a trigger from large numbers of channels. (orig.)
Quantum key distribution for 10 Gb/s dense wavelength division multiplexing networks
International Nuclear Information System (INIS)
Patel, K. A.; Dynes, J. F.; Lucamarini, M.; Choi, I.; Sharpe, A. W.; Yuan, Z. L.; Shields, A. J.; Penty, R. V.
2014-01-01
We demonstrate quantum key distribution (QKD) with bidirectional 10 Gb/s classical data channels in a single fiber using dense wavelength division multiplexing. Record secure key rates of 2.38 Mbps and fiber distances up to 70 km are achieved. Data channels are simultaneously monitored for error-free operation. The robustness of QKD is further demonstrated with a secure key rate of 445 kbps over 25 km, obtained in the presence of data lasers launching conventional 0 dBm power. We discuss the fundamental limit for the QKD performance in the multiplexing environment
Opportunities for biodiversity gains under the world's largest reforestation programme
Hua, Fangyuan; Wang, Xiaoyang; Zheng, Xinlei; Fisher, Brendan; Wang, Lin; Zhu, Jianguo; Tang, Ya; Yu, Douglas W.; Wilcove, David S.
2016-01-01
Reforestation is a critical means of addressing the environmental and social problems of deforestation. China's Grain-for-Green Program (GFGP) is the world's largest reforestation scheme. Here we provide the first nationwide assessment of the tree composition of GFGP forests and the first combined ecological and economic study aimed at understanding GFGP's biodiversity implications. Across China, GFGP forests are overwhelmingly monocultures or compositionally simple mixed forests. Focusing on birds and bees in Sichuan Province, we find that GFGP reforestation results in modest gains (via mixed forest) and losses (via monocultures) of bird diversity, along with major losses of bee diversity. Moreover, all current modes of GFGP reforestation fall short of restoring biodiversity to levels approximating native forests. However, even within existing modes of reforestation, GFGP can achieve greater biodiversity gains by promoting mixed forests over monocultures; doing so is unlikely to entail major opportunity costs or pose unforeseen economic risks to households. PMID:27598524
Silicon Chip-to-Chip Mode-Division Multiplexing
DEFF Research Database (Denmark)
Baumann, Jan Markus; Porto da Silva, Edson; Ding, Yunhong
2018-01-01
A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes.......A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes....
Promoting information diffusion through interlayer recovery processes in multiplex networks
Wang, Xin; Li, Weihua; Liu, Longzhao; Pei, Sen; Tang, Shaoting; Zheng, Zhiming
2017-09-01
For information diffusion in multiplex networks, the effect of interlayer contagion on spreading dynamics has been explored in different settings. Nevertheless, the impact of interlayer recovery processes, i.e., the transition of nodes to stiflers in all layers after they become stiflers in any layer, still remains unclear. In this paper, we propose a modified ignorant-spreader-stifler model of rumor spreading equipped with an interlayer recovery mechanism. We find that the information diffusion can be effectively promoted for a range of interlayer recovery rates. By combining the mean-field approximation and the Markov chain approach, we derive the evolution equations of the diffusion process in two-layer homogeneous multiplex networks. The optimal interlayer recovery rate that achieves the maximal enhancement can be calculated by solving the equations numerically. In addition, we find that the promoting effect on a certain layer can be strengthened if information spreads more extensively within the counterpart layer. When applying the model to two-layer scale-free multiplex networks, with or without degree correlation, similar promoting effect is also observed in simulations. Our work indicates that the interlayer recovery process is beneficial to information diffusion in multiplex networks, which may have implications for designing efficient spreading strategies.
Multiplex measuring systems in physics
International Nuclear Information System (INIS)
Soroko, L.M.
1980-01-01
The principles of operation of multiplex devices used in different spheres of physics are discussed. The ''multiplex'' notion means that the data output of the device is an integral image of the functional dependence under investigation, but not its readings as in usual instruments. The analysis of the present state of developments of the multiplex systems in optics, nuclear magnetic resonance spectroscopy, in time-of-flight spectrometers for slow and fast neutrons, as well as elementary particle detectors, is given. The construction algorithms for the digital codes are presented, the history of development of the multiplex measuring principle is given [ru
Integrated photonics : compact multiplexing
Pile, D.; Chen, H.; Uden, van R.G.H.; Okonkwo, C.M.; Koonen, A.M.J.
2015-01-01
Spatial multiplexers (SMUXs) for mode division multiplexing often involve multiple strategies for mode-selective excitation and the minimization of insertion and other losses. Haoshuo Chen, Roy van Uden, Chigo Okonkwo and Ton Koonen, working at the COBRA Institute at the Eindhoven University of
Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.
Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting
2016-01-25
We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.
Broadcast Reserved Opportunity Assisted Diversity Relaying Scheme and Its Performance Evaluation
Directory of Open Access Journals (Sweden)
Xia Chen
2008-05-01
Full Text Available Relay-based transmission can over the benefits in terms of coverage extension as well as throughput improvement if compared to conventional direct transmission. In a relay enhanced cellular (REC network, where multiple mobile terminals act as relaying nodes (RNs, multiuser diversity gain can be exploited. We propose an efficient relaying scheme, referred to as Broadcast Reserved Opportunity Assisted Diversity (BROAD for the REC networks. Unlike the conventional Induced Multiuser Diversity Relaying (IMDR scheme, our scheme acquires channel quality information (CQI in which the destined node (DN sends pilots on a reserved radio resource. The BROAD scheme can significantly decrease the signaling overhead among the mobile RNs while achieving the same multiuser diversity as the conventional IMDR scheme. In addition, an alternative version of the BROAD scheme, named as A-BROAD scheme, is proposed also, in which the candidate RN(s feed back partial or full CQI to the base station (BS for further scheduling purpose. The A-BROAD scheme achieves a higher throughput than the BROAD scheme at the cost of extra signalling overhead. The theoretical analysis given in this paper demonstrates the feasibility of the schemes in terms of their multiuser diversity gains in a REC network.
Dynamic Optically Multiplexed Imaging
2015-07-29
Dynamic Optically Multiplexed Imaging Yaron Rachlin, Vinay Shah, R. Hamilton Shepard, and Tina Shih Lincoln Laboratory, Massachusetts Institute of...V. Shah, and T. Shih “Design Architectures for Optically Multiplexed Imaging,” in submission 9 R. Gupta , P. Indyk, E. Price, and Y. Rachlin
Polarization-multiplexing ghost imaging
Dongfeng, Shi; Jiamin, Zhang; Jian, Huang; Yingjian, Wang; Kee, Yuan; Kaifa, Cao; Chenbo, Xie; Dong, Liu; Wenyue, Zhu
2018-03-01
A novel technique for polarization-multiplexing ghost imaging is proposed to simultaneously obtain multiple polarimetric information by a single detector. Here, polarization-division multiplexing speckles are employed for object illumination. The light reflected from the objects is detected by a single-pixel detector. An iterative reconstruction method is used to restore the fused image containing the different polarimetric information by using the weighted sum of the multiplexed speckles based on the correlation coefficients obtained from the detected intensities. Next, clear images of the different polarimetric information are recovered by demultiplexing the fused image. The results clearly demonstrate that the proposed method is effective.
Coherent optical DFT-spread OFDM transmission using orthogonal band multiplexing.
Yang, Qi; He, Zhixue; Yang, Zhu; Yu, Shaohua; Yi, Xingwen; Shieh, William
2012-01-30
Coherent optical OFDM (CO-OFDM) combined with orthogonal band multiplexing provides a scalable and flexible solution for achieving ultra high-speed rate. Among many CO-OFDM implementations, digital Fourier transform spread (DFT-S) CO-OFDM is proposed to mitigate fiber nonlinearity in long-haul transmission. In this paper, we first illustrate the principle of DFT-S OFDM. We then experimentally evaluate the performance of coherent optical DFT-S OFDM in a band-multiplexed transmission system. Compared with conventional clipping methods, DFT-S OFDM can reduce the OFDM peak-to-average power ratio (PAPR) value without suffering from the interference of the neighboring bands. With the benefit of much reduced PAPR, we successfully demonstrate 1.45 Tb/s DFT-S OFDM over 480 km SSMF transmission.
Multiuser switched diversity scheduling schemes
Shaqfeh, Mohammad; Alnuweiri, Hussein M.; Alouini, Mohamed-Slim
2012-01-01
Multiuser switched-diversity scheduling schemes were recently proposed in order to overcome the heavy feedback requirements of conventional opportunistic scheduling schemes by applying a threshold-based, distributed, and ordered scheduling mechanism. The main idea behind these schemes is that slight reduction in the prospected multiuser diversity gains is an acceptable trade-off for great savings in terms of required channel-state-information feedback messages. In this work, we characterize the achievable rate region of multiuser switched diversity systems and compare it with the rate region of full feedback multiuser diversity systems. We propose also a novel proportional fair multiuser switched-based scheduling scheme and we demonstrate that it can be optimized using a practical and distributed method to obtain the feedback thresholds. We finally demonstrate by numerical examples that switched-diversity scheduling schemes operate within 0.3 bits/sec/Hz from the ultimate network capacity of full feedback systems in Rayleigh fading conditions. © 2012 IEEE.
Multiuser switched diversity scheduling schemes
Shaqfeh, Mohammad
2012-09-01
Multiuser switched-diversity scheduling schemes were recently proposed in order to overcome the heavy feedback requirements of conventional opportunistic scheduling schemes by applying a threshold-based, distributed, and ordered scheduling mechanism. The main idea behind these schemes is that slight reduction in the prospected multiuser diversity gains is an acceptable trade-off for great savings in terms of required channel-state-information feedback messages. In this work, we characterize the achievable rate region of multiuser switched diversity systems and compare it with the rate region of full feedback multiuser diversity systems. We propose also a novel proportional fair multiuser switched-based scheduling scheme and we demonstrate that it can be optimized using a practical and distributed method to obtain the feedback thresholds. We finally demonstrate by numerical examples that switched-diversity scheduling schemes operate within 0.3 bits/sec/Hz from the ultimate network capacity of full feedback systems in Rayleigh fading conditions. © 2012 IEEE.
On-chip mode division multiplexing technologies
DEFF Research Database (Denmark)
Ding, Yunhong; Frellsen, Louise Floor; Guan, Xiaowei
2016-01-01
Space division multiplexing (SDM) is currently widely investigated in order to provide enhanced capacity thanks to the utilization of space as a new degree of multiplexing freedom in both optical fiber communication and on-chip interconnects. Basic components allowing the processing of spatial...... photonic integrated circuit mode (de) multiplexer for few-mode fibers (FMFs)....
Directory of Open Access Journals (Sweden)
Xianyi Chen
2018-01-01
Full Text Available Compared to the encrypted-image-based reversible data hiding (EIRDH method, the encrypted-signals-based reversible data hiding (ESRDH technique is a novel way to achieve a greater embedding rate and better quality of the decrypted signals. Motivated by ESRDH using signal energy transfer, we propose an improved ESRDH method using code division multiplexing and value expansion. At the beginning, each pixel of the original image is divided into several parts containing a little signal and multiple equal signals. Next, all signals are encrypted by Paillier encryption. And then a large number of secret bits are embedded into the encrypted signals using code division multiplexing and value expansion. Since the sum of elements in any spreading sequence is equal to 0, lossless quality of directly decrypted signals can be achieved using code division multiplexing on the encrypted equal signals. Although the visual quality is reduced, high-capacity data hiding can be accomplished by conducting value expansion on the encrypted little signal. The experimental results show that our method is better than other methods in terms of the embedding rate and average PSNR.
Combining target enrichment with barcode multiplexing for high throughput SNP discovery
Directory of Open Access Journals (Sweden)
Lunke Sebastian
2010-11-01
Full Text Available Abstract Background The primary goal of genetic linkage analysis is to identify genes affecting a phenotypic trait. After localisation of the linkage region, efficient genetic dissection of the disease linked loci requires that functional variants are identified across the loci. These functional variations are difficult to detect due to extent of genetic diversity and, to date, incomplete cataloguing of the large number of variants present both within and between populations. Massively parallel sequencing platforms offer unprecedented capacity for variant discovery, however the number of samples analysed are still limited by cost per sample. Some progress has been made in reducing the cost of resequencing using either multiplexing methodologies or through the utilisation of targeted enrichment technologies which provide the ability to resequence genomic areas of interest rather that full genome sequencing. Results We developed a method that combines current multiplexing methodologies with a solution-based target enrichment method to further reduce the cost of resequencing where region-specific sequencing is required. Our multiplex/enrichment strategy produced high quality data with nominal reduction of sequencing depth. We undertook a genotyping study and were successful in the discovery of novel SNP alleles in all samples at uniplex, duplex and pentaplex levels. Conclusion Our work describes the successful combination of a targeted enrichment method and index barcode multiplexing to reduce costs, time and labour associated with processing large sample sets. Furthermore, we have shown that the sequencing depth obtained is adequate for credible SNP genotyping analysis at uniplex, duplex and pentaplex levels.
DEFF Research Database (Denmark)
Porto da Silva, Edson; Yankov, Metodi Plamenov; Da Ros, Francesco
2016-01-01
Gains in achievable information rates from probabilistic shaping and digital backpropagation are compared for WDM transmission of 5 × 10 GBd DP-256QAM/1024QAM up to 1700 km of reach. The combination of both techniques its shown to provide gains of up to ∼0.5 bits/QAM symbol...
Asymptotic analysis for Nakagami-m fading channels with relay selection
Zhong, Caijun
2011-06-01
In this paper, we analyze the asymptotic outage probability performance of both decode-and-forward (DF) and amplify-and-forward (AF) relaying systems using partial relay selection and the "best" relay selection schemes for Nakagami-m fading channels. We derive their respective outage probability expressions in the asymptotic high signal-to-noise ratio (SNR) regime, from which the diversity order and coding gain are analyzed. In addition, we investigate the impact of power allocation between the source and relay terminals and derive the diversity-multiplexing tradeoff (DMT) for these relay selection systems. The theoretical findings suggest that partial relay selection can improve the diversity of the system and can achieve the same DMT as the "best" relay selection scheme under certain conditions. © 2011 IEEE.
Drift chamber and pulse height readout systems using analog multiplexing
International Nuclear Information System (INIS)
Cisneros, E.L; Kang, H.K.; Hall, J.N.; Larsen, R.S.
1976-11-01
Drift chamber and pulse-height readout systems are being developed for use in a new large scale detector at the SPEAR colliding beam facility. The systems are based upon 32 channels of sample-and-hold together with an analog multiplexer in a single-width CAMAC module. The modules within each crate are scanned by an autonomous controller containing a single ADC and memory plus arithmetic capability for offset, gain and linearity corrections. The drift chamber module has a facility for extracting hit wire information for use in trigger decision circuitry
Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying
2015-06-01
In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers. Copyright © 2015 Elsevier Inc. All rights reserved.
Steatocystoma multiplex hos 39-årig kvinde
DEFF Research Database (Denmark)
Duffy, Jonas Raymond; Siersen, Hans Erik; Bonde, Christian T
2011-01-01
-coloured cystic lesions on the chest, abdomen, axillae and back. The patient's clinical presentations and history were compatible with steatocystoma multiplex. Various treatment options for steatocystoma multiplex and steatocystoma multiplex suppurativum have been published and include oral antibiotics...
Multiplexed microsatellite recovery using massively parallel sequencing
Jennings, T.N.; Knaus, B.J.; Mullins, T.D.; Haig, S.M.; Cronn, R.C.
2011-01-01
Conservation and management of natural populations requires accurate and inexpensive genotyping methods. Traditional microsatellite, or simple sequence repeat (SSR), marker analysis remains a popular genotyping method because of the comparatively low cost of marker development, ease of analysis and high power of genotype discrimination. With the availability of massively parallel sequencing (MPS), it is now possible to sequence microsatellite-enriched genomic libraries in multiplex pools. To test this approach, we prepared seven microsatellite-enriched, barcoded genomic libraries from diverse taxa (two conifer trees, five birds) and sequenced these on one lane of the Illumina Genome Analyzer using paired-end 80-bp reads. In this experiment, we screened 6.1 million sequences and identified 356958 unique microreads that contained di- or trinucleotide microsatellites. Examination of four species shows that our conversion rate from raw sequences to polymorphic markers compares favourably to Sanger- and 454-based methods. The advantage of multiplexed MPS is that the staggering capacity of modern microread sequencing is spread across many libraries; this reduces sample preparation and sequencing costs to less than $400 (USD) per species. This price is sufficiently low that microsatellite libraries could be prepared and sequenced for all 1373 organisms listed as 'threatened' and 'endangered' in the United States for under $0.5M (USD).
Explaining HIV Risk Multiplexity: A Social Network Analysis.
Felsher, Marisa; Koku, Emmanuel
2018-04-21
Risk multiplexity (i.e., overlap in drug-use, needle exchange and sexual relations) is a known risk factor for HIV. However, little is known about predictors of multiplexity. This study uses egocentric data from the Colorado Springs study to examine how individual, behavioral and social network factors influence engagement in multiplex risk behavior. Analyses revealed that compared to Whites, Hispanics were significantly more likely to engage in risk multiplexity and Blacks less so. Respondents who were similar to each other (e.g., in terms of race) had significantly higher odds of being in risk multiplex relationships, and respondents' risk perceptions and network size were significantly associated with engaging in multiplex risk behaviors. Findings from interaction analysis showed the effect of knowing someone with HIV on the odds of multiplexity depends partly on whether respondents' know their HIV status. Findings suggest that demographics, HIV behaviors and network factors impact engagement in multiplex risk behaviors, highlighting the need for multi-level interventions aimed at reducing HIV risk behavior.
Percolation in real multiplex networks
Bianconi, Ginestra; Radicchi, Filippo
2016-12-01
We present an exact mathematical framework able to describe site-percolation transitions in real multiplex networks. Specifically, we consider the average percolation diagram valid over an infinite number of random configurations where nodes are present in the system with given probability. The approach relies on the locally treelike ansatz, so that it is expected to accurately reproduce the true percolation diagram of sparse multiplex networks with negligible number of short loops. The performance of our theory is tested in social, biological, and transportation multiplex graphs. When compared against previously introduced methods, we observe improvements in the prediction of the percolation diagrams in all networks analyzed. Results from our method confirm previous claims about the robustness of real multiplex networks, in the sense that the average connectedness of the system does not exhibit any significant abrupt change as its individual components are randomly destroyed.
Multiuser hybrid switched-selection diversity systems
Shaqfeh, Mohammad
2011-09-01
A new multiuser scheduling scheme is proposed and analyzed in this paper. The proposed system combines features of conventional full-feedback selection-based diversity systems and reduced-feedback switch-based diversity systems. The new hybrid system provides flexibility in trading-off the channel information feedback overhead with the prospected multiuser diversity gains. The users are clustered into groups, and the users\\' groups are ordered into a sequence. Per-group feedback thresholds are used and optimized to maximize the system overall achievable rate. The proposed hybrid system applies switched diversity criterion to choose one of the groups, and a selection criterion to decide the user to be scheduled from the chosen group. Numerical results demonstrate that the system capacity increases as the number of users per group increases, but at the cost of more required feedback messages. © 2011 IEEE.
Achieving Appropriate Gestational Weight Gain: The Role of Healthcare Provider Advice.
Deputy, Nicholas P; Sharma, Andrea J; Kim, Shin Y; Olson, Christine K
2018-01-10
The Institute of Medicine (IOM) revised gestational weight gain recommendations in 2009. We examined associations between healthcare provider advice about gestational weight gain and inadequate or excessive weight gain, stratified by prepregnancy body mass index category. We analyzed cross-sectional data from women delivering full-term (37-42 weeks of gestation), singleton infants from four states that participated in the 2010-2011 Pregnancy Risk Assessment Monitoring System (unweighted n = 7125). Women reported the weight gain range (start and end values) advised by their healthcare provider; advice was categorized as follows: starting below recommendations, starting and ending within recommendations (IOM consistent), ending above recommendations, not remembered, or not received. We examined associations between healthcare provider advice and inadequate or excessive, compared with appropriate, gestational weight gain using adjusted prevalence ratios (aPR) and 95% confidence intervals (CIs). Overall, 26.3% of women reported receiving IOM-consistent healthcare provider advice; 26.0% received no advice. Compared with IOM-consistent advice, advice below recommendations was associated with higher likelihood of inadequate weight gain among underweight (aPR 2.22, CI 1.29-3.82) and normal weight women (aPR 1.57, CI 1.23-2.02); advice above recommendations was associated with higher likelihood of excessive weight gain among all but underweight women (aPR range 1.36, CI 1.08-1.72 to aPR 1.42, CI 1.19-1.71). Not remembering or not receiving advice was associated with both inadequate and excessive weight gain. Few women reported receiving IOM-consistent advice; not receiving IOM-consistent advice put women at-risk for weight gain outside recommendations. Strategies that raise awareness of IOM recommendations and address barriers to providing advice are needed.
Larry, Triaka A.
The need for more diversity in STEM-related careers and college majors is urgent. Self-efficacy and student-teacher relationships are factors that have been linked to influencing students’ pursuit of subject-specific careers and academic achievement. The impact of self-efficacy and student perceptions of teacher interpersonal behaviors on student achievement have been extensively researched in the areas of Mathematics and English, however, most studies using science achievement, as a criterion variable, were conducted using non-diverse, White upper middle class to affluent participants. In order to determine the strength of relationships between perceived science self-efficacy, and student perceptions of teacher interpersonal behaviors as factors that influence science achievement (science GPA), the Science Self-Efficacy Questionnaire (SSEQ) and Questionnaire on Teacher Interactions (QTI) were administered to twelfth grade students enrolled at a highly diverse urban Title I high school, while controlling for demographics, defined as gender, ethnicity, and minority status. Using a hierarchical multiple linear regression analysis, results demonstrated that the predictor variables (i.e., gender, ethnicity, minority status, science self-efficacy, and teacher interpersonal behaviors) accounted for 20.8% of the variance in science GPAs. Science self-efficacy made the strongest unique contribution to explaining science GPA, while minority status and gender were found to be statistically significant contributors to the full model as well. Ethnicity and teacher interpersonal behaviors did not make a statistically significant contribution to the variance in science GPA, and accounted for ≤ 1% of the variance. Implications and recommendations for future research are subsequently given.
A novel mirror diversity receiver for indoor MIMO visible light
Park, Ki-Hong
2016-03-01
In this paper, we propose and study a non-imaging receiver design reducing the correlation of channel matrix for indoor multiple-input multiple-output (MIMO) visible light communication (VLC) systems. Contrary to previous works, our proposed mirror diversity receiver (MDR) not only blocks the reception of light on one specific direction but also improves the channel gain on the other direction by receiving the light reflected by a mirror deployed between the photodetectors. We analyze the channel capacity and optimal height of mirror in terms of maximum channel capacity for a 2 -by-2 MIMO-VLC system in a 2-dimensional geometric model.We prove that this constructive and destructive effects in channel matrix resulting from our proposed MDR are more beneficial to obtain well-conditioned channel matrix which is suitable for implementing spatial-multiplexing MIMO-VLC systems in order to support high data rate.
Wang, Yiguang; Huang, Xingxing; Shi, Jianyang; Wang, Yuan-quan; Chi, Nan
2016-05-01
Visible light communication (VLC) has no doubt become a promising candidate for future wireless communications due to the increasing trends in the usage of light-emitting diodes (LEDs). In addition to indoor high-speed wireless access and positioning applications, VLC usage in outdoor scenarios, such as vehicle networks and intelligent transportation systems, are also attracting significant interest. However, the complex outdoor environment and ambient noise are the key challenges for long-range high-speed VLC outdoor applications. To improve system performance and transmission distance, we propose to use receiver diversity technology in an outdoor VLC system. Maximal ratio combining-based receiver diversity technology is utilized in two receivers to achieve the maximal signal-to-noise ratio. A 400-Mb/s VLC transmission using a phosphor-based white LED and a 1-Gb/s wavelength division multiplexing VLC transmission using a red-green-blue LED are both successfully achieved over a 100-m outdoor distance with the bit error rate below the 7% forward error correction limit of 3.8×10-3. To the best of our knowledge, this is the highest data rate at 100-m outdoor VLC transmission ever achieved. The experimental results clearly prove the benefit and feasibility of receiver diversity technology for long-range high-speed outdoor VLC systems.
Spatial analysis of various multiplex cinema types
Directory of Open Access Journals (Sweden)
Young-Seo Park
2016-03-01
Full Text Available This study identifies the spatial characteristics and relationships of each used space according to the multiplex type. In this study, multiplexes are classified according to screen rooms and circulation systems, and each used space is quantitatively analyzed. The multiplex type based on screen rooms and moving line systems influences the relationship and characteristics of each used space in various ways. In particular, the structure of the used space of multiplexes has a significant effect on profit generation and audience convenience.
The Gain of Performance of Optical WDM Networks
Directory of Open Access Journals (Sweden)
Miroslav Bahleda
2008-01-01
Full Text Available We study the blocking probability and performance of single-fiber and multifiber optical networks with wavelength division multiplexing (WDM. We extend the well-known analytical blocking probability model by Barry and Humblet to the general model, which is proposed for both single-fiber and multifiber network paths with any kind of wavelength conversion (no, limited, or full wavelength conversion and for uniform and nonuniform link loads. We investigate the effect of the link load, wavelength conversion degree, and the number of wavelengths, fibers, and hops on blocking probability. We also extend the definition of the gain of wavelength conversion by Barry and Humblet to the gain of performance, which is fully general. Thanks to this definition and implementation of our model, we compare different WDM node architectures and present interesting results.
Multiplexed Thiol Reactivity Profiling for Target Discovery of Electrophilic Natural Products.
Tian, Caiping; Sun, Rui; Liu, Keke; Fu, Ling; Liu, Xiaoyu; Zhou, Wanqi; Yang, Yong; Yang, Jing
2017-11-16
Electrophilic groups, such as Michael acceptors, expoxides, are common motifs in natural products (NPs). Electrophilic NPs can act through covalent modification of cysteinyl thiols on functional proteins, and exhibit potent cytotoxicity and anti-inflammatory/cancer activities. Here we describe a new chemoproteomic strategy, termed multiplexed thiol reactivity profiling (MTRP), and its use in target discovery of electrophilic NPs. We demonstrate the utility of MTRP by identifying cellular targets of gambogic acid, an electrophilic NP that is currently under evaluation in clinical trials as anticancer agent. Moreover, MTRP enables simultaneous comparison of seven structurally diversified α,β-unsaturated γ-lactones, which provides insights into the relative proteomic reactivity and target preference of diverse structural scaffolds coupled to a common electrophilic motif and reveals various potential druggable targets with liganded cysteines. We anticipate that this new method for thiol reactivity profiling in a multiplexed manner will find broad application in redox biology and drug discovery. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ezeribe, A. C.; Robinson, M.; Robinson, N.; Scarff, A.; Spooner, N. J. C.; Yuriev, L.
2018-02-01
More target mass is required in current TPC based directional dark matter detectors for improved detector sensitivity. This can be achieved by scaling up the detector volumes, but this results in the need for more analogue signal channels. A possible solution to reducing the overall cost of the charge readout electronics is to multiplex the signal readout channels. Here, we present a multiplexer system in expanded mode based on LMH6574 chips produced by Texas Instruments, originally designed for video processing. The setup has a capability of reducing the number of readouts in such TPC detectors by a factor of 20. Results indicate that the important charge distribution asymmetry along an ionization track is retained after multiplexed signals are demultiplexed.
Bilevel alarm monitoring multiplexer
International Nuclear Information System (INIS)
Johnson, C.S.
1977-06-01
This report describes the operation of the Bilevel Alarm Monitoring Multiplexer used in the Adaptive Intrusion Data System (AIDS) to transfer and control alarm signals being sent to the Nova 2 computer, the Memory Controlled Data Processor, and its own integral Display Panel. The multiplexer can handle 48 alarm channels and format the alarms into binary formats compatible with the destination of the alarm data
Practical implementation of a multiplex PCR for acute respiratory tract infections in children
Gruteke, Paul; Glas, Afina S.; Dierdorp, Mirjam; Vreede, Willem B.; Pilon, Jan-Willem; Bruisten, Sylvia M.
2004-01-01
Molecular testing for acute respiratory infections (ARIs) has documented value but limited implementation due to questions that typically slow the acceptance of new tests. This study sought to address these questions and achieve implementation. Rhinovirus was added to a nested multiplex PCR (M-PCR),
Formulating the Net Gain of MISO-SFN in the Presence of Self-Interferences
Directory of Open Access Journals (Sweden)
S. Jeon
2015-06-01
Full Text Available In this study, an analytical formula for multiple-input single-output single frequency network gain (MISO-SFNG is investigated. To formulate the net MISO-SFNG, we derived the average signal to interference plus noise ratio (SINR where the gain achieved by the distributed MISO diversity as a function of power imbalance is curve-fitted. Further, we analyzed the losses owing to self-interferences resulting from the delay spread and imperfect channel estimation. We verified the accuracy and effectiveness of the derived formula by comparing the measurement results with the analytical results. The derived formula helps to understand how various system factors affect the gain under a given condition. The formula can be used to evaluate the MISO-SFNG and to predict the MISO-SFN coverage in various system configurations.
Phase-Shift Cyclic-Delay Diversity for MIMO OFDM Systems
Directory of Open Access Journals (Sweden)
Young-Han Nam
2010-01-01
Full Text Available Phase-shift cyclic-delay diversity (PS CDD scheme and space-frequency-block-code (SFBC PS CDD are developed for multiple-input-multiple-output (MIMO orthogonal frequency division multiplexing (OFDM systems. The proposed PS CDD scheme preserves the diversity advantage of traditional CDD in uncorrelated multiantenna channels, and furthermore removes frequency-selective nulling problem of the traditional CDD in correlated multiantenna channels.
Frequency multiplexing for readout of spin qubits
Energy Technology Data Exchange (ETDEWEB)
Hornibrook, J. M.; Colless, J. I.; Mahoney, A. C.; Croot, X. G.; Blanvillain, S.; Reilly, D. J., E-mail: david.reilly@sydney.edu.au [ARC Centre of Excellence for Engineered Quantum Systems, School of Physics, University of Sydney, Sydney, NSW 2006 (Australia); Lu, H.; Gossard, A. C. [Materials Department, University of California, Santa Barbara, California 93106 (United States)
2014-03-10
We demonstrate a low loss, chip-level frequency multiplexing scheme for readout of scaled-up spin qubit devices. By integrating separate bias tees and resonator circuits on-chip for each readout channel, we realise dispersive gate-sensing in combination with charge detection based on two radio frequency quantum point contacts. We apply this approach to perform multiplexed readout of a double quantum dot in the few-electron regime and further demonstrate operation of a 10-channel multiplexing device. Limitations for scaling spin qubit readout to large numbers of multiplexed channels are discussed.
Preliminary study of visual effect of multiplex hologram
Fu, Huaiping; Xiong, Bingheng; Yang, Hong; Zhang, Xueguo
2004-06-01
The process of any movement of real object can be recorded and displayed by a multiplex holographic stereogram. An embossing multiplex holographic stereogram and a multiplex rainbow holographic stereogram have been made by us, the multiplex rainbow holographic stereogram reconstructs the dynamic 2D line drawing of speech organs, the embossing multiplex holographic stereogram reconstructs the process of an old man drinking water. In this paper, we studied the visual result of an embossing multiplex holographic stereogram made with 80 films of 2-D pictures. Forty-eight persons of aged from 13 to 67 were asked to see the hologram and then to answer some questions about the feeling of viewing. The results indicate that this kind of holograms could be accepted by human visual sense organ without any problem. This paper also discusses visual effect of the multiplex holography stereograms base on visual perceptual psychology. It is open out that the planar multiplex holograms can be recorded and present the movement of real animal and object. Not only have the human visual perceptual constancy for shape, just as that size, color, etc... but also have visual perceptual constancy for binocular parallax.
Wang, Andong; Zhu, Long; Liu, Jun; Du, Cheng; Mo, Qi; Wang, Jian
2015-11-16
Mode-division multiplexing passive optical network (MDM-PON) is a promising scheme for next-generation access networks to further increase fiber transmission capacity. In this paper, we demonstrate the proof-of-concept experiment of hybrid mode-division multiplexing (MDM) and time-division multiplexing (TDM) PON architecture by exploiting orbital angular momentum (OAM) modes. Bidirectional transmissions with 2.5-Gbaud 4-level pulse amplitude modulation (PAM-4) downstream and 2-Gbaud on-off keying (OOK) upstream are demonstrated in the experiment. The observed optical signal-to-noise ratio (OSNR) penalties for downstream and upstream transmissions at a bit-error rate (BER) of 2 × 10(-3) are less than 2.0 dB and 3.0 dB, respectively.
Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong
2018-02-28
A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.
A megajoule class krypton fluoride amplifier for single shot, high gain ICF application
International Nuclear Information System (INIS)
Rose, E.; Hanson, D.; Krohn, B.; McLeod, J.; Kang, M.
1988-01-01
A design study is underway to define the optimal architecture for a KrF laser system which will deliver 10 MJ of 248-nm light to an ICF target. We present one approach which incorporates final power amplifiers in the megajoule class, achieving 10 MJ with four final amplifiers. Each double-pass laser amplifier employs two-sided electron-beam pumping of the laser gas medium. Details of the design are based on a Monte-Carlo electron-beam deposition code, a one-dimensional, time-dependent kinetics code, and pulsed power circuit modeling. Linear dimensions of the amplifier's extracted gain volume are 6.25 m in height and length and 5.12 m in width. Each amplifier handles 160 angularly multiplexed laser channels. The one-amagat, krypton-rich laser medium is e-beam pumped at 60-kW cm/sup /minus/3/ (4-MA at3.3-MV) over the 2-microsecond duration of the laser beam pulse train. 5 refs., 4 figs
Directory of Open Access Journals (Sweden)
Sandrine Prost
Full Text Available The recent availability of novel dyes and alternative light sources to facilitate complex tissue immunofluorescence studies such as multiplex labelling has not been matched by reports critically evaluating the considerations and relative benefits of these new tools, particularly in combination. Product information is often limited to wavelengths used for older fluorophores (FITC, TRITC & corresponding Alexa dyes family. Consequently, novel agents such as Quantum dots are not widely appreciated or used, despite highly favourable properties including extremely bright emission, stability and potentially reduced tissue autofluorescence at the excitation wavelength. Using spectral analysis, we report here a detailed critical appraisal and comparative evaluation of different light sources and fluorophores in multiplex immunofluorescence of clinical biopsy sections. The comparison includes mercury light, metal halide and 3 different LED-based systems, using 7 Qdots (525, 565, 585, 605, 625, 705, Cy3 and Cy5. We discuss the considerations relevant to achieving the best combination of light source and fluorophore for accurate multiplex fluorescence quantitation. We highlight practical limitations and confounders to quantitation with filter-based approaches.
Multiplexed Western Blotting Using Microchip Electrophoresis.
Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T
2016-07-05
Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Generation of ninety-six angularly multiplexed KrF beams at Aurora
International Nuclear Information System (INIS)
Rose, E.A.
1987-01-01
The Aurora KrF laser facility is designed to produce ninety-six laser beams at 248 nm with total energy of -- 10 kJ. The 5-ns duration beams are angularly multiplexed to allow sequential amplification in electron-beam-pumped amplifiers. These amplifiers operated over a half-microsecond period. Previous to this investigation, all individual components of the Aurora system have been operated independently. As a first step toward integration of the full system, the author operated the front end, beam slicer, small-aperture module (SAM), and angle encoder to generate ninety-six angularly multiplexed beams. These beams have been delivered to the first of the three large amplifiers, which will boost the pulse train energy from <1 J to 10 kJ. Measurements to date have concentrated on the total energy of the pulse train and pulse shapes of the individual beams at positions preceding and following SAM. Measured gain through SAM is -- 13 with 20 the target figure. Relative pulse heights are preserved through SAM with the exception of the first pulse of the 12
Ren, Yongxiong; Xie, Guodong; Yan, Yan; Li, Long; Zhao, Zhe; Wang, Jian; Tur, Moshe; Molisch, Andreas F.; Ashrafi, Solyman
2017-01-01
There is a continuing growth in the demand for data bandwidth, and the multiplexing of multiple independent data streams has the potential to provide the needed data capacity. One technique uses the spatial domain of an electromagnetic (EM) wave, and space division multiplexing (SDM) has become increasingly important for increased transmission capacity and spectral efficiency of a communication system. A subset of SDM is mode division multiplexing (MDM), in which multiple orthogonal beams each on a different mode can be multiplexed. A potential modal basis set to achieve MDM is to use orbital angular momentum (OAM) of EM waves. In such a system, multiple OAM beams each carrying an independent data stream are multiplexed at the transmitter, propagate through a common medium and are demultiplexed at the receiver. As a result, the total capacity and spectral efficiency of the communication system can be multiplied by a factor equal to the number of transmitted OAM modes. Over the past few years, progress has been made in understanding the advantages and limitations of using multiplexed OAM beams for communication systems. In this review paper, we highlight recent advances in the use of OAM multiplexing for high-capacity free-space optical and millimetre-wave communications. We discuss different technical challenges (e.g. atmospheric turbulence and crosstalk) as well as potential techniques to mitigate such degrading effects. This article is part of the themed issue ‘Optical orbital angular momentum’. PMID:28069770
Joint nonbinary low-density parity-check codes and modulation diversity over fading channels
Shi, Zhiping; Li, Tiffany Jing; Zhang, Zhongpei
2010-09-01
A joint exploitation of coding and diversity techniques to achieve efficient, reliable wireless transmission is considered. The system comprises a powerful non-binary low-density parity-check (LDPC) code that will be soft-decoded to supply strong error protection, a quadratic amplitude modulator (QAM) that directly takes in the non-binary LDPC symbols and a modulation diversity operator that will provide power- and bandwidth-efficient diversity gain. By relaxing the rate of the modulation diversity rotation matrices to below 1, we show that a better rate allocation can be arranged between the LDPC codes and the modulation diversity, which brings significant performance gain over previous systems. To facilitate the design and evaluation of the relaxed modulation diversity rotation matrices, based on a set of criteria, three practical design methods are given and their point pairwise error rate are analyzed. With EXIT chart, we investigate the convergence between demodulator and decoder.A rate match method is presented based on EXIT analysis. Through analysis and simulations, we show that our strategies are very effective in combating random fading and strong noise on fading channels.
Laguerre Gaussian beam multiplexing through turbulence
CSIR Research Space (South Africa)
Trichili, A
2014-08-17
Full Text Available We analyze the effect of atmospheric turbulence on the propagation of multiplexed Laguerre Gaussian modes. We present a method to multiplex Laguerre Gaussian modes using digital holograms and decompose the resulting field after encountering a...
Advanced combinational microfluidic multiplexer for fuel cell reactors
International Nuclear Information System (INIS)
Lee, D W; Kim, Y; Cho, Y-H; Doh, I
2013-01-01
An advanced combinational microfluidic multiplexer capable to address multiple fluidic channels for fuel cell reactors is proposed. Using only 4 control lines and two different levels of control pressures, the proposed multiplexer addresses up to 19 fluidic channels, at least two times larger than the previous microfluidic multiplexers. The present multiplexer providing high control efficiency and simple structure for channel addressing would be used in the application areas of the integrated microfluidic systems such as fuel cell reactors and dynamic pressure generators
A novel mirror diversity receiver for indoor MIMO visible light communication systems
Park, Kihong
2016-12-24
In this paper, we propose and study a non-imaging receiver design reducing the correlation of channel matrix for indoor multiple-input multiple-output (MIMO) visible light communication (VLC) systems. Contrary to previous works, our proposed mirror diversity receiver (MDR) not only blocks the reception of light on one specific direction but also improves the channel gain on the other direction by receiving the light reflected by a mirror deployed between the photodetectors. We analyze the channel capacity and optimal height of mirror in terms of maximum channel capacity for a 2 × 2 MIMO-VLC system in a 2-dimensional geometric model. We prove that this constructive and destructive effects in channel matrix resulting from our proposed MDR are more beneficial to obtain well-conditioned channel matrix which is suitable for implementing spatial-multiplexing MIMO-VLC systems in order to support high data rate.
Leisure managers’ perceptions of employee diversity and impact of employee diversity
Garib, Y.R.
2013-01-01
This aim of the study is to gain more insight in diversity perceptions and the diversity benefits in the leisure industry by investigating the impact of leisure managers’ diversity perceptions on organizational performance perceptions. The diversity typology of Harrison and Klein (2007) based on
Low-Complexity Full-Diversity Detection in Two-User MIMO X Channels
Ismail, Amr
2014-01-26
Several interference cancellation (IC) schemes have been recently proposed to suppress multi-user interference for various network configurations (e.g., multiple access and X channels). However, most of these schemes trade-off diversity for implementation complexity or vice-versa. In this paper, we propose a full-diversity interference cancellation scheme in a multiple-input multiple-output (MIMO) X channel with two sources and two destinations while maintaining low decoding complexity. We provide sufficient conditions for a wide range of space-time block codes (STBCs) to achieve full-diversity gain under the so-called partial interference cancellation group decoding (PICGD) in the configuration of interest. A systematic construction is then proposed to achieve full-diversity. The constructed scheme is compared to recently proposed IC scheme in terms of performance and decoding complexity. Our IC scheme outperforms the recently proposed scheme in the case it provides higher transmission rate, while it loses slightly in the case of equal rates. In terms of decoding complexity, both schemes are equivalent.
Low-Complexity Full-Diversity Detection in Two-User MIMO X Channels
Ismail, Amr; Abediseid, Walid; Alouini, Mohamed-Slim
2014-01-01
Several interference cancellation (IC) schemes have been recently proposed to suppress multi-user interference for various network configurations (e.g., multiple access and X channels). However, most of these schemes trade-off diversity for implementation complexity or vice-versa. In this paper, we propose a full-diversity interference cancellation scheme in a multiple-input multiple-output (MIMO) X channel with two sources and two destinations while maintaining low decoding complexity. We provide sufficient conditions for a wide range of space-time block codes (STBCs) to achieve full-diversity gain under the so-called partial interference cancellation group decoding (PICGD) in the configuration of interest. A systematic construction is then proposed to achieve full-diversity. The constructed scheme is compared to recently proposed IC scheme in terms of performance and decoding complexity. Our IC scheme outperforms the recently proposed scheme in the case it provides higher transmission rate, while it loses slightly in the case of equal rates. In terms of decoding complexity, both schemes are equivalent.
