WorldWideScience

Sample records for achieve cryptic coloration

  1. Spiny mice modulate eumelanin to pheomelanin ratio to achieve cryptic coloration in "evolution canyon," Israel.

    Directory of Open Access Journals (Sweden)

    Natarajan Singaravelan

    Full Text Available BACKGROUND: Coat coloration in mammals is an explicit adaptation through natural selection. Camouflaging with the environment is the foremost evolutionary drive in explaining overall coloration. Decades of enquiries on this topic have been limited to repetitive coat color measurements to correlate the morphs with background/habitat blending. This led to an overwhelming endorsement of concealing coloration as a local phenotypic adaptation in animals, primarily rodents to evade predators. However, most such studies overlooked how rodents actually achieve such cryptic coloration. Cryptic coloration could be attained only through optimization between the yellow- to brown-colored "pheomelanin" and gray to black-colored "eumelanin" in the hairs. However, no study has explored this conjecture yet. "Evolution Canyon" (EC in Israel is a natural microscale laboratory where the relationship between organism and environment can be explored. EC is comprised of an "African" slope (AS, which exhibits a yellow-brownish background habitat, and a "European" slope (ES, exhibiting a dark grayish habitat; both slopes harbor spiny mice (Acomys cahirinus. Here, we examine how hair melanin content of spiny mice living in the opposing slopes of EC evolves toward blending with their respective background habitat. METHODOLOGY/PRINCIPAL FINDINGS: We measured hair-melanin (both eumelanin and pheomelanin contents of 30 spiny mice from the EC using high-performance liquid chromatography (HPLC that detects specific degradation products of eumelanin and pheomelanin. The melanin pattern of A. cahirinus approximates the background color of the slope on which they dwell. Pheomelanin is slightly (insignificantly higher in individuals found on the AS to match the brownish background, whereas individuals of the ES had significantly greater eumelanin content to mimic the dark grayish background. This is further substantiated by a significantly higher eumelanin and pheomelanin ratio on

  2. Color perception influences microhabitat selection of refugia and affects monitoring success for a cryptic anuran species.

    Science.gov (United States)

    Cohen, Bradley S; MacKenzie, Michelle L; Maerz, John C; Farrell, Christopher B; Castleberry, Steven B

    2016-10-01

    Perceptual-biases are important for understanding an animal's natural history, identifying potential ecological traps, and for developing effective means to monitor individuals and populations. Despite research demonstrating anurans having a positive phototactic response towards blue colors, we do not yet understand if color cues are used functionally beyond sexual selection. The aim of our study was to determine if color cues are used in selecting microhabitat, and if anuran's blue-positive phototactic response could increase selection of artificial PVC refugia used to monitor cryptic camouflaging anuran species. We captured 32 Cope's Gray Treefrogs and placed them in mesh enclosures with three PVC tubes painted blue, brown, and white. Concurrently, we placed blue, brown, or unpainted white PVC tubes in stratified arrays around a treefrog breeding pond, and counted the number of occasions treefrogs occupied different colored PVC tubes. In the confined choice experiment, treefrogs selected blue tubes (48.3%) significantly more often than brown (28.5%) or white (23.2%) tubes. Our field experiment mirrored these findings (52.0% of capture events in blue, 29.0% in brown, and 19.0% in unpainted white tubes). Our results suggest color influences Cope's Gray Treefrog microhabitat selection, and they utilize color vision when choosing refugia. We demonstrate simple, small changes based on perceptual-biases can induce behaviors that may in turn have large impacts on sampling techniques used in monitoring and inventorying. Incorporating non-traditional physiological measures into animal inventorying and monitoring programs can be used in the future to improve conservation efforts. PMID:27235736

  3. The Role of Color Vision Anomalies in Elementary School Achievement

    Science.gov (United States)

    Mandola, John

    1969-01-01

    Results of a study involving 13 color-deficient and 15 color-normal pupils in grades three through six, show no evidence of relationship between color vision and achievement. Supports findings of previous studies by Lorenz and McClure (1935), and Shearron (1965). (CJ)

  4. Use of Hyperspectral Imagery to Assess Cryptic Color Matching in Sargassum Associated Crabs.

    Science.gov (United States)

    Russell, Brandon J; Dierssen, Heidi M

    2015-01-01

    Mats of the pelagic macroalgae Sargassum represent a complex environment for the study of marine camouflage at the air-sea interface. Endemic organisms have convergently evolved similar colors and patterns, but quantitative assessments of camouflage strategies are lacking. Here, spectral camouflage of two crab species (Portunus sayi and Planes minutus) was assessed using hyperspectral imagery (HSI). Crabs matched Sargassum reflectance across blue and green wavelengths (400-550 nm) and diverged at longer wavelengths. Maximum discrepancy was observed in the far-red (i.e., 675 nm) where Chlorophyll a absorption occurred in Sargassum and not the crabs. In a quantum catch color model, both crabs showed effective color matching against blue/green sensitive dichromat fish, but were still discernible to tetrachromat bird predators that have visual sensitivity to far red wavelengths. The two species showed opposing trends in background matching with relation to body size. Variation in model parameters revealed that discrimination of crab and background was impacted by distance from the predator, and the ratio of cone cell types for bird predators. This is one of the first studies to detail background color matching in this unique, challenging ecosystem at the air-sea interface. PMID:26352667

  5. Use of Hyperspectral Imagery to Assess Cryptic Color Matching in Sargassum Associated Crabs.

    Science.gov (United States)

    Russell, Brandon J; Dierssen, Heidi M

    2015-01-01

    Mats of the pelagic macroalgae Sargassum represent a complex environment for the study of marine camouflage at the air-sea interface. Endemic organisms have convergently evolved similar colors and patterns, but quantitative assessments of camouflage strategies are lacking. Here, spectral camouflage of two crab species (Portunus sayi and Planes minutus) was assessed using hyperspectral imagery (HSI). Crabs matched Sargassum reflectance across blue and green wavelengths (400-550 nm) and diverged at longer wavelengths. Maximum discrepancy was observed in the far-red (i.e., 675 nm) where Chlorophyll a absorption occurred in Sargassum and not the crabs. In a quantum catch color model, both crabs showed effective color matching against blue/green sensitive dichromat fish, but were still discernible to tetrachromat bird predators that have visual sensitivity to far red wavelengths. The two species showed opposing trends in background matching with relation to body size. Variation in model parameters revealed that discrimination of crab and background was impacted by distance from the predator, and the ratio of cone cell types for bird predators. This is one of the first studies to detail background color matching in this unique, challenging ecosystem at the air-sea interface.

  6. Effect of Color-Coded Notation on Music Achievement of Elementary Instrumental Students.

    Science.gov (United States)

    Rogers, George L.

    1991-01-01

    Presents results of a study of color-coded notation to teach music reading to instrumental students. Finds no clear evidence that color-coded notation enhances achievement on performing by memory, sight-reading, or note naming. Suggests that some students depended on the color-coding and were unable to read uncolored notation well. (DK)

  7. The Impact of Color-Coding Freshmen Integrated-Science Assignments on Student Achievement

    Science.gov (United States)

    Sturdivant Allen, Anita Kay

    Students in Grade 9 exhibit high rates of grade retention and absenteeism. Educators have used different strategies that will increase the achievement of those students. The purpose of this study was to determine whether a relationship existed between student achievement and the strategy to use colored paper for Grade 9 science assignments and tests. Itten's color theory provided the theoretical framework. Itten was one of the first researchers to explore the notion that the human eye can detect wavelengths as colors and that those colors can engage and create order in the human brain. A sample of students assigned to 4 classroom teachers at one high school who volunteered to take part in the study for 18 weeks were used in this quantitative study. Teachers administered student assessments on blue, green, yellow, and white paper. Each class was assigned 1 of the 4 colors for 4.5 weeks. The classes were then assigned a different color for the same length of time until each class had exposure to all 4 colors. Physical science exams given to students in the same grade or subject were used as the dependent variable. An ANOVA indicated that the groups using blue paper scored the highest on the physical science exams; students who used white paper earned the lowest scores. When comparing all 3 groups using colored paper (all three colored paper groups combined into one group) to the white paper groups, t-test results indicated that students using any colored paper scored higher than students using white paper. Further research on the impact of colored paper on student academic performance is necessary. Implications for positive social change indicate that new knowledge about instructional tools that impact student achievement deserves more attention.

  8. Sequence variation in the melanocortin-1 receptor (MC1R pigmentation gene and its role in the cryptic coloration of two South American sand lizards

    Directory of Open Access Journals (Sweden)

    Josmael Corso

    2012-01-01

    Full Text Available In reptiles, dorsal body darkness often varies with substrate color or temperature environment, and is generally presumed to be an adaptation for crypsis or thermoregulation. However, the genetic basis of pigmentation is poorly known in this group. In this study we analyzed the coding region of the melanocortin-1-receptor (MC1R gene, and therefore its role underlying the dorsal color variation in two sympatric species of sand lizards (Liolaemus that inhabit the southeastern coast of South America: L. occipitalis and L. arambarensis. The first is light-colored and occupies aeolic pale sand dunes, while the second is brownish and lives in a darker sandy habitat. We sequenced 630 base pairs of MC1R in both species. In total, 12 nucleotide polymorphisms were observed, and four amino acid replacement sites, but none of them could be associated with a color pattern. Comparative analysis indicated that these taxa are monomorphic for amino acid sites that were previously identified as functionally important in other reptiles. Thus, our results indicate that MC1R is not involved in the pigmentation pattern observed in Liolaemus lizards. Therefore, structural differences in other genes, such as ASIP, or variation in regulatory regions of MC1R may be responsible for this variation. Alternatively, the phenotypic differences observed might be a consequence of non-genetic factors, such as thermoregulatory mechanisms.

  9. The Influence of School Factors on Racial Opportunity Cost for High-Achieving Students of Color

    Science.gov (United States)

    Venzant Chambers, Terah T.; Huggins, Kristin Shawn

    2014-01-01

    Previous work on racial opportunity cost--that is, the price that students of color pay in their pursuit of academic success--is extended here using organizational culture literature to more closely explore the interplay of school culture with the racial opportunity cost experienced by the study participants. Eighteen African American and Latina/o…

  10. Achievements and perspectives in biochemistry concerning anthocyanin modification for blue flower coloration.

    Science.gov (United States)

    Sasaki, Nobuhiro; Nakayama, Toru

    2015-01-01

    Genetic engineering of roses and other plants of floricultural importance to give them a truly blue petal color is arguably one of the holy grails of plant biotechnology. Toward this goal, bluish carnations and roses were previously engineered by establishing an exclusive accumulation of delphinidin (Dp)-type anthocyanins in their petals via the heterologous expression of a flavonoid 3',5'-hydroxylase gene. Very recently, purple-blue varieties of chrysanthemums were also genetically engineered via a similar biochemical strategy. Although the floral colors of these transgenic plants still lack a true blue color, the basis for the future molecular breeding of truly blue flowers is via the engineering of anthocyanin pathways. Anthocyanins with multiple aromatic acyl groups (often referred to as polyacylated anthocyanins) in the 3'- or 7-position tend to display a more stable blue color than non-acylated anthocyanins. The 7-polyacylation process during the biosynthesis of purple-blue anthocyanins in delphinium (Delphinium grandiflorum) was found to occur in vacuoles using acyl-glucose as both the glucosyl and acyl donor. Glucosyltransferases and acyltransferases involved in anthocyanin 7-polyacylation in delphinium are vacuolar acyl-glucose-dependent enzymes belonging to the glycoside hydrolase family 1 and serine carboxypeptidae-like protein family, respectively. The 7-polyacylation proceeds through the alternate glucosylation and p-hydroxybenzoylation catalyzed by these enzymes. p-Hydroxybenzoyl-glucose serves as the p-hydroxybenzoyl and glucosyl donor to produce anthocyanins modified with a p-hydroxybenzoyl-glucose concatemer at the 7-position. This novel finding has provided a potential breakthrough for the genetic engineering of truly blue flowers, where polyacylated Dp-type anthocyanins are accumulated exclusively in the petals.

  11. ROLE OF COLOR TO SUPPORT THE ACHIEVEMENT OF RELAXATION IN BUSSINES HOTEL (CASE STUDIES OF BUSINESS HOTEL IN SEMARANG

    Directory of Open Access Journals (Sweden)

    Adel Issa Elsosan

    2015-12-01

    Full Text Available Semarang sebagai pusat bisnis dan pariwisata di Jawa Tengah memberikan kesempatan bagi investor untuk berinvestasi di Semarang. Akhir-akhir ini bisnis perhotelan di Kota Semarang menunjukkan prospek cerah. Hal ini dapat dilihat dari meningkatnya jumlah wisatawan yang menginap di hotel. Salah satu alasannya adalah banyak kegiatan seperti pertemuan yang diselenggarakan oleh instansi pemerintah, baik lokal maupun nasional, yang diselenggarakan di kota Semarang. Berdasarkan hasil survei awal, sebagian besar hotel di Semarang masih minim fasilitas dan tidak berlaku pentingnya pelaksanaan warna bagi pengunjung. Studi tentang peran warna untuk mencapai relaksasi ini penting karena jika relaksasi mencapai sehingga manusia dapat membuat lebih konsentrasi dan merasa menyegarkan. Tujuan dari penelitian ini adalah: Studi tentang bagaimana warna mempengaruhi dalam penciptaan relaksasi di hotel bisnis di Semarang. Sampel penelitian diarahkan ke hotel menggunakan warna dingin dan hotel warna hangat di Semarang. Metode analisis yang digunakan adalah analisis deskriptif. Berdasarkan hasil dan analisis, kesimpulan dalam penelitian ini adalah: (1 Warna dalam menciptakan relaksasi sangat penting bagi responden dan kedua warna dingin dan warna hangat dapat membuat dan menciptakan relaksasi. (2 Hal-hal yang mempengaruhi pemilihan warna untuk meningkatkan bisnis hotel adalah tujuan untuk tinggal di hotel, pertimbangan ini untuk bekerja dan nilai pribadi seperti liburan, juga relaksasi. [Title: Role of Color to Support The Achievement of Relaxation in Bussines Hotel (Case Studies of Business Hotel in Semarang] Semarang as a business and tourism hub in Central Java provides an opportunity for investors to invest in Semarang. Lately the hospitality business in the city of Semarang show bright prospects. It can be seen from the increasing number of tourists who stay at the hotel. One reason is that many activities such as meetings held by government agencies, both local

  12. Women Physicists of Color Achieving at the Intersection of Race and Gender

    Science.gov (United States)

    Horton, K. Renee

    2006-03-01

    As minority women physicists, we stand at the intersection of race and gender. We are physicists to be sure, but we are also women of Native, African and Hispanic descent. We are colleagues, mothers, sisters, and wives, as are our white counterparts, but our experiences cannot be distilled to only gender or race. As Prudence Carter and Scott Page remind us, women of color emerge from the interaction between race and gender. This distinction is important since most researchers who study American women's participation in science focus exclusively on the participation of white American women. Of those who acknowledge the existence of non-white women, most do so by disclaiming the exclusion of women of color because the numbers are so small or the experiences are different from white American women. There are some important differences however. While American women are 15 percent of all scientists and engineers, black American women are 60 percent of all black scientists and engineers. Yet less than 3 black women and 3 Hispanic women earn PhDs each year, out of about 1100. As Rachel Ivie and Kim Nies Ray point out, ``Minority women especially represent a great, untapped resource that could be drawn on to increase the size of the scientific workforce in the U.S." Donna Nelson's study of diversity in science and engineering faculties further finds that there are no female black or Native American full professors. In physics, there are no black women professors and no Native American women professors at all. Despite such a bleak picture, there is hope. Of the 18 departments that award at least 40 percent of bachelor's degrees to women, 7 are Historically Black Colleges and Universities. Black women are earning degrees from HBCUs at rates above equity, and many singles and firsts at predominantly white institutions continue to persevere despite the obstacles. Prudence Carter. 2005. Intersectional Matters and Meanings: Ethnicity, Gender, and Resistance to ``Acting White

  13. Topics in Current Science Research: Closing the Achievement Gap for Under Resourced Students of Color

    Science.gov (United States)

    Loya Villalpando, Alvaro; Daal, Miguel; Phipps, Arran; Speller, Danielle; Sadoulet, Bernard; Winheld, Rachel; Cryogenic Dark Matter Search Collaboration

    2015-04-01

    Topics in Current Science Research (TCSR) is a five-week summer course offered at the University of California, Berkeley through a collaboration between the Level Playing Field Institute's Summer Math and Science Honors Academy (SMASH) Program and the Cryogenic Dark Matter Search (CDMS) group at UC Berkeley. SMASH is an academic enrichment program geared towards under-resourced, high school students of color. The goals of the course are to expand the students' conception of STEM, to teach the students that science is a method of inquiry and not just a collection of facts that are taught in school, and to expose the scholars to critical thinking within a scientific setting. The course's curriculum engages the scholars in hands-on scientific research, project proposal writing, and presentation of their scientific work to their peers as well as to a panel of UC Berkeley scientists. In this talk, we describe the course and the impact it has had on previous scholars, we discuss how the course's pedagogy has evolved over the past 10 years to enhance students' perception and understanding of science, and we present previous participants' reflections and feedback about the course and its success in providing high school students a genuine research experience at the university level.

  14. Nest Construction by a Ground-nesting Bird Represents a Potential Trade-off Between Egg Crypticity and Thermoregulation

    Science.gov (United States)

    Predation selects against conspicuous colors in bird eggs and nests, while thermoregulatory constraints select for nest building behavior that regulates incubation temperatures. We present results that reveal a trade-off between nest crypticity and thermoregulation of eggs base...

  15. Cryptic exposure to arsenic.

    Science.gov (United States)

    Rossy, Kathleen M; Janusz, Christopher A; Schwartz, Robert A

    2005-01-01

    Arsenic is an odorless, colorless and tasteless element long linked with effects on the skin and viscera. Exposure to it may be cryptic. Although human intake can occur from four forms, elemental, inorganic (trivalent and pentavalent arsenic) and organic arsenic, the trivalent inorganic arsenicals constitute the major human hazard. Arsenic usually reaches the skin from occupational, therapeutic, or environmental exposure, although it still may be employed as a poison. Occupations involving new technologies are not exempt from arsenic exposure. Its acute and chronic effects are noteworthy. Treatment options exist for arsenic-induced pathology, but prevention of toxicity remains the main focus. Vitamin and mineral supplementation may play a role in the treatment of arsenic toxicity.

  16. Cryptic exposure to arsenic

    Directory of Open Access Journals (Sweden)

    Rossy Kathleen

    2005-01-01

    Full Text Available Arsenic is an odorless, colorless and tasteless element long linked with effects on the skin and viscera. Exposure to it may be cryptic. Although human intake can occur from four forms, elemental, inorganic (trivalent and pentavalent arsenic and organic arsenic, the trivalent inorganic arsenicals constitute the major human hazard. Arsenic usually reaches the skin from occupational, therapeutic, or environmental exposure, although it still may be employed as a poison. Occupations involving new technologies are not exempt from arsenic exposure. Its acute and chronic effects are noteworthy. Treatment options exist for arsenic-induced pathology, but prevention of toxicity remains the main focus. Vitamin and mineral supplementation may play a role in the treatment of arsenic toxicity.

  17. Cryptic biodiversity in a changing world

    OpenAIRE

    Luciano B Beheregaray; Caccone, Adalgisa

    2007-01-01

    DNA studies are revealing the extent of hidden, or cryptic, biodiversity. Two new studies challenge paradigms about cryptic biodiversity and highlight the importance of adding a historical and biogeographic dimension to biodiversity research.

  18. The great repression: chromatin and cryptic transcription.

    Science.gov (United States)

    Hennig, Bianca P; Fischer, Tamás

    2013-01-01

    The eukaryotic chromatin structure is essential in correctly defining transcription units. Impairing this structure can activate cryptic promoters, and lead to the accumulation of aberrant RNA transcripts. Here we discuss critical pathways that are responsible for the repression of cryptic transcription and the maintenance of genome integrity.