Multiplexed image storage by electromagnetically induced transparency in a solid
Heinze, G.; Rentzsch, N.; Halfmann, T.
2012-11-01
We report on frequency- and angle-multiplexed image storage by electromagnetically induced transparency (EIT) in a Pr3+:Y2SiO5 crystal. Frequency multiplexing by EIT relies on simultaneous storage of light pulses in atomic coherences, driven in different frequency ensembles of the inhomogeneously broadened solid medium. Angular multiplexing by EIT relies on phase matching of the driving laser beams, which permits simultaneous storage of light pulses propagating under different angles into the crystal. We apply the multiplexing techniques to increase the storage capacity of the EIT-driven optical memory, in particular to implement multiplexed storage of larger two-dimensional amounts of data (images). We demonstrate selective storage and readout of images by frequency-multiplexed EIT and angular-multiplexed EIT, as well as the potential to combine both multiplexing approaches towards further enhanced storage capacities.
Mahon, Lee
1997-01-01
The purpose of this proposal was to field test and evaluate a Teacher Training program that would prepare teachers to increase the motivation and achievement of culturally diverse students in the areas of science and mathematics. Designed as a three year program, this report covers the first two years of the training program at the Ronald McNair School in the Ravenswood School district, using the resources of the NASA Ames Research Center and the California Framework for Mathematics and Science.
Frequency-domain readout multiplexing of transition-edge sensor arrays
Energy Technology Data Exchange (ETDEWEB)
Lanting, T.M. [Physics Department, University of California, Berkeley, CA 94720 (United States)]. E-mail: tlanting@berkeley.edu; Arnold, K. [Physics Department, University of California, Berkeley, CA 94720 (United States); Cho, Hsiao-Mei [Physics Department, University of California, Berkeley, CA 94720 (United States); Clarke, John [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Dobbs, Matt [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Holzapfel, William [Physics Department, University of California, Berkeley, CA 94720 (United States); Lee, Adrian T. [Physics Department, University of California, Berkeley, CA 94720 (United States); Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Lueker, M. [Physics Department, University of California, Berkeley, CA 94720 (United States); Richards, P.L. [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Smith, A.D. [Northrop-Grumman, Redondo Beach, CA 94278 (United States); Spieler, H.G. [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)
2006-04-15
We have demonstrated frequency-domain readout multiplexing of eight channels for superconducting transition-edge sensor bolometer arrays. The multiplexed readout noise is 6.5 pA/{radical}Hz, well below the bolometer dark noise of 15-20 pA/{radical}Hz. We measure an upper limit on crosstalk of 0.004 between channels adjacent in frequency which meets our design requirement of 0.01. We have observed vibration insensitivity in our frequency-domain multiplexed transition-edge sensors, making this system very attractive for telescope and satellite observations. We also discuss extensions to our multiplexed readout. In particular, we are developing a SQUID flux-locked loop that is entirely cold and collaborating on digital multiplexer technology in order to scale up the number of multiplexed channels.
DEFF Research Database (Denmark)
Rommel, Simon; Mendinueta, José Manuel Delgado; Klaus, Werner
2017-01-01
This paper discusses spatially diverse optical vector network analysis for space division multiplexing (SDM) component and system characterization, which is becoming essential as SDM is widely considered to increase the capacity of optical communication systems. Characterization of a 108-channel ...... in the few-mode multi-core fiber and their impact on system IL and MDL are analyzed, finding splices to cause significant mode-mixing and to be non-negligible in system capacity analysis.......This paper discusses spatially diverse optical vector network analysis for space division multiplexing (SDM) component and system characterization, which is becoming essential as SDM is widely considered to increase the capacity of optical communication systems. Characterization of a 108-channel...... photonic lantern spatial multiplexer, coupled to a 36-core 3-mode fiber, is experimentally demonstrated, extracting the full impulse response and complex transfer function matrices as well as insertion loss (IL) and mode-dependent loss (MDL) data. Moreover, the mode-mixing behavior of fiber splices...
Implementation of multiplexing in a subcarrier-wave quantum cryptography system
International Nuclear Information System (INIS)
Chistyakov, V V; Gleim, A V; Egorov, V I; Nazarov, Yu V
2014-01-01
Quantum cryptography allows distributing secure keys in a way that any eavesdropping in the channel is inevitably detected. This work is dedicated to introducing wavelength division multiplexing in a subcarrier-wave quantum cryptography system. Compared to other existing schemes, the resulting device is able to achieve higher bitrates (up to 2.26 Mbit/s at 20 km), is robust against external conditions and compatible with standard telecommunication fibres in multi-user environment
Prototype data terminal-multiplexer/demultiplexer
Leck, D. E.; Goodwin, J. E.
1972-01-01
The design and operation of a quad redundant data terminal and a multiplexer/demultiplexer (MDU) is described. The most unique feature is the design of the quad redundant data terminal. This is one of the few designs where the unit is fail/op, fail/op, fail/safe. Laboratory tests confirm that the unit will operate satisfactorily with the failure of three out of four channels. Although the design utilizes state-of-the-art technology, the waveform error checks, the voting techniques, and the parity bit checks are believed to be used in unique configurations. Correct word selection routines are also novel. The MDU design, while not redundant, utilizes, the latest state-of-the-art advantages of light coupler and interested amplifiers. Much of the technology employed was an evolution of prior NASA contracts related to the Addressable Time Division Data System. A good example of the earlier technology development was the development of a low level analog multiplexer, a high level analog multiplexer, and a digital multiplexer. A list of all drawings is included for reference and all schematic, block and timing diagrams are incorporated.
Bender, Amy N.; Cliche, Jean-François; de Haan, Tijmen; Dobbs, Matt A.; Gilbert, Adam J.; Montgomery, Joshua; Rowlands, Neil; Smecher, Graeme M.; Smith, Ken; Wilson, Andrew
2014-07-01
Frequency domain multiplexing (fMux) is an established technique for the readout of transition-edge sensor (TES) bolometers in millimeter-wavelength astrophysical instrumentation. In fMux, the signals from multiple detectors are read out on a single pair of wires reducing the total cryogenic thermal loading as well as the cold component complexity and cost of a system. The current digital fMux system, in use by POLARBEAR, EBEX, and the South Pole Telescope, is limited to a multiplexing factor of 16 by the dynamic range of the Superconducting Quantum Interference Device pre-amplifier and the total system bandwidth. Increased multiplexing is key for the next generation of large format TES cameras, such as SPT-3G and POLARBEAR2, which plan to have on the of order 15,000 detectors. Here, we present the next generation fMux readout, focusing on the warm electronics. In this system, the multiplexing factor increases to 64 channels per module (2 wires) while maintaining low noise levels and detector stability. This is achieved by increasing the system bandwidth, reducing the dynamic range requirements though active feedback, and digital synthesis of voltage biases with a novel polyphase filter algorithm. In addition, a version of the new fMux readout includes features such as low power consumption and radiation-hard components making it viable for future space-based millimeter telescopes such as the LiteBIRD satellite.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Optimizing diffusion in multiplexes by maximizing layer dissimilarity
Serrano, Alfredo B.; Gómez-Gardeñes, Jesús; Andrade, Roberto F. S.
2017-05-01
Diffusion in a multiplex depends on the specific link distribution between the nodes in each layer, but also on the set of the intralayer and interlayer diffusion coefficients. In this work we investigate, in a quantitative way, the efficiency of multiplex diffusion as a function of the topological similarity among multiplex layers. This similarity is measured by the distance between layers, taken among the pairs of layers. Results are presented for a simple two-layer multiplex, where one of the layers is held fixed, while the other one can be rewired in a controlled way in order to increase or decrease the interlayer distance. The results indicate that, for fixed values of all intra- and interlayer diffusion coefficients, a large interlayer distance generally enhances the global multiplex diffusion, providing a topological mechanism to control the global diffusive process. For some sets of networks, we develop an algorithm to identify the most sensitive nodes in the rewirable layer, so that changes in a small set of connections produce a drastic enhancement of the global diffusion of the whole multiplex system.
Nishizaki, Tatsuya; Matoba, Osamu; Nitta, Kouichi
2014-09-01
The recording properties of three-dimensional speckle-shift multiplexing in reflection-type holographic memory are analyzed numerically. Three-dimensional recording can increase the number of multiplexed holograms by suppressing the cross-talk noise from adjacent holograms by using depth-direction multiplexing rather than in-plane multiplexing. Numerical results indicate that the number of multiplexed holograms in three-layer recording can be increased by 1.44 times as large as that of a single-layer recording when an acceptable signal-to-noise ratio is set to be 2 when NA=0.43 and the thickness of the recording medium is 0.5 mm.
Bradbury, Angela R; Patrick-Miller, Linda; Long, Jessica; Powers, Jacquelyn; Stopfer, Jill; Forman, Andrea; Rybak, Christina; Mattie, Kristin; Brandt, Amanda; Chambers, Rachelle; Chung, Wendy K; Churpek, Jane; Daly, Mary B; Digiovanni, Laura; Farengo-Clark, Dana; Fetzer, Dominique; Ganschow, Pamela; Grana, Generosa; Gulden, Cassandra; Hall, Michael; Kohler, Lynne; Maxwell, Kara; Merrill, Shana; Montgomery, Susan; Mueller, Rebecca; Nielsen, Sarah; Olopade, Olufunmilayo; Rainey, Kimberly; Seelaus, Christina; Nathanson, Katherine L; Domchek, Susan M
2015-06-01
Multiplex genetic testing, including both moderate- and high-penetrance genes for cancer susceptibility, is associated with greater uncertainty than traditional testing, presenting challenges to informed consent and genetic counseling. We sought to develop a new model for informed consent and genetic counseling for four ongoing studies. Drawing from professional guidelines, literature, conceptual frameworks, and clinical experience, a multidisciplinary group developed a tiered-binned genetic counseling approach proposed to facilitate informed consent and improve outcomes of cancer susceptibility multiplex testing. In this model, tier 1 "indispensable" information is presented to all patients. More specific tier 2 information is provided to support variable informational needs among diverse patient populations. Clinically relevant information is "binned" into groups to minimize information overload, support informed decision making, and facilitate adaptive responses to testing. Seven essential elements of informed consent are provided to address the unique limitations, risks, and uncertainties of multiplex testing. A tiered-binned model for informed consent and genetic counseling has the potential to address the challenges of multiplex testing for cancer susceptibility and to support informed decision making and adaptive responses to testing. Future prospective studies including patient-reported outcomes are needed to inform how to best incorporate multiplex testing for cancer susceptibility into clinical practice.Genet Med 17 6, 485-492.
Strain measurement using multiplexed fiber optic sensors
International Nuclear Information System (INIS)
Kwon, Il Bum; Kim, Chi Yeop; Yoon, Dong Jin; Lee, Seung Seok
2003-01-01
FBG(Fiber Bragg grating) sensor, which is one of the fiber optic sensors for the application of smart structures, can not only measure one specific point but also multiple points by multiplexing techniques. We have proposed a novel multiplexing technique of FBG sensor by the intensity modulation of light source. This technique is applicable to WDM(Wavelength Division Multiplexing) technique and number of sensors in this system can be increased by using this technique with WDM technique.
Rapid, Time-Division Multiplexed, Direct Absorption- and Wavelength Modulation-Spectroscopy
Directory of Open Access Journals (Sweden)
Alexander Klein
2014-11-01
Full Text Available We present a tunable diode laser spectrometer with a novel, rapid time multiplexed direct absorption- and wavelength modulation-spectroscopy operation mode. The new technique allows enhancing the precision and dynamic range of a tunable diode laser absorption spectrometer without sacrificing accuracy. The spectroscopic technique combines the benefits of absolute concentration measurements using calibration-free direct tunable diode laser absorption spectroscopy (dTDLAS with the enhanced noise rejection of wavelength modulation spectroscopy (WMS. In this work we demonstrate for the first time a 125 Hz time division multiplexed (TDM-dTDLAS-WMS spectroscopic scheme by alternating the modulation of a DFB-laser between a triangle-ramp (dTDLAS and an additional 20 kHz sinusoidal modulation (WMS. The absolute concentration measurement via the dTDLAS-technique allows one to simultaneously calibrate the normalized 2f/1f-signal of the WMS-technique. A dTDLAS/WMS-spectrometer at 1.37 µm for H2O detection was built for experimental validation of the multiplexing scheme over a concentration range from 50 to 3000 ppmV (0.1 MPa, 293 K. A precision of 190 ppbV was achieved with an absorption length of 12.7 cm and an averaging time of two seconds. Our results show a five-fold improvement in precision over the entire concentration range and a significantly decreased averaging time of the spectrometer.
Bonnet, A; Thévenon, S; Maudet, F; Maillard, J C
2002-10-01
Thirty bovine and eight ovine microsatellite primer pairs were tested on four tropical deer species: Eld's and Swamp deer (highly threatened) and Rusa and Vietnamese Sika deer (economically important). Thirty markers gave an amplified product in all four species (78.9%). The number of polymorphic microsatellite markers varied among the species from 14 in Eld's deer (47%) to 20 in Swamp deer (67%). Among them, 11 microsatellite loci were multiplexed in three polymerase chain reactions (PCRs) and labelled with three different fluorochromes that can be loaded in one gel-lane. To test the efficiency of the multiplex, primary genetic studies (mean number of alleles, expected heterozygosities and Fis values) were carried out on four deer populations. Parentage exclusion probability and probability of identity were computed and discussed on a Swamp deer population. These multiplexes PCRs were also tested on several other deer species and subspecies. The aim of this study is to establish a tool useful for genetic studies of population structure and diversity in four tropical deer species which with few modifications can be applied to other species of the genus Cervus.
Energy Technology Data Exchange (ETDEWEB)
Reindl, W.; Deng, K.; Gladden, J.M.; Cheng, G.; Wong, A.; Singer, S.W.; Singh, S.; Lee, J.-C.; Yao, J.-S.; Hazen, T.C.; Singh, A.K; Simmons, B.A.; Adams, P.D.; Northen, T.R.
2011-05-01
The enzymatic hydrolysis of long-chain polysaccharides is a crucial step in the conversion of biomass to lignocellulosic biofuels. The identification and characterization of optimal glycoside hydrolases is dependent on enzyme activity assays, however existing methods are limited in terms of compatibility with a broad range of reaction conditions, sample complexity, and especially multiplexity. The method we present is a multiplexed approach based on Nanostructure-Initiator Mass Spectrometry (NIMS) that allowed studying several glycolytic activities in parallel under diverse assay conditions. Although the substrate analogs carried a highly hydrophobic perfluorinated tag, assays could be performed in aqueous solutions due colloid formation of the substrate molecules. We first validated our method by analyzing known {beta}-glucosidase and {beta}-xylosidase activities in single and parallel assay setups, followed by the identification and characterization of yet unknown glycoside hydrolase activities in microbial communities.
Multiplexed phase-space imaging for 3D fluorescence microscopy.
Liu, Hsiou-Yuan; Zhong, Jingshan; Waller, Laura
2017-06-26
Optical phase-space functions describe spatial and angular information simultaneously; examples of optical phase-space functions include light fields in ray optics and Wigner functions in wave optics. Measurement of phase-space enables digital refocusing, aberration removal and 3D reconstruction. High-resolution capture of 4D phase-space datasets is, however, challenging. Previous scanning approaches are slow, light inefficient and do not achieve diffraction-limited resolution. Here, we propose a multiplexed method that solves these problems. We use a spatial light modulator (SLM) in the pupil plane of a microscope in order to sequentially pattern multiplexed coded apertures while capturing images in real space. Then, we reconstruct the 3D fluorescence distribution of our sample by solving an inverse problem via regularized least squares with a proximal accelerated gradient descent solver. We experimentally reconstruct a 101 Megavoxel 3D volume (1010×510×500µm with NA 0.4), demonstrating improved acquisition time, light throughput and resolution compared to scanning aperture methods. Our flexible patterning scheme further allows sparsity in the sample to be exploited for reduced data capture.
A deeper insight into the ethnic make-up of school cohorts: diversity and school achievement
Maestri, V.
2011-01-01
While the share of non-native students in a class is expected to have a non positive effect on school achievement, little is said about the heterogeneity of the ethnic minority make-up. Ethnic diversity can stimulate the creativity of students, can push them to be proficient in the instructional
Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana
2016-10-01
The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.
Frequency Domain Multiplexing for Use With NaI[Tl] Detectors
Belling, Samuel; Coherent Collaboration
2017-09-01
A process used in many forms of signal communication known as multiplexing is adapted for the purpose of combining signals from NaI[Tl] detectors so that fewer digitizer channels can be used to process the signal information from large experiments within the COHERENT collaboration. Each signal is passed through a ringing circuit to modulate it with a characteristic frequency. Information about the signal can be extracted from its amplitude, frequency, and phase. Simulations in LTSpice show that an operational amplifier circuit with a parallel LRC feedback loop can serve as the modulating circuit. Several such circuits can be constructed and housed compactly in a unit, and fed to an inverting, summing amplifier with tunable gain, such that the signals are carried by one cable. The signals are analyzed based on a Fourier transform after being digitized. The results show that the energy, channel, and time of the original interaction can be recovered by this process. In some cases it is possible through filtering and deconvolution to recover the shape of the original signal. The effort is ongoing, but with the design presented it is possible to multiplex 10 detectors into a single digitizer channel. NSF REU Program at Duke University.
Development of film antenna for diversity reception; Diversity taio film antenna no kaihatsu
Energy Technology Data Exchange (ETDEWEB)
Shigeta, K; Taniguchi, T; Kubota, K [Mazda Motor Corp., Hiroshima (Japan)
1997-10-01
Based on the principle of capacitance-loaded window antennas, a new film antenna construction pasting an antenna element on a defogger element printed on a rear window was found. The film antennas show high reception performance, and can be used as television diversity antennas or a VICS-FM multiplex antenna. This paper describes the antenna design concept, the antenna construction and the application to a recreational vehicle which styling is 1.3-Box wagon for the electric accessory. 2 refs., 11 figs.
Fafin, Alexandre; Cardin, Julien; Dufour, Christian; Gourbilleau, Fabrice
2014-05-19
We present a comparative study of the gain achievement in a waveguide whose active layer is constituted by a silica matrix containing silicon nanograins acting as sensitizer of either neodymium ions (Nd3+) or erbium ions (Er3+). By means of an auxiliary differential equation and finite difference time domain (ADE-FDTD) approach that we developed, we investigate the steady states regime of both rare earths ions and silicon nanograins levels populations as well as the electromagnetic field for different pumping powers ranging from 1 to 104 mW/mm2. Moreover, the achievable gain has been estimated in this pumping range. The Nd3+ doped waveguide shows a higher gross gain per unit length at 1064 nm (up to 30 dB/cm) than the one with Er3+ doped active layer at 1532 nm (up to 2 dB/cm). Taking into account the experimental background losses we demonstrate that a significant positive net gain can only be achieved with the Nd3+ doped waveguide.
Cavity enhanced eigenmode multiplexing for volume holographic data storage
Miller, Bo E.; Takashima, Yuzuru
2017-08-01
Previously, we proposed and experimentally demonstrated enhanced recording speeds by using a resonant optical cavity to semi-passively increase the reference beam power while recording image bearing holograms. In addition to enhancing the reference beam power the cavity supports the orthogonal reference beam families of its eigenmodes, which can be used as a degree of freedom to multiplex data pages and increase storage densities for volume Holographic Data Storage Systems (HDSS). While keeping the increased recording speed of a cavity enhanced reference arm, image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at two Bragg angles for expedited recording of four multiplexed holograms. We experimentally confirmed write rates are enhanced by an average factor of 1.1, and page crosstalk is about 2.5%. This hybrid multiplexing opens up a pathway to increase storage density while minimizing modifications to current angular multiplexing HDSS.
Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.
Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W
2017-09-15
Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo
madSTORM: a superresolution technique for large-scale multiplexing at single-molecule accuracy
Yi, Jason; Manna, Asit; Barr, Valarie A.; Hong, Jennifer; Neuman, Keir C.; Samelson, Lawrence E.
2016-01-01
Investigation of heterogeneous cellular structures using single-molecule localization microscopy has been limited by poorly defined localization accuracy and inadequate multiplexing capacity. Using fluorescent nanodiamonds as fiducial markers, we define and achieve localization precision required for single-molecule accuracy in dSTORM images. Coupled with this advance, our new multiplexing strategy, madSTORM, allows accurate targeting of multiple molecules using sequential binding and elution of fluorescent antibodies. madSTORM is used on an activated T-cell to localize 25 epitopes, 14 of which are on components of the same multimolecular T-cell receptor complex. We obtain an average localization precision of 2.6 nm, alignment error of 2.0 nm, and molecules within structures. Probing the molecular topology of complex signaling cascades and other heterogeneous networks is feasible with madSTORM. PMID:27708141
Comfort, Leeann N; Shortell, Stephen M; Rodriguez, Hector P; Colla, Carrie H
2018-01-31
To examine whether an empirically derived taxonomy of Accountable Care Organizations (ACOs) is associated with quality and spending performance among patients of ACOs in the Medicare Shared Savings Program (MSSP). Three waves of the National Survey of ACOs and corresponding publicly available Centers for Medicare & Medicaid Services performance data for NSACO respondents participating in the MSSP (N = 204); SK&A Office Based Physicians Database from QuintilesIMS. We compare the performance of three ACO types (physician-led, integrated, and hybrid) for three domains: quality, spending, and likelihood of achieving savings. Sources of performance variation within and between ACO types are compared for each performance measure. There is greater heterogeneity within ACO types than between ACO types. There were no consistent differences in quality by ACO type, nor were there differences in likelihood of achieving savings or overall spending per-person-year. There was evidence for higher spending on physician services for physician-led ACOs. ACOs of diverse structures perform comparably on core MSSP quality and spending measures. CMS should maintain its flexibility and continue to support participation of diverse ACOs. Future research to identify modifiable organizational factors that account for performance variation within ACO types may provide insight as to how best to improve ACO performance based on organizational structure and ownership. © Health Research and Educational Trust.
A novel MUX/DEMUX based on few-mode FBG for mode division multiplexing system
Han, Yueyu; Hu, Guijun
2016-05-01
In this paper, a novel mode multiplexer/demultiplexer (MUX/DEMUX) based on few-mode fiber Bragg gratings (FBG) has been proposed. The principle of the MUX/DEMUX based on few-mode FBG has been described in detail, and crosstalk of better than -20 dB is obtained experimentally. Then a 2×2 division multiplexing (MDM) system has been established with the MUX/DEMUX we proposed. The transmission experiment of 2×10 Gbps PRBS has been achieved successfully, which are carried by LP01 mode and LP11 mode, respectively. When the receiver sensitivity is greater than -14 dB m and -10 dB m, the BER can both reach 10-3 for B2B and 10 km transmission, respectively.
Directory of Open Access Journals (Sweden)
Samantha Spindel
2014-11-01
Full Text Available This review investigates optical sensor platforms for protein multiplexing, the ability to analyze multiple analytes simultaneously. Multiplexing is becoming increasingly important for clinical needs because disease and therapeutic response often involve the interplay between a variety of complex biological networks encompassing multiple, rather than single, proteins. Multiplexing is generally achieved through one of two routes, either through spatial separation on a surface (different wells or spots or with the use of unique identifiers/labels (such as spectral separation—different colored dyes, or unique beads—size or color. The strengths and weaknesses of conventional platforms such as immunoassays and new platforms involving protein arrays and lab-on-a-chip technology, including commercially-available devices, are discussed. Three major public health concerns are identified whereby detecting medically-relevant markers using Point-of-Care (POC multiplex assays could potentially allow for a more efficient diagnosis and treatment of diseases.
DEFF Research Database (Denmark)
Rahman, Imadur Mohamed; Marchetti, Nicola; Fitzek, Frank
2005-01-01
(SIC) receiver where the detection is done on subcarrier by sub-carrier basis based on both Zero Forcing (ZF) and Minimum Mean Square Error (MMSE) nulling criterion for the system. In terms of Frame Error Rate (FER), MMSE based SIC receiver performs better than all other receivers compared......In this work, we have analyzed a joint spatial diversity and multiplexing transmission structure for MIMO-OFDM system, where Orthogonal Space-Frequency Block Coding (OSFBC) is used across all spatial multiplexing branches. We have derived a BLAST-like non-linear Successive Interference Cancellation...... in this paper. We have found that a linear two-stage receiver for the proposed system [1] performs very close to the non-linear receiver studied in this work. Finally, we compared the system performance in spatially correlated scenario. It is found that higher amount of spatial correlation at the transmitter...
Ding, Yuzhe; Huang, Eric; Lam, Kit S; Pan, Tingrui
2013-05-21
Biopatterning has been increasingly used for well-defined cellular microenvironment, patterned surface topology, and guided biological cues; however, it meets challenges on biocompatibility, thermal and chemical sensitivity, as well as limited availability of reagents. In this paper, we aim at combining the desired features from non-contact inkjet printing and dot-matrix impact printing to establish a versatile multiplexed micropatterning platform, referred to as Microfluidic Impact Printer (MI-Printer), for emerging biomedical applications. Using this platform, we can achieve the distinct features of no cross-contamination, sub-microliter ink loading with a minimal dead volume, high-throughput printing, biocompatible non-contact processing, sequential patterning with self-alignment, wide adaptability for complex media (e.g., cell suspension or colloidal solutions), interchangeable/disposable cartridge design, and simple assembly and configuration, all highly desirable towards laboratory-based research and development. Specifically, the printing resolution of the MI-printer platform has been experimentally characterized and theoretically analysed. Optimal printing resolution of 80 μm has been repeatedly obtained. Furthermore, two useful functions of the MI-printer, multiplexed printing and combinatorial printing, have been experimentally demonstrated with less than 10 μm misalignment. Moreover, molecular and biological patterning, utilizing the multiplexed and combinatorial printing, has been implemented to illustrate the utility of this versatile printing technique for emerging biomedical applications.
Guss, Paul; Rabin, Michael; Croce, Mark; Hoteling, Nathan; Schwellenbach, David; Kruschwitz, Craig; Mocko, Veronika; Mukhopadhyay, Sanjoy
2017-09-01
We demonstrate very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor (TES) array. The readout circuit consists of superconducting microwave resonators coupled to radio frequency superconducting-quantum-interference devices (RF-SQUIDs) and transduces changes in input current to changes in phase of a microwave signal. We used a flux-ramp modulation to linearize the response and avoid low-frequency noise. The result is a very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor array. We performed and validated a small-scale demonstration and test of all the components of our concept system, which encompassed microcalorimetry, microwave multiplexing, RF-SQUIDs, and software-defined radio (SDR). We shall display data we acquired in the first simultaneous combination of all key innovations in a 4-pixel demonstration, including microcalorimetry, microwave multiplexing, RF-SQUIDs, and SDR. We present the energy spectrum of a gadolinium-153 (153Gd) source we measured using our 4-pixel TES array and the RF-SQUID multiplexer. For each pixel, one can observe the two 97.4 and 103.2 keV photopeaks. We measured the 153Gd photon source with an achieved energy resolution of 70 eV, full width half maximum (FWHM) at 100 keV, and an equivalent readout system noise of 90 pA/pHz at the TES. This demonstration establishes a path for the readout of cryogenic x-ray and gamma ray sensor arrays with more elements and spectral resolving powers. We believe this project has improved capabilities and substantively advanced the science useful for missions such as nuclear forensics, emergency response, and treaty verification through the explored TES developments.
(SSR) markers for analysis of genetic diversity in African rice ...
African Journals Online (AJOL)
Bonny Oloka
2015-05-06
May 6, 2015 ... and conservation. To address this knowledge gap, 10 highly polymorphic rice simple sequence repeat. (SSR) markers were used to characterize 99 rice genotypes to determine their diversity and place them in their different population groups. The SSR markers were multiplexed in 3 panels to increase their.
User Multiplexing in Relay Enhanced LTE-Advanced Networks
DEFF Research Database (Denmark)
Teyeb, Oumer Mohammed; Frederiksen, Frank; Redana, Simone
2010-01-01
is radio relaying. This uses relay nodes that act as surrogate base stations for mobile users whose radio links with the base stations are not experiencing good enough conditions. In the downlink, the data that is destined for the relayed users may first have to be multiplexed by the base station, sent...... over the wireless backhaul link towards the relay node, and de-multiplexed and forwarded to the individual users by the relay node. The reverse process also has to be undertaken in the uplink. In this paper, we present a novel multiplexing scheme which is able to adapt the addressing and bitmapping...... of user identification to the actual number of users being served by the relay nodes, and thus greatly reduce the multiplexing overhead....
Real-time multiplexed digital cavity-enhanced spectroscopy
International Nuclear Information System (INIS)
Boyson, Toby K.; Dagdigian, Paul J.; Pavey, Karl D.; Fitzgerald, Nicholas J.; Spence, Thomas G.; Moore, David S.; Harb, Charles C.
2015-01-01
Cavity-enhanced spectroscopy is a sensitive optical absorption technique but one where the practical applications have been limited to studying small wavelength ranges. In addition, this Letter shows that wideband operation can be achieved by combining techniques usually reserved for the communications community with that of cavity-enhanced spectroscopy, producing a multiplexed real-time cavity-enhanced spectrometer. We use multiple collinear laser sources operating asynchronously and simultaneously while being detected on a single photodetector. This is synonymous with radio frequency (RF) cellular systems in which signals are detected on a single antenna but decoded uniquely. Here, we demonstrate results with spectra of methyl salicylate and show parts-per-billion per root hertz sensitivity measured in real-time
Recent progress of erbium-doped fiber amplifiers and their components
Fukushima, Masaru; Miura, Jutaro
2007-09-01
The Erbium-doped fiber amplifiers (EDFA) are widely available in a today's commercial market, and are deployed in various optical transmission applications from terrestrial system to undersea system. Broad gain spectrum over 9 THz enabled huge growth of bandwidth usage in 1550nm region aimed at broadband Internet, and its broad gain characteristics triggered bandwidth competition on dense wavelength division multiplex (DWDM) network these ten years. At first, we briefly review the evolutional history of EDFA with previous achievements. And we will explain the primary and important key devices which compose EDFA. We will discuss design parameters, and recent trend and achievements of the devices, which cover Erbium-doped fibers (EDF), 980-nm laser diodes (LD), and gain flattening filters (GFFs). The chip structure of 980-nm LD is explained to achieve high power and to realize high reliability. These key devices enabled EDFA to prevail in commercial area. After the discussion of key components, we will introduce recent achievements of gain controlled EDFAs which are applied in conjunction with Re-configurable Optical Add/Drop Multiplexer (ROADM). We will report the transient gain dynamics of the cascaded EDFAs with a recirculating loop experiment.
Scogin, Stephen C.; Cavlazoglu, Baki; LeBlanc, Jennifer; Stuessy, Carol L.
2017-08-01
While the achievement gap in science exists in the US, research associated with our investigation reveals some high school science programs serving diverse student bodies are successfully closing the gap. Using a mixed methods approach, we identified and investigated ten high schools in a large Southwestern state that fit the definition of "highly successful, highly diverse". By conducting interviews with science liaisons associated with each school and reviewing the literature, we developed a rubric identifying specific characteristics associated with successful science programs. These characteristics and practices included setting high expectations for students, providing extensive teacher support for student learning, and utilizing student-centered pedagogy. We used the rubric to assess the successful high school science programs and compare them to other high school science programs in the state (i.e., less successful and less diverse high school science programs). Highly successful, highly diverse schools were very different in their approach to science education when compared to the other programs. The findings from this study will help schools with diverse students to strengthen hiring practices, enhance teacher support mechanisms, and develop student-focused strategies in the classroom that increase science achievement.
Multiple routes transmitted epidemics on multiplex networks
International Nuclear Information System (INIS)
Zhao, Dawei; Li, Lixiang; Peng, Haipeng; Luo, Qun; Yang, Yixian
2014-01-01
This letter investigates the multiple routes transmitted epidemic process on multiplex networks. We propose detailed theoretical analysis that allows us to accurately calculate the epidemic threshold and outbreak size. It is found that the epidemic can spread across the multiplex network even if all the network layers are well below their respective epidemic thresholds. Strong positive degree–degree correlation of nodes in multiplex network could lead to a much lower epidemic threshold and a relatively smaller outbreak size. However, the average similarity of neighbors from different layers of nodes has no obvious effect on the epidemic threshold and outbreak size. -- Highlights: •We studies multiple routes transmitted epidemic process on multiplex networks. •SIR model and bond percolation theory are used to analyze the epidemic processes. •We derive equations to accurately calculate the epidemic threshold and outbreak size. •ASN has no effect on the epidemic threshold and outbreak size. •Strong positive DDC leads to a lower epidemic threshold and a smaller outbreak size.
Multiple routes transmitted epidemics on multiplex networks
Energy Technology Data Exchange (ETDEWEB)
Zhao, Dawei [Information Security Center, State Key Laboratory of Networking and Switching Technology, Beijing University of Posts and Telecommunications, P.O. Box 145, Beijing 100876 (China); National Engineering Laboratory for Disaster Backup and Recovery, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Shandong Provincial Key Laboratory of Computer Network, Shandong Computer Science Center, Jinan 250014 (China); Li, Lixiang [Information Security Center, State Key Laboratory of Networking and Switching Technology, Beijing University of Posts and Telecommunications, P.O. Box 145, Beijing 100876 (China); National Engineering Laboratory for Disaster Backup and Recovery, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Peng, Haipeng, E-mail: penghaipeng@bupt.edu.cn [Information Security Center, State Key Laboratory of Networking and Switching Technology, Beijing University of Posts and Telecommunications, P.O. Box 145, Beijing 100876 (China); National Engineering Laboratory for Disaster Backup and Recovery, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Luo, Qun; Yang, Yixian [Information Security Center, State Key Laboratory of Networking and Switching Technology, Beijing University of Posts and Telecommunications, P.O. Box 145, Beijing 100876 (China); National Engineering Laboratory for Disaster Backup and Recovery, Beijing University of Posts and Telecommunications, Beijing 100876 (China)
2014-02-01
This letter investigates the multiple routes transmitted epidemic process on multiplex networks. We propose detailed theoretical analysis that allows us to accurately calculate the epidemic threshold and outbreak size. It is found that the epidemic can spread across the multiplex network even if all the network layers are well below their respective epidemic thresholds. Strong positive degree–degree correlation of nodes in multiplex network could lead to a much lower epidemic threshold and a relatively smaller outbreak size. However, the average similarity of neighbors from different layers of nodes has no obvious effect on the epidemic threshold and outbreak size. -- Highlights: •We studies multiple routes transmitted epidemic process on multiplex networks. •SIR model and bond percolation theory are used to analyze the epidemic processes. •We derive equations to accurately calculate the epidemic threshold and outbreak size. •ASN has no effect on the epidemic threshold and outbreak size. •Strong positive DDC leads to a lower epidemic threshold and a smaller outbreak size.
Liu, Shaorong; Gao, Lin; Pu, Qiaosheng; Lu, Joann J; Wang, Xingjia
2006-02-01
We have recently developed a new process to create cross-linked polyacrylamide (CPA) coatings on capillary walls to suppress protein-wall interactions. Here, we demonstrate CPA-coated capillaries for high-efficiency (>2 x 10(6) plates per meter) protein separations by capillary zone electrophoresis (CZE). Because CPA virtually eliminates electroosmotic flow, positive and negative proteins cannot be analyzed in a single run. A "one-sample-two-separation" approach is developed to achieve a comprehensive protein analysis. High throughput is achieved through a multiplexed CZE system.
Impact of multiplexed reading scheme on nanocrossbar memristor memory's scalability
International Nuclear Information System (INIS)
Zhu Xuan; Tang Yu-Hua; Wu Jun-Jie; Yi Xun; Wu Chun-Qing
2014-01-01
Nanocrossbar is a potential memory architecture to integrate memristor to achieve large scale and high density memory. However, based on the currently widely-adopted parallel reading scheme, scalability of the nanocrossbar memory is limited, since the overhead of the reading circuits is in proportion with the size of the nanocrossbar component. In this paper, a multiplexed reading scheme is adopted as the foundation of the discussion. Through HSPICE simulation, we reanalyze scalability of the nanocrossbar memristor memory by investigating the impact of various circuit parameters on the output voltage swing as the memory scales to larger size. We find that multiplexed reading maintains sufficient noise margin in large size nanocrossbar memristor memory. In order to improve the scalability of the memory, memristors with nonlinear I—V characteristics and high LRS (low resistive state) resistance should be adopted. (interdisciplinary physics and related areas of science and technology)
Cryogenic on-chip multiplexer for the study of quantum transport in 256 split-gate devices
International Nuclear Information System (INIS)
Al-Taie, H.; Kelly, M. J.; Smith, L. W.; Xu, B.; Griffiths, J. P.; Beere, H. E.; Jones, G. A. C.; Ritchie, D. A.; Smith, C. G.; See, P.
2013-01-01
We present a multiplexing scheme for the measurement of large numbers of mesoscopic devices in cryogenic systems. The multiplexer is used to contact an array of 256 split gates on a GaAs/AlGaAs heterostructure, in which each split gate can be measured individually. The low-temperature conductance of split-gate devices is governed by quantum mechanics, leading to the appearance of conductance plateaux at intervals of 2e 2 /h. A fabrication-limited yield of 94% is achieved for the array, and a “quantum yield” is also defined, to account for disorder affecting the quantum behaviour of the devices. The quantum yield rose from 55% to 86% after illuminating the sample, explained by the corresponding increase in carrier density and mobility of the two-dimensional electron gas. The multiplexer is a scalable architecture, and can be extended to other forms of mesoscopic devices. It overcomes previous limits on the number of devices that can be fabricated on a single chip due to the number of electrical contacts available, without the need to alter existing experimental set ups
Standaert, Baudouin; Schecroun, Nadia; Ethgen, Olivier; Topachevskyi, Oleksandr; Morioka, Yoriko; Van Vlaenderen, Ilse
2017-12-01
Many countries struggle with the prioritisation of introducing new vaccines because of budget limitations and lack of focus on public health goals. A model has been developed that defines how specific health goals can be optimised through immunisation within vaccination budget constraints. Japan, as a country example, could introduce 4 new pediatric vaccines targeting influenza, rotavirus, pneumococcal disease and mumps with known burden of disease, vaccine efficacies and maximum achievable coverages. Operating under budget constraints, the Portfolio-model for the Management of Vaccines (PMV) identifies the optimal vaccine ranking and combination for achieving the maximum QALY gain over a period of 10 calendar years in children optimal sequence of vaccine introduction (mumps [1st], followed by influenza [2nd], rotavirus [3rd], and pneumococcal [4th]). With exactly the same budget but without vaccine ranking, the total QALY gain can be 20% lower. The PMV model could be a helpful tool for decision makers in those environments with limited budget where vaccines have to be selected for trying to optimise specific health goals. Copyright © 2017 GlaxoSmithKline Biologicals SA. Published by Elsevier B.V. All rights reserved.
DFT based spatial multiplexing and maximum ratio transmission for mm-wawe large MIMO
DEFF Research Database (Denmark)
Phan-Huy, D.-T.; Tölli, A.; Rajatheva, N.
2014-01-01
-SM-MRT). When the DFT-SM scheme alone is used, the data streams are either mapped onto different angles of departures in the case of aligned linear arrays, or mapped onto different orbital angular momentums in the case of aligned circular arrays. Maximum ratio transmission pre-equalizes the channel......By using large point-to-point multiple input multiple output (MIMO), spatial multiplexing of a large number of data streams in wireless communications using millimeter-waves (mm-waves) can be achieved. However, according to the antenna spacing and transmitter-receiver distance, the MIMO channel...... is likely to be ill-conditioned. In such conditions, highly complex schemes such as the singular value decomposition (SVD) are necessary. In this paper, we propose a new low complexity system called discrete Fourier transform based spatial multiplexing (DFT-SM) with maximum ratio transmission (DFT...
O'Dwyer, Aidan
2001-01-01
This paper will discuss the design of PI and PID controller tuning rules to compensate processes with delay, that are modelled in a number of ways. The rules allow the achievement of constant gain and phase margins as the delay varies.
International Nuclear Information System (INIS)
Zhao Jia-Sheng; Li Pan; Chen Xiao-Dong; Feng Su-Juan; Mao Qing-He
2012-01-01
The evolutions of the pulses propagating in decreasing and increasing gain distributed fiber amplifiers with finite gain bandwidths are investigated by simulations with the nonlinear Schrödinger equation. The results show that the parabolic pulse propagations in both the decreasing and the increasing gain amplifiers are restricted by the finite gain bandwidth. For a given input pulse, by choosing a small initial gain coefficient and gain variation rate, the whole gain for the pulse amplification limited by the gain bandwidth may be higher, which is helpful for the enhancement of the output linearly chirped pulse energy. Compared to the decreasing gain distributed fiber amplifier, the increasing gain distributed amplifier may be more conducive to suppress the pulse spectral broadening and increase the critical amplifier length for achieving a larger output linearly chirped pulse energy
Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi
2011-01-01
In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.
SQUID readout multiplexers for transition-edge sensor arrays
Energy Technology Data Exchange (ETDEWEB)
Lee, Adrian T. [Physics Department, University of California, Berkeley, CA 94720 (United States) and Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)]. E-mail: atl@physics.berkeley.edu
2006-04-15
Two classes of SQUID multiplexer are being developed for large arrays of cryogenic sensors, distinguished by their operation in either the time domain or frequency domain. Several systems optimized for use with Transition-Edge Sensors (TES) are reaching a high level of maturity, and will be deployed on funded astrophysics experiments in the next several years. A useful technical figure of merit is the product of the number of detectors multplexed multipled by the bandwidth of the detectors, which can be termed the 'total signal bandwidth' of a multiplexer system. This figure of merit is comparable within a factor of two for the mature systems. Several new concepts for increasing the total bandwidth are being developed in the broad class of frequency domain multiplexers. Another notable area of progress is in the level of integration of muliplexer and detector array. The time domain system for SCUBA-II is a sophisticated bump-bonded sandwich structure, and the Jena/MPI group is integrating detectors and a time domain multiplexer on one substrate. Finally, the Kinetic Inductance Detectors (KID)/HEMT (non-SQUID) detector/multiplexer system, will be discussed briefly.
Cross-talk free selective reconstruction of individual objects from multiplexed optical field data
Zea, Alejandro Velez; Barrera, John Fredy; Torroba, Roberto
2018-01-01
In this paper we present a data multiplexing method for simultaneous storage in a single package composed by several optical fields of tridimensional (3D) objects, and their individual cross-talk free retrieval. Optical field data are extracted from off axis Fourier holograms, and then sampled by multiplying them with random binary masks. The resulting sampled optical fields can be used to reconstruct the original objects. Sampling causes a loss of quality that can be controlled by the number of white pixels in the binary masks and by applying a padding procedure on the optical field data. This process can be performed using a different binary mask for each optical field, and then added to form a multiplexed package. With the adequate choice of sampling and padding, we can achieve a volume reduction in the multiplexed package over the addition of all individual optical fields. Moreover, the package can be multiplied by a binary mask to select a specific optical field, and after the reconstruction procedure, the corresponding 3D object is recovered without any cross-talk. We demonstrate the effectiveness of our proposal for data compression with a comparison with discrete cosine transform filtering. Experimental results confirm the validity of our proposal.
Multiplexing schemes for an achromatic programmable diffractive lens
Energy Technology Data Exchange (ETDEWEB)
Millan, M S; Perez-Cabre, E; Oton, J [Technical University of Catalonia, Dep. Optics and Optometry, Terrassa-Barcelona, 08222 (Spain)], E-mail: millan@oo.upc.edu
2008-11-01
A multiplexed programmable diffractive lens, displayed on a pixelated liquid crystal device under broadband illumination, is proposed to compensate for the severe chromatic aberration that affects diffractive elements. The proposed lens is based on multiplexing a set of sublenses with a common focal length for different wavelengths. We consider different types of integration of the optical information (spatial only, temporal only and hybrid spatial-temporal) combined with a proper selection of the spectral bandwidth. The properties and limits of the achromatic programmable multiplexed lens are described. Experimental results are presented and discussed.
Multiplexing schemes for an achromatic programmable diffractive lens
International Nuclear Information System (INIS)
Millan, M S; Perez-Cabre, E; Oton, J
2008-01-01
A multiplexed programmable diffractive lens, displayed on a pixelated liquid crystal device under broadband illumination, is proposed to compensate for the severe chromatic aberration that affects diffractive elements. The proposed lens is based on multiplexing a set of sublenses with a common focal length for different wavelengths. We consider different types of integration of the optical information (spatial only, temporal only and hybrid spatial-temporal) combined with a proper selection of the spectral bandwidth. The properties and limits of the achromatic programmable multiplexed lens are described. Experimental results are presented and discussed.
The Remarkable Structural Diversity Achieved in ent-Kaurane Diterpenes by Fungal Biotransformations
Directory of Open Access Journals (Sweden)
Jacqueline A. Takahashi
2014-02-01
Full Text Available The use of biotransformations in organic chemistry is widespread, with highlights of interesting applications in the functionalization of natural products containing unactivated carbons, like the kaurane diterpenes. A number of compounds with kaurane skeletons can be isolated in large amounts from several plant species and a myriad of biological activities has been related to these compounds. Studies on structure versus activity have showed that, in most cases, in kaurane diterpenes, activity increases with the increase of functionalization. Since naturally occurring kaurane diterpenes usually have limited functional groups to be used as targets for semi-synthetic modifications, production of more polar derivatives from kaurane diterpenes have been achieved mostly through the use of fungal biotransformations. In this review, selected examples the wonderful chemical diversity produced by fungi in kaurane diterpenes is presented. This diversity includes mainly hydroxylation of nearly all carbon atoms of the kaurane molecule, many of them carried out stereoselectively, as well as ring rearrangements, among other chemical modifications. Sources of starting materials, general biotransformation protocols employed, fungi with most consistent regioselectivity towards kaurane skeleton, as well as biological activities associated with starting materials and products are also described.
Eigenmode multiplexing with SLM for volume holographic data storage
Chen, Guanghao; Miller, Bo E.; Takashima, Yuzuru
2017-08-01
The cavity supports the orthogonal reference beam families as its eigenmodes while enhancing the reference beam power. Such orthogonal eigenmodes are used as additional degree of freedom to multiplex data pages, consequently increase storage densities for volume Holographic Data Storage Systems (HDSS) when the maximum number of multiplexed data page is limited by geometrical factor. Image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at multiple Bragg angles by using Liquid Crystal on Silicon (LCOS) spatial light modulators (SLMs) in reference arms. Total of nine holograms are recorded with three angular and three eigenmode.
Yeom, Jeong Seon; Chu, Eunmi; Jung, Bang Chul; Jin, Hu
2018-02-10
In this paper, we propose a novel low-complexity multi-user superposition transmission (MUST) technique for 5G downlink networks, which allows multiple cell-edge users to be multiplexed with a single cell-center user. We call the proposed technique diversity-controlled MUST technique since the cell-center user enjoys the frequency diversity effect via signal repetition over multiple orthogonal frequency division multiplexing (OFDM) sub-carriers. We assume that a base station is equipped with a single antenna but users are equipped with multiple antennas. In addition, we assume that the quadrature phase shift keying (QPSK) modulation is used for users. We mathematically analyze the bit error rate (BER) of both cell-edge users and cell-center users, which is the first theoretical result in the literature to the best of our knowledge. The mathematical analysis is validated through extensive link-level simulations.
Brunow, Stephan; Nijkamp, Peter
There is evidence from the literature that firms enjoy higher productivity levels, when the workforce employed is culturally more diverse. It is an open question whether this gain is utilized to shift the supply curve and set lower prices in order to achieve a higher demand and possibly higher
Xin, Wei
1997-10-01
A Terabit Hybrid Electro-optical /underline[Se]lf- routing Ultrafast Switch (THESEUS) has been proposed. It is a self-routing wavelength division multiplexed (WDM) / microwave subcarrier multiplexed (SCM) asynchronous transfer mode (ATM) switch for the multirate ATM networks. It has potential to be extended to a large ATM switch as 1000 x 1000 without internal blocking. Among the advantages of the hybrid implementation are flexibility in service upgrade, relaxed tolerances on optical filtering, protocol simplification and less processing overhead. For a small ATM switch, the subcarrier can be used as output buffers to solve output contention. A mathematical analysis was conducted to evaluate different buffer configurations. A testbed has been successfully constructed. Multirate binary data streams have been switched through the testbed and error free reception ([<]10-9 bit error rate) has been achieved. A simple, intuitive theoretical model has been developed to describe the heterodyne optical beat interference. A new concept of interference time and interference length has been introduced. An experimental confirmation has been conducted. The experimental results match the model very well. It shows that a large portion of optical bandwidth is wasted due to the beat interference. Based on the model, several improvement approaches have been proposed. The photo-generated carrier lifetime of silicon germanium has been measured using time-resolved reflectivity measurement. Via oxygen ion implantation, the carrier lifetime has been reduced to as short as 1 ps, corresponding to 1 THz of photodetector bandwidth. It has also been shown that copper dopants act as recombination centers in the silicon germanium.
Social contagions on correlated multiplex networks
Wang, Wei; Cai, Meng; Zheng, Muhua
2018-06-01
The existence of interlayer degree correlations has been disclosed by abundant multiplex network analysis. However, how they impose on the dynamics of social contagions are remain largely unknown. In this paper, we propose a non-Markovian social contagion model in multiplex networks with inter-layer degree correlations to delineate the behavior spreading, and develop an edge-based compartmental (EBC) theory to describe the model. We find that multiplex networks promote the final behavior adoption size. Remarkably, it can be observed that the growth pattern of the final behavior adoption size, versus the behavioral information transmission probability, changes from discontinuous to continuous once decreasing the behavior adoption threshold in one layer. We finally unravel that the inter-layer degree correlations play a role on the final behavior adoption size but have no effects on the growth pattern, which is coincidence with our prediction by using the suggested theory.
Directory of Open Access Journals (Sweden)
Nayereh Nouri
2014-01-01
Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.
Experimental investigation of the cascadability of a cross-gain modulation wavelength converter
DEFF Research Database (Denmark)
Zheng, Xueyan; Liu, Fenghai; Kloch, Allan
2000-01-01
by adding a fiber grating-based optical add-drop multiplexer after the semiconductor optical amplifier (SOA) to enhance the high-frequency response of the wavelength converter. However, the low-frequency degradation of the signal together with amplified spontaneous emission (ASE) noise and jitter......The cascading characteristics of a wavelength converter based on cross-gain modulation (XGM) are studied experimentally using a recirculating loop at 10 Gb/s. The maximum cascaded number of the wavelength converter converting the signal to the same wavelength is improved from five to eight...
Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.
Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng
2017-10-11
To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.
Developments of Highly Multiplexed, Multi-chroic Pixels for Balloon-Borne Platforms
Aubin, F.; Hanany, S.; Johnson, B. R.; Lee, A.; Suzuki, A.; Westbrook, B.; Young, K.
2018-02-01
We present our work to develop and characterize low thermal conductance bolometers that are part of sinuous antenna multi-chroic pixels (SAMP). We use longer, thinner and meandered bolometer legs to achieve 9 pW/K thermal conductance bolometers. We also discuss the development of inductor-capacitor chips operated at 4 K to extend the multiplexing factor of the frequency domain multiplexing to 105, an increase of 60% compared to the factor currently demonstrated for this readout system. This technology development is motivated by EBEX-IDS, a balloon-borne polarimeter designed to characterize the polarization of foregrounds and to detect the primordial gravity waves through their B-mode signature on the polarization of the cosmic microwave background. EBEX-IDS will operate 20,562 transition edge sensor bolometers spread over 7 frequency bands between 150 and 360 GHz. Balloon and satellite platforms enable observations at frequencies inaccessible from the ground and with higher instantaneous sensitivity. This development improves the readiness of the SAMP and frequency domain readout technologies for future satellite applications.
Moving through a multiplex holographic scene
Mrongovius, Martina
2013-02-01
This paper explores how movement can be used as a compositional element in installations of multiplex holograms. My holographic images are created from montages of hand-held video and photo-sequences. These spatially dynamic compositions are visually complex but anchored to landmarks and hints of the capturing process - such as the appearance of the photographer's shadow - to establish a sense of connection to the holographic scene. Moving around in front of the hologram, the viewer animates the holographic scene. A perception of motion then results from the viewer's bodily awareness of physical motion and the visual reading of dynamics within the scene or movement of perspective through a virtual suggestion of space. By linking and transforming the physical motion of the viewer with the visual animation, the viewer's bodily awareness - including proprioception, balance and orientation - play into the holographic composition. How multiplex holography can be a tool for exploring coupled, cross-referenced and transformed perceptions of movement is demonstrated with a number of holographic image installations. Through this process I expanded my creative composition practice to consider how dynamic and spatial scenes can be conveyed through the fragmented view of a multiplex hologram. This body of work was developed through an installation art practice and was the basis of my recently completed doctoral thesis: 'The Emergent Holographic Scene — compositions of movement and affect using multiplex holographic images'.
Radiometric and signal-to-noise ratio properties of multiplex dispersive spectrometry
International Nuclear Information System (INIS)
Barducci, Alessandro; Guzzi, Donatella; Lastri, Cinzia; Nardino, Vanni; Marcoionni, Paolo; Pippi, Ivan
2010-01-01
Recent theoretical investigations have shown important radiometric disadvantages of interferential multiplexing in Fourier transform spectrometry that apparently can be applied even to coded aperture spectrometers. We have reexamined the methods of noninterferential multiplexing in order to assess their signal-to-noise ratio (SNR) performance, relying on a theoretical modeling of the multiplexed signals. We are able to show that quite similar SNR and radiometric disadvantages affect multiplex dispersive spectrometry. The effect of noise on spectral estimations is discussed.
Directory of Open Access Journals (Sweden)
Xiaoling Wang
2016-07-01
Full Text Available Building on longitudinal data from 73 Chinese manufacturing firms during 2009–2012, we assess whether and how firms gain higher efficiency in achieving their sustainability goals by adopting management practice standards (ISO 9001, ISO 14001, and/or OHSAS 18001. We propose four pathways for firms to gain sustainability efficiency in their certification journey: participation, qualitative integration, quantitative expansion, and temporal accumulation. Our results confirm that firms certifying management standards gain higher efficiency in pursuing their sustainability goals than firms without these standards. We also find some support for increased efficiency effect in firms with diverse management systems over firms with only a single certificate in 2011. Finally, our results highlight the experiential and temporal accumulation effect of such efficiency gains, that is, firms with prior certification experience or having a longer certification history demonstrate higher efficiency gains in pursuing their sustainability goals.
Topology-optimized silicon photonic wire mode (de)multiplexer
DEFF Research Database (Denmark)
Frellsen, Louise Floor; Frandsen, Lars Hagedorn; Ding, Yunhong
2015-01-01
We have designed and for the first time experimentally verified a topology optimized mode (de)multiplexer, which demultiplexes the fundamental and the first order mode of a double mode photonic wire to two separate single mode waveguides (and multiplexes vice versa). The device has a footprint...
Link overlap, viability, and mutual percolation in multiplex networks
International Nuclear Information System (INIS)
Min, Byungjoon; Lee, Sangchul; Lee, Kyu-Min; Goh, K.-I.
2015-01-01
Many real-world complex systems are best modeled by multiplex networks. The multiplexity has proved to have broad impact on the system’s structure and function. Most theoretical studies on multiplex networks to date, however, have largely ignored the effect of the link overlap across layers despite strong empirical evidences for its significance. In this article, we investigate the effect of the link overlap in the viability of multiplex networks, both analytically and numerically. After a short recap of the original multiplex viability study, the distinctive role of overlapping links in viability and mutual connectivity is emphasized and exploited for setting up a proper analytic framework. A rich phase diagram for viability is obtained and greatly diversified patterns of hysteretic behavior in viability are observed in the presence of link overlap. Mutual percolation with link overlap is revisited as a limit of multiplex viability problem, and the controversy between existing results is clarified. The distinctive role of overlapping links is further demonstrated by the different responses of networks under random removals of overlapping and non-overlapping links, respectively, as well as under several link-removal strategies. Our results show that the link overlap facilitates the viability and mutual percolation; at the same time, the presence of link overlap poses a challenge in analytical approaches to the problem
Fragoso, Alex; Laboria, Noemi; Botero, Mary Luz; Bejarano, Diego; Latta, Daniel; Hansen-Hagge, Thomas E.; Kemmner, Wolfgang; Katakis, Ioanis; Gärtner, Claudia; Drese, Klaus; O'Sullivan, Ciara K.
2010-02-01
A microsystem integrating electrochemical biosensoric detection for the simultaneous multiplexed detection of protein markers of breast cancer is reported. The immobilization of antibodies against each of carcinoembryonic antigen (CEA), prostate specific antigen (PSA) and cancer antigen 15-3 (CA15-3) was achieved via crosslinking to a bipodal dithiol chemisorbed on gold electrodes. This bipodal dithiol had the double function of eliminating non-specific binding and optimal spacing of the anchor antibodies for maximum accessibility to the target proteins. Storage conditions were optimized, demonstrating a long-term stability of the reporter conjugates jointly stored within a single reservoir in the microsystem. The final system has been optimized in terms of incubation times, temperatures and simultaneous, multiplexed detection of the protein markers was achieved in less than 10 minutes with less than ng/mL detection limits. The microsystem has been validated using real patient serum samples and excellent correlation with ELISA results obtained.
Genetic barcoding with fluorescent proteins for multiplexed applications.
Smurthwaite, Cameron A; Williams, Wesley; Fetsko, Alexandra; Abbadessa, Darin; Stolp, Zachary D; Reed, Connor W; Dharmawan, Andre; Wolkowicz, Roland
2015-04-14
Fluorescent proteins, fluorescent dyes and fluorophores in general have revolutionized the field of molecular cell biology. In particular, the discovery of fluorescent proteins and their genes have enabled the engineering of protein fusions for localization, the analysis of transcriptional activation and translation of proteins of interest, or the general tracking of individual cells and cell populations. The use of fluorescent protein genes in combination with retroviral technology has further allowed the expression of these proteins in mammalian cells in a stable and reliable manner. Shown here is how one can utilize these genes to give cells within a population of cells their own biosignature. As the biosignature is achieved with retroviral technology, cells are barcoded 'indefinitely'. As such, they can be individually tracked within a mixture of barcoded cells and utilized in more complex biological applications. The tracking of distinct populations in a mixture of cells is ideal for multiplexed applications such as discovery of drugs against a multitude of targets or the activation profile of different promoters. The protocol describes how to elegantly develop and amplify barcoded mammalian cells with distinct genetic fluorescent markers, and how to use several markers at once or one marker at different intensities. Finally, the protocol describes how the cells can be further utilized in combination with cell-based assays to increase the power of analysis through multiplexing.
Opportunistic Fixed Gain Bidirectional Relaying with Outdated CSI
Khan, Fahd Ahmed; Tourki, Kamel; Alouini, Mohamed-Slim; Qaraqe, Khalid A.
2015-01-01
In a network with multiple relays, relay selection has been shown as an effective scheme to achieve diversity as well as to improve the overall throughput. This paper studies the impact of using outdated channel state information for relay selection on the performance of a network where two sources communicate with each other via fixed-gain amplify-and-forward relays. For a Rayleigh faded channel, closed-form expressions for the outage probability, moment generating function and symbol error rate are derived. Simulations results are also presented to corroborate the derived analytical results. It is shown that adding relays does not improve the performance if the channel is substantially outdated. Furthermore, relay location is also taken into consideration and it is shown that the performance can be improved by placing the relay closer to the source whose channel is more outdated. © 2015 IEEE.
Opportunistic Fixed Gain Bidirectional Relaying with Outdated CSI
Khan, Fahd Ahmed
2015-05-01
In a network with multiple relays, relay selection has been shown as an effective scheme to achieve diversity as well as to improve the overall throughput. This paper studies the impact of using outdated channel state information for relay selection on the performance of a network where two sources communicate with each other via fixed-gain amplify-and-forward relays. For a Rayleigh faded channel, closed-form expressions for the outage probability, moment generating function and symbol error rate are derived. Simulations results are also presented to corroborate the derived analytical results. It is shown that adding relays does not improve the performance if the channel is substantially outdated. Furthermore, relay location is also taken into consideration and it is shown that the performance can be improved by placing the relay closer to the source whose channel is more outdated. © 2015 IEEE.
Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh
2018-04-23
Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.
Directory of Open Access Journals (Sweden)
Qiuying Huang
2011-04-01
Full Text Available Probe-based fluorescence melting curve analysis (FMCA is a powerful tool for mutation detection based on melting temperature generated by thermal denaturation of the probe-target hybrid. Nevertheless, the color multiplexing, probe design, and cross-platform compatibility remain to be limited by using existing probe chemistries. We hereby explored two dual-labeled, self-quenched probes, TaqMan and shared-stem molecular beacons, in their ability to conduct FMCA. Both probes could be directly used for FMCA and readily integrated with closed-tube amplicon hybridization under asymmetric PCR conditions. Improved flexibility of FMCA by using these probes was illustrated in three representative applications of FMCA: mutation scanning, mutation identification and mutation genotyping, all of which achieved improved color-multiplexing with easy probe design and versatile probe combination and all were validated with a large number of real clinical samples. The universal cross-platform compatibility of these probes-based FMCA was also demonstrated by a 4-color mutation genotyping assay performed on five different real-time PCR instruments. The dual-labeled, self-quenched probes offered unprecedented combined advantage of enhanced multiplexing, improved flexibility in probe design, and expanded cross-platform compatibility, which would substantially improve FMCA in mutation detection of various applications.
Digital holograms for laser mode multiplexing
CSIR Research Space (South Africa)
Mhlanga, T
2014-10-02
Full Text Available multiplexing Thandeka Mhlangaa, b, Abderrahmen Trichilic, Angela Dudleya, Darryl Naidooa, b, Mourad Zghalc and Andrew Forbesa, b aCSIR National Laser Centre, P.O. Box 395, Pretoria 0001, South Africa bSchool of Physics, University of KwaZulu-Natal, Private Bag... problems. In this context, we demonstrate a method of multiplexing laser modes using spatial light modulators (SLMs). In our proposed technique, we use Laguerre Gaussian (LG) modes, which form a complete basis set; hence multi-mode masks can be created...
Simple Multiplexing Hand-Held Control Unit
Hannaford, Blake
1989-01-01
Multiplexer consists of series of resistors, each shunted by single-pole, single-throw switch. User operates switches by pressing buttons or squeezing triggers. Prototype includes three switches operated successfully in over 200 hours of system operations. Number of switches accommodated determined by signal-to-noise ratio of current source, noise induced in control unit and cable, and number of bits in output of analog-to-digital converter. Because many computer-contolled robots have extra analog-to-digital channels, such multiplexer added at little extra cost.
Adaptive Neuro-Fuzzy Based Gain Controller for Erbium-Doped Fiber Amplifiers
Directory of Open Access Journals (Sweden)
YUCEL, M.
2017-02-01
Full Text Available Erbium-doped fiber amplifiers (EDFA must have a flat gain profile which is a very important parameter such as wavelength division multiplexing (WDM and dense WDM (DWDM applications for long-haul optical communication systems and networks. For this reason, it is crucial to hold a stable signal power per optical channel. For the purpose of overcoming performance decline of optical networks and long-haul optical systems, the gain of the EDFA must be controlled for it to be fixed at a high speed. In this study, due to the signal power attenuation in long-haul fiber optic communication systems and non-equal signal amplification in each channel, an automatic gain controller (AGC is designed based on the adaptive neuro-fuzzy inference system (ANFIS for EDFAs. The intelligent gain controller is implemented and the performance of this new electronic control method is demonstrated. The proposed ANFIS-based AGC-EDFA uses the experimental dataset to produce the ANFIS-based sets and the rule base. Laser diode currents are predicted within the accuracy rating over 98 percent with the proposed ANFIS-based system. Upon comparing ANFIS-based AGC-EDFA and experimental results, they were found to be very close and compatible.
Microprocessorized message multiplexer
International Nuclear Information System (INIS)
Ejzman, S.; Guglielmi, L.; Jaeger, J.J.
1980-07-01
The 'Microprocessorized Message Multiplexer' is an elementary development tool used to create and debug the software of a target microprocessor (User Module: UM). It connects together four devices: a terminal, a cassette recorder, the target microprocessor and a host computer where macro and editor for the M 6800 microprocessor are resident [fr
Design, development and evaluation of a resistor-based multiplexing circuit for a 20×20 SiPM array
International Nuclear Information System (INIS)
Wang, Zhonghai; Sun, Xishan; Lou, Kai; Meier, Joseph; Zhou, Rong; Yang, Chaowen; Zhu, Xiaorong; Shao, Yiping
2016-01-01
One technical challenge in developing a large-size scintillator detector with multiple Silicon Photomultiplier (SiPM) arrays is to read out a large number of detector output channels. To achieve this, different signal multiplexing circuits have been studied and applied with different performances and cost-effective tradeoffs. Resistor-based multiplexing circuits exhibit simplicity and signal integrity, but also present the disadvantage of timing shift among different channels. In this study, a resistor-based multiplexing circuit for a large-sized SiPM array readout was developed and evaluated by simulation and experimental studies. Similarly to a multiplexing circuit used for multi-anode PMT, grounding and branching resistors were connected to each SiPM output channel. The grounding resistor was used to simultaneously reduce the signal crosstalk among different channels and to improve timing performance. Both grounding and branching resistor values were optimized to maintain a balanced performance of the event energy, timing, and positioning. A multiplexing circuit was implemented on a compact PCB and applied for a flat-panel detector which consisted of a 32×32 LYSO scintillator crystals optically coupled to 5×5 SiPM arrays for a total 20×20 output channels. Test results showed excellent crystal identification for all 1024 LYSO crystals (each with 2×2×30 mm"3 size) with "2"2Na flood-source irradiation. The measured peak-to-valley ratio from typical crystal map profile is around 3:1 to 6.6:1, an average single crystal energy resolution of about 17.3%, and an average single crystal timing resolution of about 2 ns. Timing shift among different crystals, as reported in some other resistor-based multiplexing circuit designs, was not observed. In summary, we have designed and implemented a practical resistor-based multiplexing circuit that can be readily applied for reading out a large SiPM array with good detector performance.
Design, development and evaluation of a resistor-based multiplexing circuit for a 20×20 SiPM array
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhonghai [College of Physical Science and Technology, Key Laboratory of Radiation Physics and Technology, Ministry of Education, Sichuan University, Chengdu (China); Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States); Sun, Xishan [Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States); Lou, Kai [Department of Electrical and Computer Engineering, Rice University, Houston, Tx (United States); Meier, Joseph [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, Tx (United States); Zhou, Rong; Yang, Chaowen [College of Physical Science and Technology, Key Laboratory of Radiation Physics and Technology, Ministry of Education, Sichuan University, Chengdu (China); Zhu, Xiaorong [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, Houston, Tx (United States); Shao, Yiping [Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States)
2016-04-21
One technical challenge in developing a large-size scintillator detector with multiple Silicon Photomultiplier (SiPM) arrays is to read out a large number of detector output channels. To achieve this, different signal multiplexing circuits have been studied and applied with different performances and cost-effective tradeoffs. Resistor-based multiplexing circuits exhibit simplicity and signal integrity, but also present the disadvantage of timing shift among different channels. In this study, a resistor-based multiplexing circuit for a large-sized SiPM array readout was developed and evaluated by simulation and experimental studies. Similarly to a multiplexing circuit used for multi-anode PMT, grounding and branching resistors were connected to each SiPM output channel. The grounding resistor was used to simultaneously reduce the signal crosstalk among different channels and to improve timing performance. Both grounding and branching resistor values were optimized to maintain a balanced performance of the event energy, timing, and positioning. A multiplexing circuit was implemented on a compact PCB and applied for a flat-panel detector which consisted of a 32×32 LYSO scintillator crystals optically coupled to 5×5 SiPM arrays for a total 20×20 output channels. Test results showed excellent crystal identification for all 1024 LYSO crystals (each with 2×2×30 mm{sup 3} size) with {sup 22}Na flood-source irradiation. The measured peak-to-valley ratio from typical crystal map profile is around 3:1 to 6.6:1, an average single crystal energy resolution of about 17.3%, and an average single crystal timing resolution of about 2 ns. Timing shift among different crystals, as reported in some other resistor-based multiplexing circuit designs, was not observed. In summary, we have designed and implemented a practical resistor-based multiplexing circuit that can be readily applied for reading out a large SiPM array with good detector performance.
Multiplexing a high-throughput liability assay to leverage efficiencies.
Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele
2009-06-01
In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.
Multiplex PCR identification of Taenia spp. in rodents and carnivores.
Al-Sabi, Mohammad N S; Kapel, Christian M O
2011-11-01
The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.
Characterization of highly multiplexed monolithic PET / gamma camera detector modules
Pierce, L. A.; Pedemonte, S.; DeWitt, D.; MacDonald, L.; Hunter, W. C. J.; Van Leemput, K.; Miyaoka, R.
2018-04-01
PET detectors use signal multiplexing to reduce the total number of electronics channels needed to cover a given area. Using measured thin-beam calibration data, we tested a principal component based multiplexing scheme for scintillation detectors. The highly-multiplexed detector signal is no longer amenable to standard calibration methodologies. In this study we report results of a prototype multiplexing circuit, and present a new method for calibrating the detector module with multiplexed data. A 50 × 50 × 10 mm3 LYSO scintillation crystal was affixed to a position-sensitive photomultiplier tube with 8 × 8 position-outputs and one channel that is the sum of the other 64. The 65-channel signal was multiplexed in a resistive circuit, with 65:5 or 65:7 multiplexing. A 0.9 mm beam of 511 keV photons was scanned across the face of the crystal in a 1.52 mm grid pattern in order to characterize the detector response. New methods are developed to reject scattered events and perform depth-estimation to characterize the detector response of the calibration data. Photon interaction position estimation of the testing data was performed using a Gaussian Maximum Likelihood estimator and the resolution and scatter-rejection capabilities of the detector were analyzed. We found that using a 7-channel multiplexing scheme (65:7 compression ratio) with 1.67 mm depth bins had the best performance with a beam-contour of 1.2 mm FWHM (from the 0.9 mm beam) near the center of the crystal and 1.9 mm FWHM near the edge of the crystal. The positioned events followed the expected Beer–Lambert depth distribution. The proposed calibration and positioning method exhibited a scattered photon rejection rate that was a 55% improvement over the summed signal energy-windowing method.
High-Capacity Multi-Core Fibers for Space-Division Multiplexing
DEFF Research Database (Denmark)
Ye, Feihong
The transmission capacity of the present optical fiber communication systems based on time division multiplexing (TDM) and wavelength-division multiplexing (WDM) using single-mode fibers (SMFs) is reaching its limit of around 100 Tbit/s per fiber due to the fiber nonlinearities, fiber fuse...... phenomenon and the optical amplifier bandwidth. To meet the ever increasing global data traffic growth and to overcome the looming capacity crunch, a new multiplexing technology using new optical fibers is urgently needed. Space-division multiplexing (SDM) is a promising scheme to overcome the capacity limit...... of the present SMF-based systems. Among the proposed SDM schemes, the one based on uncoupled multi-core fibers (MCFs) having multiple cores in a mutual cladding has proven effective in substantially increasing the transmission capacity per fiber with least system complexity as demonstrated in several state...
DEFF Research Database (Denmark)
de Bang, Thomas Christian
Analytical methods for targeted and multiplexed analysis of proteins and nucleic acids (DNA and RNA) are important tools for investigating how environmental stimuli affect biological entities at the molecular level. Specific analyses of proteins and nucleic acids can be achieved on the basis...
Active Seattle: achieving walkability in diverse neighborhoods.
Deehr, Rebecca C; Shumann, Amy
2009-12-01
The Active Living by Design project based in Seattle (Active Seattle) advocated for policies and projects in diverse communities supporting a more walkable city, while using social marketing and education to get more people walking more often. Walking audits were carried out in select diverse neighborhoods, resulting in recommendations for policy change and built-environment improvements. Advocacy for city-scale policies also occurred. Walking maps and other social-marketing products promoted behavior change. Major Safe Routes to School activities occurred and were made possible by separate funding sources. Positive results of Active Seattle included an increase in funding for pedestrian infrastructure, a pedestrian master plan, a Complete Streets policy, substantial increase in Safe Routes to School activity, and institutionalization of active living and active transportation within partner agencies. Challenges included institutional prioritization for improving pedestrian infrastructure, funding inequity, and a community need that was greater than could be fulfilled. Efforts to overcome funding inequities or other resistance to pedestrian-oriented physical projects will benefit from high-visibility campaigns that have a lasting impact on public perception and decision makers' political will. To reach vulnerable populations that have substantial barriers to increasing walking frequency, extensive staff time for outreach is needed. Changing the built environment to encourage walking may be a long-term solution in communities with diverse populations. Influencing and educating local government officials to make active living projects and policies a high budgetary priority is essential for large-scale impact and long-term change.
Directory of Open Access Journals (Sweden)
Lank Simon M
2012-08-01
Full Text Available Abstract Background High-resolution HLA genotyping is a critical diagnostic and research assay. Current methods rarely achieve unambiguous high-resolution typing without making population-specific frequency inferences due to a lack of locus coverage and difficulty in exon-phase matching. Achieving high-resolution typing is also becoming more challenging with traditional methods as the database of known HLA alleles increases. Results We designed a cDNA amplicon-based pyrosequencing method to capture 94% of the HLA class I open-reading-frame with only two amplicons per sample, and an analogous method for class II HLA genes, with a primary focus on sequencing the DRB loci. We present a novel Galaxy server-based analysis workflow for determining genotype. During assay validation, we performed two GS Junior sequencing runs to determine the accuracy of the HLA class I amplicons and DRB amplicon at different levels of multiplexing. When 116 amplicons were multiplexed, we unambiguously resolved 99%of class I alleles to four- or six-digit resolution, as well as 100% unambiguous DRB calls. The second experiment, with 271 multiplexed amplicons, missed some alleles, but generated high-resolution, concordant typing for 93% of class I alleles, and 96% for DRB1 alleles. In a third, preliminary experiment we attempted to sequence novel amplicons for other class II loci with mixed success. Conclusions The presented assay is higher-throughput and higher-resolution than existing HLA genotyping methods, and suitable for allele discovery or large cohort sampling. The validated class I and DRB primers successfully generated unambiguously high-resolution genotypes, while further work is needed to validate additional class II genotyping amplicons.
Counsell, Shelly L.; Wright, Brian L.
2016-01-01
Physical science activities provide multiple and varied opportunities for young children to actively observe, engage in, interact with, and interpret experiences in the physical world within diverse, inclusive settings. If all learners are to gain access to, fully participate in, and achieve maximum profit from early science opportunities,…
Coherence Multiplex System Topologies
Meijerink, Arjan; Taniman, R.O.; Heideman, G.H.L.M.; van Etten, Wim
2007-01-01
Coherence multiplexing is a potentially inexpensive form of optical code-division multiple access, which is particularly suitable for short-range applications with moderate bandwidth requirements, such as access networks, LANs, or interconnects. Various topologies are known for constructing an
An output amplitude configurable wideband automatic gain control with high gain step accuracy
International Nuclear Information System (INIS)
He Xiaofeng; Ye Tianchun; Mo Taishan; Ma Chengyan
2012-01-01
An output amplitude configurable wideband automatic gain control (AGC) with high gain step accuracy for the GNSS receiver is presented. The amplitude of an AGC is configurable in order to cooperate with baseband chips to achieve interference suppression and be compatible with different full range ADCs. And what's more, the gain-boosting technology is introduced and the circuit is improved to increase the step accuracy. A zero, which is composed by the source feedback resistance and the source capacity, is introduced to compensate for the pole. The AGC is fabricated in a 0.18 μm CMOS process. The AGC shows a 62 dB gain control range by 1 dB each step with a gain error of less than 0.2 dB. The AGC provides 3 dB bandwidth larger than 80 MHz and the overall power consumption is less than 1.8 mA, and the die area is 800 × 300 μm 2 . (semiconductor integrated circuits)
High sensitive photonic crystal multiplexed biosensor array using H0 sandwiched cavities
Directory of Open Access Journals (Sweden)
Arafa Safia
2017-01-01
Full Text Available We theoretically investigate a high sensitive photonic crystal integrated biosensor array structure which is potentially used for label-free multiplexed sensing. The proposed device consists of an array of three sandwiched H0 cavities patterned above silicon on insulator (SOI substrate; each cavity has been designed for different cavity spacing and different resonant wavelength. Results obtained by performing finite-difference time-domain (FDTD simulations, indicate that the response of each detection unit shifts independently in terms of refractive index variations. The optimized design makes possible the combination of sensing as a function of location, as well as a function of time in the same platform. A refractive index sensitivity of 520nm/RIU and a quality factor over 104 are both achieved with an accompanied crosstalk of less than -26 dB. In addition, the device presents an improved detection limit (DL of 1.24.10-6 RIU and a wide measurement range. These features make the designed device a promising element for performing label-free multiplexed detection in monolithic substrate for medical diagnostics and environmental monitoring.
Mode-multiplexed transmission over conventional graded-index multimode fibers
Ryf, R.; Fontaine, N.K.; Chen, H.; Guan, B.; Huang, B.; Esmaeelpour, M.; Gnauck, A.H.; Randel, S.; Yoo, S.J.B.; Koonen, A.M.J.; Shubochkin, R.; Sun, Yi; Lingle, R.
2015-01-01
We present experimental results for combined mode-multiplexed and wavelength multiplexed transmission over conventional graded-index multimode fibers. We use mode-selective photonic lanterns as mode couplers to precisely excite a subset of the modes of the multimode fiber and additionally to
DEFF Research Database (Denmark)
2015-01-01
The present invention relates to a multiplex editing system. The system allows multiple editing of nucleic acid sequences such as genomic sequences, such as knockins of genes of interest in a genome, knockouts of genomic sequences and/or allele replacement. Also provided herein are a method...... for editing nucleic acids and a cell comprising a stably integrated endonuclease....
Directory of Open Access Journals (Sweden)
Fuyu Shimomura
2016-02-01
Full Text Available Increasing student diversity in K-12 schools has gained attention in Japan and the US. In the US, racial diversity has historically shaped inequity in educational access and teacher quality. In Japan, regardless of its reputation for cultural homogeneity among its residents, issues surrounding student diversity have gained attention because of the increasing number of returnees—Japanese students raised overseas because of their parents’ expatriation. This paper compares and contrasts the diversity issues in K-12 school settings in both countries, and explores potential approaches to improve the accommodation of diversity in K-12 schools.
Jiao, Wei; Xie, Li; Li, Hailan; Lan, Jiao; Mo, Zhuning; Yang, Ziji; Liu, Fei; Xiao, Ruiping; He, Yunlei; Ye, Luyi; Zhu, Ziyan
2014-04-01
To screen rare blood groups Fy(a-), s-, k-, Di(b-) and Js(b-) in an ethnic Zhuang population. Sequence-specific primers were designed based on single nucleotide polymorphism (SNP) sites of blood group antigens Fy(b) and s. A specific multiplex PCR system I was established. Multiplex PCR system II was applied to detect alleles antigens Di(b), k, Js(b)1910 and Js(b) 2019 at the same time. The two systems was were used to screen for rare blood group antigens in 4490 randomly selected healthy donors of Guangxi Zhuang ethnic origin. We successfully made the multiplex PCR system I. We detected the rare blood group antigens using the two PCR system. There are five Fy(a-), three s(-), two Di(b-) in 4490 Guangxi zhuang random samples. The multiplex PCR system I has achieved good accuracy and stability. With multiplex PCR systems I and II, 4490 samples were screened. Five Fy(a-), three s(-) and two Di(b-) samples were discovered. Multiplex PCR is an effective methods, which can be used for high throughput screening of rare blood groups. The rare blood types of Guangxi Zhuang ethnic origin obtained through the screening can provide valuable information for compatible blood transfusion. Through screening we obtained precious rare blood type materials which can be used to improve the capability of compatible infusion and reduce the transfusion reactions.
Zhao, Ming; Li, Yu; Peng, Leilei
2014-05-05
We present a novel excitation-emission multiplexed fluorescence lifetime microscopy (FLIM) method that surpasses current FLIM techniques in multiplexing capability. The method employs Fourier multiplexing to simultaneously acquire confocal fluorescence lifetime images of multiple excitation wavelength and emission color combinations at 44,000 pixels/sec. The system is built with low-cost CW laser sources and standard PMTs with versatile spectral configuration, which can be implemented as an add-on to commercial confocal microscopes. The Fourier lifetime confocal method allows fast multiplexed FLIM imaging, which makes it possible to monitor multiple biological processes in live cells. The low cost and compatibility with commercial systems could also make multiplexed FLIM more accessible to biological research community.
Microwave multiplex readout for superconducting sensors
Energy Technology Data Exchange (ETDEWEB)
Ferri, E., E-mail: elena.ferri@mib.infn.it [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Becker, D.; Bennett, D. [NIST, Boulder, CO (United States); Faverzani, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Fowler, J.; Gard, J. [NIST, Boulder, CO (United States); Giachero, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Hays-Wehle, J.; Hilton, G. [NIST, Boulder, CO (United States); Maino, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Mates, J. [NIST, Boulder, CO (United States); Puiu, A.; Nucciotti, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Reintsema, C.; Schmidt, D.; Swetz, D.; Ullom, J.; Vale, L. [NIST, Boulder, CO (United States)
2016-07-11
The absolute neutrino mass scale is still an outstanding challenge in both particle physics and cosmology. The calorimetric measurement of the energy released in a nuclear beta decay is a powerful tool to determine the effective electron-neutrino mass. In the last years, the progress on low temperature detector technologies has allowed to design large scale experiments aiming at pushing down the sensitivity on the neutrino mass below 1 eV. Even with outstanding performances in both energy (~ eV on keV) and time resolution (~ 1 μs) on the single channel, a large number of detectors working in parallel is required to reach a sub-eV sensitivity. Microwave frequency domain readout is the best available technique to readout large array of low temperature detectors, such as Transition Edge Sensors (TESs) or Microwave Kinetic Inductance Detectors (MKIDs). In this way a multiplex factor of the order of thousands can be reached, limited only by the bandwidth of the available commercial fast digitizers. This microwave multiplexing system will be used to readout the HOLMES detectors, an array of 1000 microcalorimeters based on TES sensors in which the {sup 163}Ho will be implanted. HOLMES is a new experiment for measuring the electron neutrino mass by means of the electron capture (EC) decay of {sup 163}Ho. We present here the microwave frequency multiplex which will be used in the HOLMES experiment and the microwave frequency multiplex used to readout the MKID detectors developed in Milan as well.
Control of Angular Intervals for Angle-Multiplexed Holographic Memory
Kinoshita, Nobuhiro; Muroi, Tetsuhiko; Ishii, Norihiko; Kamijo, Koji; Shimidzu, Naoki
2009-03-01
In angle-multiplexed holographic memory, the full width at half maximum of the Bragg selectivity curves is dependent on the angle formed between the medium and incident laser beams. This indicates the possibility of high density and high multiplexing number by varying the angular intervals between adjacent holograms. We propose an angular interval scheduling for closely stacking holograms into medium even when the angle range is limited. We obtained bit error rates of the order of 10-4 under the following conditions: medium thickness of 1 mm, laser beam wavelength of 532 nm, and angular multiplexing number of 300.