  19. Role of cryptic genes in microbial evolution.

    Science.gov (United States)

    Hall, B G; Yokoyama, S; Calhoun, D H

    1983-12-01

    Cryptic genes are phenotypically silent DNA sequences, not normally expressed during the life cycle of an individual. They may, however, be activated in a few individuals of a large population by mutation, recombination, insertion elements, or other genetic mechanisms. A consideration of the microbial literature concerning biochemical evolution, physiology, and taxonomy provides the basis for a hypothesis of microbial adaptation and evolution by mutational activation of cryptic genes. Evidence is presented, and a mathematical model is derived, indicating that powerful and biologically important mechanisms exist to prevent the loss of cryptic genes. We propose that cryptic genes persist as a vital element of the genetic repertoire, ready for recall by mutational activation in future generations. Cryptic genes provide a versatile endogenous genetic reservoir that enhances the adaptive potential of a species by a mechanism that is independent of genetic exchange.

  20. Cryptic Mining in Light of Artificial Intelligence

    OpenAIRE

    Shaligram Prajapat; Aditi Thakur; Kajol Maheshwari; Ramjeevan Singh Thakur

    2015-01-01

    “The analysis of cryptic text is hard problem”, and there is no fixed algorithm for generating plain-text from cipher text. Human brains do this intelligently. The intelligent cryptic analysis process needs learning algorithms, co-operative effort of cryptanalyst and mechanism of knowledge based inference engine. This information of knowledge base will be useful for mining data(plain-text, key or cipher text plain-text relationships), classification of cipher text based on enciphering algorit...

  1. Brainstem haematoma due to presumed cryptic telangiectasia.

    OpenAIRE

    Howard, R S

    1986-01-01

    Three patients with primary brainstem haematoma are reported. The clinical presentation suggested an initial diagnosis of pontine tumour in two and demyelination in one patient. The subacute course is characteristic of brainstem haematoma due to presumed cryptic telangiectasia, the abnormal vessels being destroyed by the haemorrhage. These findings emphasise the importance of considering haematoma due to cryptic telangiectasia in the differential diagnosis of subacute brainstem lesions.

  2. Error Filtering Schemes for Color Images in Visual Cryptography

    Directory of Open Access Journals (Sweden)

    Shiny Malar F.R

    2011-11-01

    Full Text Available The color visual cryptography methods are free from the limitations of randomness on color images. The two basic ideas used are error diffusion and pixel synchronization. Error diffusion is a simple method, in which the quantization error at each pixel level is filtered and fed as the input to the next pixel. In this way low frequency that is obtained between the input and output image is minimized which in turn give quality images. Degradation of colors are avoided with the help of pixel synchronization. The proposal of this work presents an efficient color image visual cryptic filtering scheme to improve the image quality on restored original image from visual cryptic shares. The proposed color image visual cryptic filtering scheme presents a deblurring effect on the non-uniform distribution of visual cryptic share pixels. After eliminating blurring effects on the pixels, Fourier transformation is applied to normalize the unevenly transformed share pixels on the original restored image. This in turn improves the quality of restored visual cryptographic image to its optimality. In addition the overlapping portions of the two or multiple visual cryptic shares are filtered out with homogeneity of pixel texture property on the restored original image. Experimentation are conducted with standard synthetic and real data set images, which shows better performance of proposed color image visual cryptic filtering scheme measured in terms of PSNR value (improved to 3 times and share pixel error rate (reduced to nearly 11% with existing grey visual cryptic filters. The results showed that the noise effects such as blurring on the restoration of original image are removed completely.

  3. Population genetics and cryptic species

    International Nuclear Information System (INIS)

    Does the definition of a species matter for pest management purposes? Taxonomists provide us with tools - usually morphological characters - to identify a group of organisms that we call a species. The implication of this identification is that all of the individuals that fit the provided description are members of the species in question. The taxonomists have considered the range of variation among individuals in defining the species, but this variation is often forgotten when we take the concept of species to the level of management. Just as there is morphological variation among individuals, there is also variation in practically any character we might imagine, which has implications for the short and long term success of our management tactics. The rich literature on insecticide resistance should be a constant reminder of the fact that the pressure on pest survival and reproduction applied by our management approaches frequently leads to evolutionary changes within the pest species. The degree of variation within a particular species is a defining characteristic of that species. This level of variability may have very important implications for successful management, so it is very important to measure variation and, whenever possible, the genetic basis of that variation, in a target species. Population genetic approaches can provide evidence of genetic structure (or lack thereof) among populations of a species. These types of data can be used to discuss the movement of pest populations on a local or global scale. In other cases, we may have a complex of species that share some, but not all, characteristics. Species complexes that share morphological characters (i.e., cannot be easily distinguished) but not biological characters are referred to as sibling or cryptic species

  4. Discrimination, crypticity, and incipient taxa in entamoeba.

    Science.gov (United States)

    Espinosa, Avelina; Paz-Y-Miño-C, Guillermo

    2012-01-01

    Persistent difficulties in resolving clear lineages in diverging populations of prokaryotes or unicellular eukaryotes (protistan polyphyletic groups) are challenging the classical species concept. Although multiple integrated approaches would render holistic taxonomies, most phylogenetic studies are still based on single-gene or morphological traits. Such methodologies conceal natural lineages, which are considered "cryptic." The concept of species is considered artificial and inadequate to define natural populations. Social organisms display differential behaviors toward kin than to nonrelated individuals. In "social" microbes, kin discrimination has been used to help resolve crypticity. Aggregative behavior could be explored in a nonsocial protist to define phylogenetic varieties that are considered "cryptic." Two Entamoeba invadens strains, IP-1 and VK-1:NS are considered close populations of the same "species." This study demonstrates that IP-1 and VK-1:NS trophozoites aggregate only with alike members and discriminate members of different strains based on behavioral and chemical signals. Combined morphological, behavioral/chemical, and ecological studies could improve Archamoebae phylogenies and define cryptic varieties. Evolutionary processes in which selection acted continuously and cumulatively on ancestors of Entamoeba populations gave rise to chemical and behavioral signals that allowed individuals to discriminate nonpopulation members and, gradually, to the emergence of new lineages; alternative views that claim a "Designer" or "Creator" as responsible for protistan diversity are unfounded.

  5. Cryptic Mining in Light of Artificial Intelligence

    Directory of Open Access Journals (Sweden)

    Shaligram Prajapat

    2015-08-01

    Full Text Available “The analysis of cryptic text is hard problem”, and there is no fixed algorithm for generating plain-text from cipher text. Human brains do this intelligently. The intelligent cryptic analysis process needs learning algorithms, co-operative effort of cryptanalyst and mechanism of knowledge based inference engine. This information of knowledge base will be useful for mining data(plain-text, key or cipher text plain-text relationships, classification of cipher text based on enciphering algorithms, key length or any other desirable parameters, clustering of cipher text based on similarity and extracting association rules for identifying weaknesses of cryptic algorithms. This categorization will be useful for placing given cipher text into a specific category or solving difficult level of cipher text-plain text conversion process. This paper elucidates cipher text-plain text process first than utilizes it to create a framework for AI-enabled-Cryptanalysis system. The process demonstrated in this paper attempts to analyze captured cipher from scratch. The system design elements presented in the paper gives all hints and guidelines for development of AI enabled Cryptic analysis tool.

  6. Using color management in color document processing

    Science.gov (United States)

    Nehab, Smadar

    1995-04-01

    Color Management Systems have been used for several years in Desktop Publishing (DTP) environments. While this development hasn't matured yet, we are already experiencing the next generation of the color imaging revolution-Device Independent Color for the small office/home office (SOHO) environment. Though there are still open technical issues with device independent color matching, they are not the focal point of this paper. This paper discusses two new and crucial aspects in using color management in color document processing: the management of color objects and their associated color rendering methods; a proposal for a precedence order and handshaking protocol among the various software components involved in color document processing. As color peripherals become affordable to the SOHO market, color management also becomes a prerequisite for common document authoring applications such as word processors. The first color management solutions were oriented towards DTP environments whose requirements were largely different. For example, DTP documents are image-centric, as opposed to SOHO documents that are text and charts centric. To achieve optimal reproduction on low-cost SOHO peripherals, it is critical that different color rendering methods are used for the different document object types. The first challenge in using color management of color document processing is the association of rendering methods with object types. As a result of an evolutionary process, color matching solutions are now available as application software, as driver embedded software and as operating system extensions. Consequently, document processing faces a new challenge, the correct selection of the color matching solution while avoiding duplicate color corrections.

  7. Color grading and colors in film

    OpenAIRE

    Výbora, Jan

    2016-01-01

    This thesis focuses on use of colors in film industry and the possibilities of color grading. It examines manipulation with colors in film history, and examines color theory, which in- cludes their use, meanings and ways of combining them. Next, it maps common visuals styles used in film industry and compares how frequently they are used. With the help of all gathered knowledge, it presents few ways how to color grade in DaVinci Resolve software to achieve desired look. The outcome of the col...

  8. Cryptic function loss in animal populations.

    Science.gov (United States)

    McConkey, Kim R; O'Farrill, Georgina

    2015-04-01

    The essential functional roles performed by animal species are lost when they become locally extinct, and ecosystems are critically threatened by this decline in functional diversity. Theory that links function, diversity, and ecosystem stability exists but fails to assess function loss that occurs in species with persistent populations. The entire functional role of a species, or a critical component of it, can be lost following large population declines (functional extinction), following population increase, or after behavioural adaptations to changes in the population, community, habitat, or climate. Here, we provide a framework that identifies the scenarios under which 'cryptic' function loss can occur in persistent populations. Cryptic function loss is potentially widespread and critically threatens ecosystem stability across the globe. PMID:25678379

  9. Color-induced graph colorings

    CERN Document Server

    Zhang, Ping

    2015-01-01

    A comprehensive treatment of color-induced graph colorings is presented in this book, emphasizing vertex colorings induced by edge colorings. The coloring concepts described in this book depend not only on the property required of the initial edge coloring and the kind of objects serving as colors, but also on the property demanded of the vertex coloring produced. For each edge coloring introduced, background for the concept is provided, followed by a presentation of results and open questions dealing with this topic. While the edge colorings discussed can be either proper or unrestricted, the resulting vertex colorings are either proper colorings or rainbow colorings. This gives rise to a discussion of irregular colorings, strong colorings, modular colorings, edge-graceful colorings, twin edge colorings and binomial colorings. Since many of the concepts described in this book are relatively recent, the audience for this book is primarily mathematicians interested in learning some new areas of graph colorings...

  10. Color Homography

    OpenAIRE

    Finlayson, Graham; Gong, Han; Fisher, Robert

    2016-01-01

    We show the surprising result that colors across a change in viewing condition (changing light color, shading and camera) are related by a homography. Our homography color correction application delivers improved color fidelity compared with the linear least-square.

  11. Color Blindness

    Science.gov (United States)

    ... rose in full bloom. If you have a color vision defect, you may see these colors differently than most people. There are three main kinds of color vision defects. Red-green color vision defects are the ...

  12. Familial cryptic translocation in Angelman syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Weyerts, L.K.; Wiley, J.E.; Loud, K.M. [ECU School of Medicine, Greenville, NC (United States)] [and others

    1994-09-01

    The majority of patients with Angelman syndrome have been shown to have a cytogenetic or molecular deletion on the maternally derived chromosome 15. We report on a case of Angelman syndrome in which this deletion occurs as an unbalanced cryptic translocation involving chromosomes 14 and 15. The proband was diagnosed clinically as having Angelman syndrome. Multiple cytogenetic studies were done without detecting any deletion. When DNA probes (Oncor) specific for the Prader Willi/Angelman locus became available, the patient was restudied and found to be deleted for {open_quotes}region A{close_quotes} (D15S11) but not for {open_quotes}region B{close_quotes} (GABRB3). No other abnormality was detected. The proband`s mother was then studied. The chromosome 15 marker probe and D15S11 were detected on different chromosomes. Using alpha-satellite probes, a cryptic 14;15 translocation was uncovered. This balanced translocation was also found to be carried by the sister of the proband. This case, along with a case presented at the 1993 ASHG meeting, illustrates the need for using acrocentric probes when studying Angelman syndrome patients. The proband was studied using additional probes specific for this region and found to be deleted for SNRPN but not for D15S10. The breakpoint of the translocation in this patient delineates the smallest deletion of the Angelman syndrome region reported to date and therefore may represent the specific gene involved.

  13. Cryptic species in putative ancient asexual darwinulids (Crustacea, Ostracoda.

    Directory of Open Access Journals (Sweden)

    Isa Schön

    Full Text Available BACKGROUND: Fully asexually reproducing taxa lack outcrossing. Hence, the classic Biological Species Concept cannot be applied. METHODOLOGY/PRINCIPAL FINDINGS: We used DNA sequences from the mitochondrial COI gene and the nuclear ITS2 region to check species boundaries according to the evolutionary genetic (EG species concept in five morphospecies in the putative ancient asexual ostracod genera, Penthesilenula and Darwinula, from different continents. We applied two methods for detecting cryptic species, namely the K/θ method and the General Mixed Yule Coalescent model (GMYC. We could confirm the existence of species in all five darwinulid morphospecies and additional cryptic diversity in three morphospecies, namely in Penthesilenula brasiliensis, Darwinula stevensoni and in P. aotearoa. The number of cryptic species within one morphospecies varied between seven (P. brasiliensis, five to six (D. stevensoni and two (P. aotearoa, respectively, depending on the method used. Cryptic species mainly followed continental distributions. We also found evidence for coexistence at the local scale for Brazilian cryptic species of P. brasiliensis and P. aotearoa. Our ITS2 data confirmed that species exist in darwinulids but detected far less EG species, namely two to three cryptic species in P. brasiliensis and no cryptic species at all in the other darwinulid morphospecies. CONCLUSIONS/SIGNIFICANCE: Our results clearly demonstrate that both species and cryptic diversity can be recognized in putative ancient asexual ostracods using the EG species concept, and that COI data are more suitable than ITS2 for this purpose. The discovery of up to eight cryptic species within a single morphospecies will significantly increase estimates of biodiversity in this asexual ostracod group. Which factors, other than long-term geographic isolation, are important for speciation processes in these ancient asexuals remains to be investigated.

  14. The Economic Benefits of Closing Educational Achievement Gaps: Promoting Growth and Strengthening the Nation by Improving the Educational Outcomes of Children of Color

    Science.gov (United States)

    Lynch, Robert G.; Oakford, Patrick

    2014-01-01

    Our nation is currently experiencing growing levels of income and wealth inequality, which are contributing to longstanding racial and ethnic gaps in education outcomes and other areas. This report quantifies the economic benefits of closing one of the most harmful racial and ethnic gaps: the educational achievement gap that exists between black…

  15. Population Structure and Cryptic Relatedness in Genetic Association Studies

    OpenAIRE

    Astle, William; Balding, David J.

    2010-01-01

    We review the problem of confounding in genetic association studies, which arises principally because of population structure and cryptic relatedness. Many treatments of the problem consider only a simple ``island'' model of population structure. We take a broader approach, which views population structure and cryptic relatedness as different aspects of a single confounder: the unobserved pedigree defining the (often distant) relationships among the study subjects. Kinship is therefore a cent...

  16. Image composition with color harmonization

    Institute of Scientific and Technical Information of China (English)

    Congde Wang; Rong Zhang; Fan Deng

    2009-01-01

    Image matting and color transfer are combined to achieve image composition.Firstly,digital matting is used to pull out the region of interest.Secondly,taking color harmonization into account,color transfer techniques are introduced in pasting the region onto the target image.Experimental results show that the proposed approach generates visually plea.sing composite images.

  17. Color blindness

    Science.gov (United States)

    ... color blindness often have problems seeing reds and greens, too. The most severe form of color blindness is achromatopsia. This is a rare condition in which a person cannot see any color, only shades of gray. Most color blindness is due to ...

  18. Color Blindness

    Institute of Scientific and Technical Information of China (English)

    严双红

    2007-01-01

    About one in 12 boys is color-blind, and one in every 400 girls, so in each school class there are likely to be at least one or two people who are color-blind. Because they are color- blind from birth, most people do not know that they are color-

  19. Cryptic Genetic Variation in Evolutionary Developmental Genetics

    Directory of Open Access Journals (Sweden)

    Annalise B. Paaby

    2016-06-01

    Full Text Available Evolutionary developmental genetics has traditionally been conducted by two groups: Molecular evolutionists who emphasize divergence between species or higher taxa, and quantitative geneticists who study variation within species. Neither approach really comes to grips with the complexities of evolutionary transitions, particularly in light of the realization from genome-wide association studies that most complex traits fit an infinitesimal architecture, being influenced by thousands of loci. This paper discusses robustness, plasticity and lability, phenomena that we argue potentiate major evolutionary changes and provide a bridge between the conceptual treatments of macro- and micro-evolution. We offer cryptic genetic variation and conditional neutrality as mechanisms by which standing genetic variation can lead to developmental system drift and, sheltered within canalized processes, may facilitate developmental transitions and the evolution of novelty. Synthesis of the two dominant perspectives will require recognition that adaptation, divergence, drift and stability all depend on similar underlying quantitative genetic processes—processes that cannot be fully observed in continuously varying visible traits.

  20. Uncalibrated color

    Science.gov (United States)

    Moroney, Nathan

    2006-01-01

    Color calibration or the use of color measurement processes to characterize the color properties of a device or workflow is often expected or assumed for many color reproduction applications. However it is interesting to consider applications or situations in which color calibration is not as critical. In the first case it is possible to imagine an implicit color calibration resulting from a standardization or convergence of the colorant and substrate spectrum. In the second case it is possible to imagine cases where the device color variability is significantly less than the user color thresholds or expectations for color consistency. There are still general requirements for this form of pragmatic color but they are generally lower than for the higher end of digital color reproduction. Finally it is possible to imagine an implicit calibration that leverages in some way the highly accurate memory color for the hue of common objects. This scenario culminates with a challenge to create a natural capture calibration standard that does not require individual calibration, is spectrally diverse, is inexpensive and is environmentally friendly.

  1. Ocean Color

    Data.gov (United States)

    National Aeronautics and Space Administration — Satellite-derived Ocean Color Data sets from historical and currently operational NASA and International Satellite missions including the NASA Coastal Zone Color...

  2. Multiple rearrangements in cryptic species of electric knifefish, Gymnotus carapo (Gymnotidae, Gymnotiformes revealed by chromosome painting

    Directory of Open Access Journals (Sweden)

    O'Brien Patricia CM

    2010-04-01

    Full Text Available Abstract Background Gymnotus (Gymnotidae, Gymnotiformes is the Neotropical electric fish genus with the largest geographic distribution and the largest number of species, 33 of which have been validated. The diploid number varies from 2n = 39-40 to 2n = 54. Recently we studied the karyotype of morphologically indistinguishable samples from five populations of G. carapo sensu stricto from the Eastern Amazon of Brazil. We found two cytotypes, 2n = 42 (30 M/SM + 12 ST/A and 2n = 40 (34 M/SM + 6 ST/A and we concluded that the differences between the two cryptic species are due to pericentric inversions and one tandem fusion. Results In this study we use for the first time, whole chromosome probes prepared by FACS of the Gymnotus carapo sensu strictu species, cytotype with 2n = 42. Using two color hybridizations we were able to distinguish pairs 1, 2, 3, 7, 9, 14, 16, 18, 19, 20 and 21. It was not possible to separate by FACS and distinguish each of the following chromosome pairs even with dual color FISH: {4,8}; {10,11}; {5,6,17}; {12,13,15}. The FISH probes were then used in chromosome painting experiments on metaphases of the 2n = 40 cytotype. While some chromosomes show conserved synteny, others are rearranged in different chromosomes. Eight syntenic associations were found. Conclusions These results show that the karyotype differences between these cryptic species are greater than assumed by classical cytogenetics. These data reinforce the previous supposition that these two cytotypes are different species, despite the absence of morphological differences. Additionally, the homology of repetitive DNA between the two provides evidence of recent speciation.

  3. Color Names

    OpenAIRE

    Benavente, Robert; Van De Weijer, Joost; Vanrell, Maria; Schmid, Cordelia; Baldrich, Ramon; Verbeek, Jakob; Larlus, Diane

    2012-01-01

    International audience Within a computer vision context color naming is the action of assigning linguistic color labels to pixels, regions or objects in images. Humans use color names routinely and seemingly without effort to describe the world around us. They have been primarily studied in the fields of visual psychology, anthropology and linguistics [17]. Color names are for example used in the context of image retrieval. A user might query an image search engine for "red cars". The syste...

  4. Color invariance

    NARCIS (Netherlands)

    J.M. Geusebroek; R. van den Boomgaard; A.W.M. Smeulders; H. Geerts

    2001-01-01

    This paper presents the measurement of colored object reflectance, under different, general assumptions regarding the imaging conditions. We exploit the Gaussian scale-space paradigm for color images to define a framework for the robust measurement of object reflectance from color images. Object ref

  5. Cryptic Methane Emissions from Upland Forest Ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Megonigal, Patrick [Smithsonian Institution, Washington, DC (United States); Pitz, Scott [Johns Hopkins Univ., Baltimore, MD (United States); Smithsonian Institution, Washington, DC (United States)

    2016-04-19

    This exploratory research on Cryptic Methane Emissions from Upland Forest Ecosystems was motivated by evidence that upland ecosystems emit 36% as much methane to the atmosphere as global wetlands, yet we knew almost nothing about this source. The long-term objective was to refine Earth system models by quantifying methane emissions from upland forests, and elucidate the biogeochemical processes that govern upland methane emissions. The immediate objectives of the grant were to: (i) test the emerging paradigm that upland trees unexpectedly transpire methane, (ii) test the basic biogeochemical assumptions of an existing global model of upland methane emissions, and (iii) develop the suite of biogeochemical approaches that will be needed to advance research on upland methane emissions. We instrumented a temperate forest system in order to explore the processes that govern upland methane emissions. We demonstrated that methane is emitted from the stems of dominant tree species in temperate upland forests. Tree emissions occurred throughout the growing season, while soils adjacent to the trees consumed methane simultaneously, challenging the concept that forests are uniform sinks of methane. High frequency measurements revealed diurnal cycling in the rate of methane emissions, pointing to soils as the methane source and transpiration as the most likely pathway for methane transport. We propose the forests are smaller methane sinks than previously estimated due to stem emissions. Stem emissions may be particularly important in upland tropical forests characterized by high rainfall and transpiration, resolving differences between models and measurements. The methods we used can be effectively implemented in order to determine if the phenomenon is widespread.

  6. Geochemical evidence for cryptic sulfur cycling in salt marsh sediments

    DEFF Research Database (Denmark)

    Mills, Jennifer V.; Antler, Gilad; Turchyn, Alexandra V.

    2016-01-01

    to represent the salt marsh sediments suggests that the uptake rate of sulfate during this cryptic sulfur cycling is similar to the uptake rate of sulfate during the fastest microbial sulfate reduction that has been measured in the natural environment. The difference is that during cryptic sulfur cycling, all...... investigate sulfur cycling in salt marsh sediments from Norfolk, England where we observe high ferrous iron concentrations with no depletion of sulfate or change in the sulfur isotope ratio of that sulfate, but a 5‰ increase in the oxygen isotope ratio in sulfate, indicating that sulfate has been through...... a reductive cycle replacing its oxygen atoms. This cryptic sulfur cycle was replicated in laboratory incubations using 18O-enriched water, demonstrating that the field results do not solely result from mixing processes in the natural environment. Numerical modeling of the laboratory incubations scaled...

  7. Color Categories and Color Appearance

    Science.gov (United States)

    Webster, Michael A.; Kay, Paul

    2012-01-01

    We examined categorical effects in color appearance in two tasks, which in part differed in the extent to which color naming was explicitly required for the response. In one, we measured the effects of color differences on perceptual grouping for hues that spanned the blue-green boundary, to test whether chromatic differences across the boundary…

  8. Color Terms and Color Concepts

    Science.gov (United States)

    Davidoff, Jules

    2006-01-01

    In their lead articles, both Kowalski and Zimiles (2006) and O'Hanlon and Roberson (2006) declare a general relation between color term knowledge and the ability to conceptually represent color. Kowalski and Zimiles, in particular, argue for a priority for the conceptual representation in color term acquisition. The complexities of the interaction…

  9. Antifungal susceptibility profile of cryptic species of Aspergillus.

    Science.gov (United States)

    Alastruey-Izquierdo, Ana; Alcazar-Fuoli, Laura; Cuenca-Estrella, Manuel

    2014-12-01

    The use of molecular tools has led to the description of new cryptic species among different Aspergillus species complexes. Their frequency in the clinical setting has been reported to be between 10 and 15%. The susceptibility to azoles and amphotericin B of many of these species is low, and some of them, such as Aspergillus calidoustus or Aspergillus lentulus, are considered multi-resistant. The changing epidemiology, the frequency of cryptic species, and the different susceptibility profiles make antifungal susceptibility testing an important tool to identify the optimal antifungal agent to treat the infections caused by these species.

  10. Disruptive coloration provides camouflage independent of background matching

    OpenAIRE

    Schaefer, H. Martin; Stobbe, Nina

    2006-01-01

    Natural selection shapes the evolution of anti-predator defences, such as camouflage. It is currently contentious whether crypsis and disruptive coloration are alternative mechanisms of camouflage or whether they are interrelated anti-predator defences. Disruptively coloured prey is characterized by highly contrasting patterns to conceal the body shape, whereas cryptic prey minimizes the contrasts to background. Determining bird predation of artificial moths, we found that moths which were di...

  11. Cryptic species and genetic structure in Didemnum granulatum Tokioka, 1954 (Tunicata: Ascidiacea) from the southern Brazilian coast.

    Science.gov (United States)

    Bouzon, J L; Vargas, S M; Oliveira Neto, J F; Stoco, P H; Brandini, F P

    2014-11-01

    Didemnum granulatum is a colonial fouling ascidian that lives in subtidal substrates, worldwide. It exhibits two morphotypes, orange and beige. In this study, we verified if the color morphotypes and/or the spatial distribution of specimens in different islands might be associated to patterns of genetic structure of a single species, or if they represent distinct cryptic species. Specimens were collected in four islands, along the coast of the Santa Catarina state. A segment of 490 bp from the mitochondrial gene cytochrome c oxidase subunit 1 (COI) was amplified from 45 samples. Twenty-one haplotypes were identified. The total haplotype diversity (0.912) and the total nucleotide diversity (0.044) were high. The global Fst of the populations analyzed was 0.97, with most of the variation occurring between orange and beige groups (82.19%). The variation found between populations within groups was 15.37%, and 2.45% within populations. Haplotype networks and the neighbor-joining tree showed clear genetic divergence between individuals of distinct colors, and between the islands. These evidences strongly support the presence of a complex of two cryptic species for D. granulatum occupying the studied area. Both species were also highly genetically structured between islands, suggesting that the conservation process of these populations is complex. PMID:25627604

  12. Color Analysis

    Science.gov (United States)

    Wrolstad, Ronald E.; Smith, Daniel E.

    Color, flavor, and texture are the three principal quality attributes that determine food acceptance, and color has a far greater influence on our judgment than most of us appreciate. We use color to determine if a banana is at our preferred ripeness level, and a discolored meat product can warn us that the product may be spoiled. The marketing departments of our food corporations know that, for their customers, the color must be "right." The University of California Davis scorecard for wine quality designates four points out of 20, or 20% of the total score, for color and appearance (1). Food scientists who establish quality control specifications for their product are very aware of the importance of color and appearance. While subjective visual assessment and use of visual color standards are still used in the food industry, instrumental color measurements are extensively employed. Objective measurement of color is desirable for both research and industrial applications, and the ruggedness, stability, and ease of use of today's color measurement instruments have resulted in their widespread adoption.

  13. RGBW color separation for field sequential color LCDs

    Science.gov (United States)

    Sun, Pei-Li

    2008-01-01

    Field sequential color (FSC) LCD is one of the preferred display technologies to achieve wide color gamut and high luminous efficiency. But this technology suffers from an unpleasing color breakup effect. This phenomenon can be reduced by adding a white primary. As RGBW primaries are recommended for FSC-LCD, the next question is how to convert standard RGB signals to RGBW without large color variations. The present study first optimal the spectra of RGB primaries using the 3D gamut boundaries of standard object color spectra (SOCS) database and Adobe RGB in CIECAM02 space with observer metamerism constraint. The optimal RGB primaries then were used to derive six modes for RGB to RGBW conversion. The final step is to further optimize color correction matrix based on CIE170-1:2006 'age and size dependent cone fundamentals' to compensate the visual color shift of elders.

  14. Color Portraits: From Color Picking to Interacting with Color

    OpenAIRE

    Jalal, Ghita; Maudet, Nolwenn; Mackay, Wendy E.

    2015-01-01

    Although ubiquitous, color pickers have remained largely unchanged for 25 years. Based on contextual interviews with artists and designers, we created the Color Portraits design space to characterize five key color manipulation activities: sampling and tweaking individual colors, manipulating color relationships, combining colors with other elements, revisiting previous color choices, and revealing a design process through color. We found similar color manipulation requirements with scientist...

  15. Modeling human color categorization: color discrimination and color memory

    OpenAIRE

    Broek, van den, M.M.P.; Hendriks, M.A.; Puts, M.J.H.; Heskes, T.; Lucas, P.; Vuurpijl, L.G.; W. Wiegerinck

    2003-01-01

    Color matching in Content-Based Image Retrieval is done using a color space and measuring distances between colors. Such an approach yields non-intuitive results for the user. We introduce color categories (or focal colors), determine that they are valid, and use them in two experiments. The experiments conducted prove the difference between color categorization by the cognitive processes color discrimination and color memory. In addition, they yield a Color Look-Up Table, which can improve c...

  16. COLOR IMAGES

    Directory of Open Access Journals (Sweden)

    Dominique Lafon

    2011-05-01

    Full Text Available The goal of this article is to present specific capabilities and limitations of the use of color digital images in a characterization process. The whole process is investigated, from the acquisition of digital color images to the analysis of the information relevant to various applications in the field of material characterization. A digital color image can be considered as a matrix of pixels with values expressed in a vector-space (commonly 3 dimensional space whose specificity, compared to grey-scale images, is to ensure a coding and a representation of the output image (visualisation printing that fits the human visual reality. In a characterization process, it is interesting to regard color image attnbutes as a set of visual aspect measurements on a material surface. Color measurement systems (spectrocolorimeters, colorimeters and radiometers and cameras use the same type of light detectors: most of them use Charge Coupled Devices sensors. The difference between the two types of color data acquisition systems is that color measurement systems provide a global information of the observed surface (average aspect of the surface: the color texture is not taken into account. Thus, it seems interesting to use imaging systems as measuring instruments for the quantitative characterization of the color texture.

  17. Stridulations reveal cryptic speciation in neotropical sympatric ants.

    Directory of Open Access Journals (Sweden)

    Ronara Souza Ferreira

    Full Text Available The taxonomic challenge posed by cryptic species underlines the importance of using multiple criteria in species delimitation. In the current paper we tested the use of acoustic analysis as a tool to assess the real diversity in a cryptic species complex of Neotropical ants. In order to understand the potential of acoustics and to improve consistency in the conclusions by comparing different approaches, phylogenetic relationships of all the morphs considered were assessed by the analysis of a fragment of the mitochondrial DNA cytochrome b. We observed that each of the cryptic morph studied presents a morphologically distinct stridulatory organ and that all sympatric morphs produce distinctive stridulations. This is the first evidence of such a degree of specialization in the acoustic organ and signals in ants, which suggests that stridulations may be among the cues used by these ants during inter-specific interactions. Mitochondrial DNA variation corroborated the acoustic differences observed, confirming acoustics as a helpful tool to determine cryptic species in this group of ants, and possibly in stridulating ants in general. Congruent morphological, acoustic and genetic results constitute sufficient evidence to propose each morph studied here as a valid new species, suggesting that P. apicalis is a complex of at least 6 to 9 species, even if they present different levels of divergence. Finally, our results highlight that ant stridulations may be much more informative than hitherto thought, as much for ant communication as for integrative taxonomists.

  18. Why do cryptic species tend not to co-occur? A case study on two cryptic pairs of butterflies.

    Directory of Open Access Journals (Sweden)

    Raluca Vodă

    Full Text Available As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus-P. celina (Lycaenidae, to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and 'precipitation during the driest quarter' was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like "founder takes all" and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns.

  19. Colors and Some Morphological Traits as Defensive Mechanisms in Anurans

    Directory of Open Access Journals (Sweden)

    Luís Felipe Toledo

    2009-01-01

    Full Text Available Anurans may be brightly colored or completely cryptic. Generally, in the former situation, we are dealing with aposematism, and the latter is an example of camouflage. However, these are only simple views of what such colorations really mean and which defensive strategy is implied. For instance, a brightly colored frog may be part of a mimicry ring, which could be either Batesian, Müllerian, or Browerian. These are only examples of the diversity of color-usage systems as defensive strategies. Unfortunately, reports on the use of colors as defensive mechanisms are widespread in the available literature, and the possible functions are rarely mentioned. Therefore, we reviewed the literature and added new data to this subject. Then, we the use of colors (as defensive mechanism into categories. Mimicry was divided into the subcategories camouflage, homotypy, and nondeceitful homotypy, and these groups were also subcategorized. Dissuasive coloration was divided into behavioral display of colors, polymorphism, and polyphenism. Aposematism was treated apart, but aposematic colorations may be present in other defensive strategies. Finally, we propose functions and forms of evolution for some color systems in post-metamorphic anurans and hope that this review can be the basis for future research, even on other animal groups.

  20. Fiber-optic color synthesizer.

    Science.gov (United States)

    Jeong, Y; Lee, D; Lee, Jhang W; Oh, K

    2006-07-15

    Full-color synthesis was achieved, for what we believe is the first time, utilizing a novel 3x1 hard polymer-clad fiber coupler along with red, green, and blue (RGB) LED primaries. By using RGB LEDs that are coupled to three input ports, the device rendered full color from the output port with a circular emitting pixel of 135 microm in diameter with an extended color gamut. The proposed fiber-optic color synthesizer can provide a compact waveguide solution for the beam scanning display and the tunable pure white source for LED backlighting.

  1. Color 3D Reverse Engineering

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    This paper presents a principle and a method of col or 3D laser scanning measurement. Based on the fundamental monochrome 3D measureme nt study, color information capture, color texture mapping, coordinate computati on and other techniques are performed to achieve color 3D measurement. The syste m is designed and composed of a line laser light emitter, one color CCD camera, a motor-driven rotary filter, a circuit card and a computer. Two steps in captu ring object's images in the measurement process: Firs...

  2. Color vision.

    Science.gov (United States)

    Gegenfurtner, Karl R; Kiper, Daniel C

    2003-01-01

    Color vision starts with the absorption of light in the retinal cone photoreceptors, which transduce electromagnetic energy into electrical voltages. These voltages are transformed into action potentials by a complicated network of cells in the retina. The information is sent to the visual cortex via the lateral geniculate nucleus (LGN) in three separate color-opponent channels that have been characterized psychophysically, physiologically, and computationally. The properties of cells in the retina and LGN account for a surprisingly large body of psychophysical literature. This suggests that several fundamental computations involved in color perception occur at early levels of processing. In the cortex, information from the three retino-geniculate channels is combined to enable perception of a large variety of different hues. Furthermore, recent evidence suggests that color analysis and coding cannot be separated from the analysis and coding of other visual attributes such as form and motion. Though there are some brain areas that are more sensitive to color than others, color vision emerges through the combined activity of neurons in many different areas.

  3. Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae

    OpenAIRE

    alves, a; Crous, P.W.; Correia, A; Phillips, A.J.L.

    2008-01-01

    Lasiodiplodia theobromae is a common pathogen that Occurs on a large number of hosts in the tropics and subtropics. A collection of isolates identified as L. theobromae was studied on the basis of sequence data from the ITS regions and EF1-alpha gene. Phylogenetic analyses identified three well-supported clades within this group of isolates, one corresponding to L. theobromae and two others corresponding to potential cryptic species. The distinct phylogenetic position of the two clades is sup...

  4. The cryptic enhancer elements of the tCUP promoter.

    Science.gov (United States)

    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian

    2003-02-01

    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  5. Taxonomic distribution of cryptic diversity among metazoans: not so homogeneous after all.

    Science.gov (United States)

    Pérez-Ponce de León, Gerardo; Poulin, Robert

    2016-08-01

    Cryptic diversity plagues estimates of biodiversity, conservation efforts and attempts to control diseases and invasive species. Here, we re-visit a decade-old assessment of whether or not cryptic species are homogeneously reported among higher metazoan taxa. We compiled information from an extensive survey of the literature to recover all reports of cryptic species among metazoans. After correcting for currently known species richness and research effort per taxon, we find that cryptic species are over-reported in some taxa and under-reported in others. Although several taxa showing either a lack or an excess of reported cryptic species were poorly studied invertebrate groups, we found that cryptic species were over-reported in amphibians, reptiles and crustaceans, all relatively well-studied groups. The observed heterogeneity in the distribution of reported cryptic species may reflect taxon-specific properties affecting either the propensity for cryptic species to be formed or their likelihood of being detected by conventional taxonomy. Either way, the implications of cryptic diversity may not apply equally across all taxonomic groups. PMID:27555648

  6. Modeling human color categorization: color discrimination and color memory

    NARCIS (Netherlands)

    Broek, van den E.L.; Hendriks, M.A.; Puts, M.J.H.; Vuurpijl, L.G.; Heskes, T.; Lucas, P.; Vuurpijl, L.G.; Wiegerinck, W.

    2003-01-01

    Color matching in Content-Based Image Retrieval is done using a color space and measuring distances between colors. Such an approach yields non-intuitive results for the user. We introduce color categories (or focal colors), determine that they are valid, and use them in two experiments. The experim

  7. Color Calibration for Colorized Vision System with Digital Sensor and LED Array Illuminator

    Directory of Open Access Journals (Sweden)

    Zhenmin Zhu

    2016-01-01

    Full Text Available Color measurement by the colorized vision system is a superior method to achieve the evaluation of color objectively and continuously. However, the accuracy of color measurement is influenced by the spectral responses of digital sensor and the spectral mismatch of illumination. In this paper, two-color vision system illuminated by digital sensor and LED array, respectively, is presented. The Polynomial-Based Regression method is applied to solve the problem of color calibration in the sRGB and CIE  L⁎a⁎b⁎ color spaces. By mapping the tristimulus values from RGB to sRGB color space, color difference between the estimated values and the reference values is less than 3ΔE. Additionally, the mapping matrix ΦRGB→sRGB has proved a better performance in reducing the color difference, and it is introduced subsequently into the colorized vision system proposed for a better color measurement. Necessarily, the printed matter of clothes and the colored ceramic tile are chosen as the application experiment samples of our colorized vision system. As shown in the experimental data, the average color difference of images is less than 6ΔE. It indicates that a better performance of color measurement is obtained via the colorized vision system proposed.

  8. Colored Preons

    CERN Document Server

    Finkelstein, Robert J

    2009-01-01

    Previous studies have suggested complementary models of the elementary particles as (a) quantum knots and (b) preonic nuclei that are field and particle descriptions, respectively, of the same particles. This earlier work, carried out in the context of standard electroweak (SU(2) x U(1)) physics, is here extended to the strong interactions by the introduction of color (SU(3)) charges.