Highly multiplexible thermal kinetic inductance detectors for x-ray imaging spectroscopy
International Nuclear Information System (INIS)
Ulbricht, Gerhard; Mazin, Benjamin A.; Szypryt, Paul; Walter, Alex B.; Bockstiegel, Clint; Bumble, Bruce
2015-01-01
For X-ray imaging spectroscopy, high spatial resolution over a large field of view is often as important as high energy resolution, but current X-ray detectors do not provide both in the same device. Thermal Kinetic Inductance Detectors (TKIDs) are being developed as they offer a feasible way to combine the energy resolution of transition edge sensors with pixel counts approaching CCDs and thus promise significant improvements for many X-ray spectroscopy applications. TKIDs are a variation of Microwave Kinetic Inductance Detectors (MKIDs) and share their multiplexibility: working MKID arrays with 2024 pixels have recently been demonstrated and much bigger arrays are under development. In this work, we present a TKID prototype, which is able to achieve an energy resolution of 75 eV at 5.9 keV, even though its general design still has to be optimized. We further describe TKID fabrication, characterization, multiplexing, and working principle and demonstrate the necessity of a data fitting algorithm in order to extract photon energies. With further design optimizations, we expect to be able to improve our TKID energy resolution to less than 10 eV at 5.9 keV
Highly multiplexible thermal kinetic inductance detectors for x-ray imaging spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Ulbricht, Gerhard, E-mail: ulbricht@physics.ucsb.edu; Mazin, Benjamin A.; Szypryt, Paul; Walter, Alex B.; Bockstiegel, Clint [Department of Physics, University of California, Santa Barbara, California 93106 (United States); Bumble, Bruce [NASA Jet Propulsion Laboratory, 4800 Oak Grove Drive, Pasadena, California 91125 (United States)
2015-06-22
For X-ray imaging spectroscopy, high spatial resolution over a large field of view is often as important as high energy resolution, but current X-ray detectors do not provide both in the same device. Thermal Kinetic Inductance Detectors (TKIDs) are being developed as they offer a feasible way to combine the energy resolution of transition edge sensors with pixel counts approaching CCDs and thus promise significant improvements for many X-ray spectroscopy applications. TKIDs are a variation of Microwave Kinetic Inductance Detectors (MKIDs) and share their multiplexibility: working MKID arrays with 2024 pixels have recently been demonstrated and much bigger arrays are under development. In this work, we present a TKID prototype, which is able to achieve an energy resolution of 75 eV at 5.9 keV, even though its general design still has to be optimized. We further describe TKID fabrication, characterization, multiplexing, and working principle and demonstrate the necessity of a data fitting algorithm in order to extract photon energies. With further design optimizations, we expect to be able to improve our TKID energy resolution to less than 10 eV at 5.9 keV.
The Effects of Teacher Purpose on Achievement Gains.
Balajthy, Ernest
2000-01-01
Addresses the issue of teacher purpose in using technology for reading and literacy instruction. Notes that computers were used mostly for motivation and self-esteem and not for raising achievement. Argues that educators need to critically think through the multiple realities they face as they consider the use of technology with disabled readers.…
Computerized multiplexing and processing of in-core signals
International Nuclear Information System (INIS)
Meyer, J.
1982-09-01
After a presentation of the in-core instrumentation the main objectives of electric connection multiplexing are given. The conclusion of a study led to choose the multiplexing solution for the reactor building/electric building connections and to associate an information order management system based on the utilization of microprocessors. Finally, the control system (processors, organization, communication, language) is presented [fr
Multiplexing and data processing of in-core signals
International Nuclear Information System (INIS)
Meyer, M.
1983-01-01
The application of multiplexing and signal processing techniques used for reactor operation and utilisation of data from the in-core instrumentation system is described. After a brief recall about in-core instrumentation, the aims, the advantages of multiplexing are presented. One of the aims of this realization is to show the compatibity between the technologies used with a PWR environment [fr
Optical properties of nanowire metamaterials with gain
DEFF Research Database (Denmark)
Isidio de Lima, Joaquim Junior; Adam, Jost; Rego, Davi
2016-01-01
The transmittance, reflectance and absorption of a nanowire metamaterial with optical gain are numerically simulated and investigated. It is assumed that the metamaterial is represented by aligned silver nanowires embedded into a semiconductor matrix, made of either silicon or gallium phosphide....... The gain in the matrix is modeled by adding a negative imaginary part to the dielectric function of the semiconductor. It is found that the optical coefficients of the metamaterial depend on the gain magnitude in a non-trivial way: they can both increase and decrease with gain depending on the lattice...... constant of the metamaterial. This peculiar behavior is explained by the field redistribution between the lossy metal nanowires and the amplifying matrix material. These findings are significant for a proper design of nanowire metamaterials with low optical losses for diverse applications....
Sarri, Tove; Troeng, Linnea
2016-01-01
Alarming statistics provides that only 10,2 percentage of companies listed on the Swedish stock exchange has achieved gender equality in their top management. The fact is that women being discriminated, since men dominates these positions of power. The study is of a qualitative nature and aims to achieve a deeper understanding and knowledge contribution of how gender equal companies´ has achieved this gender diversity in their top management. Sweden's highest ranking business leaders has been...
Multiplexing of spatial modes in the mid-IR region
Gailele, Lucas; Maweza, Loyiso; Dudley, Angela; Ndagano, Bienvenu; Rosales-Guzman, Carmelo; Forbes, Andrew
2017-02-01
Traditional optical communication systems optimize multiplexing in polarization and wavelength both trans- mitted in fiber and free-space to attain high bandwidth data communication. Yet despite these technologies, we are expected to reach a bandwidth ceiling in the near future. Communications using orbital angular momentum (OAM) carrying modes offers infinite dimensional states, providing means to increase link capacity by multiplexing spatially overlapping modes in both the azimuthal and radial degrees of freedom. OAM modes are multiplexed and de-multiplexed by the use of spatial light modulators (SLM). Implementation of complex amplitude modulation is employed on laser beams phase and amplitude to generate Laguerre-Gaussian (LG) modes. Modal decomposition is employed to detect these modes due to their orthogonality as they propagate in space. We demonstrate data transfer by sending images as a proof-of concept in a lab-based scheme. We demonstrate the creation and detection of OAM modes in the mid-IR region as a precursor to a mid-IR free-space communication link.
Fuyu Shimomura
2016-01-01
Increasing student diversity in K-12 schools has gained attention in Japan and the US. In the US, racial diversity has historically shaped inequity in educational access and teacher quality. In Japan, regardless of its reputation for cultural homogeneity among its residents, issues surrounding student diversity have gained attention because of the increasing number of returnees—Japanese students raised overseas because of their parents’ expatriation. This paper compares and contrasts the div...
Determinants of public cooperation in multiplex networks
Battiston, Federico; Perc, Matjaž; Latora, Vito
2017-07-01
Synergies between evolutionary game theory and statistical physics have significantly improved our understanding of public cooperation in structured populations. Multiplex networks, in particular, provide the theoretical framework within network science that allows us to mathematically describe the rich structure of interactions characterizing human societies. While research has shown that multiplex networks may enhance the resilience of cooperation, the interplay between the overlap in the structure of the layers and the control parameters of the corresponding games has not yet been investigated. With this aim, we consider here the public goods game on a multiplex network, and we unveil the role of the number of layers and the overlap of links, as well as the impact of different synergy factors in different layers, on the onset of cooperation. We show that enhanced public cooperation emerges only when a significant edge overlap is combined with at least one layer being able to sustain some cooperation by means of a sufficiently high synergy factor. In the absence of either of these conditions, the evolution of cooperation in multiplex networks is determined by the bounds of traditional network reciprocity with no enhanced resilience. These results caution against overly optimistic predictions that the presence of multiple social domains may in itself promote cooperation, and they help us better understand the complexity behind prosocial behavior in layered social systems.
Study of gain-coupled distributed feedback laser based on high order surface gain-coupled gratings
Gao, Feng; Qin, Li; Chen, Yongyi; Jia, Peng; Chen, Chao; Cheng, LiWen; Chen, Hong; Liang, Lei; Zeng, Yugang; Zhang, Xing; Wu, Hao; Ning, Yongqiang; Wang, Lijun
2018-03-01
Single-longitudinal-mode, gain-coupled distributed feedback (DFB) lasers based on high order surface gain-coupled gratings are achieved. Periodic surface metal p-contacts with insulated grooves realize gain-coupled mechanism. To enhance gain contrast in the quantum wells without the introduction of effective index-coupled effect, groove length and depth were well designed. Our devices provided a single longitudinal mode with the maximum CW output power up to 48.8 mW/facet at 971.31 nm at 250 mA without facet coating, 3dB linewidth (39 dB). Optical bistable characteristic was observed with a threshold current difference. Experimentally, devices with different cavity lengths were contrasted on power-current and spectrum characteristics. Due to easy fabrication technique and stable performance, it provides a method of fabricating practical gain-coupled distributed feedback lasers for commercial applications.
Cavity-enhanced eigenmode and angular hybrid multiplexing in holographic data storage systems.
Miller, Bo E; Takashima, Yuzuru
2016-12-26
Resonant optical cavities have been demonstrated to improve energy efficiencies in Holographic Data Storage Systems (HDSS). The orthogonal reference beams supported as cavity eigenmodes can provide another multiplexing degree of freedom to push storage densities toward the limit of 3D optical data storage. While keeping the increased energy efficiency of a cavity enhanced reference arm, image bearing holograms are multiplexed by orthogonal phase code multiplexing via Hermite-Gaussian eigenmodes in a Fe:LiNbO3 medium with a 532 nm laser at two Bragg angles. We experimentally confirmed write rates are enhanced by an average factor of 1.1, and page crosstalk is about 2.5%. This hybrid multiplexing opens up a pathway to increase storage density while minimizing modification of current angular multiplexing HDSS.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Li, Yupeng; Ding, Ding
2017-09-01
Benefiting from the high spectral efficiency and low peak-to-average power ratio, constant envelope orthogonal frequency division multiplexing (OFDM) is a promising technique in coherent optical communication. Polarization-division multiplexing (PDM) has been employed as an effective way to double the transmission capacity in the commercial 100 Gb/s PDM-QPSK system. We investigated constant envelope OFDM together with PDM. Simulation results show that the acceptable maximum launch power into the fiber improves 10 and 6 dB for 80- and 320-km transmission, respectively (compared with the conventional PDM OFDM system). The maximum reachable distance of the constant envelope OFDM system is able to reach 800 km, and even 1200 km is reachable if an ideal erbium doped fiber amplifier is employed.
Experimental demonstration of subcarrier multiplexed quantum key distribution system.
Mora, José; Ruiz-Alba, Antonio; Amaya, Waldimar; Martínez, Alfonso; García-Muñoz, Víctor; Calvo, David; Capmany, José
2012-06-01
We provide, to our knowledge, the first experimental demonstration of the feasibility of sending several parallel keys by exploiting the technique of subcarrier multiplexing (SCM) widely employed in microwave photonics. This approach brings several advantages such as high spectral efficiency compatible with the actual secure key rates, the sharing of the optical fainted pulse by all the quantum multiplexed channels reducing the system complexity, and the possibility of upgrading with wavelength division multiplexing in a two-tier scheme, to increase the number of parallel keys. Two independent quantum SCM channels featuring a sifted key rate of 10 Kb/s/channel over a link with quantum bit error rate <2% is reported.
Come On! Using intervention mapping to help healthy pregnant women achieve healthy weight gain
Astrid Merkx; Marlein Ausems; Raymond de Vries; Marianne Nieuwenhuijze
2017-01-01
Objective: Gaining too much or too little weight in pregnancy (according to Institute of Medicine (IOM) guidelines) negatively affects both mother and child, but many women find it difficult to manage their gestational weight gain (GWG). Here we describe the use of the intervention mapping protocol
2011-11-21
... Multiplexed Microbiology Devices: Their clinical application and public health/clinical needs; inclusion of...] Advancing Regulatory Science for Highly Multiplexed Microbiology/ Medical Countermeasure Devices; Public... Multiplexed Microbiology/ Medical Countermeasure Devices'' that published in the Federal Register of August 8...
Design of a robust thin-film interference filter for erbium-doped fiber amplifier gain equalization
Verly, Pierre G.
2002-06-01
Gain-flattening filters (GFFs) are key wavelength division multiplexing components in fiber-optics telecommunications. Challenging issues in the design of thin-film GFFs were recently the subject of a contest organized at the 2001 Conference on Optical Interference Coatings. The interest and main difficulty of the proposed problem was to minimize the sensitivity of a GFF to simulated fabrication errors. A high-yield solution and its design philosophy are described. The approach used to control the filter robustness is explained and illustrated by numerical results.
Performance modeling, loss networks, and statistical multiplexing
Mazumdar, Ravi
2009-01-01
This monograph presents a concise mathematical approach for modeling and analyzing the performance of communication networks with the aim of understanding the phenomenon of statistical multiplexing. The novelty of the monograph is the fresh approach and insights provided by a sample-path methodology for queueing models that highlights the important ideas of Palm distributions associated with traffic models and their role in performance measures. Also presented are recent ideas of large buffer, and many sources asymptotics that play an important role in understanding statistical multiplexing. I
Cooperative spreading processes in multiplex networks.
Wei, Xiang; Chen, Shihua; Wu, Xiaoqun; Ning, Di; Lu, Jun-An
2016-06-01
This study is concerned with the dynamic behaviors of epidemic spreading in multiplex networks. A model composed of two interacting complex networks is proposed to describe cooperative spreading processes, wherein the virus spreading in one layer can penetrate into the other to promote the spreading process. The global epidemic threshold of the model is smaller than the epidemic thresholds of the corresponding isolated networks. Thus, global epidemic onset arises in the interacting networks even though an epidemic onset does not arise in each isolated network. Simulations verify the analysis results and indicate that cooperative spreading processes in multiplex networks enhance the final infection fraction.
Race and Academic Achievement in Racially Diverse High Schools: Opportunity and Stratification.
Muller, Chandra; Riegle-Crumb, Catherine; Schiller, Kathryn S; Wilkinson, Lindsey; Frank, Kenneth A
2010-04-01
BACKGROUND/CONTEXT: Brown v Board of Education fundamentally changed our nation's schools, yet we know surprisingly little about how and whether they provide equality of educational opportunity. Although substantial evidence suggests that African American and Latino students who attend these schools face fewer learning opportunities than their White counterparts, until now, it has been impossible to examine this using a representative sample because of lack of data. PURPOSE/OBJECTIVE/RESEARCH QUESTION/FOCUS OF STUDY: This study uses newly available data to investigate whether racially diverse high schools offer equality of educational opportunity to students from different racial and ethnic groups. This is examined by measuring the relative representation of minority students in advanced math classes at the beginning of high school and estimating whether and how this opportunity structure limits the level of achievement attained by African American and Latino students by the end of high school. SETTING: This study uses data from the Adolescent Health and Academic Achievement Study (AHAA) and its partner study, the National Longitudinal Study of Adolescent Health (Add Health), a stratified, nationally representative study of students in U.S. high schools first surveyed in 1994-1995. POPULATION/PARTICIPANTS/SUBJECTS: Two samples of racially diverse high schools were used in the analysis: one with African Americans, Whites, and Asians (26 schools with 3,149 students), and the other with Latinos, Whites, and Asians (22 schools with 2,775 students). RESEARCH DESIGN: Quantitative analyses first assess how high schools vary in the extent to which minority students are underrepresented in advanced sophomore math classes. Hierarchical multilevel modeling is then used to estimate whether racial-ethnic differences in representation in advanced math have an impact on African American and Latino students' achievement by the end of high school, relative to the Whites and Asians
Directory of Open Access Journals (Sweden)
Bang Chul Jung
2017-07-01
Full Text Available We introduce a distributed protocol to achieve multiuser diversity in a multicell multiple-input multiple-output (MIMO uplink network, referred to as a MIMO interfering multiple-access channel (IMAC. Assuming both no information exchange among base stations (BS and local channel state information at the transmitters for the MIMO IMAC, we propose a joint beamforming and user scheduling protocol, and then show that the proposed protocol can achieve the optimal multiuser diversity gain, i.e., KMlog(SNRlog N, as long as the number of mobile stations (MSs in a cell, N, scales faster than SNR K M − L 1 − ϵ for a small constant ϵ > 0, where M, L, K, and SNR denote the number of receive antennas at each BS, the number of transmit antennas at each MS, the number of cells, and the signal-to-noise ratio, respectively. Our result indicates that multiuser diversity can be achieved in the presence of intra-cell and inter-cell interference even in a distributed fashion. As a result, vital information on how to design distributed algorithms in interference-limited cellular environments is provided.
Filla, Robert T; Schrell, Adrian M; Coulton, John B; Edwards, James L; Roper, Michael G
2018-02-20
A method for multiplexed sample analysis by mass spectrometry without the need for chemical tagging is presented. In this new method, each sample is pulsed at unique frequencies, mixed, and delivered to the mass spectrometer while maintaining a constant total flow rate. Reconstructed ion currents are then a time-dependent signal consisting of the sum of the ion currents from the various samples. Spectral deconvolution of each reconstructed ion current reveals the identity of each sample, encoded by its unique frequency, and its concentration encoded by the peak height in the frequency domain. This technique is different from other approaches that have been described, which have used modulation techniques to increase the signal-to-noise ratio of a single sample. As proof of concept of this new method, two samples containing up to 9 analytes were multiplexed. The linear dynamic range of the calibration curve was increased with extended acquisition times of the experiment and longer oscillation periods of the samples. Because of the combination of the samples, salt had little effect on the ability of this method to achieve relative quantitation. Continued development of this method is expected to allow for increased numbers of samples that can be multiplexed.
Topicality and impact in social media: diverse messages, focused messengers.
Weng, Lilian; Menczer, Filippo
2015-01-01
We have a limited understanding of the factors that make people influential and topics popular in social media. Are users who comment on a variety of matters more likely to achieve high influence than those who stay focused? Do general subjects tend to be more popular than specific ones? Questions like these demand a way to detect the topics hidden behind messages associated with an individual or a keyword, and a gauge of similarity among these topics. Here we develop such an approach to identify clusters of similar hashtags in Twitter by detecting communities in the hashtag co-occurrence network. Then the topical diversity of a user's interests is quantified by the entropy of her hashtags across different topic clusters. A similar measure is applied to hashtags, based on co-occurring tags. We find that high topical diversity of early adopters or co-occurring tags implies high future popularity of hashtags. In contrast, low diversity helps an individual accumulate social influence. In short, diverse messages and focused messengers are more likely to gain impact.
Penalty-free transmission at 10 Gbit/s through 40 cascaded 1-nm arrayed waveguide multiplexers
DEFF Research Database (Denmark)
Nissov, Morten; Jørgensen, Bo Foged; Pedersen, Rune Johan Skullerud
1997-01-01
Cascaded optical add-drop multiplexers (OADM) and optical cross connects (OXC) are key components in optical wavelength-division multiplex networks. OADMs with filtering of the passing signals and OXCs can be constructed by the use of wavelength-division multiplexers. Cascadability of multiplexers...
Aptamer-based multiplexed proteomic technology for biomarker discovery.
Directory of Open Access Journals (Sweden)
Larry Gold
2010-12-01
Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.
Aptamer-based multiplexed proteomic technology for biomarker discovery.
Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom
2010-12-07
The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.
DEFF Research Database (Denmark)
Hu, Hao; Laguardia Areal, Janaina; Palushani, Evarist
2010-01-01
A 10-G Ethernet packet with maximum packet size of 1518 bytes is synchronized to a master clock with 200-kHz frequency offset using a time lens. The input 10-Gb/s non-return-to-zero packet is at the same time converted into a return-to-zero (RZ) packet with a pulsewidth of 10 ps and then time......-division multiplexed with four 10-Gb/s optical time-division-multiplexing (OTDM) channels, thus constituting a 50-Gb/s OTDM serial signal. Error-free performances of the synchronized RZ packet and demultiplexed packet from the aggregated 50-Gb/s OTDM signal are achieved....
Gain claming in single-pass and double-pass L-band erbium-doped fiber amplifiers
International Nuclear Information System (INIS)
Harun, S.W.; Ahmad, H.
2004-01-01
Gain clamping is demonstrated in single-pass and double-pass long wavelength band erbium-doped fiber amplifiers. A C/L-band wavelength division multiplexing coupler is used in single-pass system to generate a laser at 1566 nm. The gain for the amplifier is clamped at 15.5 dB with gain variation of less than 0.2 dB from input signal power of -40 to -14 dBm with almost negligible noise figure penalty. However, the flatness of gain spectrum is slightly degraded due to the un-optimisation of erbium-doped fiber length. The advantage of this configuration is that the oscillating light does not appear at the output of the amplifier. A highly efficient gain-clamped long wavelength band erbium-doped fiber amplifiers with improved noise figure characteristic is demonstrated by simply adding a broadband conventional band fiber Bragg grating in double pass system. The combination of the fiber Bragg grating and optical circulator has created laser in the cavity for gain clamping. By adjusting the power combination of pumps 1 and 2, the clamped gain level can be controlled. The amplifier gain is clamped at 28.1 dB from -40 to -25 dBm with gain variation of less than 0.5 dB by setting the pumps 1 and 2 at 59.5 and 50.6 mW, respectively. The gain is also flat from 1574 nm to 1604 nm with gain variation of less than 3 dB. The corresponding noise figure varies from 5.6 to 7.6 dB, which is 0.8 to 2.6 dB reduced compared to those of unclamped amplifier (Authors)
Directory of Open Access Journals (Sweden)
Sonia E. Eynard
2018-01-01
Full Text Available Genomic selection (GS is commonly used in livestock and increasingly in plant breeding. Relying on phenotypes and genotypes of a reference population, GS allows performance prediction for young individuals having only genotypes. This is expected to achieve fast high genetic gain but with a potential loss of genetic diversity. Existing methods to conserve genetic diversity depend mostly on the choice of the breeding individuals. In this study, we propose a modification of the reference population composition to mitigate diversity loss. Since the high cost of phenotyping is the limiting factor for GS, our findings are of major economic interest. This study aims to answer the following questions: how would decisions on the reference population affect the breeding population, and how to best select individuals to update the reference population and balance maximizing genetic gain and minimizing loss of genetic diversity? We investigated three updating strategies for the reference population: random, truncation, and optimal contribution (OC strategies. OC maximizes genetic merit for a fixed loss of genetic diversity. A French Montbéliarde dairy cattle population with 50K SNP chip genotypes and simulations over 10 generations were used to compare these different strategies using milk production as the trait of interest. Candidates were selected to update the reference population. Prediction bias and both genetic merit and diversity were measured. Changes in the reference population composition slightly affected the breeding population. Optimal contribution strategy appeared to be an acceptable compromise to maintain both genetic gain and diversity in the reference and the breeding populations.
Eynard, Sonia E; Croiseau, Pascal; Laloë, Denis; Fritz, Sebastien; Calus, Mario P L; Restoux, Gwendal
2018-01-04
Genomic selection (GS) is commonly used in livestock and increasingly in plant breeding. Relying on phenotypes and genotypes of a reference population, GS allows performance prediction for young individuals having only genotypes. This is expected to achieve fast high genetic gain but with a potential loss of genetic diversity. Existing methods to conserve genetic diversity depend mostly on the choice of the breeding individuals. In this study, we propose a modification of the reference population composition to mitigate diversity loss. Since the high cost of phenotyping is the limiting factor for GS, our findings are of major economic interest. This study aims to answer the following questions: how would decisions on the reference population affect the breeding population, and how to best select individuals to update the reference population and balance maximizing genetic gain and minimizing loss of genetic diversity? We investigated three updating strategies for the reference population: random, truncation, and optimal contribution (OC) strategies. OC maximizes genetic merit for a fixed loss of genetic diversity. A French Montbéliarde dairy cattle population with 50K SNP chip genotypes and simulations over 10 generations were used to compare these different strategies using milk production as the trait of interest. Candidates were selected to update the reference population. Prediction bias and both genetic merit and diversity were measured. Changes in the reference population composition slightly affected the breeding population. Optimal contribution strategy appeared to be an acceptable compromise to maintain both genetic gain and diversity in the reference and the breeding populations. Copyright © 2018 Eynard et al.
Orbital Angular Momentum Multiplexing over Visible Light Communication Systems
Tripathi, Hardik Rameshchandra
This thesis proposes and explores the possibility of using Orbital Angular Momentum multiplexing in Visible Light Communication system. Orbital Angular Momentum is mainly applied for laser and optical fiber transmissions, while Visible Light Communication is a technology using the light as a carrier for wireless communication. In this research, the study of the state of art and experiments showing some results on multiplexing based on Orbital Angular Momentum over Visible Light Communication system were done. After completion of the initial stage; research work and simulations were performed on spatial multiplexing over Li-Fi channel modeling. Simulation scenarios which allowed to evaluate the Signal-to-Noise Ratio, Received Power Distribution, Intensity and Illuminance were defined and developed.
Time-varying multiplex network: Intralayer and interlayer synchronization
Rakshit, Sarbendu; Majhi, Soumen; Bera, Bidesh K.; Sinha, Sudeshna; Ghosh, Dibakar
2017-12-01
A large class of engineered and natural systems, ranging from transportation networks to neuronal networks, are best represented by multiplex network architectures, namely a network composed of two or more different layers where the mutual interaction in each layer may differ from other layers. Here we consider a multiplex network where the intralayer coupling interactions are switched stochastically with a characteristic frequency. We explore the intralayer and interlayer synchronization of such a time-varying multiplex network. We find that the analytically derived necessary condition for intralayer and interlayer synchronization, obtained by the master stability function approach, is in excellent agreement with our numerical results. Interestingly, we clearly find that the higher frequency of switching links in the layers enhances both intralayer and interlayer synchrony, yielding larger windows of synchronization. Further, we quantify the resilience of synchronous states against random perturbations, using a global stability measure based on the concept of basin stability, and this reveals that intralayer coupling strength is most crucial for determining both intralayer and interlayer synchrony. Lastly, we investigate the robustness of interlayer synchronization against a progressive demultiplexing of the multiplex structure, and we find that for rapid switching of intralayer links, the interlayer synchronization persists even when a large number of interlayer nodes are disconnected.
Directory of Open Access Journals (Sweden)
Owen Higgins
2018-02-01
Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.
Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert
2018-01-01
Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124
The new challenges of multiplex networks: Measures and models
Battiston, Federico; Nicosia, Vincenzo; Latora, Vito
2017-02-01
What do societies, the Internet, and the human brain have in common? They are all examples of complex relational systems, whose emerging behaviours are largely determined by the non-trivial networks of interactions among their constituents, namely individuals, computers, or neurons, rather than only by the properties of the units themselves. In the last two decades, network scientists have proposed models of increasing complexity to better understand real-world systems. Only recently we have realised that multiplexity, i.e. the coexistence of several types of interactions among the constituents of a complex system, is responsible for substantial qualitative and quantitative differences in the type and variety of behaviours that a complex system can exhibit. As a consequence, multilayer and multiplex networks have become a hot topic in complexity science. Here we provide an overview of some of the measures proposed so far to characterise the structure of multiplex networks, and a selection of models aiming at reproducing those structural properties and quantifying their statistical significance. Focusing on a subset of relevant topics, this brief review is a quite comprehensive introduction to the most basic tools for the analysis of multiplex networks observed in the real-world. The wide applicability of multiplex networks as a framework to model complex systems in different fields, from biology to social sciences, and the colloquial tone of the paper will make it an interesting read for researchers working on both theoretical and experimental analysis of networked systems.
Feng, S F; Schwemmer, M; Gershman, S J; Cohen, J D
2014-03-01
Why is it that behaviors that rely on control, so striking in their diversity and flexibility, are also subject to such striking limitations? Typically, people cannot engage in more than a few-and usually only a single-control-demanding task at a time. This limitation was a defining element in the earliest conceptualizations of controlled processing; it remains one of the most widely accepted axioms of cognitive psychology, and is even the basis for some laws (e.g., against the use of mobile devices while driving). Remarkably, however, the source of this limitation is still not understood. Here, we examine one potential source of this limitation, in terms of a trade-off between the flexibility and efficiency of representation ("multiplexing") and the simultaneous engagement of different processing pathways ("multitasking"). We show that even a modest amount of multiplexing rapidly introduces cross-talk among processing pathways, thereby constraining the number that can be productively engaged at once. We propose that, given the large number of advantages of efficient coding, the human brain has favored this over the capacity for multitasking of control-demanding processes.
International Nuclear Information System (INIS)
Sudiyanto; Aminus, S; Sujono, Djoko; Ngatinu; Sudaryanto; Wiyana, Badi
1996-01-01
A channel multiplexing for the analog input channels of the Advantech PCL-718 ADC-12 bit by using PCLD-889 programmable Amplifier / multiplexer board have been done. The experiments have been prepared by using Turbo-C software where every PCLD-889 board multiplexes 16 differential input channels into one analog output channel, up to 10 PCLD-889 can be cascaded to expand the analog input of PCL-718 ADC-12 bit to 8 x 16 channels
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Centrality in earthquake multiplex networks
Lotfi, Nastaran; Darooneh, Amir Hossein; Rodrigues, Francisco A.
2018-06-01
Seismic time series has been mapped as a complex network, where a geographical region is divided into square cells that represent the nodes and connections are defined according to the sequence of earthquakes. In this paper, we map a seismic time series to a temporal network, described by a multiplex network, and characterize the evolution of the network structure in terms of the eigenvector centrality measure. We generalize previous works that considered the single layer representation of earthquake networks. Our results suggest that the multiplex representation captures better earthquake activity than methods based on single layer networks. We also verify that the regions with highest seismological activities in Iran and California can be identified from the network centrality analysis. The temporal modeling of seismic data provided here may open new possibilities for a better comprehension of the physics of earthquakes.
Yin, Stuart (Shizhuo); Chao, Ju-Hung; Zhu, Wenbin; Chen, Chang-Jiang; Campbell, Adrian; Henry, Michael; Dubinskiy, Mark; Hoffman, Robert C.
2017-08-01
In this paper, we present a novel large capacity (a 1000+ channel) time division multiplexing (TDM) laser beam combining technique by harnessing a state-of-the-art nanosecond speed potassium tantalate niobate (KTN) electro-optic (EO) beam deflector as the time division multiplexer. The major advantages of TDM approach are: (1) large multiplexing capability (over 1000 channels), (2) high spatial beam quality (the combined beam has the same spatial profile as the individual beam), (3) high spectral beam quality (the combined beam has the same spectral width as the individual beam, and (4) insensitive to the phase fluctuation of individual laser because of the nature of the incoherent beam combining. The quantitative analyses show that it is possible to achieve over one hundred kW average power, single aperture, single transverse mode solid state and/or fiber laser by pursuing this innovative beam combining method, which represents a major technical advance in the field of high energy lasers. Such kind of 100+ kW average power diffraction limited beam quality lasers can play an important role in a variety of applications such as laser directed energy weapons (DEW) and large-capacity high-speed laser manufacturing, including cutting, welding, and printing.
Opportunities and Challenges of Multiplex Assays: A Machine Learning Perspective.
Chen, Junfang; Schwarz, Emanuel
2017-01-01
Multiplex assays that allow the simultaneous measurement of multiple analytes in small sample quantities have developed into a widely used technology. Their implementation spans across multiple assay systems and can provide readouts of similar quality as the respective single-plex measures, albeit at far higher throughput. Multiplex assay systems are therefore an important element for biomarker discovery and development strategies but analysis of the derived data can face substantial challenges that may limit the possibility of identifying meaningful biological markers. This chapter gives an overview of opportunities and challenges of multiplexed biomarker analysis, in particular from the perspective of machine learning aimed at identification of predictive biological signatures.
Li, Jia; Macdonald, Joanne
2016-09-15
Lateral flow biosensors are a leading technology in point-of-care diagnostics due to their simplicity, rapidness and low cost. Their primacy in this arena continues through technological breakthroughs such as multiplexing: the detection of more than one biomarker in a single assay. Multiplexing capacity is critical for improving diagnostic efficiency, enhancing the diagnostic precision for specific diseases and reducing diagnostic cost. Here we review, for the first time, the various types and strategies employed for creating multiplexed lateral flow biosensors. These are classified into four main categories in terms of specific application or multiplexing level, namely linear, parameter, spatial and conceptual. We describe the practical applications and implications for each approach and compare their advantages and disadvantages. Importantly, multiplexing is still subject to limitations of the traditional lateral flow biosensor, such as sensitivity and specificity. However, by pushing the limitations of the traditional medium into the multiplex arena, several technological breakthroughs are emerging with novel solutions that further expand the utility of lateral flow biosensing for point-of-care applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Multiplex amplification of large sets of human exons.
Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay
2007-11-01
A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.
Directory of Open Access Journals (Sweden)
Jianfeng Zheng
2012-01-01
Full Text Available This paper is aimed at studying the impacts of mutual coupling, matching networks, and polarization of antennas on performances of Multiple-Input Multiple-Output (MIMO systems employing Spatial Multiplexing (SM. In particular, the uncoded average Bit Error Rate (BER of MIMO systems is investigated. An accurate signal analysis framework based on circuit network parameters is presented to describe the transmit/receive characteristics of the matched/unmatched antenna array. The studied arrays consist of matched/unmatched compact copolarization and polarization diversity antenna array. Monte-Carlo numerical simulations are used to study the BER performances of the SM MIMO systems using maximum-likelihood and/or zero-forcing detection schemes. The simulation results demonstrate that the use of matching networks can improve the BER performance of SM MIMO systems significantly, and the BER performance deterioration due to antenna orientation randomness can be compensated by use of polarization diversity antenna arrays.
Rommel, Simon; Mendinueta, José Manuel Delgado; Klaus, Werner; Sakaguchi, Jun; Olmos, Juan José Vegas; Awaji, Yoshinari; Monroy, Idelfonso Tafur; Wada, Naoya
2017-09-18
This paper discusses spatially diverse optical vector network analysis for space division multiplexing (SDM) component and system characterization, which is becoming essential as SDM is widely considered to increase the capacity of optical communication systems. Characterization of a 108-channel photonic lantern spatial multiplexer, coupled to a 36-core 3-mode fiber, is experimentally demonstrated, extracting the full impulse response and complex transfer function matrices as well as insertion loss (IL) and mode-dependent loss (MDL) data. Moreover, the mode-mixing behavior of fiber splices in the few-mode multi-core fiber and their impact on system IL and MDL are analyzed, finding splices to cause significant mode-mixing and to be non-negligible in system capacity analysis.
The consequences of multiplexing and limited view angle in coded-aperture imaging
International Nuclear Information System (INIS)
Smith, W.E.; Barrett, H.H.; Paxman, R.G.
1984-01-01
Coded-aperture imaging (CAI) is a method for reconstructing distributions of radionuclide tracers that offers advantages over ECT and PET; namely, many views can be taken simultaneously without detector motion, and large numbers of photons are utilized since collimators are not required. However, because of this type of data acquisition, the coded image suffers from multiplexing; i.e., more than one object point may be mapped to each detector in the coded image. To investigate the dependence of the reconstruction on multiplexing, the authors reconstruct a simulated two-dimensional circular object from multiplexed one-dimensional coded-image data, then perform the reconstruction from un-multiplexed data. Each of these reconstructions are produced both from noise-free and noisy simulated data. To investigate the dependence on view angle, the authors reconstruct two simulated three-dimensional objects; a spherical phantom, and a series of point-like objects arranged nearly in a plane. Each of these reconstructions are from multiplexed two-dimensional coded-image data, first using two orthogonal views, and then a single viewing direction. The two-dimensional reconstructions demonstrate that, in the noise-free case, the multiplexing of the data does not seriously affect the reconstruction equality and that in the noisy-data case, the multiplexing helps, due to the fact that more photons are collected. Also, for point-like objects confined to a near-planar region of space, the authors show that restricted views can give satisfactory results, but that, for a large, three-dimensional object, a more complete viewing geometry is required
Liu, Yu; Chen, Qiaoshu; Liu, Jianbo; Yang, Xiaohai; Guo, Qiuping; Li, Li; Liu, Wei; Wang, Kemin
2017-03-21
DNA nanostructures have emerged as powerful and versatile building blocks for the construction of programmable nanoscale structures and functional sensors for biomarker detection, disease diagnostics, and therapy. Here we integrated multiple sensing modules into a single DNA three-dimensional (3D) nanoarchitecture with a triangular-prism (TP) structure for ratiometric and multiplexed biomolecule detection on a single microbead. In our design, the complementary hybridization of three clip sequences formed TP nanoassemblies in which the six single-strand regions in the top and bottom faces act as binding sites for different sensing modules, including an anchor module, reference sequence module, and capture sequence module. The multifunctional modular TP nanostructures were thus exploited for ratiometric and multiplexed biomolecule detection on microbeads. Microbead imaging demonstrated that, after ratiometric self-calibration analysis, the imaging deviations resulting from uneven fluorescence intensity distribution and differing probe concentrations were greatly reduced. The rigid nanostructure also conferred the TP as a framework for geometric positioning of different capture sequences. The inclusion of multiple targets led to the formation of sandwich hybridization structures that gave a readily detectable optical response at different fluorescence channels and distinct fingerprint-like pattern arrays. This approach allowed us to discriminate multiplexed biomolecule targets in a simple and efficient fashion. In this module-designed strategy, the diversity of the controlled DNA assembly coupled with the geometrically well-defined rigid nanostructures of the TP assembly provides a flexible and reliable biosensing approach that shows great promise for biomedical applications.
Kariuki, C M; van Arendonk, J A M; Kahi, A K; Komen, H
2017-06-01
Dairy cattle industries contribute to food and nutrition security and are a source of income for numerous households in many developing countries. Selective breeding can enhance efficiency in these industries. Developing dairy industries are characterized by diverse production and marketing systems. In this paper, we use weighted goal aggregating procedure to derive consensus trait preferences for different producer categories and processors. We based the study on the dairy industry in Kenya. The analytic hierarchy process was used to derive individual preferences for milk yield (MY), calving interval (CIN), production lifetime (PLT), mature body weight (MBW), and fat yield (FY). Results show that classical classification of production systems into large-scale and smallholder systems does not capture all differences in trait preferences. These differences became apparent when classification was based on productivity at the individual animal level, with high and low intensity producers and processors as the most important groups. High intensity producers had highest preferences for PLT and MY, whereas low intensity producers had highest preference for CIN and PLT; processors preferred MY and FY the most. The highest disagreements between the groups were observed for FY, PLT, and MY. Individual and group preferences were aggregated into consensus preferences using weighted goal programming. Desired gains were obtained as a product of consensus preferences and percentage genetic gains (G%). These were 2.42, 0.22, 2.51, 0.15, and 0.87 for MY, CIN, PLT, MBW, and FY, respectively. Consensus preferences can be used to derive a single compromise breeding objective for situations where the same genetic resources are used in diverse production and marketing circumstances. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license
Directory of Open Access Journals (Sweden)
Saim Memon
2017-06-01
Full Text Available A considerable effort is devoted to devising retrofit solutions for reducing space-heating energy in the domestic sector. Existing UK solid-wall dwellings, which have both heritage values and historic fabric, are being improved but they tend to have meagre thermal performance, partly, due to the heat-loss through glazings. This paper takes comparative analyses approach to envisage space-heating supply required in order to maintain thermal comfort temperatures and attainable solar energy gains to households with the retrofit of an experimentally achievable thermal performance of the fabricated sample of triple vacuum glazing to a UK solid-wall dwelling. 3D dynamic thermal models (timely regimes of heating, occupancy, ventilation and internal heat gains of an externally-insulated solid-wall detached dwelling with a range of existing glazing types along with triple vacuum glazings are modelled. A dramatic decrease of space-heating load and moderate increase of solar gains are resulted with the dwelling of newly achievable triple vacuum glazings (having centre-of-pane U-value of 0.33 Wm-2K-1 compared to conventional glazing types. The space-heating annual cost of single glazed dwellings was minimised to 15.31% (≈USD 90.7 with the retrofit of triple-vacuum glazings. An influence of total heat-loss through the fabric of solid-wall dwelling was analysed with steady-state calculations which indicates a fall of 10.23 % with triple vacuum glazings compared to single glazings.
Coaching to Augment Mentoring to Achieve Faculty Diversity: A Randomized Controlled Trial.
Williams, Simon N; Thakore, Bhoomi K; McGee, Richard
2016-08-01
The Academy for Future Science Faculty (the Academy) is a novel coaching intervention for biomedical PhD students designed to address limitations in previous efforts to promote faculty diversity. Unlike traditional research mentoring, the Academy includes both group and individual coaching, coaches have no research or evaluation roles with the students, and it is based on social science theories. The authors present a qualitative case study of one of the coaching groups and provide statistical analyses indicating whether one year in the Academy effects students' perceptions of the achievability and desirability of an academic career. The authors tested (July 2012-July 2013), with Northwestern University ethical approval, the Academy via a longitudinal randomized controlled trial. Participants were 121 latter-stage biomedical PhD students. The authors collected data via questionnaires, interviews, and meeting recordings. The case study shows how group career coaching can effectively supplement traditional one-to-one research mentoring; provide new role models for underrepresented minority students; and provide theory-based lenses through which to engage in open conversations about race, gender, and science careers. Repeated-measures analysis of variance showed that perceived achievability increased in the Academy group from baseline to one-year follow-up (mean, 5.75 versus 6.39) but decreased in the control group (6.58 versus 5.81). Perceived desirability decreased significantly less (P coaching model can effectively supplement traditional research mentoring and promote persistence toward academic careers.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Li, Lanlan; Pan, Lijia; Ma, Zhong; Yan, Ke; Cheng, Wen; Shi, Yi; Yu, Guihua
2018-02-12
Multiplexing, one of the main trends in biosensors, aims to detect several analytes simultaneously by integrating miniature sensors on a chip. However, precisely depositing electrode materials and selective enzymes on distinct microelectrode arrays remains an obstacle to massively produced multiplexed sensors. Here, we report on a "drop-on-demand" inkjet printing process to fabricate multiplexed biosensors based on nanostructured conductive hydrogels in which the electrode material and several kinds of enzymes were printed on the electrode arrays one by one by employing a multinozzle inkjet system. The whole inkjet printing process can be finished within three rounds of printing and only one round of alignment. For a page of sensor arrays containing 96 working electrodes, the printing process took merely ∼5 min. The multiplexed assays can detect glucose, lactate, and triglycerides in real time with good selectivity and high sensitivity, and the results in phosphate buffer solutions and calibration serum samples are comparable. The inkjet printing process exhibited advantages of high efficiency and accuracy, which opens substantial possibilities for massive fabrication of integrated multiplexed biosensors for human health monitoring.