  9. Color tejido

    OpenAIRE

    Rius Tormo, Palmira

    2010-01-01

    La exposición que se propone tiene como núcleo principal el color y muestra las posibilidades expresivas que aporta a los diferentes materiales. Las 7 obras presentadas buscan la armonía estética y la fuerza simbólica.

  10. Predation in Ground-Nesting Birds: an Experimental Study Using Natural Egg-Color Variation

    Directory of Open Access Journals (Sweden)

    Aurora M. Castilla

    2007-06-01

    Full Text Available We tested the hypothesis that cryptically colored eggs would suffer less predation than conspicuous eggs in the ground-nesting red-legged partridge, Alectoris rufa. We used A. rufa as a model species because it has a wide range of natural egg colors, the eggs are widely available from breeding farms, and nests are easily mimicked because they are scrapes containing no vegetation. The study was conducted in the spring of 2001 in forest and fallow fields of central Spain in Castilla La Mancha, Ciudad Real. We used 384 clutches of natural eggs that were white, white spotted, brown, or brown spotted. Within clutches, eggs were consistent in color and size; among clutches, color differences were distributed across habitats. Clutches were checked once after 2 wk of exposure. Cryptic coloration had a survival advantage that was dependent on the local suite of predators. Rodent predation was nonselective with respect to clutch color; however, avian predation was significantly higher for conspicuous clutches. In addition, there was an interaction of landscape and egg color for avian predation. In forest landscapes, the clutches with highest survival were brown spotted, whereas in fallow landscapes, brown and brown spotted clutches had higher survival than white and white potted clutches. Thus, both the predator suite and the landscape had significant effects on the value of cryptic egg coloration. Our study is relevant for conservationists and managers in charge of restocking programs in hunting areas. The release of other partridge species or their hybrids could result in hybridization with wild partridges, potentially leading to nonoptimal clutch pigmentation and reduced survival of the native species. We therefore recommend that local authorities, managers, and conservationists be cautious with the use of alien species and hybrids and release only autochthonous species of partridges within their natural ranges.

  11. A Color-Opponency Based Biological Model for Color Constancy

    Directory of Open Access Journals (Sweden)

    Yongjie Li

    2011-05-01

    Full Text Available Color constancy is the ability of the human visual system to adaptively correct color-biased scenes under different illuminants. Most of the existing color constancy models are nonphysiologically plausible. Among the limited biological models, the great majority is Retinex and its variations, and only two or three models directly simulate the feature of color-opponency, but only of the very earliest stages of visual pathway, i.e., the single-opponent mechanisms involved at the levels of retinal ganglion cells and lateral geniculate nucleus (LGN neurons. Considering the extensive physiological evidences supporting that both the single-opponent cells in retina and LGN and the double-opponent neurons in primary visual cortex (V1 are the building blocks for color constancy, in this study we construct a color-opponency based color constancy model by simulating the opponent fashions of both the single-opponent and double-opponent cells in a forward manner. As for the spatial structure of the receptive fields (RF, both the classical RF (CRF center and the nonclassical RF (nCRF surround are taken into account for all the cells. The proposed model was tested on several typical image databases commonly used for performance evaluation of color constancy methods, and exciting results were achieved.

  12. Complete sequence of a cryptic virus from hemp (Cannabis sativa).

    Science.gov (United States)

    Ziegler, Angelika; Matoušek, Jaroslav; Steger, Gerhard; Schubert, Jörg

    2012-02-01

    Hemp (Cannabis sativa) was found to be a useful propagation host for hop latent virus, a carlavirus. However, when virus preparations were analysed by electron microscopy, along with the expected filamentous particles, spherical particles with a diameter of around 34 nm were found. RNA from virus preparations was purified, and cDNA was prepared and cloned. Sequence information was used to search databases, and the greatest similarity was found with Primula malacoides virus 1, a putative new member of the genus Partitivirus. The full sequences of RNA 1 and RNA 2 of this new hemp cryptic virus were obtained.

  13. Computational color technology

    CERN Document Server

    Kang, Henry R

    2006-01-01

    Henry Kang provides the fundamental color principles and mathematical tools to prepare the reader for a new era of color reproduction, and for subsequent applications in multispectral imaging, medical imaging, remote sensing, and machine vision. This book is intended to bridge the gap between color science and computational color technology, putting color adaptation, color constancy, color transforms, color display, and color rendition in the domain of vector-matrix representations and theories. Computational Color Technology deals with color digital images on the spectral level using vector-m

  14. Monitoring cryptic amphibians and reptiles in a Florida state park.

    Science.gov (United States)

    Engeman, Richard M; Meshaka, Walter E; Severson, Robert; Severson, Mary Ann; Kaufman, Greg; Groninger, N Paige; Smith, Henry T

    2016-04-01

    We monitored cryptic herpetofauna at Savannas Preserve State Park, Florida, by combining artificial cover counts with a quantitative paradigm for constructing and calculating population indices. Weekly indices were calculated from two consecutive days of data collection each week for 7 months from mid-winter to mid-summer in three habitats. Seventeen species were observed at least once, and time trends using index values were followed for six species. Among these, abundance and seasonal pattern information were obtained for an exotic species (greenhouse frog) and a species identified by the Florida Committee on Rare and Endangered Plants and Animals as threatened (Florida scrub lizard). We identified winter as the optimal time in this area to monitor populations for conducting annual assessments. This combined observation and indexing approach could provide managers or researchers with an economical means to quantitatively index population trends for multiple cryptic herpetofauna species simultaneously. Using artificial cover to sample within a population indexing design can be generalized beyond monitoring herpetofauna. Other forms of artificial cover that can be used as observation stations include aquatic artificial substrates, artificial tree cavities, artificial reefs, and other artificial aquatic structures and artificial sea grass units, among many others, and a wide range of taxa are suitable for population monitoring using artificial cover as observation stations in the approach we present, including insects, soil invertebrates, micro and macro aquatic invertebrates, fish, crustaceans, and small mammals.

  15. Monitoring cryptic amphibians and reptiles in a Florida state park.

    Science.gov (United States)

    Engeman, Richard M; Meshaka, Walter E; Severson, Robert; Severson, Mary Ann; Kaufman, Greg; Groninger, N Paige; Smith, Henry T

    2016-04-01

    We monitored cryptic herpetofauna at Savannas Preserve State Park, Florida, by combining artificial cover counts with a quantitative paradigm for constructing and calculating population indices. Weekly indices were calculated from two consecutive days of data collection each week for 7 months from mid-winter to mid-summer in three habitats. Seventeen species were observed at least once, and time trends using index values were followed for six species. Among these, abundance and seasonal pattern information were obtained for an exotic species (greenhouse frog) and a species identified by the Florida Committee on Rare and Endangered Plants and Animals as threatened (Florida scrub lizard). We identified winter as the optimal time in this area to monitor populations for conducting annual assessments. This combined observation and indexing approach could provide managers or researchers with an economical means to quantitatively index population trends for multiple cryptic herpetofauna species simultaneously. Using artificial cover to sample within a population indexing design can be generalized beyond monitoring herpetofauna. Other forms of artificial cover that can be used as observation stations include aquatic artificial substrates, artificial tree cavities, artificial reefs, and other artificial aquatic structures and artificial sea grass units, among many others, and a wide range of taxa are suitable for population monitoring using artificial cover as observation stations in the approach we present, including insects, soil invertebrates, micro and macro aquatic invertebrates, fish, crustaceans, and small mammals. PMID:26739988

  16. Uncovering Cryptic Parasitoid Diversity in Horismenus (Chalcidoidea, Eulophidae.

    Directory of Open Access Journals (Sweden)

    Sarah G Kenyon

    Full Text Available Horismenus parasitoids are an abundant and understudied group of eulophid wasps found mainly in the New World. Recent surveys based on morphological analyses in Costa Rica have quadrupled the number of named taxa, with more than 400 species described so far. This recent revision suggests that there is still a vast number of unknown species to be identified. As Horismenus wasps have been widely described as parasitoids of insect pests associated with crop plants, it is of high importance to properly establish the extant diversity of the genus, in order to provide biological control practitioners with an exhaustive catalog of putative control agents. In this study, we first collected Horismenus wasps from wild Phaseolus bean seeds in Central Mexico and Arizona to assess the genetic relatedness of three morphologically distinct species with overlapping host and geographical ranges. Sequence data from two nuclear and two mitochondrial gene regions uncovered three cryptic species within each of the three focal species (i.e., H. missouriensis, H. depressus and H. butcheri. The monophyly of each cryptic group is statistically supported (except in two of them represented by one single tip in which monophyly cannot be tested. The phylogenetic reconstruction is discussed with respect to differences between gene regions as well as likely reasons for the differences in variability between species.

  17. Allopatric speciation within a cryptic species complex of Australasian octopuses.

    Directory of Open Access Journals (Sweden)

    Michael D Amor

    Full Text Available Despite extensive revisions over recent decades, the taxonomy of benthic octopuses (Family Octopodidae remains in a considerable flux. Among groups of unresolved status is a species complex of morphologically similar shallow-water octopods from subtropical Australasia, including: Allopatric populations of Octopus tetricus on the eastern and western coasts of Australia, of which the Western Australian form is speculated to be a distinct or sub-species; and Octopus gibbsi from New Zealand, a proposed synonym of Australian forms. This study employed a combination of molecular and morphological techniques to resolve the taxonomic status of the 'tetricus complex'. Phylogenetic analyses (based on five mitochondrial genes: 12S rRNA, 16S rRNA, COI, COIII and Cytb and Generalised Mixed Yule Coalescent (GMYC analysis (based on COI, COIII and Cytb distinguished eastern and Western Australian O. tetricus as distinct species, while O. gibbsi was found to be synonymous with the east Australian form (BS = >97, PP = 1; GMYC p = 0.01. Discrete morphological differences in mature male octopuses (based on sixteen morphological traits provided further evidence of cryptic speciation between east (including New Zealand and west coast populations; although females proved less useful in morphological distinction among members of the tetricus complex. In addition, phylogenetic analyses suggested populations of octopuses currently treated under the name Octopus vulgaris are paraphyletic; providing evidence of cryptic speciation among global populations of O. vulgaris, the most commercially valuable octopus species worldwide.

  18. Minimized state complexity of quantum-encoded cryptic processes

    Science.gov (United States)

    Riechers, Paul M.; Mahoney, John R.; Aghamohammadi, Cina; Crutchfield, James P.

    2016-05-01

    The predictive information required for proper trajectory sampling of a stochastic process can be more efficiently transmitted via a quantum channel than a classical one. This recent discovery allows quantum information processing to drastically reduce the memory necessary to simulate complex classical stochastic processes. It also points to a new perspective on the intrinsic complexity that nature must employ in generating the processes we observe. The quantum advantage increases with codeword length: the length of process sequences used in constructing the quantum communication scheme. In analogy with the classical complexity measure, statistical complexity, we use this reduced communication cost as an entropic measure of state complexity in the quantum representation. Previously difficult to compute, the quantum advantage is expressed here in closed form using spectral decomposition. This allows for efficient numerical computation of the quantum-reduced state complexity at all encoding lengths, including infinite. Additionally, it makes clear how finite-codeword reduction in state complexity is controlled by the classical process's cryptic order, and it allows asymptotic analysis of infinite-cryptic-order processes.

  19. Placing an upper limit on cryptic marine sulphur cycling

    Science.gov (United States)

    Johnston, D. T.; Gill, B. C.; Masterson, A.; Beirne, E.; Casciotti, K. L.; Knapp, A. N.; Berelson, W.

    2014-09-01

    A quantitative understanding of sources and sinks of fixed nitrogen in low-oxygen waters is required to explain the role of oxygen-minimum zones (OMZs) in controlling the fixed nitrogen inventory of the global ocean. Apparent imbalances in geochemical nitrogen budgets have spurred numerous studies to measure the contributions of heterotrophic and autotrophic N2-producing metabolisms (denitrification and anaerobic ammonia oxidation, respectively). Recently, `cryptic' sulphur cycling was proposed as a partial solution to the fundamental biogeochemical problem of closing marine fixed-nitrogen budgets in intensely oxygen-deficient regions. The degree to which the cryptic sulphur cycle can fuel a loss of fixed nitrogen in the modern ocean requires the quantification of sulphur recycling in OMZ settings. Here we provide a new constraint for OMZ sulphate reduction based on isotopic profiles of oxygen (18O/16O) and sulphur (33S/32S, 34S/32S) in seawater sulphate through oxygenated open-ocean and OMZ-bearing water columns. When coupled with observations and models of sulphate isotope dynamics and data-constrained model estimates of OMZ water-mass residence time, we find that previous estimates for sulphur-driven remineralization and loss of fixed nitrogen from the oceans are near the upper limit for what is possible given in situ sulphate isotope data.

  20. Colored Traveling Salesman Problem.

    Science.gov (United States)

    Li, Jun; Zhou, MengChu; Sun, Qirui; Dai, Xianzhong; Yu, Xiaolong

    2015-11-01

    The multiple traveling salesman problem (MTSP) is an important combinatorial optimization problem. It has been widely and successfully applied to the practical cases in which multiple traveling individuals (salesmen) share the common workspace (city set). However, it cannot represent some application problems where multiple traveling individuals not only have their own exclusive tasks but also share a group of tasks with each other. This work proposes a new MTSP called colored traveling salesman problem (CTSP) for handling such cases. Two types of city groups are defined, i.e., each group of exclusive cities of a single color for a salesman to visit and a group of shared cities of multiple colors allowing all salesmen to visit. Evidences show that CTSP is NP-hard and a multidepot MTSP and multiple single traveling salesman problems are its special cases. We present a genetic algorithm (GA) with dual-chromosome coding for CTSP and analyze the corresponding solution space. Then, GA is improved by incorporating greedy, hill-climbing (HC), and simulated annealing (SA) operations to achieve better performance. By experiments, the limitation of the exact solution method is revealed and the performance of the presented GAs is compared. The results suggest that SAGA can achieve the best quality of solutions and HCGA should be the choice making good tradeoff between the solution quality and computing time.

  1. Preferred color correction for digital LCD TVs

    Science.gov (United States)

    Kim, Kyoung Tae; Kim, Choon-Woo; Ahn, Ji-Young; Kang, Dong-Woo; Shin, Hyun-Ho

    2009-01-01

    Instead of colorimetirc color reproduction, preferred color correction is applied for digital TVs to improve subjective image quality. First step of the preferred color correction is to survey the preferred color coordinates of memory colors. This can be achieved by the off-line human visual tests. Next step is to extract pixels of memory colors representing skin, grass and sky. For the detected pixels, colors are shifted towards the desired coordinates identified in advance. This correction process may result in undesirable contours on the boundaries between the corrected and un-corrected areas. For digital TV applications, the process of extraction and correction should be applied in every frame of the moving images. This paper presents a preferred color correction method in LCH color space. Values of chroma and hue are corrected independently. Undesirable contours on the boundaries of correction are minimized. The proposed method change the coordinates of memory color pixels towards the target color coordinates. Amount of correction is determined based on the averaged coordinate of the extracted pixels. The proposed method maintains the relative color difference within memory color areas. Performance of the proposed method is evaluated using the paired comparison. Results of experiments indicate that the proposed method can reproduce perceptually pleasing images to viewers.

  2. Development of an XYZ Digital Camera with Embedded Color Calibration System for Accurate Color Acquisition

    Science.gov (United States)

    Kretkowski, Maciej; Jablonski, Ryszard; Shimodaira, Yoshifumi

    Acquisition of accurate colors is important in the modern era of widespread exchange of electronic multimedia. The variety of device-dependent color spaces causes troubles with accurate color reproduction. In this paper we present the outlines of accomplished digital camera system with device-independent output formed from tristimulus XYZ values. The outstanding accuracy and fidelity of acquired color is achieved in our system by employing an embedded color calibration system based on emissive device generating reference calibration colors with user-defined spectral distribution and chromaticity coordinates. The system was tested by calibrating the camera using 24 reference colors spectrally reproduced from 24 color patches of the Macbeth Chart. The average color difference (CIEDE2000) has been found to be ΔE =0.83, which is an outstanding result compared to commercially available digital cameras.

  3. Color calibration of an RGB camera mounted in front of a microscope with strong color distortion.

    Science.gov (United States)

    Charrière, Renée; Hébert, Mathieu; Trémeau, Alain; Destouches, Nathalie

    2013-07-20

    This paper aims at showing that performing color calibration of an RGB camera can be achieved even in the case where the optical system before the camera introduces strong color distortion. In the present case, the optical system is a microscope containing a halogen lamp, with a nonuniform irradiance on the viewed surface. The calibration method proposed in this work is based on an existing method, but it is preceded by a three-step preprocessing of the RGB images aiming at extracting relevant color information from the strongly distorted images, taking especially into account the nonuniform irradiance map and the perturbing texture due to the surface topology of the standard color calibration charts when observed at micrometric scale. The proposed color calibration process consists first in computing the average color of the color-chart patches viewed under the microscope; then computing white balance, gamma correction, and saturation enhancement; and finally applying a third-order polynomial regression color calibration transform. Despite the nonusual conditions for color calibration, fairly good performance is achieved from a 48 patch Lambertian color chart, since an average CIE-94 color difference on the color-chart colors lower than 2.5 units is obtained. PMID:23872775

  4. Metabolism of cryptic peptides derived from neuropeptide FF precursors: the involvement of insulin-degrading enzyme.

    Science.gov (United States)

    Grasso, Giuseppe; Mielczarek, Przemyslaw; Niedziolka, Magdalena; Silberring, Jerzy

    2014-09-22

    The term "cryptome" refers to the subset of cryptic peptides with bioactivities that are often unpredictable and very different from the parent protein. These cryptic peptides are generated by proteolytic cleavage of proteases, whose identification in vivo can be very challenging. In this work, we show that insulin-degrading enzyme (IDE) is able to degrade specific amino acid sequences present in the neuropeptide pro-NPFFA (NPFF precursor), generating some cryptic peptides that are also observed after incubation with rat brain cortex homogenate. The reported experimental findings support the increasingly accredited hypothesis, according to which, due to its wide substrate selectivity, IDE is involved in a wide variety of physiopathological processes.

  5. The Disunity of Color

    OpenAIRE

    Matthen, Mohan

    1999-01-01

    What is color? What is color vision? Most philosophers answer by reference to humans: to human color qualia, or to the environmental properties or "quality spaces" perceived by humans. It is argued, with reference to empirical findings concerning comparative color vision and the evolution of color vision, that all such attempts are mistaken. An adequate definition of color vision must eschew reference to its outputs in the human cognition and refer only to inputs: color vision consists in...