Namnabat, Soha; Kim, Kyung-Jo; Jones, Adam; Himmelhuber, Roland; DeRose, Christopher T; Trotter, Douglas C; Starbuck, Andrew L; Pomerene, Andrew; Lentine, Anthony L; Norwood, Robert A
2017-09-04
Silicon photonics has gained interest for its potential to provide higher efficiency, bandwidth and reduced power consumption compared to electrical interconnects in datacenters and high performance computing environments. However, it is well known that silicon photonic devices suffer from temperature fluctuations due to silicon's high thermo-optic coefficient and therefore, temperature control in many applications is required. Here we present an athermal optical add-drop multiplexer fabricated from ring resonators. We used a sol-gel inorganic-organic hybrid material as an alternative to previously used materials such as polymers and titanium dioxide. In this work we studied the thermal curing parameters of the sol-gel and their effect on thermal wavelength shift of the rings. With this method, we were able to demonstrate a thermal shift down to -6.8 pm/°C for transverse electric (TE) polarization in ring resonators with waveguide widths of 325 nm when the sol-gel was cured at 130°C for 10.5 hours. We also achieved thermal shifts below 1 pm/°C for transverse magnetic (TM) polarization in the C band under different curing conditions. Curing time compared to curing temperature shows to be the most important factor to control sol-gel's thermo-optic value in order to obtain an athermal device in a wide temperature range.
DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR
Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira
2004-01-01
Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815
Time-division multiplexing vs network calculus: A comparison
DEFF Research Database (Denmark)
Puffitsch, Wolfgang; Sørensen, Rasmus Bo; Schoeberl, Martin
2015-01-01
that time-division multiplexing leads to better worst-case latencies, while network calculus supports higher bandwidths. Furthermore, time-division multiplexing leads to a simpler hardware implementation, while dynamically scheduled networks-on-chip allow the integration of best-effort traffic in the on......Networks-on-chip are increasingly common in modern multicore architectures. However, general-purpose networks-on-chip are not always well suited for real-time applications that require bandwidth and latency guarantees. Two approaches to provide real-time guarantees have emerged: time......-chip network in a more natural way....
Directory of Open Access Journals (Sweden)
Hidekazu Shimodaira
2016-01-01
Full Text Available Orthogonal Frequency Division Multiplexing (OFDM is a popular multicarrier technique used to attain high spectral efficiencies. It also has other advantages such as multipath tolerance and ease of implementation. However, OFDM based systems suffer from high Peak-to-Average Power Ratio (PAPR problem. Because of the nonlinearity of the power amplifiers, the high PAPR causes significant distortion in the transmitted signal for millimeter-wave (mmWave systems. To alleviate the high PAPR problem, this paper utilizes Generalized Frequency Division Multiplexing (GFDM which can achieve high spectral efficiency as well as low PAPR. In this paper, we show the performance of GFDM using the IEEE 802.11ad multicarrier frame structures. IEEE 802.11ad is considered one of the most successful industry standards utilizing unlicensed mmWave frequency band. In addition, this paper indicates the feasibility of using GFDM for the future standards such as IEEE 802.11ay. This paper studies the performance improvements in terms of PAPR reduction for GFDM. Based on the performance results, the optimal numbers of subcarriers and subsymbols are calculated for PAPR reduction while minimizing the Bit Error Rate (BER performance degradation. Moreover, transmitter side ICI (Intercarrier Interference reduction is introduced to reduce the receiver load.
Lin, Zibei; Shi, Fan; Hayes, Ben J; Daetwyler, Hans D
2017-05-01
Heuristic genomic inbreeding controls reduce inbreeding in genomic breeding schemes without reducing genetic gain. Genomic selection is increasingly being implemented in plant breeding programs to accelerate genetic gain of economically important traits. However, it may cause significant loss of genetic diversity when compared with traditional schemes using phenotypic selection. We propose heuristic strategies to control the rate of inbreeding in outbred plants, which can be categorised into three types: controls during mate allocation, during selection, and simultaneous selection and mate allocation. The proposed mate allocation measure GminF allocates two or more parents for mating in mating groups that minimise coancestry using a genomic relationship matrix. Two types of relationship-adjusted genomic breeding values for parent selection candidates ([Formula: see text]) and potential offspring ([Formula: see text]) are devised to control inbreeding during selection and even enabling simultaneous selection and mate allocation. These strategies were tested in a case study using a simulated perennial ryegrass breeding scheme. As compared to the genomic selection scheme without controls, all proposed strategies could significantly decrease inbreeding while achieving comparable genetic gain. In particular, the scenario using [Formula: see text] in simultaneous selection and mate allocation reduced inbreeding to one-third of the original genomic selection scheme. The proposed strategies are readily applicable in any outbred plant breeding program.
Kohjiro, Satoshi; Hirayama, Fuminori; Yamamori, Hirotake; Nagasawa, Shuichi; Fukuda, Daiji; Hidaka, Mutsuo
2014-06-01
White noise of dissipationless microwave radio frequency superconducting quantum interference device (RF-SQUID) multiplexers has been experimentally studied to evaluate their readout performance for transition edge sensor (TES) photon counters ranging from near infrared to gamma ray. The characterization has been carried out at 4 K, first to avoid the low-frequency fluctuations present at around 0.1 K, and second, for a feasibility study of readout operation at 4 K for extended applications. To increase the resonant Q at 4 K and maintain low noise SQUID operation, multiplexer chips consisting of niobium nitride (NbN)-based coplanar-waveguide resonators and niobium (Nb)-based RF-SQUIDs have been developed. This hybrid multiplexer exhibited 1 × 104 ≤ Q ≤ 2 × 104 and the square root of spectral density of current noise referred to the SQUID input √SI = 31 pA/√Hz. The former and the latter are factor-of-five and seven improvements from our previous results on Nb-based resonators, respectively. Two-directional readout on the complex plane of the transmission component of scattering matrix S21 enables us to distinguish the flux noise from noise originating from other sources, such as the cryogenic high electron mobility transistor (HEMT) amplifier. Systematic noise measurements with various microwave readout powers PMR make it possible to distinguish the contribution of noise sources within the system as follows: (1) The achieved √SI is dominated by the Nyquist noise from a resistor at 4 K in parallel to the SQUID input coil which is present to prevent microwave leakage to the TES. (2) The next dominant source is either the HEMT-amplifier noise (for small values of PMR) or the quantization noise due to the resolution of 300-K electronics (for large values of PMR). By a decrease of these noise levels to a degree that is achievable by current technology, we predict that the microwave RF-SQUID multiplexer can exhibit √SI ≤ 5 pA/√Hz, i.e., close to √SI of
International Nuclear Information System (INIS)
Kohjiro, Satoshi; Hirayama, Fuminori; Yamamori, Hirotake; Nagasawa, Shuichi; Fukuda, Daiji; Hidaka, Mutsuo
2014-01-01
White noise of dissipationless microwave radio frequency superconducting quantum interference device (RF-SQUID) multiplexers has been experimentally studied to evaluate their readout performance for transition edge sensor (TES) photon counters ranging from near infrared to gamma ray. The characterization has been carried out at 4 K, first to avoid the low-frequency fluctuations present at around 0.1 K, and second, for a feasibility study of readout operation at 4 K for extended applications. To increase the resonant Q at 4 K and maintain low noise SQUID operation, multiplexer chips consisting of niobium nitride (NbN)-based coplanar-waveguide resonators and niobium (Nb)-based RF-SQUIDs have been developed. This hybrid multiplexer exhibited 1 × 10 4 ≤ Q ≤ 2 × 10 4 and the square root of spectral density of current noise referred to the SQUID input √S I = 31 pA/√Hz. The former and the latter are factor-of-five and seven improvements from our previous results on Nb-based resonators, respectively. Two-directional readout on the complex plane of the transmission component of scattering matrix S 21 enables us to distinguish the flux noise from noise originating from other sources, such as the cryogenic high electron mobility transistor (HEMT) amplifier. Systematic noise measurements with various microwave readout powers P MR make it possible to distinguish the contribution of noise sources within the system as follows: (1) The achieved √S I is dominated by the Nyquist noise from a resistor at 4 K in parallel to the SQUID input coil which is present to prevent microwave leakage to the TES. (2) The next dominant source is either the HEMT-amplifier noise (for small values of P MR ) or the quantization noise due to the resolution of 300-K electronics (for large values of P MR ). By a decrease of these noise levels to a degree that is achievable by current technology, we predict that the microwave RF-SQUID multiplexer can exhibit
Comparison of multiplex reverse transcription-PCR-enzyme ...
African Journals Online (AJOL)
Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.
Electronics for a Next-Generation SQUID-Based Time-Domain Multiplexing System
International Nuclear Information System (INIS)
Reintsema, C. D.; Doriese, W. R.; Hilton, G. C.; Irwin, K. D.; Krinsky, J. W.; Adams, J. S.; Baker, R.; Bandler, S. R.; Kelly, R. L.; Kilbourne, C. A.; Porter, F. S.; Figueroa-Feliciano, E.; Wikus, P.
2009-01-01
A decade has elapsed since the design, development and realization of a SQUID-based time-division multiplexer at NIST. During this time the system has been used extensively for low-temperature-detector-array measurements. Concurrently, there have been substantial advancements both in detector array and commercial electronic component technology. The relevance and applicability of the technology has blossomed as well, often accompanied by more demanding measurement requirements. These factors have motivated a complete redesign of the NIST room-temperature read-out electronics. The redesign has leveraged advancements in component technology to achieve new capabilities better suited to the SQUID multiplexers and detector arrays being realized today. As examples of specific performance enhancements, the overall system bandwidth has been increased by a factor of four (a row switching rate of 6.24 MHz), the compactness has been increased by over a factor of two (a higher number of detector columns and rows per circuit board), and there are two high speed outputs per column (allowing fast switching of SQUID offsets in addition to digital feedback). The system architecture, design implementations, and performance advantages of the new system will be discussed. As an application example, the science chain flight electronics for the Micro-X High Resolution Microcalorimeter X-ray Imaging Rocket will be described as both a motivation for, and a direct implementation of the new system.
Phase division multiplexed EIT for enhanced temporal resolution.
Dowrick, T; Holder, D
2018-03-29
The most commonly used EIT paradigm (time division multiplexing) limits the temporal resolution of impedance images due to the need to switch between injection electrodes. Advances have previously been made using frequency division multiplexing (FDM) to increase temporal resolution, but in cases where a fixed range of frequencies is available, such as imaging fast neural activity, an upper limit is placed on the total number of simultaneous injections. The use of phase division multiplexing (PDM) where multiple out of phase signals can be injected at each frequency is investigated to increase temporal resolution. TDM, FDM and PDM were compared in head tank experiments, to compare transfer impedance measurements and spatial resolution between the three techniques. A resistor phantom paradigm was established to investigate the imaging of one-off impedance changes, of magnitude 1% and with durations as low as 500 µs (similar to those seen in nerve bundles), using both PDM and TDM approaches. In head tank experiments, a strong correlation (r > 0.85 and p EIT injections.
Multiplexed Holograms by Surface Plasmon Propagation and Polarized Scattering.
Chen, Ji; Li, Tao; Wang, Shuming; Zhu, Shining
2017-08-09
Thanks to the superiority in controlling the optical wave fronts, plasmonic nanostructures have led to various striking applications, among which metasurface holograms have been well developed and endowed with strong multiplexing capability. Here, we report a new design of multiplexed plasmonic hologram, which allows for reconstruction of multiple holographic images in free space by scatterings of surface plasmon polariton (SPP) waves in different propagation directions. Besides, the scattered polarization states can be further modulated by arranging the orientations of nanoscatterers. By incorporation of the SPP propagation and polarized scattering, a 4-fold hologram with low crosstalk is successfully demonstrated, which breaks the limitation of only two orthogonal states in conventional polarization multiplexers. Moreover, our design using the near-field SPP as reference wave holds the advantage for compact integration. This holographic approach is expected to inspire new photonic designs with enhanced information capacity and integratability.
Fujimoto, Kayo; Valente, Thomas W
2015-01-01
Adolescents interact with their peers in multiple social settings and form various types of peer relationships that affect drinking behavior. Friendship and popularity perceptions constitute critical relationships during adolescence. These two relations are commonly measured by asking students to name their friends, and this network is used to construct drinking exposure and peer status variables. This study takes a multiplex network approach by examining the congruity between friendships and popularity as correlates of adolescent drinking. Using data on friendship and popularity nominations among high school adolescents in Los Angeles, California (N = 1707; five schools), we examined the associations between an adolescent's drinking and drinking by (a) their friends only; (b) multiplexed friendships, friends also perceived as popular; and (c) congruent, multiplexed-friends, close friends perceived as popular. Logistic regression results indicated that friend-only drinking, but not multiplexed-friend drinking, was significantly associated with self-drinking (AOR = 3.51, p < 0.05). However, congruent, multiplexed-friend drinking also was associated with self-drinking (AOR = 3.10, p < 0.05). This study provides insight into how adolescent health behavior is predicated on the multiplexed nature of peer relationships. The results have implications for the design of health promotion interventions for adolescent drinking. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Genetic diversity among farmer-preferred cassava landraces in ...
African Journals Online (AJOL)
Understanding of genetic diversity among a breeding population is an important requirement for crop improvement as it allows for the selection of diverse parental combinations and formation of heterotic pools for genetic gain. This study was carried out to determine genetic diversity within and among 51 farmer-preferred ...
Technical Considerations for Reduced Representation Bisulfite Sequencing with Multiplexed Libraries
Chatterjee, Aniruddha; Rodger, Euan J.; Stockwell, Peter A.; Weeks, Robert J.; Morison, Ian M.
2012-01-01
Reduced representation bisulfite sequencing (RRBS), which couples bisulfite conversion and next generation sequencing, is an innovative method that specifically enriches genomic regions with a high density of potential methylation sites and enables investigation of DNA methylation at single-nucleotide resolution. Recent advances in the Illumina DNA sample preparation protocol and sequencing technology have vastly improved sequencing throughput capacity. Although the new Illumina technology is now widely used, the unique challenges associated with multiplexed RRBS libraries on this platform have not been previously described. We have made modifications to the RRBS library preparation protocol to sequence multiplexed libraries on a single flow cell lane of the Illumina HiSeq 2000. Furthermore, our analysis incorporates a bioinformatics pipeline specifically designed to process bisulfite-converted sequencing reads and evaluate the output and quality of the sequencing data generated from the multiplexed libraries. We obtained an average of 42 million paired-end reads per sample for each flow-cell lane, with a high unique mapping efficiency to the reference human genome. Here we provide a roadmap of modifications, strategies, and trouble shooting approaches we implemented to optimize sequencing of multiplexed libraries on an a RRBS background. PMID:23193365
Epidemics in partially overlapped multiplex networks.
Directory of Open Access Journals (Sweden)
Camila Buono
Full Text Available Many real networks exhibit a layered structure in which links in each layer reflect the function of nodes on different environments. These multiple types of links are usually represented by a multiplex network in which each layer has a different topology. In real-world networks, however, not all nodes are present on every layer. To generate a more realistic scenario, we use a generalized multiplex network and assume that only a fraction [Formula: see text] of the nodes are shared by the layers. We develop a theoretical framework for a branching process to describe the spread of an epidemic on these partially overlapped multiplex networks. This allows us to obtain the fraction of infected individuals as a function of the effective probability that the disease will be transmitted [Formula: see text]. We also theoretically determine the dependence of the epidemic threshold on the fraction [Formula: see text] of shared nodes in a system composed of two layers. We find that in the limit of [Formula: see text] the threshold is dominated by the layer with the smaller isolated threshold. Although a system of two completely isolated networks is nearly indistinguishable from a system of two networks that share just a few nodes, we find that the presence of these few shared nodes causes the epidemic threshold of the isolated network with the lower propagating capacity to change discontinuously and to acquire the threshold of the other network.
International Nuclear Information System (INIS)
Khelifa, F.; Samet, A.; Ben Hassen, W.; Afif, M.
2011-01-01
Multiuser diversity combined with Orthogonal Frequency Division Multiple Access (OFDMA) are a promising technique for achieving high downlink capacities in new generation of cellular and wireless network systems. The total capacity of OFDMA based-system is maximized when each subchannel is assigned to the mobile station with the best channel to noise ratio for that subchannel with power is uniformly distributed between all subchannels. A contiguous method for subchannel construction is adopted in IEEE 802.16 m standard in order to reduce OFDMA system complexity. In this context, new subchannel gain computation method, can contribute, jointly with optimal assignment subchannel to maximize total system capacity. In this paper, two new methods have been proposed in order to achieve a better trade-off between fairness and efficiency use of resources. Numerical results show that proposed algorithms provide low complexity, higher total system capacity and fairness among users compared to others recent methods.
The impact of heterogeneous response on coupled spreading dynamics in multiplex networks
Nie, Xiaoyu; Tang, Ming; Zou, Yong; Guan, Shuguang; Zhou, Jie
2017-10-01
Many recent studies have demonstrated that individual awareness of disease may significantly affect the spreading process of infectious disease. In the majority of these studies, the response of the awareness is generally treated homogeneously. Considering of diversity and heterogeneity in the human behavior which widely exist under different circumstances, in this paper we study heterogeneous response when people are aware of the prevalence of infectious diseases. Specifically, we consider that an individual with more neighbors may take more preventive measures as a reaction when he is aware of the disease. A suppression strength is introduced to describe such heterogeneity, and we find that a more evident heterogeneity may cause a more effective suppressing effect to the spreading of epidemics. A mean-field theory is developed to support the results which are verified on the multiplex networks with different interlayer degree correlation.
High core count single-mode multicore fiber for dense space division multiplexing
DEFF Research Database (Denmark)
Aikawa, K.; Sasaki, Y.; Amma, Y.
2016-01-01
Multicore fibers and few-mode fibers have the potential to realize dense-space-division multiplexing systems. Several dense-space-division multiplexing system transmission experiments over multicore fibers and few-mode fibers have been demonstrated so far. Multicore fibers, including recent resul...
Eroglu, Deniz; Marwan, Norbert
2017-04-01
The complex nature of a variety of phenomena in physical, biological, or earth sciences is driven by a large number of degrees of freedom which are strongly interconnected. Although the evolution of such systems is described by multivariate time series (MTS), so far research mostly focuses on analyzing these components one by one. Recurrence based analyses are powerful methods to understand the underlying dynamics of a dynamical system and have been used for many successful applications including examples from earth science, economics, or chemical reactions. The backbone of these techniques is creating the phase space of the system. However, increasing the dimension of a system requires increasing the length of the time series in order get significant and reliable results. This requirement is one of the challenges in many disciplines, in particular in palaeoclimate, thus, it is not easy to create a phase space from measured MTS due to the limited number of available obervations (samples). To overcome this problem, we suggest to create recurrence networks from each component of the system and combine them into a multiplex network structure, the multiplex recurrence network (MRN). We test the MRN by using prototypical mathematical models and demonstrate its use by studying high-dimensional palaeoclimate dynamics derived from pollen data from the Bear Lake (Utah, US). By using the MRN, we can distinguish typical climate transition events, e.g., such between Marine Isotope Stages.
National Research Council Canada - National Science Library
Mossberg, Thomas; Greiner, Christoph
2005-01-01
.... for the first time the successful application of HBRs to wavelength division multiplexing. Measured device performance indicates that the photolithographic fabrication process has reduced multiplexer designs to practice essentially perfectly...
Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt
2017-10-07
We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.
Hershkovitz, Avital; Vesilkov, Marina; Beloosesky, Yichayaou; Brill, Shai
2017-01-10
Total joint arthroplasty (TJA) is an effective and successful treatment of osteoarthritis of the hip and knee as quantified by several measures, such as pain relief, improved walking, improved self-care, functions, and increased quality of life. Data are lacking as to the definition of a satisfactory functional gain in a postacute setting and identifying the characteristics of older patients with TJA who may achieve that gain. Our aim was to characterize patients who may achieve a satisfactory functional gain in a postacute rehabilitation setting following TJA. This was a retrospective study of 180 patients with TJA admitted during 2010-2013. The main outcome measures were the Functional Independence Measure (FIM), the Montebello Rehabilitation Factor Score (MRFS) on the motor FIM, and the Timed Get Up and Go Test. Satisfactory functional gain was defined as an mFIM MRFS score above median score. Comparisons of clinical and demographic characteristics between patients who achieved a satisfactory functional gain versus those who did not were performed by the Mann-Whitney U test and the χ test. The proportion of patients who achieved a satisfactory functional gain was similar in the total knee arthroplasty and total hip arthroplasty (THA) groups. The most significant characteristic of patients who achieved a satisfactory functional gain was their admission functional ability. Age negatively impacted the ability to achieve a satisfactory functional gain in patients with THA. Functional level on admission is the best predictive factor for a better rehabilitation outcome for patients with TJA. Age negatively affects functional gain in patients with THA.
Microfluidic platform for multiplexed detection in single cells and methods thereof
Wu, Meiye; Singh, Anup K.
2018-05-01
The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications.
Topology optimized mode multiplexing in silicon-on-insulator photonic wire waveguides
DEFF Research Database (Denmark)
Frellsen, Louise Floor; Ding, Yunhong; Sigmund, Ole
2016-01-01
We design and experimentally verify a topology optimized low-loss and broadband two-mode (de-)multiplexer, which is (de-)multiplexing the fundamental and the first-order transverse-electric modes in a silicon photonic wire. The device has a footprint of 2.6 μm x 4.22 μm and exhibits a loss 14 d...
Ultra-High Capacity Silicon Photonic Interconnects through Spatial Multiplexing
Chen, Christine P.
The market for higher data rate communication is driving the semiconductor industry to develop new techniques of writing at smaller scales, while continuing to scale bandwidth at low power consumption. Silicon photonic (SiPh) devices offer a potential solution to the electronic interconnect bandwidth bottleneck. SiPh leverages the technology commensurate of decades of fabrication development with the unique functionality of next-generation optical interconnects. Finer fabrication techniques have allowed for manufacturing physical characteristics of waveguide structures that can support multiple modes in a single waveguide. By refining modal characteristics in photonic waveguide structures, through mode multiplexing with the asymmetric y-junction and microring resonator, higher aggregate data bandwidth is demonstrated via various combinations of spatial multiplexing, broadening applications supported by the integrated platform. The main contributions of this dissertation are summarized as follows. Experimental demonstrations of new forms of spatial multiplexing combined together exhibit feasibility of data transmission through mode-division multiplexing (MDM), mode-division and wavelength-division multiplexing (MDM-WDM), and mode-division and polarization-division multiplexing (MDM-PDM) through a C-band, Si photonic platform. Error-free operation through mode multiplexers and demultiplexers show how data can be viably scaled on multiple modes and with existing spatial domains simultaneously. Furthermore, we explore expanding device channel support from two to three arms. Finding that a slight mismatch in the third arm can increase crosstalk contributions considerably, especially when increasing data rate, we explore a methodical way to design the asymmetric y-junction device by considering its angles and multiplexer/demultiplexer arm width. By taking into consideration device fabrication variations, we turn towards optimizing device performance post
Pulsed power for angular multiplexed laser fusion drivers
International Nuclear Information System (INIS)
Eninger, J.E.
1983-01-01
The feasibility of using rare gas-halide lasers, in particular the KrF laser, as inertial confinement fusion (ICF) drivers has been assessed. These lasers are scalable to the required high energy (approx. =1-5 MJ) in a short pulse (approx. =10 ns) by optical angular multiplexing, and integration of the output from approx. =100 kJ laser amplifier subsystems. The e-beam current density (approx. =50A/cm 2 ) and voltage (approx. =800 kV) required for these power amplifiers lead to an e-beam impedance of approx. =0.2Ω for approx. =300 ns pump time. This impedance level requires modularization of the large area e-gun, a) to achieve a diode inductance consistent with fast current risetime, b) to circumvent dielectric breakdown constraints in the pulse forming lines, and c) to reduce the requirement for guide magnetic fields. Pulsed power systems requirements, design concepts, scalability, tradeoffs, and performance projections are discussed in this paper
Inexpensive multiplexed library preparation for megabase-sized genomes.
Directory of Open Access Journals (Sweden)
Michael Baym
Full Text Available Whole-genome sequencing has become an indispensible tool of modern biology. However, the cost of sample preparation relative to the cost of sequencing remains high, especially for small genomes where the former is dominant. Here we present a protocol for rapid and inexpensive preparation of hundreds of multiplexed genomic libraries for Illumina sequencing. By carrying out the Nextera tagmentation reaction in small volumes, replacing costly reagents with cheaper equivalents, and omitting unnecessary steps, we achieve a cost of library preparation of $8 per sample, approximately 6 times cheaper than the standard Nextera XT protocol. Furthermore, our procedure takes less than 5 hours for 96 samples. Several hundred samples can then be pooled on the same HiSeq lane via custom barcodes. Our method will be useful for re-sequencing of microbial or viral genomes, including those from evolution experiments, genetic screens, and environmental samples, as well as for other sequencing applications including large amplicon, open chromosome, artificial chromosomes, and RNA sequencing.
An alarm multiplexer communication system
International Nuclear Information System (INIS)
Herrera, G.V.
1986-01-01
A low cost Alarm Multiplexer Communication System (AMCS) has been developed to perform the security sensor monitoring and control functions and to provide remote relay control capability for integrated security systems. AMCS has a distributed multiplexer/repeater architecture with up to four dual communication loops and dual control computers that guarantee total system operation under any single point failure condition. Each AMCS can control up to 4096 sensors and 2048 remote relays. AMCS reports alarm status information to and is controlled by either one or two Host computers. This allows for independent operation of primary and backup security command centers. AMCS communicates with the Host computers over an asynchronous serial communication link and has a message protocol which allows AMCS to fully recover from lost messages or large blocks of data communication errors. This paper describes the AMCS theory of operation, AMCS fault modes, and AMCS system design methodology. Also, cost and timing information is presented. AMCS is being used and considered for several DOE and DOD facilities
Silicon Photonic Integrated Circuit Mode Multiplexer
DEFF Research Database (Denmark)
Ding, Yunhong; Ou, Haiyan; Xu, Jing
2013-01-01
We propose and demonstrate a novel silicon photonic integrated circuit enabling multiplexing of orthogonal modes in a few-mode fiber (FMF). By selectively launching light to four vertical grating couplers, all six orthogonal spatial and polarization modes supported by the FMF are successfully...
Safety considerations for various applications of remote multiplexing in nuclear power plants
International Nuclear Information System (INIS)
Leary, J.E.
1978-01-01
There is increasing interest in the application of remote multiplexing systems (RMS) for power plant applications. Remote multiplexing can replace the majority of conventional control and instrumentation signal cables. In addition, the RMS can perform control logic functions presently implemented by discrete hardwired circuit elements. The background and trends in the use of RMS and the attendant advantages and concerns are reviewed. Classifications of multiplexed digital systems are presented to show the evolution of this technology in power plant applications. Nuclear safety-related applications of RMS are discussed with emphasis on the impact of selected NRC Regulatory Guides on such applications. (author)
Williams, Shanita D; Hansen, Kristen; Smithey, Marian; Burnley, Josepha; Koplitz, Michelle; Koyama, Kirk; Young, Janice; Bakos, Alexis
2014-01-01
It is widely accepted that diversifying the nation's health-care workforce is a necessary strategy to increase access to quality health care for all populations, reduce health disparities, and achieve health equity. In this article, we present a conceptual model that utilizes the social determinants of health framework to link nursing workforce diversity and care quality and access to two critical population health indicators-health disparities and health equity. Our proposed model suggests that a diverse nursing workforce can provide increased access to quality health care and health resources for all populations, and is a necessary precursor to reduce health disparities and achieve health equity. With this conceptual model as a foundation, we aim to stimulate the conceptual and analytical work-both within and outside the nursing field-that is necessary to answer these important but largely unanswered questions.
DEFF Research Database (Denmark)
Ding, Yunhong; Xu, Jing; Da Ros, Francesco
2013-01-01
), and large fabrication tolerance (20 nm) are measured. An on-chip mode multiplexing experiment is carried out on the fabricated circuit with non return-to-zero (NRZ) on-off keying (OOK) signals at 40 Gbit/s. The experimental results show clear eye diagrams and moderate power penalty for both TE0 and TE1...
Conserving forest biological diversity: How the Montreal Process helps achieve sustainability
Mark Nelson; Guy Robertson; Kurt. Riitters
2015-01-01
Forests support a variety of ecosystems, species and genes collectively referred to as biological diversity along with important processes that tie these all together. With the growing recognition that biological diversity contributes to human welfare in a number of important ways such as providing food, medicine and fiber (provisioning services...
The perceived diversity heuristic: the case of pseudodiversity.
Ayal, Shahar; Zakay, Dan
2009-03-01
One of the normative ways to decrease the risk of a pool with uncertainty prospects is to diversify its resources. Thus, decision makers are advised not to put all their eggs in one basket. The authors suggest that decision makers use a perceived diversity heuristic (PDH) to evaluate the risk of a pool by intuitively assessing the diversity of its sources. This heuristic yields biased judgments in cases of pseudodiversity, in which the perceived diversity of a pool is enhanced, although this fact does not change the pool's normative values. The first 3 studies introduce 2 independent sources of pseudodiversity-distinctiveness and multiplicity-showing that these two sources can lead to overdiversification under conditions of gain. In another set of 3 studies, the authors examine the effect of framing on diversification level. The results support the PDH predictions, according to which diversity seeking is obtained under conditions of gain, whereas diversity aversion is obtained under conditions of loss.
More ethical and more efficient clinical research: multiplex trial design.
Keus, Frederik; van der Horst, Iwan C C; Nijsten, Maarten W
2014-08-14
Today's clinical research faces challenges such as a lack of clinical equipoise between treatment arms, reluctance in randomizing for multiple treatments simultaneously, inability to address interactions and increasingly restricted resources. Furthermore, many trials are biased by extensive exclusion criteria, relatively small sample size and less appropriate outcome measures. We propose a 'Multiplex' trial design that preserves clinical equipoise with a continuous and factorial trial design that will also result in more efficient use of resources. This multiplex design accommodates subtrials with appropriate choice of treatment arms within each subtrial. Clinical equipoise should increase consent rates while the factorial design is the best way to identify interactions. The multiplex design may evolve naturally from today's research limitations and challenges, while principal objections seem absent. However this new design poses important infrastructural, organisational and psychological challenges that need in depth consideration.
Multiplexing symbolic dynamics-based chaos communications using synchronization
Energy Technology Data Exchange (ETDEWEB)
Blakely, Jonathan N; Corron, Ned J [US Army RDECOM, AMSRD-AMR-WS-ST, Redstone Arsenal, Huntsville, AL 35898 (United States)
2005-01-01
A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators.
Multiplexing symbolic dynamics-based chaos communications using synchronization
International Nuclear Information System (INIS)
Blakely, Jonathan N; Corron, Ned J
2005-01-01
A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators
Dynamical interplay between awareness and epidemic spreading in multiplex networks
Granell, Clara; Gomez, Sergio; Arenas, Alex
2013-01-01
We present the analysis of the interrelation between two processes accounting for the spreading of an epidemics, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusiv...
Centralized light-source optical access network based on polarization multiplexing.
Grassi, Fulvio; Mora, José; Ortega, Beatriz; Capmany, José
2010-03-01
This paper presents and demonstrates a centralized light source optical access network based on optical polarization multiplexing technique. By using two optical sources emitting light orthogonally polarized in the Central Node for downstream and upstream operations, the Remote Node is kept source-free. EVM values below telecommunication standard requirements have been measured experimentally when bidirectional digital signals have been transmitted over 10 km of SMF employing subcarrier multiplexing technique in the electrical domain.
Coherence-Multiplexed Optical RF Feeder Networks
Meijerink, Arjan; Taniman, R.O.; van Etten, Wim
2007-01-01
An optical RF feeding system for wireless access is proposed, in which the radio access points are distinguished by means of coherence multiplexing (CM). CM is a rather unknown and potentially inexpensive optical code division multiple access technique, which is particularly suitable for relatively
Machado, Jessica M D; Soares, Ruben R G; Chu, Virginia; Conde, João P
2018-01-15
The field of microfluidics holds great promise for the development of simple and portable lab-on-a-chip systems. The use of capillarity as a means of fluidic manipulation in lab-on-a-chip systems can potentially reduce the complexity of the instrumentation and allow the development of user-friendly devices for point-of-need analyses. In this work, a PDMS microchannel-based, colorimetric, autonomous capillary chip provides a multiplexed and semi-quantitative immunodetection assay. Results are acquired using a standard smartphone camera and analyzed with a simple gray scale quantification procedure. The performance of this device was tested for the simultaneous detection of the mycotoxins ochratoxin A (OTA), aflatoxin B1 (AFB1) and deoxynivalenol (DON) which are strictly regulated food contaminants with severe detrimental effects on human and animal health. The multiplexed assay was performed approximately within 10min and the achieved sensitivities of<40, 0.1-0.2 and<10ng/mL for OTA, AFB1 and DON, respectively, fall within the majority of currently enforced regulatory and/or recommended limits. Furthermore, to assess the potential of the device to analyze real samples, the immunoassay was successfully validated for these 3 mycotoxins in a corn-based feed sample after a simple sample preparation procedure. Copyright © 2017 Elsevier B.V. All rights reserved.
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Mode Division Multiplexing Exploring Hollow-Core Photonic Bandgap Fibers
DEFF Research Database (Denmark)
Xu, Jing; Lyngso, Jens Kristian; Leick, Lasse
2013-01-01
We review our recent exploratory investigations on mode division multiplexing using hollow-core photonic bandgap fibers (HC-PBGFs). Compared with traditional multimode fibers, HC-PBGFs have several attractive features such as ultra-low nonlinearities, low-loss transmission window around 2 µm etc....... After having discussed the potential and challenges of using HC-PBGFs as transmission fibers for mode multiplexing applications, we will report a number of recent proof-of-concept results obtained in our group using direct detection receivers. The first one is the transmission of two 10.7 Gbit/s non...
In-plane wavelength division de-multiplexing using photonic crystals
DEFF Research Database (Denmark)
Frandsen, Lars Hagedorn; Harpøth, Anders; Hede, K. K.
We demonstrate a novel concept for in-plane coarse wavelength division de-multiplexing in integrated photonic circuits utilizing planar photonic crystal waveguides (PhCWs) fabricated in a silicon-on-insulator material. The filtering of wavelength channels is realized by shifting the cut......-off frequency of the fundamental photonic bandgap mode. The shift is obtained by modifying the size of the border holes in consecutive sections of the PhCW1. Simulations and experimental proof-of-principle of the four-channel de-multiplexer will be presented. 1A. Adibi et al., Electron. Lett. 36, 1376...
Color multiplexing using directional holographic gratings and linear polarization
International Nuclear Information System (INIS)
Lugo, L I; Rodriguez, A; Ramirez, G; Guel, S; Nunez, O F
2011-01-01
We propose a system of multiplexing and de-multiplexing, which uses a holographic diffraction grating to compel modulated light of different colors to be sent through an optical fiber. Diffraction gratings were fabricated specifically to pick the desired direction in which we wanted the light of different wavelengths to impinge the optic fiber, and also to be separated at the output. It was been found that the system preserves the polarization of light, which give us a one more freedom degree, allowing us to process twice the original information amount.
DeGaudenzi, Riccardo; Giannetti, Filippo
1995-01-01
The downlink of a satellite-mobile personal communication system employing power-controlled Direct Sequence Code Division Multiple Access (DS-CDMA) and exploiting satellite-diversity is analyzed and its performance compared with a more traditional communication system utilizing single satellite reception. The analytical model developed has been thoroughly validated by means of extensive Monte Carlo computer simulations. It is shown how the capacity gain provided by diversity reception shrinks considerably in the presence of increasing traffic or in the case of light shadowing conditions. Moreover, the quantitative results tend to indicate that to combat system capacity reduction due to intra-system interference, no more than two satellites shall be active over the same region. To achieve higher system capacity, differently from terrestrial cellular systems, Multi-User Detection (MUD) techniques are likely to be required in the mobile user terminal, thus considerably increasing its complexity.
Santos, Carlos E; Galligan, Kathrine; Pahlke, Erin; Fabes, Richard A
2013-01-01
This research examined the relations between adherence to gender-typed behaviors in boys' friendships, achievement, and self-esteem. Participants were racially and ethnically diverse adolescent boys in grade 8 (Mage = 13.05; range = 12-14). The study was completed at a public junior high school that offered both single- and mixed-gender classes. Data were collected in 2 waves, the first wave in fall of 2010 and the second in spring of 2011. At each wave, participants completed assessments of gender concepts and self-esteem. Standardized tests scores from the end of the previous academic year and the end of the year of the study were utilized. Results revealed that the boys' adherence to physical toughness behaviors in their friendships was negatively associated with math standardized test scores and self-esteem from Time I to Time II. Indirect effects analyses revealed a relation between boys' adherence to emotional stoicism behaviors in friendships and math achievement and self-esteem via boys' adherence to physical toughness behaviors. Implications of these findings and the links between masculinity, boys' friendships, performance in school, and psychological adjustment are discussed. © 2013 American Orthopsychiatric Association.
Ballen, Cissy J; Wieman, Carl; Salehi, Shima; Searle, Jeremy B; Zamudio, Kelly R
2017-01-01
Efforts to retain underrepresented minority (URM) students in science, technology, engineering, and mathematics (STEM) have shown only limited success in higher education, due in part to a persistent achievement gap between students from historically underrepresented and well-represented backgrounds. To test the hypothesis that active learning disproportionately benefits URM students, we quantified the effects of traditional versus active learning on student academic performance, science self-efficacy, and sense of social belonging in a large (more than 250 students) introductory STEM course. A transition to active learning closed the gap in learning gains between non-URM and URM students and led to an increase in science self-efficacy for all students. Sense of social belonging also increased significantly with active learning, but only for non-URM students. Through structural equation modeling, we demonstrate that, for URM students, the increase in self-efficacy mediated the positive effect of active-learning pedagogy on two metrics of student performance. Our results add to a growing body of research that supports varied and inclusive teaching as one pathway to a diversified STEM workforce. © 2017 C. J. Ballen et al. CBE—Life Sciences Education © 2017 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.
Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva
2007-01-01
Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.
Stability in high gain plasmas in DIII-D
International Nuclear Information System (INIS)
Lazarus, E.A.; Houlberg, W.A.; Murakami, M.; Wade, M.R.
1996-10-01
Fusion power gain has been increased by a factor of 3 in DIII-D plasmas through the use of strong discharge shaping and tailoring of the pressure and current density profiles. H-mode plasmas with weak or negative central magnetic shear are found to have neoclassical ion confinement throughout most of the plasma volume. Improved MHD stability is achieved by controlling the plasma pressure profile width. The highest fusion power gain Q (ratio of fusion power to input power) in deuterium plasmas was 0.0015, which extrapolates to an equivalent Q of 0.32 in a deuterium-tritium plasma and is similar to values achieved in tokamaks of larger size and magnetic fields
A laser ablation ICP-MS based method for multiplexed immunoblot analysis
DEFF Research Database (Denmark)
de Bang, Thomas Christian; Petersen, Jørgen; Pedas, Pai Rosager
2015-01-01
developed a multiplexed antibody-based assay and analysed selected PSII subunits in barley (Hordeum vulgare L.). A selection of antibodies were labelled with specific lanthanides and immunoreacted with thylakoids exposed to Mn deficiency after western blotting. Subsequently, western blot membranes were...... analysed by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), which allowed selective and relative quantitative analysis via the different lanthanides. The method was evaluated against established liquid chromatography electrospray ionization tandem mass spectrometry (LC...... by more than one technique. The developed method enables a higher number of proteins to be multiplexed in comparison to existing immunoassays. Furthermore, multiplexed protein analysis by LA-ICP-MS provides an analytical platform with high throughput appropriate for screening large collections of plants....
Design and Performance of the Multiplexed SQUID/TES Array at Ninety Gigahertz
Stanchfield, Sara; Ade, Peter; Aguirre, James; Brevik, Justus A.; Cho, Hsiao-Mei; Datta, Rahul; Devlin, Mark; Dicker, Simon R.; Dober, Bradley; Duff, Shannon M.; Egan, Dennis; Ford, Pam; Hilton, Gene; Hubmayr, Johannes; Irwin, Kent; Knowles, Kenda; Marganian, Paul; Mason, Brian Scott; Mates, John A. B.; McMahon, Jeff; Mello, Melinda; Mroczkowski, Tony; Romero, Charles; Sievers, Jonathon; Tucker, Carole; Vale, Leila R.; Vissers, Michael; White, Steven; Whitehead, Mark; Ullom, Joel; Young, Alexander
2018-01-01
We present the array performance and astronomical images from early science results from MUSTANG-2, a 90 GHz feedhorn-coupled, microwave SQUID-multiplexed TES bolometer array operating on the Robert C. Byrd Green Bank Telescope (GBT). MUSTANG-2 was installed on the GBT on December 2, 2016 and immediately began commissioning efforts, followed by science observations, which are expected to conclude June 2017. The feedhorn and waveguide-probe-coupled detector technology is a mature technology, which has been used on instrument including the South Pole Telescope, the Atacama Cosmology Telescope, and the Atacama B-mode Search telescope. The microwave SQUID readout system developed for MUSTANG-2 currently reads out 66 detectors with a single coaxial cable and will eventually allow thousands of detectors to be multiplexed. This microwave SQUID multiplexer combines the proven abilities of millimeterwave TES detectors with the multiplexing capabilities of KIDs with no degradation in noise performance of the detectors. Each multiplexing device is read out using warm electronics consisting of a commercially available ROACH board, a DAC/ADC card, and an Intermediate Frequency mixer circuit. The hardware was originally developed by the UC Berkeley Collaboration for Astronomy Signal Processing and Electronic Research (CASPER) group, whose primary goal is to develop scalable FPGA-based hardware with the flexibility to be used in a wide range of radio signal processing applications. MUSTANG-2 is the first on-sky instrument to use microwave SQUID multiplexing and is available as a shared-risk/PI instrument on the GBT. In MUSTANG-2's first season 7 separate proposals were awarded a total of 230 hours of telescope time.