  6. Spatiochromatic Context Modeling for Color Saliency Analysis.

    Science.gov (United States)

    Zhang, Jun; Wang, Meng; Zhang, Shengping; Li, Xuelong; Wu, Xindong

    2016-06-01

    Visual saliency is one of the most noteworthy perceptual abilities of human vision. Recent progress in cognitive psychology suggests that: 1) visual saliency analysis is mainly completed by the bottom-up mechanism consisting of feedforward low-level processing in primary visual cortex (area V1) and 2) color interacts with spatial cues and is influenced by the neighborhood context, and thus it plays an important role in a visual saliency analysis. From a computational perspective, the most existing saliency modeling approaches exploit multiple independent visual cues, irrespective of their interactions (or are not computed explicitly), and ignore contextual influences induced by neighboring colors. In addition, the use of color is often underestimated in the visual saliency analysis. In this paper, we propose a simple yet effective color saliency model that considers color as the only visual cue and mimics the color processing in V1. Our approach uses region-/boundary-defined color features with spatiochromatic filtering by considering local color-orientation interactions, therefore captures homogeneous color elements, subtle textures within the object and the overall salient object from the color image. To account for color contextual influences, we present a divisive normalization method for chromatic stimuli through the pooling of contrary/complementary color units. We further define a color perceptual metric over the entire scene to produce saliency maps for color regions and color boundaries individually. These maps are finally globally integrated into a one single saliency map. The final saliency map is produced by Gaussian blurring for robustness. We evaluate the proposed method on both synthetic stimuli and several benchmark saliency data sets from the visual saliency analysis to salient object detection. The experimental results demonstrate that the use of color as a unique visual cue achieves competitive results on par with or better than 12 state

  7. Ovarian fluid allows directional cryptic female choice despite external fertilization.

    Science.gov (United States)

    Alonzo, Suzanne H; Stiver, Kelly A; Marsh-Rollo, Susan E

    2016-01-01

    In species with internal fertilization, females can favour certain males over others, not only before mating but also within the female's reproductive tract after mating. Here, we ask whether such directional post-mating (that is, cryptic) female mate choice can also occur in species with external fertilization. Using an in vitro sperm competition experiment, we demonstrate that female ovarian fluid (ovarian fluid) changes the outcome of sperm competition by decreasing the importance of sperm number thereby increasing the relative importance of sperm velocity. We further show that ovarian fluid does not differentially affect sperm from alternative male phenotypes, but generally enhances sperm velocity, motility, straightness and chemoattraction. Under natural conditions, female ovarian fluid likely increases the paternity of the preferred parental male phenotype, as these males release fewer but faster sperm. These results imply females have greater control over fertilization and potential to exert selection on males in species with external fertilization than previously thought possible. PMID:27529581

  8. Hyper-cryptic marine meiofauna: species complexes in Nemertodermatida.

    Directory of Open Access Journals (Sweden)

    Inga Meyer-Wachsmuth

    Full Text Available Nemertodermatida are microscopically small, benthic marine worms. Specimens of two nominal species, Sterreria psammicola and Nemertinoides elongatus from 33 locations worldwide were sequenced for three molecular markers. Species delimitation and validation was done using gene trees, haplotype networks and multilocus Bayesian analysis. We found 20 supported species of which nine: Nemertinoides glandulosum n.sp., N. wolfgangi n.sp., Sterreria boucheti n.sp., S. lundini n.sp., S. martindalei n.sp., S. monolithes n.sp., S. papuensis n.sp., S. variabilis n.sp. and S. ylvae n.sp., are described including nucleotide-based diagnoses. The distribution patterns indicate transoceanic dispersal in some of the species. Sympatric species were found in many cases. The high level of cryptic diversity in this meiofauna group implies that marine diversity may be higher than previously estimated.

  9. A Novel Information Security Scheme using Cryptic Steganography

    Directory of Open Access Journals (Sweden)

    K RAMA MOHANA RAO

    2010-12-01

    Full Text Available The demand for effective information security schemes is increasing day by day with the exponential growth of Internet. Cryptography and Steganography are the two popular techniques for secret communication. The contents of message are kept secret in cryptography, where as in steganography the message is embedded into the cover image (text, video and image (pay load. In this proposed system we developed a system in which cryptography and steganography are used as integrated part along with newly developed enhanced security model. In cryptography we are using MD-5 Algorithm to encrypt a message and a part of message is hidden in DCT of an image, remaining part of the message is used to generate three ( 3 secret keys which make the system highly secured. To avoid the problem of unauthorized data access steganography along with cryptography called as Cryptic-Steganography scheme is the right most solution.

  10. Cryptic photosynthesis, Extrasolar planetary oxygen without a surface biological signature

    CERN Document Server

    Cockell, C S; Raven, J A

    2008-01-01

    On the Earth, photosynthetic organisms are responsible for the production of nearly all of the oxygen in the atmosphere. On the land, vegetation reflects in the visible, leading to a red edge which has been proposed as a biosignature for life on extrasolar planets. However, in many regions of the Earth, and particularly where surface conditions are extreme, for example in hot and cold deserts, photosynthetic organisms can be driven into and under substrates where light is still sufficient for photosynthesis. These communities exhibit no detectable surface spectral signature. The same is true of the assemblages of photosynthetic organisms at more than a few meters depth in water bodies. These communities are widespread and dominate local photosynthetic productivity. We review known cryptic photosynthetic communities and their productivity. We use a radiative transfer model to link geomicrobiology with observational astronomy and calculate the disk-averaged spectra and identify detectable features that would re...

  11. Experimental tests for heritable morphological color plasticity in non-native brown trout (Salmo trutta populations.

    Directory of Open Access Journals (Sweden)

    Peter A H Westley

    Full Text Available The success of invasive species is frequently attributed to phenotypic plasticity, which facilitates persistence in novel environments. Here we report on experimental tests to determine whether the intensity of cryptic coloration patterns in a global invader (brown trout, Salmo trutta was primarily the result of plasticity or heritable variation. Juvenile F1 offspring were created through experimental crosses of wild-caught parents and reared for 30 days in the laboratory in a split-brood design on either light or dark-colored gravel substrate. Skin and fin coloration quantified with digital photography and image analysis indicated strong plastic effects in response to substrate color; individuals reared on dark substrate had both darker melanin-based skin color and carotenoid-based fin colors than other members of their population reared on light substrate. Slopes of skin and fin color reaction norms were parallel between environments, which is not consistent with heritable population-level plasticity to substrate color. Similarly, we observed weak differences in population-level color within an environment, again suggesting little genetic control on the intensity of skin and fin colors. Taken as whole, our results are consistent with the hypothesis that phenotypic plasticity may have facilitated the success of brown trout invasions and suggests that plasticity is the most likely explanation for the variation in color intensity observed among these populations in nature.

  12. Skin-color Based Videos Categorization

    OpenAIRE

    Rehanullah Khan; Asad Maqsood; Zeeshan Khan; Muhammad Ishaq; Arsalan Arif

    2012-01-01

    On dedicated websites, people can upload videos and share it with the rest of the world. Currently these videos are cat- egorized manually by the help of the user community. In this paper, we propose a combination of color spaces with the Bayesian network approach for robust detection of skin color followed by an automated video categorization. Exper- imental results show that our method can achieve satisfactory performance for categorizing videos based on skin color.

  13. Differential responses of cryptic bat species to the urban landscape.

    Science.gov (United States)

    Lintott, Paul R; Barlow, Kate; Bunnefeld, Nils; Briggs, Philip; Gajas Roig, Clara; Park, Kirsty J

    2016-04-01

    Urbanization is a key global driver in the modification of land use and has been linked to population declines even in widespread and relatively common species. Cities comprise a complex assortment of habitat types yet we know relatively little about the effects of their composition and spatial configuration on species distribution. Although many bat species exploit human resources, the majority of species are negatively impacted by urbanization. Here, we use data from the National Bat Monitoring Programme, a long-running citizen science scheme, to assess how two cryptic European bat species respond to the urban landscape. A total of 124 × 1 km(2) sites throughout Britain were surveyed. The landscape surrounding each site was mapped and classified into discrete biotope types (e.g., woodland). Generalized linear models were used to assess differences in the response to the urban environment between the two species, and which landscape factors were associated with the distributions of P. pipistrellus and P. pygmaeus. The relative prevalence of P. pygmaeus compared to P. pipistrellus was greater in urban landscapes with a higher density of rivers and lakes, whereas P. pipistrellus was frequently detected in landscapes comprising a high proportion of green space (e.g., parklands). Although P. pipistrellus is thought to be well adapted to the urban landscape, we found a strong negative response to urbanization at a relatively local scale (1 km), whilst P. pygmaeus was detected more regularly in wooded urban landscapes containing freshwater. These results show differential habitat use at a landscape scale of two morphologically similar species, indicating that cryptic species may respond differently to anthropogenic disturbance. Even species considered relatively common and well adapted to the urban landscape may respond negatively to the built environment highlighting the future challenges involved in maintaining biodiversity within an increasingly urbanized

  14. Differential responses of cryptic bat species to the urban landscape.

    Science.gov (United States)

    Lintott, Paul R; Barlow, Kate; Bunnefeld, Nils; Briggs, Philip; Gajas Roig, Clara; Park, Kirsty J

    2016-04-01

    Urbanization is a key global driver in the modification of land use and has been linked to population declines even in widespread and relatively common species. Cities comprise a complex assortment of habitat types yet we know relatively little about the effects of their composition and spatial configuration on species distribution. Although many bat species exploit human resources, the majority of species are negatively impacted by urbanization. Here, we use data from the National Bat Monitoring Programme, a long-running citizen science scheme, to assess how two cryptic European bat species respond to the urban landscape. A total of 124 × 1 km(2) sites throughout Britain were surveyed. The landscape surrounding each site was mapped and classified into discrete biotope types (e.g., woodland). Generalized linear models were used to assess differences in the response to the urban environment between the two species, and which landscape factors were associated with the distributions of P. pipistrellus and P. pygmaeus. The relative prevalence of P. pygmaeus compared to P. pipistrellus was greater in urban landscapes with a higher density of rivers and lakes, whereas P. pipistrellus was frequently detected in landscapes comprising a high proportion of green space (e.g., parklands). Although P. pipistrellus is thought to be well adapted to the urban landscape, we found a strong negative response to urbanization at a relatively local scale (1 km), whilst P. pygmaeus was detected more regularly in wooded urban landscapes containing freshwater. These results show differential habitat use at a landscape scale of two morphologically similar species, indicating that cryptic species may respond differently to anthropogenic disturbance. Even species considered relatively common and well adapted to the urban landscape may respond negatively to the built environment highlighting the future challenges involved in maintaining biodiversity within an increasingly urbanized

  15. The Algorithm to Detect Color Gradation on Silk

    Directory of Open Access Journals (Sweden)

    Suyoto

    2012-03-01

    Full Text Available The process of silk dyeing with natural dye extracts will produce a certain color. Using extracts of wood, leaf and their combinations will give some color gradations. This paper aims to create a new algorithm which can help one, whose intention is to formulate the combination of coloring process to achieve the desired color through combining coloring materials on silk fabric. This algorithm will be expected to be able to formulate the combination of colors with more than 75 percent of accuracy. The natural dyes used were Ceriops candolleana arn wood for the red, Cudraina javanensis wood for the yellow, and indigofera leaf for the blue base color.

  16. Shock Condition Forensics and Cryptic Phase Transformations from Crystallographic Orientation Relationships in Zircon

    Science.gov (United States)

    Timms, N. E.; Erickson, T. M.; Cavosie, A. J.; Pearce, M. A.; Reddy, S. M.; Zanetti, M.; Tohver, E.; Schmieder, M.; Nemchin, A. A.; Wittmann, A.

    2016-08-01

    We present an approach to constrain pressure and temperature conditions during impact events involving identification of cryptic histories of phase transformations from orientation relationships in shocked zircon, linked to new P-T phase diagrams.

  17. Habitat requirements and ecological niche of two cryptic amphipod species at landscape and local scales

    OpenAIRE

    Eisenring, M.; Altermatt, F.; Westram, A M; Jokela, J.

    2016-01-01

    Cryptic species are phylogenetically diverged taxa that are morphologically indistinguishable and may differ in their ecological and behavioral requirements. This may have important implications for ecosystem services and conservation of biodiversity. We investigated whether two ecologically important cryptic species of the freshwater amphipod Gammarus fossarum (types A and B) are associated with different habitats. We collected data on their occurrence at both the landscape scale...

  18. Color features for dating historical color images

    OpenAIRE

    Fernando, Basura; Muselet, Damien; Khan, Rahat; Tuytelaars, Tinne

    2014-01-01

    Fernando B., Muselet D., Khan R., Tuytelaars T., ''Color features for dating historical color image'', IEEE international conference on image processing - ICIP 2014, 5 pp., October 27-30, 2014, Paris, France.

  19. Embedding Color Watermarks in Color Images

    Directory of Open Access Journals (Sweden)

    Wu Tung-Lin

    2003-01-01

    Full Text Available Robust watermarking with oblivious detection is essential to practical copyright protection of digital images. Effective exploitation of the characteristics of human visual perception to color stimuli helps to develop the watermarking scheme that fills the requirement. In this paper, an oblivious watermarking scheme that embeds color watermarks in color images is proposed. Through color gamut analysis and quantizer design, color watermarks are embedded by modifying quantization indices of color pixels without resulting in perceivable distortion. Only a small amount of information including the specification of color gamut, quantizer stepsize, and color tables is required to extract the watermark. Experimental results show that the proposed watermarking scheme is computationally simple and quite robust in face of various attacks such as cropping, low-pass filtering, white-noise addition, scaling, and JPEG compression with high compression ratios.

  20. Urine - abnormal color

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003139.htm Urine - abnormal color To use the sharing features on this page, please enable JavaScript. The usual color of urine is straw-yellow. Abnormally colored urine ...

  1. Unit 50 - Color

    OpenAIRE

    Unit 57, CC in GIS; Kimerling, Jon

    1990-01-01

    This unit presents an overview of topics related to color, including its physical basis, human visual perception, how color is generated by a CRT and created on paper and how color is measured and specified.

  2. LED Color Characteristics

    Energy Technology Data Exchange (ETDEWEB)

    None

    2012-01-01

    Color quality is an important consideration when evaluating LED-based products for general illumination. This fact sheet reviews the basics regarding light and color and summarizes the most important color issues related to white-light LED systems.

  3. How hidden are hidden processes? A primer on crypticity and entropy convergence

    Science.gov (United States)

    Mahoney, John R.; Ellison, Christopher J.; James, Ryan G.; Crutchfield, James P.

    2011-09-01

    We investigate a stationary process's crypticity—a measure of the difference between its hidden state information and its observed information—using the causal states of computational mechanics. Here, we motivate crypticity and cryptic order as physically meaningful quantities that monitor how hidden a hidden process is. This is done by recasting previous results on the convergence of block entropy and block-state entropy in a geometric setting, one that is more intuitive and that leads to a number of new results. For example, we connect crypticity to how an observer synchronizes to a process. We show that the block-causal-state entropy is a convex function of block length. We give a complete analysis of spin chains. We present a classification scheme that surveys stationary processes in terms of their possible cryptic and Markov orders. We illustrate related entropy convergence behaviors using a new form of foliated information diagram. Finally, along the way, we provide a variety of interpretations of crypticity and cryptic order to establish their naturalness and pervasiveness. This is also a first step in developing applications in spatially extended and network dynamical systems.

  4. Speciation on oceanic islands: rapid adaptive divergence vs. cryptic speciation in a Guadalupe Island songbird (Aves: Junco.

    Directory of Open Access Journals (Sweden)

    Pau Aleixandre

    Full Text Available The evolutionary divergence of island populations, and in particular the tempo and relative importance of neutral and selective factors, is of central interest to the study of speciation. The rate of phenotypic evolution upon island colonization can vary greatly among taxa, and cases of convergent evolution can further confound the inference of correct evolutionary histories. Given the potential lability of phenotypic characters, molecular dating of insular lineages analyzed in a phylogenetic framework provides a critical tool to test hypotheses of phenotypic divergence since colonization. The Guadalupe junco is the only insular form of the polymorphic dark-eyed junco (Junco hyemalis, and shares eye and plumage color with continental morphs, yet presents an enlarged bill and reduced body size. Here we use variation in mtDNA sequence, morphological traits and song variables to test whether the Guadalupe junco evolved rapidly following a recent colonization by a mainland form of the dark-eyed junco, or instead represents a well-differentiated "cryptic" lineage adapted to the insular environment through long-term isolation, with plumage coloration a result of evolutionary convergence. We found high mtDNA divergence of the island lineage with respect to both continental J. hyemalis and J. phaeonotus, representing a history of isolation of about 600,000 years. The island lineage was also significantly differentiated in morphological and male song variables. Moreover, and contrary to predictions regarding diversity loss on small oceanic islands, we document relatively high levels of both haplotypic and song-unit diversity on Guadalupe Island despite long-term isolation in a very small geographic area. In contrast to prevailing taxonomy, the Guadalupe junco is an old, well-differentiated evolutionary lineage, whose similarity to mainland juncos in plumage and eye color is due to evolutionary convergence. Our findings confirm the role of remote islands

  5. Digital color imaging

    CERN Document Server

    Fernandez-Maloigne, Christine; Macaire, Ludovic

    2013-01-01

    This collective work identifies the latest developments in the field of the automatic processing and analysis of digital color images.For researchers and students, it represents a critical state of the art on the scientific issues raised by the various steps constituting the chain of color image processing.It covers a wide range of topics related to computational color imaging, including color filtering and segmentation, color texture characterization, color invariant for object recognition, color and motion analysis, as well as color image and video indexing and retrieval. <

  6. Predicting Color Output of Additive Manufactured Parts

    DEFF Research Database (Denmark)

    Eiríksson, Eyþór Rúnar; Pedersen, David Bue; Aanæs, Henrik

    2015-01-01

    In this paper we address the colorimetric performance of a multicolor additive manufacturing process. A method on how to measure and characterize color performance of said process is presented. Furthermore, a method on predicting the color output is demonstrated, allowing for previsualization of ...... of parts prior to print. Results show that color prediction can be achieved with an average color difference error of ΔE*00 = 1.5 andstd.dev σ= 0.75, with similar order of magnitude as the literature defined threshold for „Just NoticeableDifference” (JND)....

  7. Structural color from colloidal glasses

    Science.gov (United States)

    Magkiriadou, Sofia

    When a material has inhomogeneities at a lengthscale comparable to the wavelength of light, interference can give rise to structural colors: colors that originate from the interaction of the material's microstructure with light and do not require absorbing dyes. In this thesis we study a class of these materials, called photonic glasses, where the inhomogeneities form a dense and random arrangement. Photonic glasses have angle-independent structural colors that look like those of conventional dyes. However, when this work started, there was only a handful of colors accessible with photonic glasses, mostly hues of blue. We use various types of colloidal particles to make photonic glasses, and we study, both theoretically and experimentally, how the optical properties of these glasses relate to their structure and constituent particles. Based on our observations from glasses of conventional particles, we construct a theoretical model that explains the scarcity of yellow, orange, and red photonic glasses. Guided by this model, we develop novel colloidal systems that allow a higher degree of control over structural color. We assemble glasses of soft, core-shell particles with scattering cores and transparent shells, where the resonant wavelength can be tuned independently of the reflectivity. We then encapsulate glasses of these core-shell particles into emulsion droplets of tunable size; in this system, we observe, for the first time, angle-independent structural colors that cover the entire visible spectrum. To enhance color saturation, we begin experimenting with inverse glasses, where the refractive index of the particles is lower than the refractive index of the medium, with promising results. Finally, based on our theoretical model for scattering from colloidal glasses, we begin an exploration of the color gamut that could be achieved with this technique, and we find that photonic glasses are a promising approach to a new type of long-lasting, non-toxic, and

  8. Resolving cryptic species complexes of major tephritid pests

    Science.gov (United States)

    Hendrichs, Jorge; Vera, M. Teresa; De Meyer, Marc; Clarke, Anthony R.