Hu, Rong; Zhang, Xi; Xu, Qiang; Lu, Dan-Qing; Yang, Yun-Hui; Xu, Quan-Qing; Ruan, Qiong; Mo, Liu-Ting; Zhang, Xiao-Bing
2017-06-15
A universal aptameric system based on the taking advantage of double-stranded DNA/perylene diimide (dsDNA/PDI) as the signal probe was developed for multiplexed detection of small molecules. Aptamers are single-stranded DNA or RNA oligonucleotides which are selected in vitro by a process known as systematic evolution of ligands by exponential enrichment. In this work, we synthesized a new kind of PDI and reported this aggregated PDI could quench the double-stranded DNA (dsDNA)-labeled fluorophores with a high quenching efficiency. The quenching efficiencies on the fluorescence of FAM, TAMRA and Cy5 could reach to 98.3%±0.9%, 97.2%±0.6% and 98.1%±1.1%, respectively. This broad-spectrum quencher was then adopted to construct a multicolor biosensor via a label-free approach. A structure-switching-triggered enzymatic recycling amplification was employed for signal amplification. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity towards small analytes. For other targets, changing the corresponding aptamer can achieve the goal. The quencher did not interfere with the catalytic activity of nuclease. The biosensor could be manipulated with similar sensitivity no matter in pre-addition or post-addition manner. Moreover, simultaneous and multiplexed analysis of several small molecules in homogeneous solution was achieved, demonstrating its potential application in the rapid screening of multiple biotargets. Copyright © 2017 Elsevier B.V. All rights reserved.
Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M
2015-07-07
Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.
A Perron–Frobenius theory for block matrices associated to a multiplex network
International Nuclear Information System (INIS)
Romance, Miguel; Solá, Luis; Flores, Julio; García, Esther; García del Amo, Alejandro; Criado, Regino
2015-01-01
The uniqueness of the Perron vector of a nonnegative block matrix associated to a multiplex network is discussed. The conclusions come from the relationships between the irreducibility of some nonnegative block matrix associated to a multiplex network and the irreducibility of the corresponding matrices to each layer as well as the irreducibility of the adjacency matrix of the projection network. In addition the computation of that Perron vector in terms of the Perron vectors of the blocks is also addressed. Finally we present the precise relations that allow to express the Perron eigenvector of the multiplex network in terms of the Perron eigenvectors of its layers
A Perron-Frobenius theory for block matrices associated to a multiplex network
Romance, Miguel; Solá, Luis; Flores, Julio; García, Esther; García del Amo, Alejandro; Criado, Regino
2015-03-01
The uniqueness of the Perron vector of a nonnegative block matrix associated to a multiplex network is discussed. The conclusions come from the relationships between the irreducibility of some nonnegative block matrix associated to a multiplex network and the irreducibility of the corresponding matrices to each layer as well as the irreducibility of the adjacency matrix of the projection network. In addition the computation of that Perron vector in terms of the Perron vectors of the blocks is also addressed. Finally we present the precise relations that allow to express the Perron eigenvector of the multiplex network in terms of the Perron eigenvectors of its layers.
2011-08-08
... microbiology/MCM device, their clinical application and public health/clinical needs and quality criteria for... topics: 1. Clinical Application of Highly Multiplexed Microbiology Devices: Their clinical application... to evaluate the analytical and clinical performance of highly multiplexed microbiology devices...
Genetic Diversity of Tick-Borne Rickettsial Pathogens; Insights Gained from Distant Strains
Directory of Open Access Journals (Sweden)
Sebastián Aguilar Pierlé
2014-01-01
Full Text Available The ability to capture genetic variation with unprecedented resolution improves our understanding of bacterial populations and their ability to cause disease. The goal of the pathogenomics era is to define genetic diversity that results in disease. Despite the economic losses caused by vector-borne bacteria in the Order Rickettsiales, little is known about the genetic variants responsible for observed phenotypes. The tick-transmitted rickettsial pathogen Anaplasma marginale infects cattle in tropical and subtropical regions worldwide, including Australia. Genomic analysis of North American A. marginale strains reveals a closed core genome defined by high levels of Single Nucleotide Polymorphisms (SNPs. Here we report the first genome sequences and comparative analysis for Australian strains that differ in virulence and transmissibility. A list of genetic differences that segregate with phenotype was evaluated for the ability to distinguish the attenuated strain from virulent field strains. Phylogenetic analyses of the Australian strains revealed a marked evolutionary distance from all previously sequenced strains. SNP analysis showed a strikingly reduced genetic diversity between these strains, with the smallest number of SNPs detected between any two A. marginale strains. The low diversity between these phenotypically distinct bacteria presents a unique opportunity to identify the genetic determinants of virulence and transmission.
Fluorescence-Raman Dual Modal Endoscopic System for Multiplexed Molecular Diagnostics
Jeong, Sinyoung; Kim, Yong-Il; Kang, Homan; Kim, Gunsung; Cha, Myeong Geun; Chang, Hyejin; Jung, Kyung Oh; Kim, Young-Hwa; Jun, Bong-Hyun; Hwang, Do Won; Lee, Yun-Sang; Youn, Hyewon; Lee, Yoon-Sik; Kang, Keon Wook; Lee, Dong Soo; Jeong, Dae Hong
2015-03-01
Optical endoscopic imaging, which was recently equipped with bioluminescence, fluorescence, and Raman scattering, allows minimally invasive real-time detection of pathologies on the surface of hollow organs. To characterize pathologic lesions in a multiplexed way, we developed a dual modal fluorescence-Raman endomicroscopic system (FRES), which used fluorescence and surface-enhanced Raman scattering nanoprobes (F-SERS dots). Real-time, in vivo, and multiple target detection of a specific cancer was successful, based on the fast imaging capability of fluorescence signals and the multiplex capability of simultaneously detected SERS signals using an optical fiber bundle for intraoperative endoscopic system. Human epidermal growth factor receptor 2 (HER2) and epidermal growth factor receptor (EGFR) on the breast cancer xenografts in a mouse orthotopic model were successfully detected in a multiplexed way, illustrating the potential of FRES as a molecular diagnostic instrument that enables real-time tumor characterization of receptors during routine endoscopic procedures.
Triadic closure dynamics drives scaling laws in social multiplex networks
International Nuclear Information System (INIS)
Klimek, Peter; Thurner, Stefan
2013-01-01
Social networks exhibit scaling laws for several structural characteristics, such as degree distribution, scaling of the attachment kernel and clustering coefficients as a function of node degree. A detailed understanding if and how these scaling laws are inter-related is missing so far, let alone whether they can be understood through a common, dynamical principle. We propose a simple model for stationary network formation and show that the three mentioned scaling relations follow as natural consequences of triadic closure. The validity of the model is tested on multiplex data from a well-studied massive multiplayer online game. We find that the three scaling exponents observed in the multiplex data for the friendship, communication and trading networks can simultaneously be explained by the model. These results suggest that triadic closure could be identified as one of the fundamental dynamical principles in social multiplex network formation. (paper)
Diversity in Dermatology Residency Programs.
Van Voorhees, Abby S; Enos, Clinton W
2017-10-01
Given the change in our population to one that is more racially and ethnically diverse, the topic of diversity in dermatology residency programs has gained attention. In a field that has become highly competitive, diversity is lagging behind. What are the reasons for this? The existing diversity among medical school matriculants is reflective of the applicant pool, and although modest, there has been an increase in applications and acceptances from minority populations. However, these proportions do not carry through to the population applying to dermatology residency. Making sense of this and planning how to recruit a more diverse applicant pool will improve the quality and cultural competency of future dermatologists. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Gain control network conditions in early sensory coding.
Directory of Open Access Journals (Sweden)
Eduardo Serrano
Full Text Available Gain control is essential for the proper function of any sensory system. However, the precise mechanisms for achieving effective gain control in the brain are unknown. Based on our understanding of the existence and strength of connections in the insect olfactory system, we analyze the conditions that lead to controlled gain in a randomly connected network of excitatory and inhibitory neurons. We consider two scenarios for the variation of input into the system. In the first case, the intensity of the sensory input controls the input currents to a fixed proportion of neurons of the excitatory and inhibitory populations. In the second case, increasing intensity of the sensory stimulus will both, recruit an increasing number of neurons that receive input and change the input current that they receive. Using a mean field approximation for the network activity we derive relationships between the parameters of the network that ensure that the overall level of activity of the excitatory population remains unchanged for increasing intensity of the external stimulation. We find that, first, the main parameters that regulate network gain are the probabilities of connections from the inhibitory population to the excitatory population and of the connections within the inhibitory population. Second, we show that strict gain control is not achievable in a random network in the second case, when the input recruits an increasing number of neurons. Finally, we confirm that the gain control conditions derived from the mean field approximation are valid in simulations of firing rate models and Hodgkin-Huxley conductance based models.
PLC-based mode multi/demultiplexers for mode division multiplexing
Saitoh, Kunimasa; Hanzawa, Nobutomo; Sakamoto, Taiji; Fujisawa, Takeshi; Yamashita, Yoko; Matsui, Takashi; Tsujikawa, Kyozo; Nakajima, Kazuhide
2017-02-01
Recently developed PLC-based mode multi/demultiplexers (MUX/DEMUXs) for mode division multiplexing (MDM) transmission are reviewed. We firstly show the operation principle and basic characteristics of PLC-based MUX/DEMUXs with an asymmetric directional coupler (ADC). We then demonstrate the 3-mode (2LP-mode) multiplexing of the LP01, LP11a, and LP11b modes by using fabricated PLC-based mode MUX/DEMUX on one chip. In order to excite LP11b mode in the same plane, a PLC-based LP11 mode rotator is introduced. Finally, we show the PLC-based 6-mode (4LP-mode) MUX/DEMUX with a uniform height by using ADCs, LP11 mode rotators, and tapered waveguides. It is shown that the LP21a mode can be excited from the LP11b mode by using ADC, and the two nearly degenerated LP21b and LP02 modes can be (de)multiplexed separately by using tapered mode converter from E13 (E31) mode to LP21b (LP02) mode.
Performance of Multiplexed XY Resistive Micromegas detectors in a high intensity beam
Banerjee, D.; Burtsev, V.; Chumakov, A.; Cooke, D.; Depero, E.; Dermenev, A. V.; Donskov, S. V.; Dubinin, F.; Dusaev, R. R.; Emmenegger, S.; Fabich, A.; Frolov, V. N.; Gardikiotis, A.; Gninenko, S. N.; Hösgen, M.; Karneyeu, A. E.; Ketzer, B.; Kirsanov, M. M.; Konorov, I. V.; Kramarenko, V. A.; Kuleshov, S. V.; Levchenko, E.; Lyubovitskij, V. E.; Lysan, V.; Mamon, S.; Matveev, V. A.; Mikhailov, Yu. V.; Myalkovskiy, V. V.; Peshekhonov, V. D.; Peshekhonov, D. V.; Polyakov, V. A.; Radics, B.; Rubbia, A.; Samoylenko, V. D.; Tikhomirov, V. O.; Tlisov, D. A.; Toropin, A. N.; Vasilishin, B.; Arenas, G. Vasquez; Ulloa, P.; Crivelli, P.
2018-02-01
We present the performance of multiplexed XY resistive Micromegas detectors tested in the CERN SPS 100 GeV/c electron beam at intensities up to 3 . 3 × 105e- /(s ṡcm2) . So far, all studies with multiplexed Micromegas have only been reported for tests with radioactive sources and cosmic rays. The use of multiplexed modules in high intensity environments was not explored due to the effect of ambiguities in the reconstruction of the hit point caused by the multiplexing feature. For the specific mapping and beam intensities analyzed in this work with a multiplexing factor of five, more than 50% level of ambiguity is introduced due to particle pile-up as well as fake clusters due to the mapping feature. Our results prove that by using the additional information of cluster size and integrated charge from the signal clusters induced on the XY strips, the ambiguities can be reduced to a level below 2%. The tested detectors are used in the CERN NA64 experiment for tracking the incoming particles bending in a magnetic field in order to reconstruct their momentum. The average hit detection efficiency of each module was found to be ∼96% at the highest beam intensities. By using four modules a tracking resolution of 1.1% was obtained with ∼85% combined tracking efficiency.
He, Guobing; Gao, Yang; Xu, Yan; Ji, Lanting; Sun, Xiaoqiang; Wang, Xibin; Yi, Yunji; Chen, Changming; Wang, Fei; Zhang, Daming; Wu, Yuanda
2018-05-01
A polymer mode multiplexer based on asymmetric couplers is theoretically designed and experimentally demonstrated. The proposed X-junction coupler is formed by waveguides overlapped with different crossing angles in the vertical direction. A beam propagation method is adopted to optimize the dimensional parameters of the mode multiplexer to convert LP01 mode of two lower waveguides to LP11a and LP21a mode of the upper waveguide. The ultraviolet lithography and wet chemical etching are used in the fabrication process. A conversion ratio over 98% for both LP11a and LP21a mode in the wavelength range from 1530 to 1570 nm are experimentally demonstrated. This mode multiplexer has potential in broadband mode-division multiplexing transmission systems.
Special education and later academic achievement.
Ehrhardt, Jennifer; Huntington, Noelle; Molino, Janine; Barbaresi, William
2013-02-01
To determine whether grade at entry to special education is associated with improved reading achievement in children with reading disorders (RD) and whether the effect of grade at entry to special education differs by socioeconomic status (SES). The authors conducted a secondary data analysis using data from the Early Childhood Longitudinal Study-Kindergarten Cohort (ECLS-K), a nationally representative cohort of children followed longitudinally from kindergarten through eighth grade (1998-2007). Using data from the fifth grade wave of ECLS-K, the authors identified children with RD (n = 290). The outcome of interest was change in score on the reading achievement test, which was developed by ECLS-K staff, between first and fifth grade. Using multiple linear regression, the authors modeled outcome as a function of a child's grade at entry to special education, controlling for several covariates. Early entry to special education (by first grade vs second or third grade) was associated with larger gains in reading achievement between first and fifth grade (p special education by first grade versus second grade gained 4.5 more points on the reading achievement test (p special education by first grade versus third grade gained 1.7 more points on the reading achievement test (p special education between children from families of low and higher SES. For children with RD, early entry to special education is associated with improved reading achievement during elementary school.
Graphite nanocomposites sensor for multiplex detection of antioxidants in food.
Ng, Khan Loon; Tan, Guan Huat; Khor, Sook Mei
2017-12-15
Butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), and tert-butylhydroquinone (TBHQ) are synthetic antioxidants used in the food industry. Herein, we describe the development of a novel graphite nanocomposite-based electrochemical sensor for the multiplex detection and measurement of BHA, BHT, and TBHQ levels in complex food samples using a linear sweep voltammetry technique. Moreover, our newly established analytical method exhibited good sensitivity, limit of detection, limit of quantitation, and selectivity. The accuracy and reliability of analytical results were challenged by method validation and comparison with the results of the liquid chromatography method, where a linear correlation of more than 0.99 was achieved. The addition of sodium dodecyl sulfate as supporting additive further enhanced the LSV response (anodic peak current, I pa ) of BHA and BHT by 2- and 20-times, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.
A review of spectrally coded multiplexing techniques for fibre grating sensor systems
International Nuclear Information System (INIS)
Childs, Paul; Wong, Allan C L; Yan, Binbin; Li, Mo; Peng, Gang-Ding
2010-01-01
We review recent work and progress on spectrally coded multiplexing (SCM). SCM is a generic multiplexing technique that provides more efficient data usage, additional flexibility and greater channel capability for fibre and fibre grating based sensor systems. We show a few examples of newly developed SCM techniques based on specially designed fibre gratings
Super-Orthogonal Space-Time Turbo Transmit Diversity for CDMA
Directory of Open Access Journals (Sweden)
Pieter G. W. van Rooyen
2005-05-01
Full Text Available Studies have shown that transmit and receive diversity employing a combination of multiple transmit-receive antennas (given ideal channel state information (CSI and independent fading between antenna pairs will potentially yield maximum achievable system capacity. In this paper, the concept of a layered super-orthogonal turbo transmit diversity (SOTTD for downlink direct-sequence code-division multiple-access (CDMA systems is explored. This open-loop transmit diversity technique improves the downlink performance by using a small number of antenna elements at the base station and a single antenna at the handset. In the proposed technique, low-rate super-orthogonal code-spread CDMA is married with code-division transmit diversity (CDTD. At the mobile receiver, space-time (ST RAKE CDTD processing is combined with iterative turbo code-spread decoding to yield large ST gains. The performance of the SOTTD system is compared with single- and multiantenna turbo-coded (TC CDTD systems evaluated over a frequency-selective Rayleigh fading channel. The evaluation is done both by means of analysis and computer simulations. The performance results illustrate the superior performance of SOTTD compared to TC CDTD systems over practically the complete useful capacity range of CDMA. It is shown that the performance degradation characteristic of TC CDTD at low system loads (due to the inherent TC error floor is alleviated by the SOTTD system.
DEFF Research Database (Denmark)
Deng, Lei; Pang, Xiaodan; Zhao, Ying
2012-01-01
We propose a spectral efficient radio over wavelength division multiplexed passive optical network (WDM-PON) system by combining optical polarization division multiplexing (PDM) and wireless multiple input multiple output (MIMO) spatial multiplexing techniques. In our experiment, a training-based...
FEATURES OF MULTIPLEXED HOLOGRAMS RECORDING IN PHOTO-THERMO-REFRACTIVE GLASS
Directory of Open Access Journals (Sweden)
S. A. Ivanov
2016-05-01
Full Text Available We have carried out calculations of recording conditions for multiplexed holograms in photo-thermo-refractive (PTR glass. The proposed calculation sets the link between such parameters as: the angle between recording beams and the angle of sample rotation, operating wavelength, the angle of incidence on the element, output angle. To study recording features of multiplexed holograms on PTR glass several elements was made. Six holograms in each element were recorded with various exposures. All samples were heat-treated at one temperature around glass transition temperature. It has been demonstrated that at the recording of several gratings with a total exposure exceeding an optimal value for a given material, the total value of the refractive index modulation amplitude (n1 reaches the maximum attainable magnitude that is equivalent to a value of a single hologram with optimal exposure. It has been found that refractive index dynamic range of the material distributes between the gratings in accordance with the ratio between exposure times if holograms exposures have significant differences. In the present paper six-channel multiplexer was recorded for a wavelength equal to 632.8 nm (He-Ne laser. The diffraction angles correspond to calculations mentioned above. The n1 value in each grating is equal to the value of the highest attainable value of the value of n1 divided by the total number of multiplexed holograms.
SP-100 Position Multiplexer and Analog Input Processor
International Nuclear Information System (INIS)
Syed, A.; Gilliland, K.; Shukla, J.N.
1992-01-01
This paper describes the design, implementation, and performance test results of an engineering model of the Position Multiplexer (MUX)-Analog Input Processor (AIP) System for the transmission and continuous measurements of Reflector Control Drive position in SP-100. This paper describes the work performed to determine the practical circuit limitations, investigate the circuit/component degradation of the multiplexer due to radiation, develop an interference cancellation technique, and evaluate the measurement accuracy as a function of resolver angle, temperature, radiation, and interference. The system developed performs a complex cross-correlation between the resolver excitation and the resolver sine cosine outputs, from which the precise resolver amplitude and phase can be determined while simultaneously eliminating virtually all uncorrelated interference
Design and numerical optimization of a mode multiplexer based on few-mode fiber couplers
International Nuclear Information System (INIS)
Xie, Yiwei; Fu, Songnian; Liu, Hai; Zhang, Hailiang; Tang, Ming; Liu, Deming; Shum, P
2013-01-01
Mode division multiplexing (MDM) transmission based on few-mode fibers (FMFs) appears to be an alternative solution for overcoming the capacity limit of single-mode fibers (SMFs). A FMF coupler-based mode division multiplexer/demultiplexer (MMUX/DeMMUX) is proposed and theoretically investigated after the fabricated FMF is characterized. MMUXs/DeMMUXs with a mode contrast ratio (MCR) of more than 20 dB can be obtained for two-mode multiplexing and three-mode multiplexing over a wavelength span of 60 and 10 nm, respectively. We numerically verify the proposed MMUX/DeMMUX which has the advantages of high MCR, easy fabrication and maintenance, and low wavelength dependence. (paper)
Upconversion Nanoparticles-Encoded Hydrogel Microbeads-Based Multiplexed Protein Detection
Shikha, Swati; Zheng, Xiang; Zhang, Yong
2018-06-01
Fluorescently encoded microbeads are in demand for multiplexed applications in different fields. Compared to organic dye-based commercially available Luminex's xMAP technology, upconversion nanoparticles (UCNPs) are better alternatives due to their large anti-Stokes shift, photostability, nil background, and single wavelength excitation. Here, we developed a new multiplexed detection system using UCNPs for encoding poly(ethylene glycol) diacrylate (PEGDA) microbeads as well as for labeling reporter antibody. However, to prepare UCNPs-encoded microbeads, currently used swelling-based encapsulation leads to non-uniformity, which is undesirable for fluorescence-based multiplexing. Hence, we utilized droplet microfluidics to obtain encoded microbeads of uniform size, shape, and UCNPs distribution inside. Additionally, PEGDA microbeads lack functionality for probe antibodies conjugation on their surface. Methods to functionalize the surface of PEGDA microbeads (acrylic acid incorporation, polydopamine coating) reported thus far quench the fluorescence of UCNPs. Here, PEGDA microbeads surface was coated with silica followed by carboxyl modification without compromising the fluorescence intensity of UCNPs. In this study, droplet microfluidics-assisted UCNPs-encoded microbeads of uniform shape, size, and fluorescence were prepared. Multiple color codes were generated by mixing UCNPs emitting red and green colors at different ratios prior to encapsulation. UCNPs emitting blue color were used to label the reporter antibody. Probe antibodies were covalently immobilized on red UCNPs-encoded microbeads for specific capture of human serum albumin (HSA) as a model protein. The system was also demonstrated for multiplexed detection of both human C-reactive protein (hCRP) and HSA protein by immobilizing anti-hCRP antibodies on green UCNPs.
Al-Eryani, Yasser F.
2018-03-07
In this paper, a multiuser mixed radio frequency (RF) and hybrid free-space optical (FSO)/RF system is considered, where multiple mobile users transmit their data to an intermediate decode-and-forward relay node through RF links using a virtual multiple-input multipleoutput (MIMO) system, and the relay node forwards the multiplexed data of all users through a FSO link that is supported by a RF MIMO backup system to the destination. The relay node is equipped with a buffer in the physical layer for temporal storage of the users\\' data until the best channel conditions at the relay-destination link aremet. For this communication setup, we first propose a transmission protocol that achieves a multiplexing gain through a virtual MIMO system. After that, we derive closed-form expressions for the end-to-end outage probability, asymptotic outage probability, average symbol error rate, and the ergodic capacity when considering the delay-tolerant (finite buffer size) scenario. The results show that buffering in the physical layer provides a significant enhancement to the system performance (outage, error rate, and ergodic capacity). It is also found that pointing error and severe weather turbulence conditions become more tolerable with the existence of the relay\\'s buffer and RF backup link (in the second hop). In addition, the proposed virtual MIMO scheme shows a significant performance enhancement at a high number of receiving antennas, which introduces potential lowcomplexity diversity gain-based massive MIMO schemes.
Al-Eryani, Yasser F.; Salhab, Anas; Zummo, Salam A.; Alouini, Mohamed-Slim
2018-01-01
In this paper, a multiuser mixed radio frequency (RF) and hybrid free-space optical (FSO)/RF system is considered, where multiple mobile users transmit their data to an intermediate decode-and-forward relay node through RF links using a virtual multiple-input multipleoutput (MIMO) system, and the relay node forwards the multiplexed data of all users through a FSO link that is supported by a RF MIMO backup system to the destination. The relay node is equipped with a buffer in the physical layer for temporal storage of the users' data until the best channel conditions at the relay-destination link aremet. For this communication setup, we first propose a transmission protocol that achieves a multiplexing gain through a virtual MIMO system. After that, we derive closed-form expressions for the end-to-end outage probability, asymptotic outage probability, average symbol error rate, and the ergodic capacity when considering the delay-tolerant (finite buffer size) scenario. The results show that buffering in the physical layer provides a significant enhancement to the system performance (outage, error rate, and ergodic capacity). It is also found that pointing error and severe weather turbulence conditions become more tolerable with the existence of the relay's buffer and RF backup link (in the second hop). In addition, the proposed virtual MIMO scheme shows a significant performance enhancement at a high number of receiving antennas, which introduces potential lowcomplexity diversity gain-based massive MIMO schemes.
NIST mixed stain study 3: signal intensity balance in commercial short tandem repeat multiplexes.
Duewer, David L; Kline, Margaret C; Redman, Janette W; Butler, John M
2004-12-01
Short-tandem repeat (STR) allelic intensities were collected from more than 60 forensic laboratories for a suite of seven samples as part of the National Institute of Standards and Technology-coordinated 2001 Mixed Stain Study 3 (MSS3). These interlaboratory challenge data illuminate the relative importance of intrinsic and user-determined factors affecting the locus-to-locus balance of signal intensities for currently used STR multiplexes. To varying degrees, seven of the eight commercially produced multiplexes used by MSS3 participants displayed very similar patterns of intensity differences among the different loci probed by the multiplexes for all samples, in the hands of multiple analysts, with a variety of supplies and instruments. These systematic differences reflect intrinsic properties of the individual multiplexes, not user-controllable measurement practices. To the extent that quality systems specify minimum and maximum absolute intensities for data acceptability and data interpretation schema require among-locus balance, these intrinsic intensity differences may decrease the utility of multiplex results and surely increase the cost of analysis.
Energy Technology Data Exchange (ETDEWEB)
Perkins, J; Parida, S; Clavijo, A
2007-05-14
Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.
International Nuclear Information System (INIS)
Dobrzynski, L; Akjouj, A; Djafari-Rouhani, B; Al-Wahsh, H; Zielinski, P
2003-01-01
We present a simple multiplexing device made of two atomic chains coupled by two other transition metal atoms. We show that this simple atomic device can transfer electrons at a given energy from one wire to the other, leaving all other electron states unaffected. Closed-form relations between the transmission coefficients and the inter-atomic distances are given to optimize the desired directional electron ejection. Such devices can be adsorbed on insulating substrates and characterized by current surface technologies. (letter to the editor)
Packaged mode multiplexer based on silicon photonics
Chen, H.; Koonen, A.M.J.; Snyder, B.; Raz, O.; Boom, van den H.P.A.; Chen, X.
2012-01-01
A silicon photonics based mode multiplexer is proposed. Four chirped grating couplers structure can support all 6 channels in a two-mode fiber and realize LP01 and LP11 mode selective exciting. The packaged device is tested.
Design and Performance of Cyclic Delay Diversity in UWB-OFDM Systems
Directory of Open Access Journals (Sweden)
Tarasak Poramate
2008-01-01
Full Text Available This paper addresses cyclic delay diversity (CDD in an ultra-wideband communication system based on orthogonal frequency division multiplexing (OFDM technique. Symbol error rate and outage probability have been derived. It is shown that with only two transmit antennas, CDD effectively improves SER performance and reduces outage probability significantly especially when the channel delay spread is short. Both simulation and analytical results agree well in all considered cases. The selection of delay times for CDD is also addressed for some special cases.
Dynamical Interplay between Awareness and Epidemic Spreading in Multiplex Networks
Granell, Clara; Gómez, Sergio; Arenas, Alex
2013-09-01
We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.
Dynamical interplay between awareness and epidemic spreading in multiplex networks.
Granell, Clara; Gómez, Sergio; Arenas, Alex
2013-09-20
We present the analysis of the interrelation between two processes accounting for the spreading of an epidemic, and the information awareness to prevent its infection, on top of multiplex networks. This scenario is representative of an epidemic process spreading on a network of persistent real contacts, and a cyclic information awareness process diffusing in the network of virtual social contacts between the same individuals. The topology corresponds to a multiplex network where two diffusive processes are interacting affecting each other. The analysis using a microscopic Markov chain approach reveals the phase diagram of the incidence of the epidemics and allows us to capture the evolution of the epidemic threshold depending on the topological structure of the multiplex and the interrelation with the awareness process. Interestingly, the critical point for the onset of the epidemics has a critical value (metacritical point) defined by the awareness dynamics and the topology of the virtual network, from which the onset increases and the epidemics incidence decreases.
Characterization of highly multiplexed monolithic PET / gamma camera detector modules
DEFF Research Database (Denmark)
Pierce, L. A.; Pedemonte, Stefano; Dewitt, Sharon
2018-01-01
tube with 8 × 8 position-outputs and one channel that is the sum of the other 64. The 65-channel signal was multiplexed in a resistive circuit, with 65:5 or 65:7 multiplexing. A 0.9 mm beam of 511 keV photons was scanned across the face of the crystal in a 1.52 mm grid pattern in order to characterize...... and scatter-rejection capabilities of the detector were analyzed. We found that using a 7-channel multiplexing scheme (65:7 compression ratio) with 1.67 mm depth bins had the best performance with a beam-contour of 1.2 mm FWHM (from the 0.9 mm beam) near the center of the crystal and 1.9 mm FWHM near the edge...... the detector response. New methods are developed to reject scattered events and perform depthestimation to characterize the detector response of the calibration data. Photon interaction position estimation of the testing data was performed using a Gaussian Maximum Likelihood estimator and the resolution...
Mujeeb, Farina; Bajpai, Preeti; Pathak, Neelam; Verma, Smita Rastogi
2017-01-01
Inter simple sequence repeat (ISSR) markers help in identifying and determining the extent of genetic diversity in cultivars. Here, we describe their application in determining the genetic diversity of bael (Aegle marmelos Corr.). Universal ISSR primers are selected and their marker characteristics such as polymorphism information content, effective multiplex ratio and marker index have been evaluated. ISSR-PCR is then performed using universal ISSR primers to generate polymorphic bands. This information is used to determine the degree of genetic similarity among the bael varieties/accessions by cluster analysis using unweighted pair-group method with arithmetic averages (UPGMA). This technology is valuable for biodiversity conservation and for making an efficient choice of parents in breeding programs.
Dye gain gold NW array of surface plasmon polariton waveguide
Directory of Open Access Journals (Sweden)
Jun Zhu
Full Text Available Plasmon lasers can support ultrasmall mode confinement and ultrafast dynamics with device feature sizes below the diffraction limit. At present in the single visible light frequency, the optical gain method of constraint SPP on metal nanowires structure reported less. We design the gold nanowire array structure, consisting of PMMA and R6G dye molecules as gain, by 488 nm pump in the middle of the nanowires position for wide range of light, use symmetry broken overcome that momentum does not match the photonic and SPP energy conversion. Theoretical analysis shows that dyes provide coherent optical feedback, resulting in nanowires face will observe laser properties of surface plasmons. Feature analysis: the incident light and pump joint strength is greater than the sum of strength which is the incident light, pump respectively. Under the effect of dye molecules gain effective, length of SPP transmission can increase 1 µm. The results achieved in a single optical frequency of stimulated radiation, application of dye optical gain can achieve continuous gain effect. This is for the future development of plasma amplifier and the wavelength laser. Keywords: SPP, Stimulated radiation, Gold nanowires array, Dye molecules
Murshid, Syed; Alanzi, Saud; Hridoy, Arnob; Lovell, Gregory L.; Parhar, Gurinder; Chakravarty, Abhijit; Chowdhury, Bilas
2016-06-01
Spatial domain multiplexing/space division multiplexing (SDM) can increase the bandwidth of existing and futuristic optical fibers by an order of magnitude or more. In the SDM technique, we launch multiple single-mode pigtail laser sources of the same wavelength into a carrier multimode fiber at different angles. The launching angles decide the output of the carrier fiber by allocating separate spatial locations for each channel. Each channel follows a helical trajectory while traversing the length of the carrier fiber, thereby allowing spatial reuse of optical frequencies. We launch light from five different single-mode pigtail laser sources (of same wavelength) at different angles (with respect to the axis of the carrier fiber) into the carrier fiber. Owing to helical propagation, five distinct concentric donut-shaped rings with negligible crosstalk at the output end of the fiber were obtained. These SDM channels also exhibit orbital angular momentum (OAM), thereby adding an extradegree of photon freedom. We present the experimental data of five spatially multiplexed channels and compare them with simulated results to show that this technique can potentially improve the data capacity of optical fibers by an order of magnitude: A factor of five using SDM and another factor of two using OAM.
Design and synthesis of diverse functional kinked nanowire structures for nanoelectronic bioprobes.
Xu, Lin; Jiang, Zhe; Qing, Quan; Mai, Liqiang; Zhang, Qingjie; Lieber, Charles M
2013-02-13
Functional kinked nanowires (KNWs) represent a new class of nanowire building blocks, in which functional devices, for example, nanoscale field-effect transistors (nanoFETs), are encoded in geometrically controlled nanowire superstructures during synthesis. The bottom-up control of both structure and function of KNWs enables construction of spatially isolated point-like nanoelectronic probes that are especially useful for monitoring biological systems where finely tuned feature size and structure are highly desired. Here we present three new types of functional KNWs including (1) the zero-degree KNW structures with two parallel heavily doped arms of U-shaped structures with a nanoFET at the tip of the "U", (2) series multiplexed functional KNW integrating multi-nanoFETs along the arm and at the tips of V-shaped structures, and (3) parallel multiplexed KNWs integrating nanoFETs at the two tips of W-shaped structures. First, U-shaped KNWs were synthesized with separations as small as 650 nm between the parallel arms and used to fabricate three-dimensional nanoFET probes at least 3 times smaller than previous V-shaped designs. In addition, multiple nanoFETs were encoded during synthesis in one of the arms/tip of V-shaped and distinct arms/tips of W-shaped KNWs. These new multiplexed KNW structures were structurally verified by optical and electron microscopy of dopant-selective etched samples and electrically characterized using scanning gate microscopy and transport measurements. The facile design and bottom-up synthesis of these diverse functional KNWs provides a growing toolbox of building blocks for fabricating highly compact and multiplexed three-dimensional nanoprobes for applications in life sciences, including intracellular and deep tissue/cell recordings.
16-channel analog store and multiplexer unit
Energy Technology Data Exchange (ETDEWEB)
Brossard, M; Kulka, Z [Clermont-Ferrand-2 Univ., 63 - Aubiere (France). Lab. de Physique Corpusculaire
1979-03-15
A 16-channel analog store and multiplexer unit is described. The unit enables storing and selection of analog information which is then digitally encoded by single ADC. This solution becomes economically attractive particularly in multidetector pulse height analysis systems.
Chen, H.; Uden, van R.G.H.; Okonkwo, C.M.; Jung, Y.; Wheeler, N.V.; Fokoua, E.N.; Baddela, N.; Petrovich, M.N.; Poletti, F.; Richardson, D.J.; Raz, O.; Waardt, de H.; Koonen, A.M.J.
2014-01-01
A photonic integrated mode coupler based on silicon-on-insulator is employed for mode division multiplexing (MDM) over a 193 m 19-cell hollow-core photonic bandgap fibre (HC-PBGF) with a -3 dB bandwidth >120 nm. Robust MDM transmissions using LP01 and LP11 modes, and two degenerate LP11 modes (LP11a
Demonstration of an 8 × 25-Gb/s optical time-division multiplexing system
Wang, Dong; Huo, Li; Li, Yunbo; Wang, Lei; Li, Han; Jiang, Xiangyu; Chen, Xin; Lou, Caiyun
2017-11-01
An 8 × 25-Gb/s optical time-division multiplexing (OTDM) system is demonstrated experimentally. The optical pulse source is based on optical frequency comb (OFC) generation and pulse shaping, which can generate nearly chirp-free 25-GHz 1.6-ps optical Gaussian pulse. The eightfold optical time-division demultiplexer consists of a single-driven dual-parallel Mach-Zehnder modulator (DPMZM) and a Mamyshev reshaper. Error-free demultiplexing of 8 × 25-Gb/s back-to-back (B2B) signal with a power penalty of 4.1 dB to 4.4 dB at a bit error rate (BER) of 10-9 is achieved to confirm the performance of the proposed system.
Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan
2013-05-01
This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.
High dynamic range image acquisition based on multiplex cameras
Zeng, Hairui; Sun, Huayan; Zhang, Tinghua
2018-03-01
High dynamic image is an important technology of photoelectric information acquisition, providing higher dynamic range and more image details, and it can better reflect the real environment, light and color information. Currently, the method of high dynamic range image synthesis based on different exposure image sequences cannot adapt to the dynamic scene. It fails to overcome the effects of moving targets, resulting in the phenomenon of ghost. Therefore, a new high dynamic range image acquisition method based on multiplex cameras system was proposed. Firstly, different exposure images sequences were captured with the camera array, using the method of derivative optical flow based on color gradient to get the deviation between images, and aligned the images. Then, the high dynamic range image fusion weighting function was established by combination of inverse camera response function and deviation between images, and was applied to generated a high dynamic range image. The experiments show that the proposed method can effectively obtain high dynamic images in dynamic scene, and achieves good results.
Gain optimization method of a DQW superluminescent diode with broad multi-state emission
Dimas, Clara E.
2010-01-01
Optimizing gain through systematic methods of varying current injection schemes analytically is significant to maximize experimentally device yield and evaluation. Various techniques are used to calculate the amplified spontaneous emission (ASE) gain for light emitting devices consisting of single-section and multiple-sections of even length. Recently double quantum well (DQW) superluminescent diodes (SLD) have shown a broad multi-state emission due to mutlielectrodes of non-equal lengths and at high non-equal current densities. In this study, we adopt an improved method utilizing an ASE intensity ratio to calibrate a gain curve based on the sum of the measured ASE spectra to efficiently estimate the gain. Although the laser gain for GaAs/AlGaAs material is well studied, the ASE gain of SLD devices has not been systematically studied particular to further explain the multiple-state emission observed in fabricated devices. In addition a unique gain estimate was achieved where the excited state gain clamps prior to the ground state due to approaching saturation levels. In our results, high current densities in long sectioned active regions achieved sufficient un-truncated gain that show evidence of excited state emission has been observed.
Front-end multiplexing—applied to SQUID multiplexing: Athena X-IFU and QUBIC experiments
Prele, D.
2015-08-01
As we have seen for digital camera market and a sensor resolution increasing to "megapixels", all the scientific and high-tech imagers (whatever the wave length - from radio to X-ray range) tends also to always increases the pixels number. So the constraints on front-end signals transmission increase too. An almost unavoidable solution to simplify integration of large arrays of pixels is front-end multiplexing. Moreover, "simple" and "efficient" techniques allow integration of read-out multiplexers in the focal plane itself. For instance, CCD (Charge Coupled Device) technology has boost number of pixels in digital camera. Indeed, this is exactly a planar technology which integrates both the sensors and a front-end multiplexed readout. In this context, front-end multiplexing techniques will be discussed for a better understanding of their advantages and their limits. Finally, the cases of astronomical instruments in the millimeter and in the X-ray ranges using SQUID (Superconducting QUantum Interference Device) will be described.
Front-end multiplexing—applied to SQUID multiplexing: Athena X-IFU and QUBIC experiments
International Nuclear Information System (INIS)
Prele, D.
2015-01-01
As we have seen for digital camera market and a sensor resolution increasing to 'megapixels', all the scientific and high-tech imagers (whatever the wave length - from radio to X-ray range) tends also to always increases the pixels number. So the constraints on front-end signals transmission increase too. An almost unavoidable solution to simplify integration of large arrays of pixels is front-end multiplexing. Moreover, 'simple' and 'efficient' techniques allow integration of read-out multiplexers in the focal plane itself. For instance, CCD (Charge Coupled Device) technology has boost number of pixels in digital camera. Indeed, this is exactly a planar technology which integrates both the sensors and a front-end multiplexed readout. In this context, front-end multiplexing techniques will be discussed for a better understanding of their advantages and their limits. Finally, the cases of astronomical instruments in the millimeter and in the X-ray ranges using SQUID (Superconducting QUantum Interference Device) will be described
Directory of Open Access Journals (Sweden)
Gerardo Marti
2015-09-01
Full Text Available The concept of ethnic transcendence—defined as the process of co-formulating a shared religious identity among diverse members that supersedes their racial and ethnic differences through congregational involvement—captures a critical aspect of successfully integrating different racial and ethnic groups into a single, commonly shared, multi-ethnic congregation. Drawing on classic theoretical resources from Max Weber and Emile Durkheim, this paper expands on previous scholarship by conceptually articulating two different paths for the achievement of ethnic transcendence in multiracial congregations. In the first path, ethnic transcendence supports and encourages congregational diversification by inspiring members and mobilizing them to contribute their efforts to accomplish a common religious mission. In the second path, the achievement of ethnic transcendence involves the sublimation of congregational members’ religious selves to an overarching moral collective. Both paths involve privileging religious identities in favor of a particularistic ethnic or racial identity. Moreover, through both paths, the development of congregationally specific religious identities results in joining with co-members of different ethno-racial ancestries as a type of spiritually-derived kinship. Due to the fact that ethnic transcendence is an interactive process, congregational diversity is a bi-directional phenomenon representing the extent to which members allow for the integration of separate ethnicities/races into a common congregation through idealized and richly-symbolic notions of connection and belonging to a congregation. Overall, this paper suggests a heuristic framework that productively expands the concept of ethnic transcendence, allows an approach for observing cross-ethnic/inter-racial organizational processes, and ultimately contributes toward understanding how congregations (whether church, temple, or mosque pursue alternative identity
Directory of Open Access Journals (Sweden)
Zhi Wan
Full Text Available Multiplex serological immunoassays, such as implemented on microarray or microsphere-based platforms, provide greater information content and higher throughput, while lowering the cost and blood volume required. These features are particularly attractive in pediatric food allergy testing to facilitate high throughput multi-allergen analysis from finger- or heel-stick collected blood. However, the miniaturization and microfluidics necessary for creating multiplex assays make them highly susceptible to the "matrix effect" caused by interference from non-target agents in serum and other biofluids. Such interference can result in lower sensitivity, specificity, reproducibility and quantitative accuracy. These problems have in large part prevented wide-spread implementation of multiplex immunoassays in clinical laboratories. We report the development of a novel method to eliminate the matrix effect by utilizing photocleavable capture antibodies to purify and concentrate blood-based biomarkers (a process termed PC-PURE prior to detection in a multiplex immunoassay. To evaluate this approach, it was applied to blood-based allergy testing. Patient total IgE was purified and enriched using PC-PURE followed by multiplex microsphere-based detection of allergen-specific IgEs (termed the AllerBead assay. AllerBead was formatted to detect the eight most common pediatric food allergens: milk, soy, wheat, egg, peanuts, tree nuts, fin fish and shellfish, which account for >90% of all pediatric food allergies. 205 serum samples obtained from Boston Children's Hospital were evaluated. When PC-PURE was employed with AllerBead, excellent agreement was obtained with the standard, non-multiplex, ImmunoCAP® assay (average sensitivity above published negative predictive cutoffs = 96% and average Pearson r = 0.90; average specificity = 97%. In contrast, poor ImmunoCAP®-correlation was observed when PC-PURE was not utilized (average sensitivity above published negative
All-Optical Regeneration System for Optical Wavelength Division Multiplexed Communication Systems
DEFF Research Database (Denmark)
2014-01-01
The invention relates to an all-optical regeneration system for regeneration of optical wavelength division multiplexed WDM data signals in an optical WDM communication system. The system comprises a WDM-to-Optical time domain multiplexing OTDM, WDM-to-OTDM, converter, capable of converting....... The system additionally comprises an OTDM-to-WDM converter for converting the output OTDM data signal to an output WDM data signal. An input of the all-optical regenerator unit is in optical communication with an output of the WDM-to-OTDM converter, and an output of the all-optical regenerator unit...... an input WDM data signal comprising multiple wavelength channels into an input OTDM data signal comprising multiple time multiplexed time channels. The system further comprises an all-optical regenerator unit being configured for regenerating the input OTDM data signal into an output OTDM data signal...
Multiplex engineering of industrial yeast genomes using CRISPRm.
Ryan, Owen W; Cate, Jamie H D
2014-01-01
Global demand has driven the use of industrial strains of the yeast Saccharomyces cerevisiae for large-scale production of biofuels and renewable chemicals. However, the genetic basis of desired domestication traits is poorly understood because robust genetic tools do not exist for industrial hosts. We present an efficient, marker-free, high-throughput, and multiplexed genome editing platform for industrial strains of S. cerevisiae that uses plasmid-based expression of the CRISPR/Cas9 endonuclease and multiple ribozyme-protected single guide RNAs. With this multiplex CRISPR (CRISPRm) system, it is possible to integrate DNA libraries into the chromosome for evolution experiments, and to engineer multiple loci simultaneously. The CRISPRm tools should therefore find use in many higher-order synthetic biology applications to accelerate improvements in industrial microorganisms.
GAIN Technology Workshops Summary Report
Energy Technology Data Exchange (ETDEWEB)
Braase, Lori Ann [Idaho National Lab. (INL), Idaho Falls, ID (United States)
2016-08-01
National and global demand for nuclear energy is increasing and United States (U.S.) global leadership is eroding. There is a sense of urgency with respect to the deployment of the innovative nuclear energy technologies. The Gateway for Accelerated Innovation in Nuclear (GAIN) initiative is based on the simultaneous achievement of three strategic goals. The first is maintaining global technology leadership within the U.S. Department of Energy (DOE). The second is enabling global industrial leadership for nuclear vendors and suppliers. The third is focused on utility optimization of nuclear energy within the clean energy portfolio. An effective public-private partnership is required to achieve these goals. DOEs recognizes the recent sense of urgency new developers and investors have in getting their concepts to market. They know that time to market for nuclear technology takes too long and the facilities needed to conduct the necessary research, development and demonstration (RD&D) activities are very expensive to develop and maintain. Early technologies, in the lower technology readiness levels (TRL) need materials testing, analysis, modeling, code development, etc., most of which currently exists in the DOE national laboratory system. However, mature technologies typically need large component testing and demonstration facilities, which are expensive and long-lead efforts. By understanding the needs of advanced nuclear technology developers, GAIN will connect DOE national laboratory capabilities (e.g., facilities, expertise, materials, and data) with industry RD&D needs. In addition, GAIN is working with the Nuclear Regulatory Commission (NRC) to streamline processes and increase understanding of the licensing requirements for advanced reactors.
GAIN Technology Workshops Summary Report
International Nuclear Information System (INIS)
Braase, Lori Ann
2016-01-01
National and global demand for nuclear energy is increasing and United States (U.S.) global leadership is eroding. There is a sense of urgency with respect to the deployment of the innovative nuclear energy technologies. The Gateway for Accelerated Innovation in Nuclear (GAIN) initiative is based on the simultaneous achievement of three strategic goals. The first is maintaining global technology leadership within the U.S. Department of Energy (DOE). The second is enabling global industrial leadership for nuclear vendors and suppliers. The third is focused on utility optimization of nuclear energy within the clean energy portfolio. An effective public-private partnership is required to achieve these goals. DOEs recognizes the recent sense of urgency new developers and investors have in getting their concepts to market. They know that time to market for nuclear technology takes too long and the facilities needed to conduct the necessary research, development and demonstration (RD&D) activities are very expensive to develop and maintain. Early technologies, in the lower technology readiness levels (TRL) need materials testing, analysis, modeling, code development, etc., most of which currently exists in the DOE national laboratory system. However, mature technologies typically need large component testing and demonstration facilities, which are expensive and long-lead efforts. By understanding the needs of advanced nuclear technology developers, GAIN will connect DOE national laboratory capabilities (e.g., facilities, expertise, materials, and data) with industry RD&D needs. In addition, GAIN is working with the Nuclear Regulatory Commission (NRC) to streamline processes and increase understanding of the licensing requirements for advanced reactors.
Energy Technology Data Exchange (ETDEWEB)
Maphosa, F.; Doorn, R. van; Vos, W. de; Cor Schoen, C.; Smidt, H.
2009-07-01
Bioremediation management strategies for sites contaminated with chlorinated compounds require monitoring technologies that enable simultaneous detection and quantification of a wide range of microorganisms involved in reductive dechlorination. Many multiplex, quantitative detection methods available suffer from compromises between the level of multiplexing, throughput and accuracy of quantification. (Author)
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Ecological multiplex interactions determine the role of species for parasite spread amplification.
Stella, Massimo; Selakovic, Sanja; Antonioni, Alberto; Andreazzi, Cecilia
2018-04-23
Despite their potential interplay, multiple routes of many disease transmissions are often investigated separately. As an unifying framework for understanding parasite spread through interdependent transmission paths, we present the 'ecomultiplex' model, where the multiple transmission paths among a diverse community of interacting hosts are represented as a spatially explicit multiplex network. We adopt this framework for designing and testing potential control strategies for T. cruzi spread in two empirical host communities. We show that the ecomultiplex model is an efficient and low data-demanding method to identify which species enhances parasite spread and should thus be a target for control strategies. We also find that the interplay between predator-prey and host-parasite interactions leads to a phenomenon of parasite amplification, in which top predators facilitate T. cruzi spread, offering a mechanistic interpretation of previous empirical findings. Our approach can provide novel insights in understanding and controlling parasite spreading in real-world complex systems. © 2018, Stella et al.
Authentication of Meat Species in Sucuk by Multiplex PCR
Directory of Open Access Journals (Sweden)
Osman İrfan İLHAK
2015-01-01
Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.
Evolution of cooperation under social pressure in multiplex networks.
Pereda, María
2016-09-01
In this work, we aim to contribute to the understanding of human prosocial behavior by studying the influence that a particular form of social pressure, "being watched," has on the evolution of cooperative behavior. We study how cooperation emerges in multiplex complex topologies by analyzing a particular bidirectionally coupled dynamics on top of a two-layer multiplex network (duplex). The coupled dynamics appears between the prisoner's dilemma game in a network and a threshold cascade model in the other. The threshold model is intended to abstract the behavior of a network of vigilant nodes that impose the pressure of being observed altering hence the temptation to defect of the dilemma. Cooperation or defection in the game also affects the state of a node of being vigilant. We analyze these processes on different duplex networks structures and assess the influence of the topology, average degree and correlated multiplexity, on the outcome of cooperation. Interestingly, we find that the social pressure of vigilance may impact cooperation positively or negatively, depending on the duplex structure, specifically the degree correlations between layers is determinant. Our results give further quantitative insights in the promotion of cooperation under social pressure.
Directory of Open Access Journals (Sweden)
Meher Krishna Patel
2017-01-01
Full Text Available This paper presents an adaptive multiuser transceiver scheme for DS-CDMA systems in which pilot symbols are added to users’ data to estimate complex channel fading coefficients. The performance of receiver antenna diversity with maximal ratio combining (MRC technique is analyzed for imperfect channel estimation in flat fading environments. The complex fading coefficients are estimated using least mean square (LMS algorithm and these coefficients are utilized by the maximal ratio combiner for generating the decision variable. Probability of error in closed form is derived. Further, the effect of pilot signal power on bit error rate (BER and BER performance of multiplexed pilot and data signal transmission scenario are investigated. We have compared the performance of added and multiplexed pilot-data systems and concluded the advantages of both systems. The proposed CDMA technique uses the chaotic sequence as spreading sequence. Assuming proper synchronization, the computer simulation results demonstrate the better bit error rate performance in the presence of channel estimator in the chaotic based CDMA system and the receiver antenna diversity technique further improves the performance of the proposed system. Also, no channel estimator is required if there is no phase distortion to the transmitted signal.
Mohajerin-Ariaei, Amirhossein; Ziyadi, Morteza; Chitgarha, Mohammad Reza; Almaiman, Ahmed; Cao, Yinwen; Shamee, Bishara; Yang, Jeng-Yuan; Akasaka, Youichi; Sekiya, Motoyoshi; Takasaka, Shigehiro; Sugizaki, Ryuichi; Touch, Joseph D; Tur, Moshe; Langrock, Carsten; Fejer, Martin M; Willner, Alan E
2015-07-15
We demonstrate an all-optical phase noise mitigation scheme based on the generation, delay, and coherent summation of higher order signal harmonics. The signal, its third-order harmonic, and their corresponding delayed variant conjugates create a staircase phase-transfer function that quantizes the phase of quadrature-phase-shift-keying (QPSK) signal to mitigate phase noise. The signal and the harmonics are automatically phase-locked multiplexed, avoiding the need for phase-based feedback loop and injection locking to maintain coherency. The residual phase noise converts to amplitude noise in the quantizer stage, which is suppressed by parametric amplification in the saturation regime. Phase noise reduction of ∼40% and OSNR-gain of ∼3 dB at BER 10(-3) are experimentally demonstrated for 20- and 30-Gbaud QPSK input signals.
ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.
Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R
2018-03-09
Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.
Multiplex serology of paraneoplastic antineuronal antibodies.
Maat, Peter; Brouwer, Eric; Hulsenboom, Esther; VanDuijn, Martijn; Schreurs, Marco W J; Hooijkaas, Herbert; Smitt, Peter A E Sillevis
2013-05-31
Paraneoplastic neurological syndromes (PNS) are devastating neurological disorders secondary to cancer, associated with onconeural autoantibodies. Such antibodies are directed against neuronal antigens aberrantly expressed by the tumor. The detection of onconeural antibodies in a patient is extremely important in diagnosing a neurological syndrome as paraneoplastic (70% is not yet known to have cancer) and in directing the search for the underlying neoplasm. At present six onconeural antibodies are considered 'well characterized' and recognize the antigens HuD, CDR62 (Yo), amphiphysin, CRMP-5 (CV2), NOVA-1 (Ri), and Ma2. The gold standard of detection is the characteristic immunohistochemical staining pattern on brain tissue sections combined with confirmation by immunoblotting using recombinant purified proteins. Since all six onconeural antibodies are usually analyzed simultaneously and objective cut-off values for these analyses are warranted, we developed a multiplex assay based on Luminex technology. Reaction of serial dilutions of six onconeural standard sera with microsphere-bound antigens showed lower limits of detection than with Western blotting. Using the six standard sera at a dilution of 1:200, the average within-run coefficient of variation (CV) was 4% (range 1.9-7.3%). The average between-run within-day CV was 5.1% (range 2.9-6.7%) while the average between-day CV was 8.1% (range 2.8-11.6%). The shelf-life of the antigen coupled microspheres was at least two months. The sensitivity of the multiplex assay ranged from 83% (Ri) to 100% (Yo, amphiphysin, CV2) and the specificity from 96% (CV2) to 100% (Ri). In conclusion, Luminex-based multiplex serology is highly reproducible with high sensitivity and specificity for the detection of onconeural antibodies. Conventional immunoblotting for diagnosis of onconeural antibodies in the setting of a routine laboratory may be replaced by this novel, robust technology. Copyright © 2013 Elsevier B.V. All rights
Highly efficient volume hologram multiplexing in thick dye-doped jelly-like gelatin.
Katarkevich, Vasili M; Rubinov, Anatoli N; Efendiev, Terlan Sh
2014-08-01
Dye-doped jelly-like gelatin is a thick-layer self-developing photosensitive medium that allows single and multiplexed volume phase holograms to be successfully recorded using pulsed laser radiation. In this Letter, we present a method for multiplexed recording of volume holograms in a dye-doped jelly-like gelatin, which provides significant increase in their diffraction efficiency. The method is based on the recovery of the photobleached dye molecule concentration in the hologram recording zone of gel, thanks to molecule diffusion from other unexposed gel areas. As an example, an optical recording of a multiplexed hologram consisting of three superimposed Bragg gratings with mean values of the diffraction efficiency and angular selectivity of ∼75% and ∼21', respectively, is demonstrated by using the proposed method.
A high-throughput multiplex method adapted for GMO detection.
Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique
2008-12-24
A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.
Non-identical multiplexing promotes chimera states
Ghosh, Saptarshi; Zakharova, Anna; Jalan, Sarika
2018-01-01
We present the emergence of chimeras, a state referring to coexistence of partly coherent, partly incoherent dynamics in networks of identical oscillators, in a multiplex network consisting of two non-identical layers which are interconnected. We demonstrate that the parameter range displaying the chimera state in the homogeneous first layer of the multiplex networks can be tuned by changing the link density or connection architecture of the same nodes in the second layer. We focus on the impact of the interconnected second layer on the enlargement or shrinking of the coupling regime for which chimeras are displayed in the homogeneous first layer. We find that a denser homogeneous second layer promotes chimera in a sparse first layer, where chimeras do not occur in isolation. Furthermore, while a dense connection density is required for the second layer if it is homogeneous, this is not true if the second layer is inhomogeneous. We demonstrate that a sparse inhomogeneous second layer which is common in real-world complex systems can promote chimera states in a sparse homogeneous first layer.
A micro-controlled universal message multiplexer
International Nuclear Information System (INIS)
Fontaine, G.; Guglielmi, L.; Jaeger, J.J.; Szafran, S.
1981-01-01
Based on the Motorola 6800, this multiplexer is designed to provide a microprocessor development tool in the specific environment of a high energy physics laboratory. The basic philosophy of this device is to allow communication of a target (prototype) processor with a host computer under control of a human operator. The host can be an experimental on-line computer or any remote machine with a time-sharing network. It is thus possible to speed up design and debugging of a physics application program by taking advantage of the sophisticated resources usually available in a computer centre (powerful editor, large disk space, source management via ''Patchy'' etc...). In addition to the classical cross-macroassembler, a loader is available on the host for down-line loading binary code, via the multiplexer, into the prototype memory. Such a scheme is easiextended to the communication of any host interactive processing program with a data acquisition microprocessor, and provides the latter with a convenient and easily portable extension of its computing power. A typical application of this mode is described in a separate paper
Multiplexing of adjacent vortex modes with the forked grating coupler
Nadovich, Christopher T.; Kosciolek, Derek J.; Crouse, David T.; Jemison, William D.
2017-08-01
For vortex fiber multiplexing to reach practical commercial viability, simple silicon photonic interfaces with vortex fiber will be required. These interfaces must support multiplexing. Toward this goal, an efficient singlefed multimode Forked Grating Coupler (FGC) for coupling two different optical vortex OAM charges to or from the TE0 and TE1 rectangular waveguide modes has been developed. A simple, apodized device implemented with e-beam lithography and a conventional dual-etch processing on SOI wafer exhibits low crosstalk and reasonable mode match. Advanced designs using this concept are expected to further improve performance.
Full-diversity partial interference cancellation for multi-user wireless relaying networks
El Astal, M. T O
2013-12-01
We focus on the uplink channel of multi-user wireless relaying networks in a coverage extension scenario. The network consists of two users, a single half duplex (HD) relay and a destination, all equipped with multiple antennas. Perfect channel state information (CSI) is assumed to be available exclusively at the receiving nodes (i.e., the relay and the destination) while the users are assumed to be completely blind. The communication through the considered network takes place over two phases. During the first phase, both users send their information concurrently to the relay. The second phase consists of decoding the received data and forwarding it simultaneously to the destination. A transmission scheme that achieves full-diversity under partial interference cancellation (PIC) group decoding is proposed. Unlike many existing schemes, it allows the concurrent transmission in both phases while achieving the full-diversity gain of full time division multiple access (TDMA) transmission regardless of the number of antennas at each node. Numerical comparison with existing schemes in the literature is provided to corroborate our theoretical claims. It is found that our interference cancellation (IC) scheme clearly outperforms existing schemes at the expense of an affordable increase in decoding complexity at both of the relay and destination. © 2013 IEEE.
Full-diversity partial interference cancellation for multi-user wireless relaying networks
El Astal, M. T O; Ismail, Amr; Alouini, Mohamed-Slim; Olivier, Jan Corné
2013-01-01
We focus on the uplink channel of multi-user wireless relaying networks in a coverage extension scenario. The network consists of two users, a single half duplex (HD) relay and a destination, all equipped with multiple antennas. Perfect channel state information (CSI) is assumed to be available exclusively at the receiving nodes (i.e., the relay and the destination) while the users are assumed to be completely blind. The communication through the considered network takes place over two phases. During the first phase, both users send their information concurrently to the relay. The second phase consists of decoding the received data and forwarding it simultaneously to the destination. A transmission scheme that achieves full-diversity under partial interference cancellation (PIC) group decoding is proposed. Unlike many existing schemes, it allows the concurrent transmission in both phases while achieving the full-diversity gain of full time division multiple access (TDMA) transmission regardless of the number of antennas at each node. Numerical comparison with existing schemes in the literature is provided to corroborate our theoretical claims. It is found that our interference cancellation (IC) scheme clearly outperforms existing schemes at the expense of an affordable increase in decoding complexity at both of the relay and destination. © 2013 IEEE.
A multiplexable TALE-based binary expression system for in vivo cellular interaction studies.
Toegel, Markus; Azzam, Ghows; Lee, Eunice Y; Knapp, David J H F; Tan, Ying; Fa, Ming; Fulga, Tudor A
2017-11-21
Binary expression systems have revolutionised genetic research by enabling delivery of loss-of-function and gain-of-function transgenes with precise spatial-temporal resolution in vivo. However, at present, each existing platform relies on a defined exogenous transcription activator capable of binding a unique recognition sequence. Consequently, none of these technologies alone can be used to simultaneously target different tissues or cell types in the same organism. Here, we report a modular system based on programmable transcription activator-like effector (TALE) proteins, which enables parallel expression of multiple transgenes in spatially distinct tissues in vivo. Using endogenous enhancers coupled to TALE drivers, we demonstrate multiplexed orthogonal activation of several transgenes carrying cognate variable activating sequences (VAS) in distinct neighbouring cell types of the Drosophila central nervous system. Since the number of combinatorial TALE-VAS pairs is virtually unlimited, this platform provides an experimental framework for highly complex genetic manipulation studies in vivo.
The contracting round: achieving health gain or financial balance?
McCarthy, M
1998-12-01
In the 1991 National Health Service reforms, health authorities became responsible for the health of their resident population, and they contract for health services from NHS providers - trusts and primary care services. A case study in Camden and Islington, an inner London health district, during 1996-1997 shows that contracting was directed more towards achieving financial balance than health objectives. Reasons include the inflationary effect of competition within an internal market, the power of administrators in decision-making within the health authority, and lack of adequate financial accounting in the NHS to relate costs to health outcomes. The introduction of programme budgets for districts would provide more cost-effective use of the nation's resources.
Pilot-multiplexed continuous-variable quantum key distribution with a real local oscillator
Wang, Tao; Huang, Peng; Zhou, Yingming; Liu, Weiqi; Zeng, Guihua
2018-01-01
We propose a pilot-multiplexed continuous-variable quantum key distribution (CVQKD) scheme based on a local local oscillator (LLO). Our scheme utilizes time-multiplexing and polarization-multiplexing techniques to dramatically isolate the quantum signal from the pilot, employs two heterodyne detectors to separately detect the signal and the pilot, and adopts a phase compensation method to almost eliminate the multifrequency phase jitter. In order to analyze the performance of our scheme, a general LLO noise model is constructed. Besides the phase noise and the modulation noise, the photon-leakage noise from the reference path and the quantization noise due to the analog-to-digital converter (ADC) are also considered, which are first analyzed in the LLO regime. Under such general noise model, our scheme has a higher key rate and longer secure distance compared with the preexisting LLO schemes. Moreover, we also conduct an experiment to verify our pilot-multiplexed scheme. Results show that it maintains a low level of the phase noise and is expected to obtain a 554-Kbps secure key rate within a 15-km distance under the finite-size effect.
Multiplexed Colorimetric Solid-Phase Extraction
Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.
2009-01-01
Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).
Directory of Open Access Journals (Sweden)
Chen-Chi Wu
Full Text Available Despite the clinical utility of genetic diagnosis to address idiopathic sensorineural hearing impairment (SNHI, the current strategy for screening mutations via Sanger sequencing suffers from the limitation that only a limited number of DNA fragments associated with common deafness mutations can be genotyped. Consequently, a definitive genetic diagnosis cannot be achieved in many families with discernible family history. To investigate the diagnostic utility of massively parallel sequencing (MPS, we applied the MPS technique to 12 multiplex families with idiopathic SNHI in which common deafness mutations had previously been ruled out. NimbleGen sequence capture array was designed to target all protein coding sequences (CDSs and 100 bp of the flanking sequence of 80 common deafness genes. We performed MPS on the Illumina HiSeq2000, and applied BWA, SAMtools, Picard, GATK, Variant Tools, ANNOVAR, and IGV for bioinformatics analyses. Initial data filtering with allele frequencies (0.95 prioritized 5 indels (insertions/deletions and 36 missense variants in the 12 multiplex families. After further validation by Sanger sequencing, segregation pattern, and evolutionary conservation of amino acid residues, we identified 4 variants in 4 different genes, which might lead to SNHI in 4 families compatible with autosomal dominant inheritance. These included GJB2 p.R75Q, MYO7A p.T381M, KCNQ4 p.S680F, and MYH9 p.E1256K. Among them, KCNQ4 p.S680F and MYH9 p.E1256K were novel. In conclusion, MPS allows genetic diagnosis in multiplex families with idiopathic SNHI by detecting mutations in relatively uncommon deafness genes.
Optomechanical transistor with mechanical gain
Zhang, X. Z.; Tian, Lin; Li, Yong
2018-04-01
We study an optomechanical transistor, where an input field can be transferred and amplified unidirectionally in a cyclic three-mode optomechanical system. In this system, the mechanical resonator is coupled simultaneously to two cavity modes. We show that it only requires a finite mechanical gain to achieve the nonreciprocal amplification. Here the nonreciprocity is caused by the phase difference between the linearized optomechanical couplings that breaks the time-reversal symmetry of this system. The amplification arises from the mechanical gain, which provides an effective phonon bath that pumps the mechanical mode coherently. This effect is analogous to the stimulated emission of atoms, where the probe field can be amplified when its frequency is in resonance with that of the anti-Stokes transition. We show that by choosing optimal parameters, this optomechanical transistor can reach perfect unidirectionality accompanied with strong amplification. In addition, the presence of the mechanical gain can result in ultralong delay in the phase of the probe field, which provides an alternative to controlling light transport in optomechanical systems.
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
Coevolution of Cooperation and Layer Selection Strategy in Multiplex Networks
Directory of Open Access Journals (Sweden)
Katsuki Hayashi
2016-11-01
Full Text Available Recently, the emergent dynamics in multiplex networks, composed of layers of multiple networks, has been discussed extensively in network sciences. However, little is still known about whether and how the evolution of strategy for selecting a layer to participate in can contribute to the emergence of cooperative behaviors in multiplex networks of social interactions. To investigate these issues, we constructed a coevolutionary model of cooperation and layer selection strategies in which each an individual selects one layer from multiple layers of social networks and plays the Prisoner’s Dilemma with neighbors in the selected layer. We found that the proportion of cooperative strategies increased with increasing the number of layers regardless of the degree of dilemma, and this increase occurred due to a cyclic coevolution process of game strategies and layer selection strategies. We also showed that the heterogeneity of links among layers is a key factor for multiplex networks to facilitate the evolution of cooperation, and such positive effects on cooperation were observed regardless of the difference in the stochastic properties of network topologies.
Multiplex network analysis of employee performance and employee social relationships
Cai, Meng; Wang, Wei; Cui, Ying; Stanley, H. Eugene
2018-01-01
In human resource management, employee performance is strongly affected by both formal and informal employee networks. Most previous research on employee performance has focused on monolayer networks that can represent only single categories of employee social relationships. We study employee performance by taking into account the entire multiplex structure of underlying employee social networks. We collect three datasets consisting of five different employee relationship categories in three firms, and predict employee performance using degree centrality and eigenvector centrality in a superimposed multiplex network (SMN) and an unfolded multiplex network (UMN). We use a quadratic assignment procedure (QAP) analysis and a regression analysis to demonstrate that the different categories of relationship are mutually embedded and that the strength of their impact on employee performance differs. We also use weighted/unweighted SMN/UMN to measure the predictive accuracy of this approach and find that employees with high centrality in a weighted UMN are more likely to perform well. Our results shed new light on how social structures affect employee performance.
Argo: A Time-Elastic Time-Division-Multiplexed NOC using Asynchronous Routers
DEFF Research Database (Denmark)
Kasapaki, Evangelia; Sparsø, Jens
2014-01-01
are either synchronous or mesochronous. We use asynchronous routers to achieve a simpler, smaller, and more robust, self-timed design. Our design exploits the fact that pipelined asynchronous circuits also behave as ripple FIFOs. Thus, it avoids the need for explicit synchronization FIFOs between the routers......In this paper we explore the use of asynchronous routers in a time-division-multiplexed (TDM) network-on-chip (NOC), Argo, that is being developed for a multi-processor platform for hard real-time systems. TDM inherently requires a common time reference, and existing TDM-based NOC designs...... delays derived from a 65nm CMOS implementation, a worstcase analysis shows that a typical design can tolerate a skew of 1-5 cycles (depending on FIFO depths and NI clock frequency). Simulation results of a 2 x 2 NOC confirm this....
Come On! Using intervention mapping to help healthy pregnant women achieve healthy weight gain.
Merkx, Astrid; Ausems, Marlein; de Vries, Raymond; Nieuwenhuijze, Marianne J
2017-06-01
Gaining too much or too little weight in pregnancy (according to Institute of Medicine (IOM) guidelines) negatively affects both mother and child, but many women find it difficult to manage their gestational weight gain (GWG). Here we describe the use of the intervention mapping protocol to design 'Come On!', an intervention to promote adequate GWG among healthy pregnant women. We used the six steps of intervention mapping: (i) needs assessment; (ii) formulation of change objectives; (iii) selection of theory-based methods and practical strategies; (iv) development of the intervention programme; (v) development of an adoption and implementation plan; and (vi) development of an evaluation plan. A consortium of users and related professionals guided the process of development. As a result of the needs assessment, two goals for the intervention were formulated: (i) helping healthy pregnant women to stay within the IOM guidelines for GWG; and (ii) getting midwives to adequately support the efforts of healthy pregnant women to gain weight within the IOM guidelines. To reach these goals, change objectives and determinants influencing the change objectives were formulated. Theories used were the Transtheoretical Model, Social Cognitive Theory and the Elaboration Likelihood Model. Practical strategies to use the theories were the foundation for the development of 'Come On!', a comprehensive programme that included a tailored Internet programme for pregnant women, training for midwives, an information card for midwives, and a scheduled discussion between the midwife and the pregnant woman during pregnancy. The programme was pre-tested and evaluated in an effect study.
Bridging online and offline social networks: Multiplex analysis
Filiposka, Sonja; Gajduk, Andrej; Dimitrova, Tamara; Kocarev, Ljupco
2017-04-01
We show that three basic actor characteristics, namely normalized reciprocity, three cycles, and triplets, can be expressed using an unified framework that is based on computing the similarity index between two sets associated with the actor: the set of her/his friends and the set of those considering her/him as a friend. These metrics are extended to multiplex networks and then computed for two friendship networks generated by collecting data from two groups of undergraduate students. We found that in offline communication strong and weak ties are (almost) equally presented, while in online communication weak ties are dominant. Moreover, weak ties are much less reciprocal than strong ties. However, across different layers of the multiplex network reciprocities are preserved, while triads (measured with normalized three cycles and triplets) are not significant.
Mirror node correlations tuning synchronization in multiplex networks
Kumar, Anil; Baptista, Murilo S.; Zaikin, Alexey; Jalan, Sarika
2017-12-01
We show that the degree-degree correlations have a major impact on global synchronizability (GS) of multiplex networks, enabling the specification of synchronizability by only changing the degree-degree correlations of the mirror nodes while maintaining the connection architecture of the individual layer unaltered. If individual layers have nodes that are mildly correlated, the multiplex network is best synchronizable when the mirror degrees are strongly negatively correlated. If individual layers have nodes with strong degree-degree correlations, mild correlations among the degrees of mirror nodes are the best strategy for the optimization of GS. Global synchronization also depend on the density of connections, a phenomenon not observed in a single layer network. The results are crucial to understand, predict, and specify behavior of systems having multiple types of connections among the interacting units.
Kim, Stephan D.; Luo, Jiajun; Buchholz, D. Bruce; Chang, R. P. H.; Grayson, M.
2016-09-01
A modular time division multiplexer (MTDM) device is introduced to enable parallel measurement of multiple samples with both fast and slow decay transients spanning from millisecond to month-long time scales. This is achieved by dedicating a single high-speed measurement instrument for rapid data collection at the start of a transient, and by multiplexing a second low-speed measurement instrument for slow data collection of several samples in parallel for the later transients. The MTDM is a high-level design concept that can in principle measure an arbitrary number of samples, and the low cost implementation here allows up to 16 samples to be measured in parallel over several months, reducing the total ensemble measurement duration and equipment usage by as much as an order of magnitude without sacrificing fidelity. The MTDM was successfully demonstrated by simultaneously measuring the photoconductivity of three amorphous indium-gallium-zinc-oxide thin films with 20 ms data resolution for fast transients and an uninterrupted parallel run time of over 20 days. The MTDM has potential applications in many areas of research that manifest response times spanning many orders of magnitude, such as photovoltaics, rechargeable batteries, amorphous semiconductors such as silicon and amorphous indium-gallium-zinc-oxide.
A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.
Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer
2016-08-01
A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.
Receiver gain function: the actual NMR receiver gain
Mo, Huaping; Harwood, John S.; Raftery, Daniel
2010-01-01
The observed NMR signal size depends on the receiver gain parameter. We propose a receiver gain function to characterize how much the raw FID is amplified by the receiver as a function of the receiver gain setting. Although the receiver is linear for a fixed gain setting, the actual gain of the receiver may differ from what the gain setting suggests. Nevertheless, for a given receiver, we demonstrate that the receiver gain function can be calibrated. Such a calibration enables accurate compar...
Achieving Energy Efficiency Through Real-Time Feedback
Energy Technology Data Exchange (ETDEWEB)
Nesse, Ronald J.
2011-09-01
Through the careful implementation of simple behavior change measures, opportunities exist to achieve strategic gains, including greater operational efficiencies, energy cost savings, greater tenant health and ensuing productivity and an improved brand value through sustainability messaging and achievement.
Osabe, Keiichi; Kawai, Kotaro
2017-03-01
In this study, angular multiplexing hologram recording photopolymer films were studied experimentally. The films contained acrylamide as a monomer, eosin Y as a sensitizer, and triethanolamine as a promoter in a polyvinyl alcohol matrix. In order to determine the appropriate thickness of the photopolymer films for angular multiplexing, photopolymer films with thicknesses of 29-503 μm were exposed to two intersecting beams of a YVO laser at a wavelength of 532 nm to form a holographic grating with a spatial frequency of 653 line/mm. The diffraction efficiencies as a function of the incident angle of reconstruction were measured. A narrow angular bandwidth and high diffraction efficiency are required for angular multiplexing; hence, we define the Q value, which is the diffraction efficiency divided by half the bandwidth. The Q value of the films depended on the thickness of the films, and was calculated based on the measured diffraction efficiencies. The Q value of a 297-μm-thick film was the highest of the all films. Therefore, the angular multiplexing experiments were conducted using 300-μm-thick films. In the angular multiplexing experiments, the object beam transmitted by a square aperture was focused by a Fourier transform lens and interfered with a reference beam. The maximum order of angular multiplexing was four. The signal intensity that corresponds to the squared-aperture transmission and the noise intensity that corresponds to transmission without the square aperture were measured. The signal intensities decreased as the order of angular multiplexing increased, and the noise intensities were not dependent on the order of angular multiplexing.
Generalized BICM-T transceivers: Constellation and multiplexer design
Malik, Muhammad Talha
2013-09-01
Recently, it has been shown that the performance of bit-interleaved coded modulation (BICM) using convolutional codes in nonfading channels can be significantly improved if the coded bits are not interleaved at all. This particular BICM design is referred to as BICM trivial (BICM-T) and is shown to be asymptotically as good as Ungerboeck\\'s one dimensional (1D) trellis coded modulation (TCM). This BICM-T design and analysis considered a simple case of rate 1/2 channel encoder with equally spaced 16-ary quadrature amplitude modulation (QAM) constellation where the code rate matches with the modulation order as required in TCM transmission. In this paper, we consider and analyze a new BICM-T design that uses a non equally spaced signal constellation in conjunction with a bit level multiplexer. With this design and analysis, one can not only exploit the full benefit of BICM-T design by jointly optimizing different transceiver\\'s modules but also enjoys the same design flexibility as the traditional BICM to independently choose the code rate and the modulation order. The presented numerical results for 64-ary QAM with rate 1/3 code shows that the considered design can offer gains up to 2.5 dB over the traditional optimal BICM design for a target bit error rate (BER) of 10-6. © 2013 IEEE.
International Nuclear Information System (INIS)
Xu Weihua; Wu Jinhui; Gao Jinyue
2006-01-01
In a three-level V-type atomic system without any external coherent driving, owing to the coherence that results from the vacuum of the radiation field, both the probe gain with and without population inversion can be achieved with very weak incoherent pumping. The gain is achieved in the absence of any external coherent driving field, so it is different from the gain without inversion in ordinary laser-driven schemes where a coherent driving field is necessary to create the coherence. The gain is also different from the conventional lasing gain because the population inversion is achieved via vacuum-induced coherence, which is dependent on the atomic coherence
Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph
2012-11-14
DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.
Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam
2016-07-01
Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.
McCutcheon, Krista M; Gray, Julia; Chen, Natalie Y; Liu, Keyi; Park, Minha; Ellsworth, Stote; Tripp, Ralph A; Tompkins, S Mark; Johnson, Scott K; Samet, Shelly; Pereira, Lenore; Kauvar, Lawrence M
2014-01-01
Viral entry targets with therapeutic neutralizing potential are subject to multiple escape mechanisms, including antigenic drift, immune dominance of functionally irrelevant epitopes, and subtle variations in host cell mechanisms. A surprising finding of recent years is that potent neutralizing antibodies to viral epitopes independent of strain exist, but are poorly represented across the diverse human population. Identifying these antibodies and understanding the biology mediating the specific immune response is thus difficult. An effective strategy for meeting this challenge is to incorporate multiplexed antigen screening into a high throughput survey of the memory B cell repertoire from immune individuals. We used this approach to discover suites of cross-clade antibodies directed to conformational epitopes in the stalk region of the influenza A hemagglutinin (HA) protein and to select high-affinity anti-peptide antibodies to the glycoprotein B (gB) of human cytomegalovirus. In each case, our screens revealed a restricted VH and VL germline usage, including published and previously unidentified gene families. The in vivo evolution of paratope specificity with optimal neutralizing activity was understandable after correlating biological activities with kinetic binding and epitope recognition. Iterative feedback between antigen probe design based on structure and function information with high throughput multiplexed screening demonstrated a generally applicable strategy for efficient identification of safe, native, finely tuned antibodies with the potential for high genetic barriers to viral escape.
Massive MIMO-OFDM indoor visible light communication system downlink architecture design
Lang, Tian; Li, Zening; Chen, Gang
2014-10-01
Multiple-input multiple-output (MIMO) technique is now used in most new broadband communication system, and orthogonal frequency division multiplexing (OFDM) is also utilized within current 4th generation (4G) of mobile telecommunication technology. With MIMO and OFDM combined, visible light communication (VLC) system's diversity gain is increase, yet system capacity for dispersive channels is also enhanced. Moreover, with the emerging massive MIMO-OFDM VLC system, there are significant advantages than smaller systems' such as channel hardening, further increasing of energy efficiency (EE) and spectral efficiency (SE) based on law of large number. This paper addresses one of the major technological challenges, system architecture design, which was solved by semispherical beehive structure (SBS) receiver and so that diversity gain can be identified and applied in Massive MIMO VLC system. Simulation results shows that the proposed design clearly presents a spatial diversity over conventional VLC systems.
Spin and wavelength multiplexed nonlinear metasurface holography
Ye, Weimin; Zeuner, Franziska; Li, Xin; Reineke, Bernhard; He, Shan; Qiu, Cheng-Wei; Liu, Juan; Wang, Yongtian; Zhang, Shuang; Zentgraf, Thomas
2016-06-01
Metasurfaces, as the ultrathin version of metamaterials, have caught growing attention due to their superior capability in controlling the phase, amplitude and polarization states of light. Among various types of metasurfaces, geometric metasurface that encodes a geometric or Pancharatnam-Berry phase into the orientation angle of the constituent meta-atoms has shown great potential in controlling light in both linear and nonlinear optical regimes. The robust and dispersionless nature of the geometric phase simplifies the wave manipulation tremendously. Benefitting from the continuous phase control, metasurface holography has exhibited advantages over conventional depth controlled holography with discretized phase levels. Here we report on spin and wavelength multiplexed nonlinear metasurface holography, which allows construction of multiple target holographic images carried independently by the fundamental and harmonic generation waves of different spins. The nonlinear holograms provide independent, nondispersive and crosstalk-free post-selective channels for holographic multiplexing and multidimensional optical data storages, anti-counterfeiting, and optical encryption.
Interplay of delay and multiplexing: Impact on cluster synchronization
Singh, Aradhana; Jalan, Sarika; Boccaletti, Stefano
2017-04-01
Communication delays and multiplexing are ubiquitous features of real-world network systems. We here introduce a simple model where these two features are simultaneously present and report the rich phenomenology which is actually due to their interplay on cluster synchronization. A delay in one layer has non trivial impacts on the collective dynamics of the other layers, enhancing or suppressing synchronization. At the same time, multiplexing may also enhance cluster synchronization of delayed layers. We elucidate several nontrivial (and anti-intuitive) scenarios, which are of interest and potential application in various real-world systems, where the introduction of a delay may render synchronization of a layer robust against changes in the properties of the other layers.
2017-07-01
Standard 106-17 Chapter 3, July 2017 3-5 Table 3-4. Constant-Bandwidth FM Subcarrier Channels Frequency Criteria\\Channels: A B C D E F G H Deviation ...Telemetry Standards , RCC Standard 106-17 Chapter 3, July 2017 3-i CHAPTER 3 Frequency Division Multiplexing Telemetry Standards Acronyms...Frequency Division Multiplexing Telemetry Standards ................................ 3-1 3.1 General
Two Years of Site Diversity Measurements in Guam, USA
Acosta, Roberto J.; Morse, J.; Zemba, M.; Nessel, J.
2012-01-01
As NASA communication networks upgrade to higher frequencies, such as Ka-Band, atmospherically induced attenuation can become significant. This attenuation is caused by rain, clouds and atmospheric gases (oxygen and water vapor), with rain having the most noticeable effects. One technique to circumvent the increase in attenuation is to operate two terminals separated by a distance that exceeds the average rain cell size. The fact that rain cells are of finite size can then be exploited by rerouting the signal to the terminal with the strongest link. This technique, known as site diversity, is best suited for climates that have compact (less than 2km) and intense rain cells such as in Guam. In order to study the potential diversity gain at the Tracking and Data Relay Satellite (TDRS) Remote Ground Terminal (GRGT) complex in Guam a site test interferometer (STI) was installed in May of 2010. The STI is composed of two terminals with a 900m baseline that observe the same unmodulated beacon signal broadcast from a geostationary satellite (e.g., UFO 8). The potential site diversity gain is calculated by measuring the difference in signal attenuation seen at each terminal. Over the two years of data collection the cumulative distribution function (CDF) of the site diversity gain shows a better than 3 dB improvement for 90% of the time over standard operation. These results show that the use of site diversity in Guam can be very effective in combating rain fades.