    2015-01-01

    Abstract An FAO/IAEA Co-ordinated Research Project (CRP) on “Resolution of Cryptic Species Complexes of Tephritid Pests to Overcome Constraints to SIT Application and International Trade” was conducted from 2010 to 2015. As captured in the CRP title, the objective was to undertake targeted research into the systematics and diagnostics of taxonomically challenging fruit fly groups of economic importance. The scientific output was the accurate alignment of biological species with taxonomic names; which led to the applied outcome of assisting FAO and IAEA Member States in overcoming technical constraints to the application of the Sterile Insect Technique (SIT) against pest fruit flies and the facilitation of international agricultural trade. Close to 50 researchers from over 20 countries participated in the CRP, using coordinated, multidisciplinary research to address, within an integrative taxonomic framework, cryptic species complexes of major tephritid pests. The following progress was made for the four complexes selected and studied: Anastrepha fraterculus complex – Eight morphotypes and their geographic and ecological distributions in Latin America were defined. The morphotypes can be considered as distinct biological species on the basis of differences in karyotype, sexual incompatibility, post-mating isolation, cuticular hydrocarbon, pheromone, and molecular analyses. Discriminative taxonomic tools using linear and geometric morphometrics of both adult and larval morphology were developed for this complex. Bactrocera dorsalis complex – Based on genetic, cytogenetic, pheromonal, morphometric, and behavioural data, which showed no or only minor variation between the Asian/African pest fruit flies Bactrocera dorsalis, Bactrocera papayae, Bactrocera philippinensis and Bactrocera invadens, the latter three species were synonymized with Bactrocera dorsalis. Of the five target pest taxa studied, only Bactrocera dorsalis and Bactrocera carambolae remain as

  9. Resolving cryptic species complexes of major tephritid pests.

    Science.gov (United States)

    Hendrichs, Jorge; Vera, M Teresa; De Meyer, Marc; Clarke, Anthony R

    2015-01-01

    An FAO/IAEA Co-ordinated Research Project (CRP) on "Resolution of Cryptic Species Complexes of Tephritid Pests to Overcome Constraints to SIT Application and International Trade" was conducted from 2010 to 2015. As captured in the CRP title, the objective was to undertake targeted research into the systematics and diagnostics of taxonomically challenging fruit fly groups of economic importance. The scientific output was the accurate alignment of biological species with taxonomic names; which led to the applied outcome of assisting FAO and IAEA Member States in overcoming technical constraints to the application of the Sterile Insect Technique (SIT) against pest fruit flies and the facilitation of international agricultural trade. Close to 50 researchers from over 20 countries participated in the CRP, using coordinated, multidisciplinary research to address, within an integrative taxonomic framework, cryptic species complexes of major tephritid pests. The following progress was made for the four complexes selected and studied: Anastrepha fraterculus complex - Eight morphotypes and their geographic and ecological distributions in Latin America were defined. The morphotypes can be considered as distinct biological species on the basis of differences in karyotype, sexual incompatibility, post-mating isolation, cuticular hydrocarbon, pheromone, and molecular analyses. Discriminative taxonomic tools using linear and geometric morphometrics of both adult and larval morphology were developed for this complex. Bactrocera dorsalis complex - Based on genetic, cytogenetic, pheromonal, morphometric, and behavioural data, which showed no or only minor variation between the Asian/African pest fruit flies Bactrocera dorsalis, Bactrocera papayae, Bactrocera philippinensis and Bactrocera invadens, the latter three species were synonymized with Bactrocera dorsalis. Of the five target pest taxa studied, only Bactrocera dorsalis and Bactrocera carambolae remain as scientifically valid

  10. A novel widespread cryptic species and phylogeographic patterns within several giant clam species (Cardiidae: Tridacna from the Indo-Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Thomas Huelsken

    Full Text Available Giant clams (genus Tridacna are iconic coral reef animals of the Indian and Pacific Oceans, easily recognizable by their massive shells and vibrantly colored mantle tissue. Most Tridacna species are listed by CITES and the IUCN Redlist, as their populations have been extensively harvested and depleted in many regions. Here, we survey Tridacna crocea and Tridacna maxima from the eastern Indian and western Pacific Oceans for mitochondrial (COI and 16S and nuclear (ITS sequence variation and consolidate these data with previous published results using phylogenetic analyses. We find deep intraspecific differentiation within both T. crocea and T. maxima. In T. crocea we describe a previously undocumented phylogeographic division to the east of Cenderawasih Bay (northwest New Guinea, whereas for T. maxima the previously described, distinctive lineage of Cenderawasih Bay can be seen to also typify western Pacific populations. Furthermore, we find an undescribed, monophyletic group that is evolutionarily distinct from named Tridacna species at both mitochondrial and nuclear loci. This cryptic taxon is geographically widespread with a range extent that minimally includes much of the central Indo-Pacific region. Our results reinforce the emerging paradigm that cryptic species are common among marine invertebrates, even for conspicuous and culturally significant taxa. Additionally, our results add to identified locations of genetic differentiation across the central Indo-Pacific and highlight how phylogeographic patterns may differ even between closely related and co-distributed species.

  11. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae)

    OpenAIRE

    Nelson A Canal; Hernández-Ortiz, Vicente; Salas, Juan O. Tigrero; Selivon, Denise

    2015-01-01

    Abstract The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus , is a complex of cryptic species, but few studies have been performed on the mor...

  12. RGB color sensor implemented with LEDs

    Science.gov (United States)

    Filoteo-Razo, J. D.; Estudillo-Ayala, J. M.; Hernández-Garcia, J. C.; Trejo-Durán, M.; Muñoz-Lopez, A.; Jauregui-Vázquez, D.; Rojas-Laguna, R.

    2015-09-01

    This paper presents the design and implementation of an optical sensor to detect color changes in fruit by means of white light reflection to measure fruit ripeness in industrial and agricultural applications. The system consists of a LED RGB array including photodetectors, a power source and plastic optic fiber (POF). By means of Labview ® graphic interface we can control the power emission of the diodes digitally mixing the colors at different intensities until we achieve white light to be used as a source for the color sensor. We used an ATmega2560 microcontroller as a data collection device to monitor the colors obtained and to show them as color models using Matlab ®. We show results from tests conducted using two guava samples, observing the evolution of the color change on the fruit skin until they became overripe.

  13. From Cryptic Toward Canonical Pre-mRNA Splicing in Pompe Disease: a Pipeline for the Development of Antisense Oligonucleotides.

    Science.gov (United States)

    Bergsma, Atze J; In 't Groen, Stijn Lm; Verheijen, Frans W; van der Ploeg, Ans T; Pijnappel, Wwm Pim

    2016-01-01

    While 9% of human pathogenic variants have an established effect on pre-mRNA splicing, it is suspected that an additional 20% of otherwise classified variants also affect splicing. Aberrant splicing includes disruption of splice sites or regulatory elements, or creation or strengthening of cryptic splice sites. For the majority of variants, it is poorly understood to what extent and how these may affect splicing. We have identified cryptic splicing in an unbiased manner. Three types of cryptic splicing were analyzed in the context of pathogenic variants in the acid α-glucosidase gene causing Pompe disease. These involved newly formed deep intronic or exonic cryptic splice sites, and a natural cryptic splice that was utilized due to weakening of a canonical splice site. Antisense oligonucleotides that targeted the identified cryptic splice sites repressed cryptic splicing at the expense of canonical splicing in all three cases, as shown by reverse-transcriptase-quantitative polymerase chain reaction analysis and by enhancement of acid α-glucosidase enzymatic activity. This argues for a competition model for available splice sites, including intact or weakened canonical sites and natural or newly formed cryptic sites. The pipeline described here can detect cryptic splicing and correct canonical splicing using antisense oligonucleotides to restore the gene defect. PMID:27623443

  14. Role of pleiotropy in the evolution of a cryptic developmental variation in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Fabien Duveau

    2012-01-01

    Full Text Available Robust biological systems are expected to accumulate cryptic genetic variation that does not affect the system output in standard conditions yet may play an evolutionary role once phenotypically expressed under a strong perturbation. Genetic variation that is cryptic relative to a robust trait may accumulate neutrally as it does not change the phenotype, yet it could also evolve under selection if it affects traits related to fitness in addition to its cryptic effect. Cryptic variation affecting the vulval intercellular signaling network was previously uncovered among wild isolates of Caenorhabditis elegans. Using a quantitative genetic approach, we identify a non-synonymous polymorphism of the previously uncharacterized nath-10 gene that affects the vulval phenotype when the system is sensitized with different mutations, but not in wild-type strains. nath-10 is an essential protein acetyltransferase gene and the homolog of human NAT10. The nath-10 polymorphism also presents non-cryptic effects on life history traits. The nath-10 allele carried by the N2 reference strain leads to a subtle increase in the egg laying rate and in the total number of sperm, a trait affecting the trade-off between fertility and minimal generation time in hermaphrodite individuals. We show that this allele appeared during early laboratory culture of N2, which allowed us to test whether it may have evolved under selection in this novel environment. The derived allele indeed strongly outcompetes the ancestral allele in laboratory conditions. In conclusion, we identified the molecular nature of a cryptic genetic variation and characterized its evolutionary history. These results show that cryptic genetic variation does not necessarily accumulate neutrally at the whole-organism level, but may evolve through selection for pleiotropic effects that alter fitness. In addition, cultivation in the laboratory has led to adaptive evolution of the reference strain N2 to the

  15. Copepod Behavior in ``Cryptic Blooms'' of Toxic Algae

    Science.gov (United States)

    True, A. C.; Webster, D. R.; Weissburg, M. J.; Yen, J.

    2014-11-01

    Copepods,Acartia tonsa and Temora longicornis, were exposed to thin layers of exudates from the toxic dinoflagellate Karenia brevis (1 - 10,000 cells/mL) (i.e. models of ``cryptic blooms'' of toxic phytoplankton). Planar laser-induced fluorescence (PLIF) was used to quantify the spatiotemporal structure of the layer allowing for correlation of behavioral responses with toxin levels. Both species explicitly avoided the exudate layer and the vicinity of the layer. Measures of path kinematics (swimming speed, turn frequency) by location (in-layer vs. out-of-layer) and exposure (pre-contact vs. post-contact) revealed some similarities, but also significant differences, in trends for each species. A. tonsa significantly increases swimming speed and swimming speed variability in the exudate layer and post-contact, whereas T. longicornis slightly increases both in-layer and slightly reduces both post-contact. Both species increase turn frequency in-layer and post-contact with increasing K. brevis exudate concentration. Path fracticality indicates that A. tonsatrajectories became more diffuse/sinuous and T. longicornis trajectories became more linear/ballistic (trending effects). Regression analyses revealed that the rate of change of behavior with increasing exudate concentration for A. tonsa was thrice to fifty times that of T. longicornis. Toxic K. brevis can essentially eliminate top-down grazer control ,another sinister means by which it gains a competitive advantage over the local phytoplankton taxa.

  16. High cryptic soil ciliate (Ciliophora, Hypotrichida) diversity in Australia.

    Science.gov (United States)

    Kumar, Santosh; Foissner, Wilhelm

    2016-04-01

    The diversity and distribution of soil ciliates from Australia is poorly known. Thus, we studied eight taxa, using the non-flooded Petri dish culture method, live observation, silver impregnation, detailed morphometrics, ontogenesis, and reinvestigation of type slides. At first glance, the Australian taxa looked very similar to described species, however, detailed investigations resulted in the identification of six cryptic species: Afroamphisiella multinucleata minima nov. subspec., Cladotricha similis nov. spec., Erimophrya similis nov. spec., Heterogonostomum salinarum nov. gen., nov. spec., Pseudohemisincirra arabica australiensis nov. subspec., and Pattersoniella (Pattersoniellides) australiensis nov. subgen., nov. spec. This new subgenus is unique among all described hypotrichs in having reduced some anterior paroral dikinetids the fibrillar associates of which are, however, still present. Only two of the eight taxa are possibly cosmopolitans: Apourosomoida halophilaFoissner et al., 2002 and Urosoma karinaeFoissner, 1987. This supports the moderate endemicity model, i.e., that a third of protists have a restricted distribution (Foissner, Chao and Katz 2008). PMID:26844781

  17. River barriers and cryptic biodiversity in an evolutionary museum.

    Science.gov (United States)

    Voelker, G; Marks, B D; Kahindo, C; A'genonga, U; Bapeamoni, F; Duffie, L E; Huntley, J W; Mulotwa, E; Rosenbaum, S A; Light, J E

    2013-03-01

    The Riverine Barriers Hypothesis (RBH) posits that tropical rivers can be effective barriers to gene flow, based on observations that range boundaries often coincide with river barriers. Over the last 160 years, the RBH has received attention from various perspectives, with a particular focus on vertebrates in the Amazon Basin. To our knowledge, no molecular assessment of the RBH has been conducted on birds in the Afrotropics, despite its rich avifauna and many Afrotropical bird species being widely distributed across numerous watersheds and basins. Here, we provide the first genetic evidence that an Afrotropical river has served as a barrier for birds and for their lice, based on four understory bird species collected from sites north and south of the Congo River. Our results indicate near-contemporaneous, Pleistocene lineage diversification across the Congo River in these species. Our results further indicate differing levels of genetic variation in bird lice; the extent of this variation appears linked to the life-history of both the host and the louse. Extensive cryptic diversity likely is being harbored in Afrotropical forests, in both understory birds and their lice. Therefore, these forests may not be "museums" of old lineages. Rather, substantial evolutionary diversification may have occurred in Afrotropical forests throughout the Pleistocene, supporting the Pleistocene Forest Refuge Hypothesis. Strong genetic variation in birds and their lice within a small part of the Congo Basin forest indicates that we may have grossly underestimated diversity in the Afrotropics, making these forests home of substantial biodiversity in need of conservation. PMID:23532272

  18. Cryptic adaptive radiation in tropical forest trees in New Caledonia.

    Science.gov (United States)

    Pillon, Yohan; Hopkins, Helen C F; Rigault, Frédéric; Jaffré, Tanguy; Stacy, Elizabeth A

    2014-04-01

    The causes of the species richness of tropical trees are poorly understood, in particular the roles of ecological factors such as soil composition. The nickel(Ni)-hyperaccumulating tree genus Geissois (Cunoniaceae) from the South-west Pacific was chosen as a model of diversification on different substrates. Here, we investigated the leaf element compositions, spatial distributions and phylogeny of all species of Geissois occurring on New Caledonia. We found that New Caledonian Geissois descended from a single colonist and diversified relatively quickly into 13 species. Species on ultramafic and nonultramafic substrates showed contrasting patterns of leaf element composition and range overlap. Those on nonultramafic substrates were largely sympatric but had distinct leaf element compositions. By contrast, species on ultramafic substrates showed similar leaf element composition, but occurred in many cases exclusively in allopatry. Further, earlier work showed that at least three out of these seven species use different molecules to bind Ni. Geissois qualifies as a cryptic adaptive radiation, and may be the first such example in a lineage of tropical forest trees. Variation in biochemical strategies for coping with both typical and adverse soil conditions may help to explain the diversification and coexistence of tropical forest trees on similar soil types.

  19. Facts About Color Blindness

    Science.gov (United States)

    ... quickly diagnose specific types of color blindness. The Ishihara Color Test is the most common test for red-green ... red-green color blindness. The newer Cambridge Color Test uses a visual array similar to the Ishihara plates, except displayed on a computer monitor. The ...

  20. Texture affects color emotion

    NARCIS (Netherlands)

    M.P. Lucassen; T. Gevers; A. Gijsenij

    2011-01-01

    Several studies have recorded color emotions in subjects viewing uniform color (UC) samples. We conduct an experiment to measure and model how these color emotions change when texture is added to the color samples. Using a computer monitor, our subjects arrange samples along four scales: warm-cool,

  1. Color Me Understood.

    Science.gov (United States)

    Harris, Judy J.

    2000-01-01

    Describes the "color system" as a way of grouping children into different personality types based on a certain color: orange, blue, green, and gold. Lists stress producers for specific color people. Asserts that, through making groups of different colors, children begin to see the various specialties others can bring to the group and learn to…

  2. Industrial Color Physics

    CERN Document Server

    Klein, Georg A

    2010-01-01

    This unique book starts with a short historical overview of the development of the theories of color vision and applications of industrial color physics. The three dominant factors producing color - light source, color sample, and observer - are described in detail. The standardized color spaces are shown and related color values are applied to characteristic color qualities of absorption as well as of effect colorants. The fundamentals of spectrometric and colorimetric measuring techniques together with specific applications are described. Theoretical models for radiative transfer in transparent, translucent, and opaque layers are detailed; the two, three, and multi-flux approximations are presented for the first time in a coherent formalism. These methods constitute the fundamentals not only for the important classical methods, but also modern methods of recipe prediction applicable to all known colorants. The text is supplied with 52 tables, more than 200 partially colored illustrations, an appendix, and a...

  3. Sexually dichromatic coloration reflects size and immunocompetence in female Spanish terrapins, Mauremys leprosa

    Science.gov (United States)

    Ibáñez, Alejandro; Marzal, Alfonso; López, Pilar; Martín, José

    2013-12-01

    Many studies have shown the importance of colorful ornamentation in mate choosiness or intrasexual conflict. However, research on color ornaments has focused mainly on birds, lizards or fish, but remains practically unknown in other animal groups such as turtles. In addition, female ornaments and their relation with sexual selection also remain almost unknown. Here, we measured the coloration of the shell and the limb stripes of male and female Spanish terrapins Mauremys leprosa and explored the existence of sexual dichromatism and the relation of color characteristics with body size and health state estimated from the immune response to the injection of an antigen (phytohaemagglutinin test). Our results showed that shell coloration, which could be constrained by natural selection to be cryptic, changed with body size, but did not differ between sexes. In contrast, females had brighter and less ultraviolet-saturated and more orange-saturated limb stripes than males. In females, interindividual variation in limb stripe coloration was related with body size and immune response suggesting that this coloration may inform honestly about multiple traits that could be important in sexual selection. In contrast, coloration of limb stripes of males was duller than in females, and was not related with any trait suggesting that coloration is not important in sexual selection for males.

  4. The road coloring problem

    OpenAIRE

    Trahtman, A. N.

    2007-01-01

    The synchronizing word of deterministic automaton is a word in the alphabet of colors (considered as letters) of its edges that maps the automaton to a single state. A coloring of edges of a directed graph is synchronizing if the coloring turns the graph into deterministic finite automaton possessing a synchronizing word. The road coloring problem is a problem of synchronizing coloring of directed finite strongly connected graph with constant outdegree of all its vertices if the greatest comm...

  5. Color management of porcelain veneers: influence of dentin and resin cement colors

    NARCIS (Netherlands)

    A. Dozic; M. Tsagkari; G. Khashayar; M. Aboushelib

    2010-01-01

    Objective: Porcelain veneers have become an interesting treatment option to correct the shape and color of anterior teeth. Because of their limited thickness and high translucency, achieving a good color match is influenced by several variables. The aim of this work was to investigate the influence

  6. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology.

    Science.gov (United States)

    Nadler, Steven A; DE León, Gerardo Pérez-Ponce

    2011-11-01

    Herein we review theoretical and methodological considerations important for finding and delimiting cryptic species of parasites (species that are difficult to recognize using traditional systematic methods). Applications of molecular data in empirical investigations of cryptic species are discussed from an historical perspective, and we evaluate advantages and disadvantages of approaches that have been used to date. Developments concerning the theory and practice of species delimitation are emphasized because theory is critical to interpretation of data. The advantages and disadvantages of different molecular methodologies, including the number and kind of loci, are discussed relative to tree-based approaches for detecting and delimiting cryptic species. We conclude by discussing some implications that cryptic species have for research programmes in parasitology, emphasizing that careful attention to the theory and operational practices involved in finding, delimiting, and describing new species (including cryptic species) is essential, not only for fully characterizing parasite biodiversity and broader aspects of comparative biology such as systematics, evolution, ecology and biogeography, but to applied research efforts that strive to improve development and understanding of epidemiology, diagnostics, control and potential eradication of parasitic diseases.

  7. How Hidden are Hidden Processes? A Primer on Crypticity and Entropy Convergence

    CERN Document Server

    Mahoney, John R; James, Ryan G; Crutchfield, James P

    2011-01-01

    We investigate a stationary process's crypticity---a measure of the difference between its hidden state information and its observed information---using the causal states of computational mechanics. Here, we motivate crypticity and cryptic order as physically meaningful quantities that monitor how hidden a hidden process is. This is done by recasting previous results on the convergence of block entropy and block-state entropy in a geometric setting, one that is more intuitive and that leads to a number of new results. For example, we connect crypticity to how an observer synchronizes to a process. We show that the block-causal-state entropy is a convex function of block length. We give a complete analysis of spin chains. We present a classification scheme that surveys stationary processes in terms of their possible cryptic and Markov orders. We illustrate related entropy convergence behaviors using a new form of foliated information diagram. Finally, along the way, we provide a variety of interpretations of c...