Engineering women re-visioning women's scientific achievements and impacts
Tietjen, Jill S
2017-01-01
Packed with fascinating biographical sketches of female engineers, this chronological history of engineering brightens previously shadowy corners of our increasingly engineered world’s recent past. In addition to a detailed description of the diverse arenas encompassed by the word ‘engineering’ and a nuanced overview of the development of the field, the book includes numerous statistics and thought provoking facts about women’s roles in the achievement of thrilling scientific innovations. This text is a unique resource for students launching research projects in engineering and related fields, professionals interested in gaining a broader understanding of how engineering as a discipline has been impacted by events of global significance, and scholars of women’s immense, often obscured, contributions to scientific progress. Illuminates the many significant contributions of women in engineering Educates readers about the evolution of the field of engineering over the last century Demonstrates how key ...
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis
Directory of Open Access Journals (Sweden)
V Hallur
2015-01-01
Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran
2010-12-01
Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.
A Novel Multiplex HRM Assay to Detect Clopidogrel Resistance.
Zhang, Lichen; Ma, Xiaowei; You, Guoling; Zhang, Xiaoqing; Fu, Qihua
2017-11-22
Clopidogrel is an antiplatelet medicine used to prevent blood clots in patients who have had a heart attack, stroke, or other symptoms. Variability in the clinical response to clopidogrel treatment has been attributed to genetic factors. In particular, five SNPs of rs4244285, rs4986893, rs12248560, rs662 and rs1045642 have been associated with resistance to clopidogrel therapy in Chinese population. This work involves the development of a multiplex high-resolution melting (HRM) assay to genotype all five of these loci in 2 tubes. Amplicons corresponding to distinct SNPs in a common tube were designed with the aid of uMelt prediction software to have different melting temperatures Tm by addition of a GC-rich tail to the 5' end of the certain primers. Two kinds of commercial methods, Digital Fluorescence Molecular Hybridization (DFMH) and Sanger sequencing, were used as a control. Three hundred sixteen DFMH pretested samples from consecutive acute coronary syndrome patients were used for a blinded study of multiplex HRM. The sensitivity of HRM was 100% and the specificity was 99.93% reflecting detection of variants other than the known resistance SNPs. Multiplex HRM is an effective closed-tube, highly accurate, fast, and inexpensive method for genotyping the 5 clopidogrel resistance associated SNPs.
Liu, Rui; Zhang, Shixi; Wei, Chao; Xing, Zhi; Zhang, Sichun; Zhang, Xinrong
2016-05-17
The unambiguous quantification of biomolecules is of great significance in fundamental biological research as well as practical clinical diagnosis. Due to the lack of a detectable moiety, the direct and highly sensitive quantification of biomolecules is often a "mission impossible". Consequently, tagging strategies to introduce detectable moieties for labeling target biomolecules were invented, which had a long and significant impact on studies of biomolecules in the past decades. For instance, immunoassays have been developed with radioisotope tagging by Yalow and Berson in the late 1950s. The later languishment of this technology can be almost exclusively ascribed to the use of radioactive isotopes, which led to the development of nonradioactive tagging strategy-based assays such as enzyme-linked immunosorbent assay, fluorescent immunoassay, and chemiluminescent and electrochemiluminescent immunoassay. Despite great success, these strategies suffered from drawbacks such as limited spectral window capacity for multiplex detection and inability to provide absolute quantification of biomolecules. After recalling the sequences of tagging strategies, an apparent question is why not use stable isotopes from the start? A reasonable explanation is the lack of reliable means for accurate and precise quantification of stable isotopes at that time. The situation has changed greatly at present, since several atomic mass spectrometric measures for metal stable isotopes have been developed. Among the newly developed techniques, inductively coupled plasma mass spectrometry is an ideal technique to determine metal stable isotope-tagged biomolecules, for its high sensitivity, wide dynamic linear range, and more importantly multiplex and absolute quantification ability. Since the first published report by our group, metal stable isotope tagging has become a revolutionary technique and gained great success in biomolecule quantification. An exciting research highlight in this area
Multiuser hybrid switched-selection diversity systems
Shaqfeh, Mohammad; Alnuweiri, Hussein M.; Alouini, Mohamed-Slim
2011-01-01
system provides flexibility in trading-off the channel information feedback overhead with the prospected multiuser diversity gains. The users are clustered into groups, and the users' groups are ordered into a sequence. Per-group feedback thresholds
Li, Zhu-Nan; Weber, Kimberly M; Limmer, Rebecca A; Horne, Bobbi J; Stevens, James; Schwerzmann, Joy; Wrammert, Jens; McCausland, Megan; Phipps, Andrew J; Hancock, Kathy; Jernigan, Daniel B; Levine, Min; Katz, Jacqueline M; Miller, Joseph D
2017-05-01
Influenza hemagglutination inhibition (HI) and virus microneutralization assays (MN) are widely used for seroprevalence studies. However, these assays have limited field portability and are difficult to fully automate for high throughput laboratory testing. To address these issues, three multiplex influenza subtype-specific antibody detection assays were developed using recombinant hemagglutinin antigens in combination with Chembio, Luminex ® , and ForteBio ® platforms. Assay sensitivity, specificity, and subtype cross-reactivity were evaluated using a panel of well characterized human sera. Compared to the traditional HI, assay sensitivity ranged from 87% to 92% and assay specificity in sera collected from unexposed persons ranged from 65% to 100% across the platforms. High assay specificity (86-100%) for A(H5N1) rHA was achieved for sera from exposed or unexposed to hetorosubtype influenza HAs. In contrast, assay specificity for A(H1N1)pdm09 rHA using sera collected from A/Vietnam/1204/2004 (H5N1) vaccinees in 2008 was low (22-30%) in all platforms. Although cross-reactivity against rHA subtype proteins was observed in each assay platform, the correct subtype specific responses were identified 78%-94% of the time when paired samples were available for analysis. These results show that high throughput and portable multiplex assays that incorporate rHA can be used to identify influenza subtype specific infections. Published by Elsevier B.V.
Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N
2008-06-01
We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.
Genotyping-By-Sequencing for Plant Genetic Diversity Analysis: A Lab Guide for SNP Genotyping
Directory of Open Access Journals (Sweden)
Gregory W. Peterson
2014-10-01
Full Text Available Genotyping-by-sequencing (GBS has recently emerged as a promising genomic approach for exploring plant genetic diversity on a genome-wide scale. However, many uncertainties and challenges remain in the application of GBS, particularly in non-model species. Here, we present a GBS protocol we developed and use for plant genetic diversity analysis. It uses two restriction enzymes to reduce genome complexity, applies Illumina multiplexing indexes for barcoding and has a custom bioinformatics pipeline for genotyping. This genetic diversity-focused GBS (gd-GBS protocol can serve as an easy-to-follow lab guide to assist a researcher through every step of a GBS application with five main components: sample preparation, library assembly, sequencing, SNP calling and diversity analysis. Specifically, in this presentation, we provide a brief overview of the GBS approach, describe the gd-GBS procedures, illustrate it with an application to analyze genetic diversity in 20 flax (Linum usitatissimum L. accessions and discuss related issues in GBS application. Following these lab bench procedures and using the custom bioinformatics pipeline, one could generate genome-wide SNP genotype data for a conventional genetic diversity analysis of a non-model plant species.
The Groove of Growth: How Early Gains in Math Ability Influence Adolescent Achievement
Watts, Tyler W.; Duncan, Greg J.; Siegler, Robert S.; Davis-Kean, Pamela E.
2014-01-01
A number of studies, both small scale and of nationally-representative student samples, have reported substantial associations between school entry math ability and later elementary school achievement. However, questions remain regarding the persistence of the association between early growth in math ability and later math achievement due to the…
EDRN Pre-Validation of Multiplex Biomarker in Urine — EDRN Public Portal
The goal of this proposal is to begin to establish an EDRN “pre-validation” trial of a multiplex set of transcripts, including the ETS gene fusions, in post-DRE urine sediments. As can be evidenced by our preliminary data, we have established the utility of this multiplex urine test (which includes TMPRSS-ERG, SPINK1, PCA3 and GOLPH2) in a cohort of prospectively collected urine sediments from the University of Michigan EDRN CEVC site (collected by co-I, Dr. John Wei). In this proposal, we will run this multiplex assay on prospectively collected post-DRE urines collected from other EDRN sites. The idea is to couple this “pre-validation” study with an EDRN validation trial under consideration for the Gen-Probe PCA3 urine test (directed by Drs. John Wei and Harry Rittenhouse).
International Nuclear Information System (INIS)
Shah, S. A.; Riaz, U.; Zahoor, I.; Jalil, A.; Zubair, M.
2013-01-01
Multiple primaries in a single patient are uncommon, though not very rare. The existence of such cancers in two un-related, non-paired organs is even more un-common. Here, we present a case of 55 years old male who presented to us with a mucoepidermoid carcinoma of the parotid gland and was operated. Later on, he presented with a large cystic swelling in the pelvis which turned out to be pseudomyxoma peritonei. A review of slides and immunohistochemistry indicated it to be adenocarcinoma colon. He presented again with recurrent mucoepidermoid carcinoma of the parotid which was operated successfully with the use of myocutaneous flap for wound closure. He is currently undergoing chemotherapy. In order to establish a separate mono-clonal etiology of both tumours, immunohistochemistry was performed. To the best of our knowledge, carcinoma multiplex in the colon and the parotid has never been reported before. (author)
Multiplexed Dosing Assays by Digitally Definable Hydrogel Volumes
DEFF Research Database (Denmark)
Faralli, Adele; Melander, Fredrik; Larsen, Esben Kjær Unmack
2016-01-01
Stable and low-cost multiplexed drug sensitivity assays using small volumes of cells or tissue are in demand for personalized medicine, including patientspecific combination chemotherapy. Spatially defined projected light photopolymerization of hydrogels with embedded active compounds is introduc...
Directory of Open Access Journals (Sweden)
Gili Marbach-Ad
2016-12-01
Full Text Available This study describes the implementation and effectiveness of small-group active engagement (GAE exercises in an introductory biology course (BSCI207 taught in a large auditorium setting. BSCI207 (Principles of Biology III—Organismal Biology is the third introductory core course for Biological Sciences majors. In fall 2014, the instructors redesigned one section to include GAE activities to supplement lecture content. One section (n = 198 employed three lectures per week. The other section (n = 136 replaced one lecture per week with a GAE class. We explored the benefits and challenges associated with implementing GAE exercises and their relative effectiveness for unique student groups (e.g., minority students, high- and low-grade point average [GPA] students. Our findings show that undergraduates in the GAE class exhibited greater improvement in learning outcomes than undergraduates in the traditional class. Findings also indicate that high-achieving students experienced the greatest benefit from GAE activities. Some at-risk student groups (e.g., two-year transfer students showed comparably low learning gains in the course, despite the additional support that may have been afforded by active learning. Collectively, these findings provide valuable feedback that may assist other instructors who wish to revise their courses and recommendations for institutions regarding prerequisite coursework approval policies.
A biplex approach to PageRank centrality: From classic to multiplex networks.
Pedroche, Francisco; Romance, Miguel; Criado, Regino
2016-06-01
In this paper, we present a new view of the PageRank algorithm inspired by multiplex networks. This new approach allows to introduce a new centrality measure for classic complex networks and a new proposal to extend the usual PageRank algorithm to multiplex networks. We give some analytical relations between these new approaches and the classic PageRank centrality measure, and we illustrate the new parameters presented by computing them on real underground networks.
A biplex approach to PageRank centrality: From classic to multiplex networks
Pedroche, Francisco; Romance, Miguel; Criado, Regino
2016-06-01
In this paper, we present a new view of the PageRank algorithm inspired by multiplex networks. This new approach allows to introduce a new centrality measure for classic complex networks and a new proposal to extend the usual PageRank algorithm to multiplex networks. We give some analytical relations between these new approaches and the classic PageRank centrality measure, and we illustrate the new parameters presented by computing them on real underground networks.
Sun, Qizhen; Li, Xiaolei; Zhang, Manliang; Liu, Qi; Liu, Hai; Liu, Deming
2013-12-01
Fiber optic sensor network is the development trend of fiber senor technologies and industries. In this paper, I will discuss recent research progress on high capacity fiber sensor networks with hybrid multiplexing techniques and their applications in the fields of security monitoring, environment monitoring, Smart eHome, etc. Firstly, I will present the architecture of hybrid multiplexing sensor passive optical network (HSPON), and the key technologies for integrated access and intelligent management of massive fiber sensor units. Two typical hybrid WDM/TDM fiber sensor networks for perimeter intrusion monitor and cultural relics security are introduced. Secondly, we propose the concept of "Microstructure-Optical X Domin Refecltor (M-OXDR)" for fiber sensor network expansion. By fabricating smart micro-structures with the ability of multidimensional encoded and low insertion loss along the fiber, the fiber sensor network of simple structure and huge capacity more than one thousand could be achieved. Assisted by the WDM/TDM and WDM/FDM decoding methods respectively, we built the verification systems for long-haul and real-time temperature sensing. Finally, I will show the high capacity and flexible fiber sensor network with IPv6 protocol based hybrid fiber/wireless access. By developing the fiber optic sensor with embedded IPv6 protocol conversion module and IPv6 router, huge amounts of fiber optic sensor nodes can be uniquely addressed. Meanwhile, various sensing information could be integrated and accessed to the Next Generation Internet.
Weight gain in women diagnosed with breast cancer.
Demark-Wahnefried, W; Rimer, B K; Winer, E P
1997-05-01
This review of the literature indicates that weight gain is a common observation among women after the diagnosis of breast cancer. Gains in weight range from 0 to 50 lb and are influenced by menopausal status; nodal status; and the type, duration, and intensity of treatment. Weight gain appears to be greater among premenopausal women; among those who are node positive; and among those receiving higher dose, longer duration, and multiagent regimens. Psychosocial research suggests that weight gain has a profoundly negative impact on quality of life in patients with breast cancer. Recent findings also suggest that weight gain during therapy may increase the risk of recurrence and decrease survival. Although weight gain in patients with breast cancer is clinically well appreciated, little research has been conducted to investigate the underlying mechanisms of energy imbalance. Changes in rates of metabolism, physical activity, and dietary intake are all plausible mechanisms and call for more research. Further study will provide valuable insight into the problem of weight gain and encourage effective interventions to improve the quality and quantity of life for the woman with breast cancer. Until more is known, however, dietetics practitioners will have to monitor and work individually with patients with breast cancer and use empirical approaches to achieve the important goal of weight management.
DEFF Research Database (Denmark)
Laguardia Areal, Janaina; Hu, Hao; Palushani, Evarist
2010-01-01
This paper presents an optical circuit for frame synchronization and pulse compression of 10G Ethernet frames with 12000 bits and multiplexing to a 170 Gbit/s optical time division multiplexed data stream.......This paper presents an optical circuit for frame synchronization and pulse compression of 10G Ethernet frames with 12000 bits and multiplexing to a 170 Gbit/s optical time division multiplexed data stream....
RAPID DETECTION OF -THALASSEMIA MUTATIONS IN THAILAND USING MULTIPLEX ARMS
Directory of Open Access Journals (Sweden)
D. Shimbhu
2017-11-01
Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.
Directory of Open Access Journals (Sweden)
Chung Hyun-Jae
2010-09-01
Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.
Multiplexed measurements by time resolved spectroscopy using colloidal CdSe/ZnS quantum dots
Energy Technology Data Exchange (ETDEWEB)
Kaiser, U.; Jimenez de Aberasturi, D.; Malinowski, R.; Amin, F.; Parak, W. J.; Heimbrodt, W., E-mail: Wolfram.Heimbrodt@physik.uni-marburg.de [Department of Physics and Materials Sciences Center, Philipps-University of Marburg, Renthof 5, D-35032 Marburg (Germany)
2014-01-27
Multiplexed measurements of analytes in parallel is a topical demand in bioanalysis and bioimaging. An interesting alternative to commonly performed spectral multiplexing is lifetime multiplexing. In this Letter, we present a proof of principle of single-color lifetime multiplexing by coupling the same fluorophore to different nanoparticles. The effective lifetime of the fluorophores can be tuned by more than one order of magnitude due to resonance energy transfer from donor states. Measurements have been done on a model systems consisting of ATTO-590 dye molecules linked to either gold particles or to CdSe/ZnS core shell quantum dots. Both systems show the same luminescence spectrum of ATTO-590 dye emission in continuous wave excitation, but can be distinguished by means of time resolved measurements. The dye molecules bound to gold particles exhibit a mono-exponential decay with a lifetime of 4.5 ns, whereas the dye molecules bound to CdSe/ZnS dots show a nonexponential decay with a slow component of about 135 ns due to the energy transfer from the quantum dots. We demonstrate the fundamental possibility to determine the mixing ratio for dyes with equal luminescence spectra but very different transients. This opens up a pathway independent of the standard optical multiplexing with many different fluorophores emitting from the near ultraviolet to the near infrared spectral region.
Equalizer complexity of mode division multiplexed coherent receivers
Inan, B.; Spinnler, B.; Ferreira, F.; Lobato, A.; Adhikari, S.; Sleiffer, V.A.J.M.; Borne, van den D.; Hanik, N.; Jansen, S.L.
2012-01-01
We show that OFDM requires the lowest equalizer complexity for crosstalk compensation in a mode-division-multiplexing receiver. For a 2000-km transmission distance and less than 10% ODFM-specific overhead, the modal dispersion must be below 12 ps/km
Zou, Li; Wang, Le; Zhao, Sheng-Mei; Chen, Han-Wu
2016-11-01
Atmospheric turbulence (AT) induced crosstalk can significantly impair the performance of a free-space optical (FSO) communication link using orbital angular momentum (OAM) multiplexing. In this paper, we propose a multiple-user detection (MUD) turbulence mitigation scheme in an OAM-multiplexed FSO communication link. First, we present a MUD equivalent communication model for an OAM-multiplexed FSO communication link under AT. In the equivalent model, each input bit stream represents one user’s information. The deformed OAM spatial modes caused by AT, instead of the pure OAM spatial modes, are used as information carriers, and the overlapping between the deformed OAM spatial modes are computed as the correlation coefficients between the users. Then, we present a turbulence mitigation scheme based on MUD idea to enhance AT tolerance of the OAM-multiplexed FSO communication link. In the proposed scheme, the crosstalk caused by AT is used as a useful component to deduce users’ information. The numerical results show that the performance of the OAM-multiplexed communication link has greatly improved by the proposed scheme. When the turbulence strength is 1 × 10-15 m-2/3, the transmission distance is 1000 m and the channel signal-to-noise ratio (SNR) is 26 dB, the bit-error-rate (BER) performance of four spatial multiplexed OAM modes lm = +1,+2,+3,+4 are all close to 10-5, and there is a 2-3 fold increase in the BER performance in comparison with those results without the proposed scheme. In addition, the proposed scheme is more effective for an OAM-multiplexed FSO communication link with a larger OAM mode topological charge interval. The proposed scheme is a promising direction for compensating the interference caused by AT in the OAM-multiplexed FSO communication link. Project supported by the National Natural Science Foundation of China (Grant Nos. 61271238 and 61475075), the Open Research Fund of Key Lab of Broadband Wireless Communication and Sensor Network
Fluorescence-Based Multiplex Protein Detection Using Optically Encoded Microbeads
Directory of Open Access Journals (Sweden)
Dae Hong Jeong
2012-03-01
Full Text Available Potential utilization of proteins for early detection and diagnosis of various diseases has drawn considerable interest in the development of protein-based multiplex detection techniques. Among the various techniques for high-throughput protein screening, optically-encoded beads combined with fluorescence-based target monitoring have great advantages over the planar array-based multiplexing assays. This review discusses recent developments of analytical methods of screening protein molecules on microbead-based platforms. These include various strategies such as barcoded microbeads, molecular beacon-based techniques, and surface-enhanced Raman scattering-based techniques. Their applications for label-free protein detection are also addressed. Especially, the optically-encoded beads such as multilayer fluorescence beads and SERS-encoded beads are successful for generating a large number of coding.
Bradford, Jolene A; Buller, Gayle; Suter, Michael; Ignatius, Michael; Beechem, Joseph M
2004-10-01
Conventional immuno-based multiparameter flow cytometric analysis has been limited by the requirement of a dedicated detection channel for each antibody-fluorophore set. To address the need to resolve multiple biological targets simultaneously, flow cytometers with as many as 10-15 detection channels have been developed. In this study, a new Zenon immunolabeling technology is developed that allows for multiple antigen detection per detection channel using a single fluorophore, through a unique method of fluorescence-intensity multiplexing. By varying the Zenon labeling reagent-to-antibody molar ratio, the fluorescence intensity of the antibody-labeled cellular targets can be used as a unique identifier. Although demonstrated in the present study with lymphocyte immunophenotyping, this approach is broadly applicable for any immuno-based multiplexed flow cytomety assay. Lymphocyte immunophenotyping of 38 clinical blood specimens using CD3, CD4, CD8, CD16, CD56, CD19, and CD20 antibodies was performed using conventional flow cytometric analysis and fluorescence-intensity multiplexing analysis. Conventional analysis measures a single antibody-fluorophore per photomultiplier tube (PMT). Fluorescence-intensity multiplex analysis simultaneously measures seven markers with two PMTs, using Zenon labeling reagent-antibody complexes in a single tube: CD19, CD4, CD8, and CD16 antibodies labeled with Zenon Alexa Fluor 488 Mouse IgG(1) labeling reagent and CD56, CD3, and CD20 antibodies labeled with Zenon R-Phycoerythrin (R-PE) Mouse IgG(1) or IgG(2b) labeling reagents. The lymphocyte immunophenotyping results from fluorescence-intensity multiplexing using Zenon labeling reagents in a single tube were comparable to results from conventional flow cytometric analysis. Simultaneous evaluation of multiple antigens using a single fluorophore can be performed using antibodies labeled with varying ratios of a Zenon labeling reagent. Labeling two sets of antibodies with different Zenon
Directory of Open Access Journals (Sweden)
Marcel Fajkus
2015-01-01
Full Text Available In this paper, an analysis of the use of wavelength and time division multiplexing techniques for quasi-distributed measurement in uniform fiber Bragg gratings is presented. To date, publications have concentrated on the determination of the maximum number of fiber Bragg gratings on one optical fiber using wavelength and time division multiplexing. In this paper, these techniques will be extended to determine the spectral width of wavelength division multiplexing in terms of the spectral width of the light emitting diode, the spectral width of the Bragg gratings, the measurement ranges of the individual sensors, and the guard band between two adjacent Bragg gratings. For time division multiplexing, a description of the time and power conditions are given. In particular the reflected power, first order crosstalk and chromatic dispersion have been considered. Finally, these relationships were applied to verify a design in a simulation using OptiSystem software.
A 50 SNP-multiplex mass spectrometry assay for human identification
DEFF Research Database (Denmark)
Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus
2008-01-01
We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...
Router Designs for an Asynchronous Time-Division-Multiplexed Network-on-Chip
DEFF Research Database (Denmark)
Kasapaki, Evangelia; Sparsø, Jens; Sørensen, Rasmus Bo
2013-01-01
In this paper we explore the design of an asynchronous router for a time-division-multiplexed (TDM) network-on-chip (NOC) that is being developed for a multi-processor platform for hard real-time systems. TDM inherently requires a common time reference, and existing TDM-based NOC designs are either....... This adds hardware complexity and increases area and power consumption. We propose to use asynchronous routers in order to achieve a simpler, more robust and globally-asynchronous NOC, and this represents an unexplored point in the design space. The paper presents a range of alternative router designs. All...... routers have been synthesized for a 65nm CMOS technology, and the paper reports post-layout figures for area, speed and energy and compares the asynchronous designs with an existing mesochronous clocked router. The results show that an asynchronous router is 2 times smaller, marginally slower...
Channel estimation in few mode fiber mode division multiplexing transmission system
Hei, Yongqiang; Li, Li; Li, Wentao; Li, Xiaohui; Shi, Guangming
2018-03-01
It is abundantly clear that obtaining the channel state information (CSI) is of great importance for the equalization and detection in coherence receivers. However, to the best of the authors' knowledge, in most of the existing literatures, CSI is assumed to be perfectly known at the receiver. So far, few literature discusses the effects of imperfect CSI on MDM system performance caused by channel estimation. Motivated by that, in this paper, the channel estimation in few mode fiber (FMF) mode division multiplexing (MDM) system is investigated, in which two classical channel estimation methods, i.e., least square (LS) method and minimum mean square error (MMSE) method, are discussed with the assumption of the spatially white noise lumped at the receiver side of MDM system. Both the capacity and BER performance of MDM system affected by mode-dependent gain or loss (MDL) with different channel estimation errors have been studied. Simulation results show that the capacity and BER performance can be further deteriorated in MDM system by the channel estimation, and an 1e-3 variance of channel estimation error is acceptable in MDM system with 0-6 dB MDL values.
Fast reconstruction of off-axis digital holograms based on digital spatial multiplexing.
Sha, Bei; Liu, Xuan; Ge, Xiao-Lu; Guo, Cheng-Shan
2014-09-22
A method for fast reconstruction of off-axis digital holograms based on digital multiplexing algorithm is proposed. Instead of the existed angular multiplexing (AM), the new method utilizes a spatial multiplexing (SM) algorithm, in which four off-axis holograms recorded in sequence are synthesized into one SM function through multiplying each hologram with a tilted plane wave and then adding them up. In comparison with the conventional methods, the SM algorithm simplifies two-dimensional (2-D) Fourier transforms (FTs) of four N*N arrays into a 1.25-D FTs of one N*N arrays. Experimental results demonstrate that, using the SM algorithm, the computational efficiency can be improved and the reconstructed wavefronts keep the same quality as those retrieved based on the existed AM method. This algorithm may be useful in design of a fast preview system of dynamic wavefront imaging in digital holography.
An ultra-high discrimination Y chromosome short tandem repeat multiplex DNA typing system.
Directory of Open Access Journals (Sweden)
Erin K Hanson
Full Text Available In forensic casework, Y chromosome short tandem repeat markers (Y-STRs are often used to identify a male donor DNA profile in the presence of excess quantities of female DNA, such as is found in many sexual assault investigations. Commercially available Y-STR multiplexes incorporating 12-17 loci are currently used in forensic casework (Promega's PowerPlex Y and Applied Biosystems' AmpFlSTR Yfiler. Despite the robustness of these commercial multiplex Y-STR systems and the ability to discriminate two male individuals in most cases, the coincidence match probabilities between unrelated males are modest compared with the standard set of autosomal STR markers. Hence there is still a need to develop new multiplex systems to supplement these for those cases where additional discriminatory power is desired or where there is a coincidental Y-STR match between potential male participants. Over 400 Y-STR loci have been identified on the Y chromosome. While these have the potential to increase the discrimination potential afforded by the commercially available kits, many have not been well characterized. In the present work, 91 loci were tested for their relative ability to increase the discrimination potential of the commonly used 'core' Y-STR loci. The result of this extensive evaluation was the development of an ultra high discrimination (UHD multiplex DNA typing system that allows for the robust co-amplification of 14 non-core Y-STR loci. Population studies with a mixed African American and American Caucasian sample set (n = 572 indicated that the overall discriminatory potential of the UHD multiplex was superior to all commercial kits tested. The combined use of the UHD multiplex and the Applied Biosystems' AmpFlSTR Yfiler kit resulted in 100% discrimination of all individuals within the sample set, which presages its potential to maximally augment currently available forensic casework markers. It could also find applications in human evolutionary
A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.
Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli
2015-07-07
Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.
Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer
Energy Technology Data Exchange (ETDEWEB)
Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.
2000-05-05
Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.
International Nuclear Information System (INIS)
Stirling, A.J.; L'Archeveque, J.V.R.
1977-03-01
Control and instrumentation cabling accounts for nearly 1% of the capital cost of a CANDU generating station. This study of cabling requirements, methods and costs for nuclear reactors, shows that efficient design and scale economies make CANDU wiring costs (per field point) among the lowest for comparable applications. Although attractive in other reactors, commercially available remote multiplexing systems are not, as yet, cost effective for general use in CANDU stations. The report, with its comprehensive tabulation of remote multiplexing equipment, and analysis of cabling procedures describes an approach for re-evaluating the tradeoff between remote multiplexing and conventional wiring as conditions change. (author)
Diversity and MIMO Performance Evaluation of Common Phase Center Multi Element Antenna Systems
Directory of Open Access Journals (Sweden)
V. Papamichael
2008-06-01
Full Text Available The diversity and Multiple Input Multiple Output (MIMO performance provided by common phase center multi element antenna (CPCMEA systems is evaluated using two practical methods which make use of the realized active element antenna patterns. These patterns include both the impact of the mutual coupling and the mismatch power loss at antenna ports. As a case study, two and four printed Inverted F Antenna (IFA systems are evaluated by means of Effective Diversity Gain (EDG and Capacity (C. EDG is measured in terms of the signal-to-noise ratio (SNR enhancement at a specific outage probability and in terms of the SNR reduction for achieving a desired average bit error rate (BER. The concept of receive antenna selection in MIMO systems is also investigated and the simulation results show a 43% improvement in the 1% outage C of a reconfigurable 2x2 MIMO system over a fixed 2x2 one.
Directory of Open Access Journals (Sweden)
Thadeous J Kacmarczyk
Full Text Available Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads. Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.
Kacmarczyk, Thadeous J.; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron
2015-01-01
Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal. PMID:26066343
Kacmarczyk, Thadeous J; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron
2015-01-01
Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.
Remote (250 km Fiber Bragg Grating Multiplexing System
Directory of Open Access Journals (Sweden)
Manuel Lopez-Amo
2011-09-01
Full Text Available We propose and demonstrate two ultra-long range fiber Bragg grating (FBG sensor interrogation systems. In the first approach four FBGs are located 200 km from the monitoring station and a signal to noise ratio of 20 dB is obtained. The second improved version is able to detect the four multiplexed FBGs placed 250 km away, offering a signal to noise ratio of 6–8 dB. Consequently, this last system represents the longest range FBG sensor system reported so far that includes fiber sensor multiplexing capability. Both simple systems are based on a wavelength swept laser to scan the reflection spectra of the FBGs, and they are composed by two identical-lengths optical paths: the first one intended to launch the amplified laser signal by means of Raman amplification and the other one is employed to guide the reflection signal to the reception system.
Nova Upgrade: A proposed ICF facility to demonstrate ignition and gain, revision 1
1992-07-01
The present objective of the national Inertial Confinement Fusion (ICF) Program is to determine the scientific feasibility of compressing and heating a small mass of mixed deuterium and tritium (DT) to conditions at which fusion occurs and significant energy is released. The potential applications of ICF will be determined by the resulting fusion energy yield (amount of energy produced) and gain (ratio of energy released to energy required to heat and compress the DT fuel). Important defense and civilian applications, including weapons physics, weapons effects simulation, and ultimately the generation of electric power will become possible if yields of 100 to 1,000 MJ and gains exceeding approximately 50 can be achieved. Once ignition and propagating bum producing modest gain (2 to 10) at moderate drive energy (1 to 2 MJ) has been achieved, the extension to high gain (greater than 50) is straightforward. Therefore, the demonstration of ignition and modest gain is the final step in establishing the scientific feasibility of ICF. Lawrence Livermore National Laboratory (LLNL) proposes the Nova Upgrade Facility to achieve this demonstration by the end of the decade. This facility would be constructed within the existing Nova building at LLNL for a total cost of approximately $400 M over the proposed FY 1995-1999 construction period. This report discusses this facility.
Murshid, Syed; Alanzi, Saud; Hridoy, Arnob; Lovell, Greg; Parhar, Gurinder; Chakravarty, Abhijit; Chowdhury, Bilas
2014-09-01
Spatial Domain Multiplexing/Space Division Multiplexing (SDM) can increase the bandwidth of existing and futuristic optical fibers by an order of magnitude or more. In the SDM technique, we launch multiple single mode pigtail laser sources of same wavelength into a carrier fiber at different angles. The launching angles decide the output of the carrier fiber by allocating separate spatial locations for each channel. Each channel follows a helical trajectory while traversing the length of the carrier fiber, thereby allowing spatial reuse of optical frequencies. In this endeavor we launch light from five different single mode pigtail laser sources at different angles (with respect to the axis of the carrier fiber) into the carrier fiber. Owing to helical propagation we get five distinct concentric donut shaped rings with negligible crosstalk at the output end of the fiber. These SDM channels also exhibit Orbital Angular Momentum (OAM), thereby adding an extra degree of photon freedom. We present the experimental data of five spatially multiplexed channels and compare them with simulated results to show that this technique can potentially improve the data capacity of optical fibers by an order of magnitude: A factor of five using SDM and another factor of two using OAM.
Achieving excellence in training
International Nuclear Information System (INIS)
Mangin, A.M.; Solymossy, J.M.
1983-01-01
Operating a nuclear power plant is a uniquely challenging activity, requiring a high degree of competence from all who are involved. Achieving and maintaining this competence requires excellence in training. But what does excellence mean, and how do we achieve it. Based on the experience gained by INPO in plant training evaluations and accreditation activities, this paper describes some of the actions that can be taken to achieve the quality appropriate for nuclear power plant training. These actions are discussed in relation to the four phases of a performance-based training system: (1) needs analysis, (2) program design and development, (3) implementation, and (4) evaluation and improvement
Gain characterization of all-optical gain-clamped PDFFA for WDM networks using the feedback theory
Czech Academy of Sciences Publication Activity Database
Hotoleanu, M.; Karásek, Miroslav
2000-01-01
Roč. 19, č. 1 (2000), s. 9-18 ISSN 0146-8030 Grant - others:EU COST(XE) OC 265.10 Institutional research plan: CEZ:AV0Z2067918 Keywords : amplifiers * wavelength division multiplexing * transient response Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.300, year: 2000
Nanoscale Test Strips for Multiplexed Blood Analysis, Phase I
National Aeronautics and Space Administration — The goal of our nanoscale test strips, or nanostrips, is to provide rapid, low-cost, powerful multiplexed analyses in a diminutive form so that whole body health...
International Nuclear Information System (INIS)
Bito, Kotatsu; Okuno, Masanari; Kano, Hideaki; Leproux, Philippe; Couderc, Vincent; Hamaguchi, Hiro-o
2013-01-01
Highlights: ► We have developed a simultaneous measurement system of CARS and CSRS. ► We can obtain information on the electronic resonance effect with the measurement. ► The simultaneous measurement provides us with more reliable spectral information. - Abstract: We have developed a three-pulse non-degenerate multiplex coherent Raman microspectroscopic system using a white-light laser source. The fundamental output (1064 nm) of a Nd:YAG laser is used for the pump radiation with the white-light laser output (1100–1700 nm) for the Stokes radiation to achieve broadband multiplex excitations of vibrational coherences. The second harmonic (532 nm) of the same Nd:YAG laser is used for the probe radiation. Thanks to the large wavelength difference between the pump and probe radiations, coherent anti-Stokes Raman scattering (CARS) and coherent Stokes Raman scattering (CSRS) can be detected simultaneously. Simultaneous detection of CARS and CSRS enables us to obtain information on the electronic resonance effect that affects differently the CARS and CSRS signals. Simultaneous analysis of the CARS and CSRS signals provides us the imaginary part of χ (3) without introducing any arbitrary parameter in the maximum entropy method (MEM)
Multiplexed electrospray scaling for liquid fuel injection
International Nuclear Information System (INIS)
Waits, C Mike; Hanrahan, Brendan; Lee, Ivan
2010-01-01
Evaporation and space-charge requirements are evaluated to understand the effect of device scaling and fuel preheating for a liquid fuel injector using a multiplexed electrospray (MES) configuration in compact combustion applications. This work reveals the influence of the droplet diameter, droplet velocity and droplet surface temperature as well as the surrounding gas temperature on the size and performance of microfabricated MES. Measurements from MES devices are used in the model to accurately account for the droplet diameter versus flow rate relationship, the minimum droplet diameter and the relevant droplet velocities. A maximum extractor electrode to ground electrode distance of 3.1 mm required to overcome space-charge forces is found to be independent of voltage or droplet velocity for large levels of multiplexing. This maximum distance also becomes the required evaporation length scale which imposes minimum fuel pre-heating requirements for large flow densities. Required fuel preheating is therefore evaluated for both ethanol and 1-butanol with combustor parameters relevant to fuel reformation, thermoelectric conversion, thermophotovoltaic conversion and thermionic conversion
Receiver Gain Modulation Circuit
Jones, Hollis; Racette, Paul; Walker, David; Gu, Dazhen
2011-01-01
A receiver gain modulation circuit (RGMC) was developed that modulates the power gain of the output of a radiometer receiver with a test signal. As the radiometer receiver switches between calibration noise references, the test signal is mixed with the calibrated noise and thus produces an ensemble set of measurements from which ensemble statistical analysis can be used to extract statistical information about the test signal. The RGMC is an enabling technology of the ensemble detector. As a key component for achieving ensemble detection and analysis, the RGMC has broad aeronautical and space applications. The RGMC can be used to test and develop new calibration algorithms, for example, to detect gain anomalies, and/or correct for slow drifts that affect climate-quality measurements over an accelerated time scale. A generalized approach to analyzing radiometer system designs yields a mathematical treatment of noise reference measurements in calibration algorithms. By treating the measurements from the different noise references as ensemble samples of the receiver state, i.e. receiver gain, a quantitative description of the non-stationary properties of the underlying receiver fluctuations can be derived. Excellent agreement has been obtained between model calculations and radiometric measurements. The mathematical formulation is equivalent to modulating the gain of a stable receiver with an externally generated signal and is the basis for ensemble detection and analysis (EDA). The concept of generating ensemble data sets using an ensemble detector is similar to the ensemble data sets generated as part of ensemble empirical mode decomposition (EEMD) with exception of a key distinguishing factor. EEMD adds noise to the signal under study whereas EDA mixes the signal with calibrated noise. It is mixing with calibrated noise that permits the measurement of temporal-functional variability of uncertainty in the underlying process. The RGMC permits the evaluation of EDA by
Multiplex families with epilepsy
Afawi, Zaid; Oliver, Karen L.; Kivity, Sara; Mazarib, Aziz; Blatt, Ilan; Neufeld, Miriam Y.; Helbig, Katherine L.; Goldberg-Stern, Hadassa; Misk, Adel J.; Straussberg, Rachel; Walid, Simri; Mahajnah, Muhammad; Lerman-Sagie, Tally; Ben-Zeev, Bruria; Kahana, Esther; Masalha, Rafik; Kramer, Uri; Ekstein, Dana; Shorer, Zamir; Wallace, Robyn H.; Mangelsdorf, Marie; MacPherson, James N.; Carvill, Gemma L.; Mefford, Heather C.; Jackson, Graeme D.; Scheffer, Ingrid E.; Bahlo, Melanie; Gecz, Jozef; Heron, Sarah E.; Corbett, Mark; Mulley, John C.; Dibbens, Leanne M.; Korczyn, Amos D.
2016-01-01
Objective: To analyze the clinical syndromes and inheritance patterns of multiplex families with epilepsy toward the ultimate aim of uncovering the underlying molecular genetic basis. Methods: Following the referral of families with 2 or more relatives with epilepsy, individuals were classified into epilepsy syndromes. Families were classified into syndromes where at least 2 family members had a specific diagnosis. Pedigrees were analyzed and molecular genetic studies were performed as appropriate. Results: A total of 211 families were ascertained over an 11-year period in Israel. A total of 169 were classified into broad familial epilepsy syndrome groups: 61 generalized, 22 focal, 24 febrile seizure syndromes, 33 special syndromes, and 29 mixed. A total of 42 families remained unclassified. Pathogenic variants were identified in 49/211 families (23%). The majority were found in established epilepsy genes (e.g., SCN1A, KCNQ2, CSTB), but in 11 families, this cohort contributed to the initial discovery (e.g., KCNT1, PCDH19, TBC1D24). We expand the phenotypic spectrum of established epilepsy genes by reporting a familial LAMC3 homozygous variant, where the predominant phenotype was epilepsy with myoclonic-atonic seizures, and a pathogenic SCN1A variant in a family where in 5 siblings the phenotype was broadly consistent with Dravet syndrome, a disorder that usually occurs sporadically. Conclusion: A total of 80% of families were successfully classified, with pathogenic variants identified in 23%. The successful characterization of familial electroclinical and inheritance patterns has highlighted the value of studying multiplex families and their contribution towards uncovering the genetic basis of the epilepsies. PMID:26802095
Capacity gains of buffer-aided moving relays
Zafar, Ammar
2017-03-14
This work investigates the gain due to reduction in path loss by deploying buffer-aided moving relaying. In particular, the increase in gain due to moving relays is studied for dual-hop broadcast channels and the bidirectional relay channel. It is shown that the exploited gains in these channels due to buffer-aided relaying can be enhanced by utilizing the fact that a moving relay can communicate with the terminal closest to it and store the data in the buffer and then forward the data to the intended destination when it comes in close proximity with the destination. Numerical results show that for both the considered channels the achievable rates are increased as compared to the case of stationary relays. Numerical results also show that more significant increase in performance is seen when the relay moves to-and-fro between the source and the relay.
Capacity gains of buffer-aided moving relays
Zafar, Ammar; Shaqfeh, Mohammad; Alnuweiri, Hussein; Alouini, Mohamed-Slim
2017-01-01
This work investigates the gain due to reduction in path loss by deploying buffer-aided moving relaying. In particular, the increase in gain due to moving relays is studied for dual-hop broadcast channels and the bidirectional relay channel. It is shown that the exploited gains in these channels due to buffer-aided relaying can be enhanced by utilizing the fact that a moving relay can communicate with the terminal closest to it and store the data in the buffer and then forward the data to the intended destination when it comes in close proximity with the destination. Numerical results show that for both the considered channels the achievable rates are increased as compared to the case of stationary relays. Numerical results also show that more significant increase in performance is seen when the relay moves to-and-fro between the source and the relay.