  8. Cryptic diversity and ecosystem functioning: a complex tale of differential effects on decomposition.

    Science.gov (United States)

    De Meester, N; Gingold, R; Rigaux, A; Derycke, S; Moens, T

    2016-10-01

    Marine ecosystems are experiencing accelerating population and species loss. Some ecosystem functions are decreasing and there is growing interest in the link between biodiversity and ecosystem functioning. The role of cryptic (morphologically identical but genetically distinct) species in this biodiversity-ecosystem functioning link is unclear and has not yet been formally tested. We tested if there is a differential effect of four cryptic species of the bacterivorous nematode Litoditis marina on the decomposition process of macroalgae. Bacterivorous nematodes can stimulate or slow down bacterial activity and modify the bacterial assemblage composition. Moreover, we tested if interspecific interactions among the four cryptic species influence the decomposition process. A laboratory experiment with both mono- and multispecific nematode cultures was conducted, and loss of organic matter and the activity of two key extracellular enzymes for the degradation of phytodetritus were assessed. L. marina mainly influenced qualitative aspects of the decomposition process rather than its overall rate: an effect of the nematodes on the enzymatic activities became manifest, although no clear nematode effect on bulk organic matter weight loss was found. We also demonstrated that species-specific effects on the decomposition process existed. Combining the four cryptic species resulted in high competition, with one dominant species, but without complete exclusion of other species. These interspecific interactions translated into different effects on the decomposition process. The species-specific differences indicated that each cryptic species may play an important and distinct role in ecosystem functioning. Functional differences may result in coexistence among very similar species. PMID:27337962

  9. Micro-Expression Recognition Using Color Spaces.

    Science.gov (United States)

    Wang, Su-Jing; Yan, Wen-Jing; Li, Xiaobai; Zhao, Guoying; Zhou, Chun-Guang; Fu, Xiaolan; Yang, Minghao; Tao, Jianhua

    2015-12-01

    Micro-expressions are brief involuntary facial expressions that reveal genuine emotions and, thus, help detect lies. Because of their many promising applications, they have attracted the attention of researchers from various fields. Recent research reveals that two perceptual color spaces (CIELab and CIELuv) provide useful information for expression recognition. This paper is an extended version of our International Conference on Pattern Recognition paper, in which we propose a novel color space model, tensor independent color space (TICS), to help recognize micro-expressions. In this paper, we further show that CIELab and CIELuv are also helpful in recognizing micro-expressions, and we indicate why these three color spaces achieve better performance. A micro-expression color video clip is treated as a fourth-order tensor, i.e., a four-dimension array. The first two dimensions are the spatial information, the third is the temporal information, and the fourth is the color information. We transform the fourth dimension from RGB into TICS, in which the color components are as independent as possible. The combination of dynamic texture and independent color components achieves a higher accuracy than does that of RGB. In addition, we define a set of regions of interests (ROIs) based on the facial action coding system and calculated the dynamic texture histograms for each ROI. Experiments are conducted on two micro-expression databases, CASME and CASME 2, and the results show that the performances for TICS, CIELab, and CIELuv are better than those for RGB or gray. PMID:26540689

  10. Achieving Standardization

    DEFF Research Database (Denmark)

    Henningsson, Stefan

    2016-01-01

    competitive, national customs and regional economic organizations are seeking to establish a standardized solution for digital reporting of customs data. However, standardization has proven hard to achieve in the socio-technical e-Customs solution. In this chapter, the authors identify and describe what has...... to be harmonized in order for a global company to perceive e-Customs as standardized. In doing so, they contribute an explanation of the challenges associated with using a standardization mechanism for harmonizing socio-technical information systems....

  11. Achieving Standardization

    DEFF Research Database (Denmark)

    Henningsson, Stefan

    2014-01-01

    competitive, national customs and regional economic organizations are seeking to establish a standardized solution for digital reporting of customs data. However, standardization has proven hard to achieve in the socio-technical e-Customs solution. In this chapter, the authors identify and describe what has...... to be harmonized in order for a global company to perceive e-Customs as standardized. In doing so, they contribute an explanation of the challenges associated with using a standardization mechanism for harmonizing socio-technical information systems....

  12. Cryptic population dynamics: rapid evolution masks trophic interactions.

    Directory of Open Access Journals (Sweden)

    Takehito Yoshida

    2007-09-01

    Full Text Available Trophic relationships, such as those between predator and prey or between pathogen and host, are key interactions linking species in ecological food webs. The structure of these links and their strengths have major consequences for the dynamics and stability of food webs. The existence and strength of particular trophic links has often been assessed using observational data on changes in species abundance through time. Here we show that very strong links can be completely missed by these kinds of analyses when changes in population abundance are accompanied by contemporaneous rapid evolution in the prey or host species. Experimental observations, in rotifer-alga and phage-bacteria chemostats, show that the predator or pathogen can exhibit large-amplitude cycles while the abundance of the prey or host remains essentially constant. We know that the species are tightly linked in these experimental microcosms, but without this knowledge, we would infer from observed patterns in abundance that the species are weakly or not at all linked. Mathematical modeling shows that this kind of cryptic dynamics occurs when there is rapid prey or host evolution for traits conferring defense against attack, and the cost of defense (in terms of tradeoffs with other fitness components is low. Several predictions of the theory that we developed to explain the rotifer-alga experiments are confirmed in the phage-bacteria experiments, where bacterial evolution could be tracked. Modeling suggests that rapid evolution may also confound experimental approaches to measuring interaction strength, but it identifies certain experimental designs as being more robust against potential confounding by rapid evolution.

  13. Cryptic sex in the smallest eukaryotic marine green alga.

    Science.gov (United States)

    Grimsley, Nigel; Péquin, Bérangère; Bachy, Charles; Moreau, Hervé; Piganeau, Gwenaël

    2010-01-01

    Ostreococcus spp. are common worldwide oceanic picoeukaryotic pelagic algae. The complete genomes of three strains from different ecological niches revealed them to represent biologically distinct species despite their identical cellular morphologies (cryptic species). Their tiny genomes (13 Mb), with approximately 20 chromosomes, are colinear and densely packed with coding sequences, but no sexual life cycle has been described. Seventeen new strains of one of these species, Ostreococcus tauri, were isolated from 98 seawater samplings from the NW Mediterranean by filtering, culturing, cloning, and plating for single colonies and identification by sequencing their ribosomal 18S gene. In order to find the genetic markers for detection of polymorphisms and sexual recombination, we used an in silico approach to screen available genomic data. Intergenic regions of DNA likely to evolve neutrally were analyzed following polymerase chain reaction amplification of sequences using flanking primers from adjacent conserved coding sequences that were present as syntenic pairs in two different species of Ostreococcus. Analyses of such DNA regions from eight marker loci on two chromosomes from each strain revealed that the isolated O. tauri clones were haploid and that the overall level of polymorphism was approximately 0.01. Four different genetic tests for recombination showed that sexual exchanges must be inferred to account for the between-locus and between-chromosome marker combinations observed. However, our data suggest that sexual encounters are infrequent because we estimate the frequency of meioses/mitoses among the sampled strains to be 10(-6). Ostreococcus tauri and related species encode and express core genes for mitosis and meiosis, but their mechanisms of cell division and recombination, nevertheless, remain enigmatic because a classical eukaryotic spindle with 40 canonical microtubules would be much too large for the available approximately 0.9-microm(3) cellular

  14. Cryptic diversity and symbiont interactions in rock-posy lichens.

    Science.gov (United States)

    Leavitt, Steven D; Kraichak, Ekaphan; Vondrak, Jan; Nelsen, Matthew P; Sohrabi, Mohammad; Perez-Ortega, Sergio; St Clair, Larry L; Lumbsch, H Thorsten

    2016-06-01

    Identifying factors that influence species interactions is central to research in symbiotic systems. While lichens represent iconic models of symbiosis and play important roles in understanding the biology of symbiotic interactions, patterns of interactions in lichen symbionts and mechanisms governing these relationships are not well characterized. This is due, in part to the fact that current taxonomic approaches for recognizing diversity in lichen symbionts commonly fail to accurately reflect actual species diversity. In this study, we employed DNA-based approaches to circumscribed candidate species-level lineages in rock-posy lichen symbionts (mycobiont=Rhizoplaca s. lat. species; photobiont=Trebouxia species). Our results revealed a high degree of cryptic diversity in both the myco- and photobionts in these lichens. Using the candidate species circumscribed here, we investigated the specificity of the symbionts toward their partners and inferred the relative importance of various factors influencing symbiont interactions. Distinct mycobiont species complexes, ecozones, and biomes are significantly correlated with the occurrence of photobiont OTUs, indicating that complex interactions among mycobiont lineages, ecogeography, and microhabitat determine interactions between photobionts and their mycobionts in lichen symbiosis. One-to-one specificity between mycobiont and photobiont species was not found, with the exception of R. maheui that associated with a single Trebouxia OTU that was not found with other Rhizoplaca s. lat. species. We estimated the most recent common ancestor of the core Rhizoplaca group at c. 62.5Ma, similar in age to the diverse parmelioid core group in the well-studied family Parmeliaceae. However, in contrast to Parmeliaceae, species in Rhizoplaca were found to associate with a narrow range of photobionts. Our study provides important perspectives into species diversity and interactions in iconic lichen symbiotic systems and establishes a

  15. Cryptic diversity and symbiont interactions in rock-posy lichens.

    Science.gov (United States)

    Leavitt, Steven D; Kraichak, Ekaphan; Vondrak, Jan; Nelsen, Matthew P; Sohrabi, Mohammad; Perez-Ortega, Sergio; St Clair, Larry L; Lumbsch, H Thorsten

    2016-06-01

    Identifying factors that influence species interactions is central to research in symbiotic systems. While lichens represent iconic models of symbiosis and play important roles in understanding the biology of symbiotic interactions, patterns of interactions in lichen symbionts and mechanisms governing these relationships are not well characterized. This is due, in part to the fact that current taxonomic approaches for recognizing diversity in lichen symbionts commonly fail to accurately reflect actual species diversity. In this study, we employed DNA-based approaches to circumscribed candidate species-level lineages in rock-posy lichen symbionts (mycobiont=Rhizoplaca s. lat. species; photobiont=Trebouxia species). Our results revealed a high degree of cryptic diversity in both the myco- and photobionts in these lichens. Using the candidate species circumscribed here, we investigated the specificity of the symbionts toward their partners and inferred the relative importance of various factors influencing symbiont interactions. Distinct mycobiont species complexes, ecozones, and biomes are significantly correlated with the occurrence of photobiont OTUs, indicating that complex interactions among mycobiont lineages, ecogeography, and microhabitat determine interactions between photobionts and their mycobionts in lichen symbiosis. One-to-one specificity between mycobiont and photobiont species was not found, with the exception of R. maheui that associated with a single Trebouxia OTU that was not found with other Rhizoplaca s. lat. species. We estimated the most recent common ancestor of the core Rhizoplaca group at c. 62.5Ma, similar in age to the diverse parmelioid core group in the well-studied family Parmeliaceae. However, in contrast to Parmeliaceae, species in Rhizoplaca were found to associate with a narrow range of photobionts. Our study provides important perspectives into species diversity and interactions in iconic lichen symbiotic systems and establishes a

  16. "Cryptic" diagenesis and its implications for speleothem geochronologies

    Science.gov (United States)

    Bajo, Petra; Hellstrom, John; Frisia, Silvia; Drysdale, Russell; Black, Jay; Woodhead, Jon; Borsato, Andrea; Zanchetta, Giovanni; Wallace, Malcolm W.; Regattieri, Eleonora; Haese, Ralf

    2016-09-01

    Speleothems are usually considered as one of the most amenable palaeoclimate archives for U-series dating. A number of studies in recent years, however, report cases of diagenetic alteration which compromises the use of U-series systematics in speleothems, resulting in inaccurate U-Th ages. Here we present the results of a high-resolution U-Th dating study of a stalagmite (CC26) from Corchia Cave in Italy where we document a number of departures from an otherwise well-defined age-depth model, and explore potential causes for these outliers. Unlike examples illustrated in previous studies, CC26 contains no visible evidence of neomorphism, and appears, at least superficially, ideally suited to dating. Good reproducibility obtained between multi-aliquot U-Th analyses removes any possibility of analytical issues contributing to these outliers. Furthermore, replicate analyses of samples from the same stratigraphic layer yielded ages in stratigraphic sequence, implying very localized open-system behavior. Uranium loss is suggested as a causative mechanism on account of the fact that all the outliers are older than their assumed true age. A limited number of micro-voids were observed under micro-CT analyses, and it is proposed that these were pathways for U loss. Uranium-loss modelling allows us to constrain the possible timing of diagenetic alteration and indicates that the precursor for the outlier with the largest age discrepancy (309%) must have been aragonite. This study indicates that visibly unaltered speleothems may still contain small domains that have experienced post-depositional alteration. Such "cryptic" diagenesis, as recorded in this stalagmite, has implications for the constancy of accuracy of the U-series dating technique, and suggests a need for careful examination of speleothems prior to dating, particularly in low-resolution U-Th studies.

  17. Characterization of a Cryptic and Intriguing Low Molecular Weight Plasmid.

    Science.gov (United States)

    Carneiro, Lilian C; Mendes, Paulo Vinicius C; Silva, Silvana P; Souza, Guilherme R L; Bataus, Luiz Artur M

    2016-03-01

    The complete nucleotide sequence of cryptic plasmid pVCM04 isolated from Salmonella enterica serovar Enteritidis was determined and analyzed. pVCM04 contains 3853 bp with 53.6 % GC content and has twelve ORFs with more than 50 amino acids. Five of these sequences showed homology with replication and mobilization proteins. ORF1 and ORF2 showed homology with replication proteins, while ORFs 3-5 showed homology with mobilization proteins. The pVCM04 possesses a region associated with the theta-type replication mechanism. BLASTn search analysis revealed unexpectedly no similarity with sequences deposited in GenBank. The nucleotide sequence of pVCM04 can be divided into two arms: the region between nucleotides 552-1774 (encoding RepA and RepB) and the region between nucleotides 1775-3853 (encoding MobA, MobB and MobC). Codon bias pattern is distinct between mobA and repA, so the program Modeltest was used to select the best evolutionary model to study these genes. The result of ModelTest (model GTR+G for mobA and model HKY+G for repA) suggests that these genes would be subject to different selective pressures. Considering the differences in the codon usage, the selection of two different evolutionary models, and the absence of plasmids with homology to pVCM04 in GenBank, we believe that pVCM04 is a chimeric molecule and represents a new plasmid lineage. PMID:26670037

  18. Laser-evoked coloration in polymers

    Science.gov (United States)

    Zheng, H. Y.; Rosseinsky, David; Lim, G. C.

    2005-05-01

    Laser-evoked coloration in polymers has long been a major aim of polymer technology for potential applications in product surface decoration, marking personalised images and logos. However, the coloration results reported so far were mostly attributed to laser-induced thermal-chemical reactions. The laser-irradiated areas are characterized with grooves due to material removal. Furthermore, only single color was laser-induced in any given polymer matrix. To induce multiple colors in a given polymer matrix with no apparent surface material removal is most desirable and challenging and may be achieved through laser-induced photo-chemical reactions. However, little public information is available at present. We report that two colors of red and green have been produced on an initially transparent CPV/PVA samples through UV laser-induced photo-chemical reactions. This is believed the first observation of laser-induced multiple-colors in the given polymer matrix. It is believed that the colorants underwent photo-effected electron transfer with suitable electron donors from the polymers to change from colorless bipyridilium Bipm 2+ to the colored Bipm + species. The discovery may lead to new approaches to the development of laser-evoked multiple coloration in polymers.

  19. Evaluating the smoothness of color transformations

    Science.gov (United States)

    Aristova, Anna; Wang, Zhaohui; Hardeberg, Jon Y.

    2011-01-01

    Multi-dimensional look up tables (LUTs) are widely employed for color transformations due to its high accuracy and general applicability. Using the LUT model generally involves the color measurement of a large number of samples. The precision and uncertainty of the color measurement will be mainly represented in the LUTs, and will affect the smoothness of the color transformation. This, in turn, strongly influences the quality of the reproduced color images. To achieve high quality color image reproduction, the color transformation is required to be relatively smooth. In this study, we have investigated the inherent characteristics of LUTs' transformation from color measurement and their effects on the quality of reproduced images. We propose an algorithm to evaluate the smoothness of 3D LUT based color transformations quantitatively, which is based on the analysis of 3D LUTs transformation from RGB to CIELAB and the second derivative of the differences between adjacent points in vertical and horizontal ramps of each LUT entry. The performance of the proposed algorithm was compared with a those proposed in two recent studies on smoothness, and a better performance is reached by the proposed method.

  20. Botrytis californica, a new cryptic species in the B. cinerea species complex causing gray mold in blueberries and table grapes

    Science.gov (United States)

    Botrytis cinerea consists of two cryptic species, referred to as Group I and Group II based on Bc-hch gene RFLP haplotyping, and Group I has been described as a new cryptic species B. pseudocinerea. During a survey for Botrytis spp. causing gray mold in blueberries and table grapes in the Central Va...

  1. Metabolism of Cryptic Peptides Derived from Neuropeptide FF Precursors: The Involvement of Insulin-Degrading Enzyme

    Directory of Open Access Journals (Sweden)

    Giuseppe Grasso

    2014-09-01

    Full Text Available The term “cryptome” refers to the subset of cryptic peptides with bioactivities that are often unpredictable and very different from the parent protein. These cryptic peptides are generated by proteolytic cleavage of proteases, whose identification in vivo can be very challenging. In this work, we show that insulin-degrading enzyme (IDE is able to degrade specific amino acid sequences present in the neuropeptide pro-NPFFA (NPFF precursor, generating some cryptic peptides that are also observed after incubation with rat brain cortex homogenate. The reported experimental findings support the increasingly accredited hypothesis, according to which, due to its wide substrate selectivity, IDE is involved in a wide variety of physiopathological processes.

  2. Features of cryptic promoters and their varied reliance on bromodomain-containing factors.

    Directory of Open Access Journals (Sweden)

    Samantha G Pattenden

    Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.

  3. A distinct translation initiation mechanism generates cryptic peptides for immune surveillance.

    Directory of Open Access Journals (Sweden)

    Shelley R Starck

    Full Text Available MHC class I molecules present a comprehensive mixture of peptides on the cell surface for immune surveillance. The peptides represent the intracellular protein milieu produced by translation of endogenous mRNAs. Unexpectedly, the peptides are encoded not only in conventional AUG initiated translational reading frames but also in alternative cryptic reading frames. Here, we analyzed how ribosomes recognize and use cryptic initiation codons in the mRNA. We find that translation initiation complexes assemble at non-AUG codons but differ from canonical AUG initiation in response to specific inhibitors acting within the peptidyl transferase and decoding centers of the ribosome. Thus, cryptic translation at non-AUG start codons can utilize a distinct initiation mechanism which could be differentially regulated to provide peptides for immune surveillance.

  4. Node Coloring and Color Conflict Detection in Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Saoucene Mahfoudh

    2010-10-01

    Full Text Available In wireless sensor networks, energy efficiency is mainly achieved by making nodes sleep. In this paper, we present the combination of SERENA, a new node activity scheduling algorithm based on node coloring, with TDMA/CA, a collision avoidance MAC protocol. We show that the  combination of these two protocols enables substantial bandwidth and energy benefits for both general and data gathering applications. As a first contribution, we prove that the three-hop node coloring problem is NP-complete. As a second contribution, the overhead induced by SERENA during network coloring is reduced, making possible the use of these protocols even in dense networks with limited bandwidth. The third contribution of this paper is to show that applying any slot assignment algorithmwith spatial reuse based on node neighborhood without taking into account link quality can lead to poor performances because of collisions. The use of good quality links will prevent this phenomenon. The fourth contribution consists of optimizing end-to-end delays for data gathering applications, by means of cross-layering with the application. However, color conflicts resulting from topology changes, mobility and late node arrivals can give rise to collisions. As a fifth contribution, we show how the MAC layer can detect color conflicts, and cope with them at the cost of a slightly reduced throughput. Then, we discuss the tradeoffbetween requesting SERENA to solve the color conflicts and dealing with them at the MAC layer, our third contribution. The combination of SERENA and TDMA/CA is evaluated through simulations on realistic topologies.

  5. Mixed signals? Morphological and molecular evidence suggest a color polymorphism in some neotropical polythore damselflies.

    Directory of Open Access Journals (Sweden)

    Melissa Sánchez Herrera

    Full Text Available The study of color polymorphisms (CP has provided profound insights into the maintenance of genetic variation in natural populations. We here offer the first evidence for an elaborate wing polymorphism in the Neotropical damselfly genus Polythore, which consists of 21 described species, distributed along the eastern slopes of the Andes in South America. These damselflies display highly complex wing colors and patterning, incorporating black, white, yellow, and orange in multiple wing bands. Wing colors, along with some components of the male genitalia, have been the primary characters used in species description; few other morphological traits vary within the group, and so there are few useful diagnostic characters. Previous research has indicated the possibility of a cryptic species existing in P. procera in Colombia, despite there being no significant differences in wing color and pattern between the populations of the two putative species. Here we analyze the complexity and diversity of wing color patterns of individuals from five described Polythore species in the Central Amazon Basin of Peru using a novel suite of morphological analyses to quantify wing color and pattern: geometric morphometrics, chromaticity analysis, and Gabor wavelet transformation. We then test whether these color patterns are good predictors of species by recovering the phylogenetic relationships among the 5 species using the barcode gene (COI. Our results suggest that, while highly distinct and discrete wing patterns exist in Polythore, these "wingforms" do not represent monophyletic clades in the recovered topology. The wingforms identified as P. victoria and P. ornata are both involved in a polymorphism with P. neopicta; also, cryptic speciation may have taking place among individuals with the P. victoria wingform. Only P. aurora and P. spateri represent monophyletic species with a single wingform in our molecular phylogeny. We discuss the implications of this

  6. Mixed signals? Morphological and molecular evidence suggest a color polymorphism in some neotropical polythore damselflies.

    Science.gov (United States)

    Sánchez Herrera, Melissa; Kuhn, William R; Lorenzo-Carballa, Maria Olalla; Harding, Kathleen M; Ankrom, Nikole; Sherratt, Thomas N; Hoffmann, Joachim; Van Gossum, Hans; Ware, Jessica L; Cordero-Rivera, Adolfo; Beatty, Christopher D

    2015-01-01

    The study of color polymorphisms (CP) has provided profound insights into the maintenance of genetic variation in natural populations. We here offer the first evidence for an elaborate wing polymorphism in the Neotropical damselfly genus Polythore, which consists of 21 described species, distributed along the eastern slopes of the Andes in South America. These damselflies display highly complex wing colors and patterning, incorporating black, white, yellow, and orange in multiple wing bands. Wing colors, along with some components of the male genitalia, have been the primary characters used in species description; few other morphological traits vary within the group, and so there are few useful diagnostic characters. Previous research has indicated the possibility of a cryptic species existing in P. procera in Colombia, despite there being no significant differences in wing color and pattern between the populations of the two putative species. Here we analyze the complexity and diversity of wing color patterns of individuals from five described Polythore species in the Central Amazon Basin of Peru using a novel suite of morphological analyses to quantify wing color and pattern: geometric morphometrics, chromaticity analysis, and Gabor wavelet transformation. We then test whether these color patterns are good predictors of species by recovering the phylogenetic relationships among the 5 species using the barcode gene (COI). Our results suggest that, while highly distinct and discrete wing patterns exist in Polythore, these "wingforms" do not represent monophyletic clades in the recovered topology. The wingforms identified as P. victoria and P. ornata are both involved in a polymorphism with P. neopicta; also, cryptic speciation may have taking place among individuals with the P. victoria wingform. Only P. aurora and P. spateri represent monophyletic species with a single wingform in our molecular phylogeny. We discuss the implications of this polymorphism, and the

  7. Diversity and environmental relations of cryptic, systemic Botrytis infections in symptomless hosts.

    Directory of Open Access Journals (Sweden)

    Michael W. Shaw

    2016-05-01

    Full Text Available Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. B. cinerea and B. pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles.

  8. Coloring night vision imagery for depth perception

    Institute of Scientific and Technical Information of China (English)

    Xiaojing Gu; Shaoyuan Sun; Jian'an Fang

    2009-01-01

    Depth perception for night vision(NV)imagery could largely improve scene comprehension.We present a novel scheme to give fused multi-band NV imagery smoothly natural color appearance as well as depth sense from color.Our approach is based on simulating color cues by varying saturation values of each object in the color NV image,in correspondence with the ratio between the infrared and low-light-level sensor outputs which in practice is the depth feature for same materials.We render the NV image segment-by-segment by taking advantage of image segmentation,dominant color transfer,saturation variation,and image fusion.Experiments have shown that the proposed scheme can achieve satisfying results.

  9. Color constancy by characterization of illumination chromaticity

    Science.gov (United States)

    Nikkanen, Jarno T.

    2011-05-01

    Computational color constancy algorithms play a key role in achieving desired color reproduction in digital cameras. Failure to estimate illumination chromaticity correctly will result in invalid overall colour cast in the image that will be easily detected by human observers. A new algorithm is presented for computational color constancy. Low computational complexity and low memory requirement make the algorithm suitable for resource-limited camera devices, such as consumer digital cameras and camera phones. Operation of the algorithm relies on characterization of the range of possible illumination chromaticities in terms of camera sensor response. The fact that only illumination chromaticity is characterized instead of the full color gamut, for example, increases robustness against variations in sensor characteristics and against failure of diagonal model of illumination change. Multiple databases are used in order to demonstrate the good performance of the algorithm in comparison to the state-of-the-art color constancy algorithms.

  10. Color vision: retinal blues.

    Science.gov (United States)

    Johnston, Jamie; Esposti, Federico; Lagnado, Leon

    2012-08-21

    Two complementary studies have resolved the circuitry underlying green-blue color discrimination in the retina. A blue-sensitive interneuron provides the inhibitory signal required for computing green-blue color opponency.

  11. Color chiral solitons

    CERN Document Server

    Novozhilov, V Yu; Novozhilov, Victor; Novozhilov, Yuri

    2002-01-01

    We discuss specific features of color chiral solitons (asymptotics, possibility of confainment, quantization) at example of isolated SU(2) color skyrmions, i.e. skyrmions in a background field which is the vacuum field forming the gluon condensate.

  12. Colors Can Affect Us!

    Institute of Scientific and Technical Information of China (English)

    张俊斌

    2006-01-01

    Different colors affect us differently.The following will show us how they work. Experiment proves that math problems worked on yellow paper have fewer mistakes than problems written on other colors of paper.

  13. Color rendition engine.

    Science.gov (United States)

    Zukauskas, Artūras; Vaicekauskas, Rimantas; Vitta, Pranciškus; Tuzikas, Arūnas; Petrulis, Andrius; Shur, Michael

    2012-02-27

    A source of white light with continuously tuned color rendition properties, such as color fidelity, as well as color saturating and color dulling ability has been developed. The source, which is composed of red (R), amber (A), green (G), and blue (B) light-emitting diodes, has a spectral power distribution varied as a weighted sum of "white" RGB and AGB blends. At the RGB and AGB end-points, the source has a highest color saturating and color dulling ability, respectively, as follows from the statistical analysis of the color-shift vectors for 1269 Munsell samples. The variation of the weight parameter allows for continuously traversing all possible metameric RAGB blends, including that with the highest color fidelity. The source was used in a psychophysical experiment on the estimation of the color appearance of familiar objects, such as vegetables, fruits, and soft-drink cans of common brands, at correlated color temperatures of 3000 K, 4500 K, and 6500 K. By continuously tuning the weight parameter, each of 100 subjects selected RAGB blends that, to their opinion, matched lighting characterized as "most saturating," "most dulling," "most natural," and "preferential". The end-point RGB and AGB blends have been almost unambiguously attributed to "most saturating" and "most dulling" lighting, respectively. RAGB blends that render a highest number of colors with high fidelity have, on average, been attributed to "most natural" lighting. The "preferential" color quality of lighting has, on average, been matched to RAGB blends that provide color rendition with fidelity somewhat reduced in favor of a higher saturation. Our results infer that tunable "color rendition engines" can validate color rendition metrics and provide lighting meeting specific needs and preferences to color quality. PMID:22418343

  14. Reimagining the Color Wheel

    Science.gov (United States)

    Snyder, Jennifer

    2011-01-01

    Color wheels are a traditional project for many teachers. The author has used them in art appreciation classes for many years, but one problem she found when her pre-service art education students created colored wheels was that they were boring: simple circles, with pie-shaped pieces, which students either painted or colored in. This article…

  15. Physical Environment and Middle Grade Achievement.

    Science.gov (United States)

    Chan, Tak Cheung

    This study measured the influence of air conditioning, carpeting, fluorescent lighting, and interior pastel coloring on the academic achievement of eighth grade Georgia pupils in 1975-76 when the variance due to socioeconomic status was statistically controlled. Analysis of covariance was used to compare the achievement scores of students on the…

  16. An Analysis of Predator Selection to Affect Aposematic Coloration in a Poison Frog Species.

    Directory of Open Access Journals (Sweden)

    Corinna E Dreher

    Full Text Available Natural selection is widely noted to drive divergence of phenotypic traits. Predation pressure can facilitate morphological divergence, for example the evolution of both cryptic and conspicuous coloration in animals. In this context Dendrobatid frogs have been used to study evolutionary forces inducing diversity in protective coloration. The polytypic strawberry poison frog (Oophaga pumilio shows strong divergence in aposematic coloration among populations. To investigate whether predation pressure is important for color divergence among populations of O. pumilio we selected four mainland populations and two island populations from Costa Rica and Panama. Spectrometric measurements of body coloration were used to calculate color and brightness contrasts of frogs as an indicator of conspicuousness for the visual systems of several potential predators (avian, crab and snake and a conspecific observer. Additionally, we conducted experiments using clay model frogs of different coloration to investigate whether the local coloration of frogs is better protected than non-local color morphs, and if predator communities vary among populations. Overall predation risk differed strongly among populations and interestingly was higher on the two island populations. Imprints on clay models indicated that birds are the main predators while attacks of other predators were rare. Furthermore, clay models of local coloration were equally likely to be attacked as those of non-local coloration. Overall conspicuousness (and brightness contrast of local frogs was positively correlated with attack rates by birds across populations. Together with results from earlier studies we conclude that conspicuousness honestly indicates toxicity to avian predators. The different coloration patterns among populations of strawberry poison frogs in combination with behavior and toxicity might integrate into equally efficient anti-predator strategies depending on local predation and

  17. Ultrathin Nanostructured Metals for Highly Transmissive Plasmonic Subtractive Color Filters

    CERN Document Server

    Zeng, Beibei; Bartoli, Filbert J

    2013-01-01

    Plasmonic color filters employing a single optically-thick nanostructured metal layer have recently generated considerable interest as an alternative to colorant-based color filtering technologies, due to their reliability, ease of fabrication, high color tunability. However, their relatively low transmission efficiency (~30%) is an important challenge that needs to be addressed. The present work reports, for the first time, a novel plasmonic subtractive color filtering scheme that exploits the counter-intuitive phenomenon of extraordinary low transmission (ELT) through an ultrathin nanostructured metal film. This approach relies on a fundamentally different color filtering mechanism than that of exsiting plasmonic additive color filters, and achieves unusually high transmission efficiencies of 60~70% for simple architectures. Furthermore, owing to short-range interactions of surface plasmon polaritons at ELT resonances, our design offers high spatial resolution color filtering with compact pixel size close t...

  18. Adaptive Color Calibration Based One-Shot Structured Light System

    Directory of Open Access Journals (Sweden)

    Jie Yuan

    2012-08-01

    Full Text Available In one-shot color structured light systems, the color of stripe patterns are typically distorted with respect to color crosstalk, ambient light and the albedo of the scanned objects, leading to mismatch in the correspondence of color stripes between the projected and captured images. In this paper, an adaptive color calibration and Discrete Trend Transform algorithm are presented to achieve high-resolution 3D reconstructions. The adaptive color calibration, according to the relative albedo in RGB channels, can improve the accuracy of labeling stripe by alleviating the effect of albedo and ambient light while decoding the color. Furthermore, the Discrete Trend Transform in the M channel makes the color calibration an effective method for detecting weak stripes due to the uneven surfaces or reflectance characteristics of the scanned objects. With this approach, the presented system is suitable for scanning moving objects and generating high-resolution 3D reconstructions without the need of dark laboratory environments.

  19. Reflective color STN-LCD technologies

    Science.gov (United States)

    Fujita, Shingo; Yamaguchi, Hisanori; Mizuno, Hiroaki; Ohtani, Toshiya; Sekime, Tomoaki; Hatanaka, Takayuki; Ogawa, Tetsu

    1998-04-01

    Reflective color STN-LCDs should be one of the most promising devices for mobile business tools (MBT), because the demand such as low cost, low power consumption, light weight and compact size is especially strong for this application. A reflective color STN-LCD with a single polarizer and double retardation films has been investigated. The double retardation films arranged in front of LC-layer enabled the LCD to contain reflective electrodes inside the panel. This configuration achieves the bright image with no parallax. A new construction of a reflective STN-LCD with a single polarizer has been decided by means of our own method in which the color difference (Delta) E* as the optimizing parameter has been used. Further, RGB color filters has been newly designed for our reflective LCD, and the aluminum (Al) layer has been introduced as reflective electrodes. As a result, we have realized 7.8-in.-diagonal refractive color STN-LCD(640 by 480) which has 15% reflectance, 1:14 contrast ratio, 4096 color capability and the sufficient color gamut. It has been confirmed that the single polarizer reflective color STN-LCD has sufficient enough performance for MBT use. We believe that it will be a key device for this application.

  20. Tanslation of Color Words

    Institute of Scientific and Technical Information of China (English)

    徐丹

    2009-01-01

    Being a minor part in the translation field,the translation of color words is far more complex than people may have imagined.Apart from the literal meaning of color words in the target language,there are other factors that affect the understanding.This paper mainly focuses on three main characteristics of color words that make the translation work difficult-color words'variations and combinations,rich symbolic meanings and culture differences.It also provides possible ways to deal with the prickly problem of finding equivalents,the complexity of transferring symbolic meanings and the subtle problem of crossing culture boundaries in translation of color words.

  1. Acquired color vision deficiency.

    Science.gov (United States)

    Simunovic, Matthew P

    2016-01-01

    Acquired color vision deficiency occurs as the result of ocular, neurologic, or systemic disease. A wide array of conditions may affect color vision, ranging from diseases of the ocular media through to pathology of the visual cortex. Traditionally, acquired color vision deficiency is considered a separate entity from congenital color vision deficiency, although emerging clinical and molecular genetic data would suggest a degree of overlap. We review the pathophysiology of acquired color vision deficiency, the data on its prevalence, theories for the preponderance of acquired S-mechanism (or tritan) deficiency, and discuss tests of color vision. We also briefly review the types of color vision deficiencies encountered in ocular disease, with an emphasis placed on larger or more detailed clinical investigations.

  2. Background matching and evolution of cryptic colours of selected passerines in deciduous woodlands

    DEFF Research Database (Denmark)

    Bursell, Jens; Dyck, Jan

    2003-01-01

    Most drab plumage colours are probably cryptic. Crypsis (camouflage) occurs when the colour of a significant part of the plumage is similar to the colour of a significant part of the background against which the prey bird may be detected by a potential predator. In this study we compare back...

  3. A cryptic BAP1 splice mutation in a family with uveal and cutaneous melanoma, and paraganglioma

    DEFF Research Database (Denmark)

    Wadt, K.; Choi, J.; Chung, J.Y.;

    2012-01-01

    as paraganglioma, breast cancer, and suspected mesothelioma cases in the family. Bioinformatic analysis and splicing assays demonstrated that this mutation creates a strong cryptic splice donor, resulting in aberrant splicing and a truncating frameshift of the BAP1 transcript. Somatic loss of the wild-type allele...

  4. Characterization of a cryptic gene pair from Neisseria gonorrhoeae that is common to pathogenic Neisseria species.

    OpenAIRE

    Seifert, H S; Wilson, D

    1992-01-01

    A pair of genes, each of which produces in Escherichia coli a 20-kDa, periplasmically localized protein that cross-reacts with anti-rpoN monoclonal antibody, was isolated from Neisseria gonorrhoeae. Homologs of the two genes were detected in pathogenic Neisseria species but not in commensal species. These genes are designated cnp1 and cnp2 (cryptic neisserial protein).

  5. Cryptic genetic variation can make "irreducible complexity" a common mode of adaptation in sexual populations.

    Science.gov (United States)

    Trotter, Meredith V; Weissman, Daniel B; Peterson, Grant I; Peck, Kayla M; Masel, Joanna

    2014-12-01

    The existence of complex (multiple-step) genetic adaptations that are "irreducible" (i.e., all partial combinations are less fit than the original genotype) is one of the longest standing problems in evolutionary biology. In standard genetics parlance, these adaptations require the crossing of a wide adaptive valley of deleterious intermediate stages. Here, we demonstrate, using a simple model, that evolution can cross wide valleys to produce "irreducibly complex" adaptations by making use of previously cryptic mutations. When revealed by an evolutionary capacitor, previously cryptic mutants have higher initial frequencies than do new mutations, bringing them closer to a valley-crossing saddle in allele frequency space. Moreover, simple combinatorics implies an enormous number of candidate combinations exist within available cryptic genetic variation. We model the dynamics of crossing of a wide adaptive valley after a capacitance event using both numerical simulations and analytical approximations. Although individual valley crossing events become less likely as valleys widen, by taking the combinatorics of genotype space into account, we see that revealing cryptic variation can cause the frequent evolution of complex adaptations.

  6. Cryptic species diversity in sub-Antarctic islands: A case study of Lepidonotothen.

    Science.gov (United States)

    Dornburg, Alex; Federman, Sarah; Eytan, Ron I; Near, Thomas J

    2016-11-01

    The marine fauna of the Southern Ocean is well known for an impressive adaptive radiation of fishes, the notothenioids. However, when compared to other marine areas, the frigid waters of the Southern Ocean also contain a seemingly large proportion of cryptic species. The documented instances of speciation in the absence of morphological change are largely observed in invertebrate taxa, in particular around peri- and sub-Antarctic islands such as South Georgia, which has been dubbed a cryptic species hotspot. This prevalence of cryptic species raises the question of how generalizable these patterns are for Antarctic vertebrates. Here we examine aspects of genotype and phenotype in an Antarctic notothenioid fish species, Lepidonotothen nudifrons, which is distributed in near shore habitats of the Antarctic Peninsula, South Orkney Islands, South Georgia, and the South Sandwich Islands. The results of our analyses show that L. nudifrons comprises two species. We highlight that cryptic species are phenomena not restricted to invertebrate lineages, raising the possibility that the species diversity of notothenioids and other Southern Ocean fishes is under-described. In addition, our findings raise several questions about the evolutionary origin and maintenance of morphological stasis in one of the most extreme habitats on earth.

  7. Restricted Gene Flow among Lineages of Thrips tabaci Supports Genetic Divergence Among Cryptic Species Groups

    Science.gov (United States)

    Jacobson, Alana L.; Nault, Brian A.; Vargo, Edward L.; Kennedy, George G.

    2016-01-01

    Knowledge of the relative influence of population- versus species-level genetic variation is important to understand patterns of phenotypic variation and ecological relationships that exist among and within morphologically indistinguishable cryptic species and subspecies. In the case of cryptic species groups that are pests, such knowledge is also essential for devising effective population management strategies. The globally important crop pest Thrips tabaci is a taxonomically difficult group of putatively cryptic species. This study examines population genetic structure of T. tabaci and reproductive isolation among lineages of this species complex using microsatellite markers and mitochondrial COI sequences. Overall, genetic structure supports T. tabaci as a cryptic species complex, although limited interbreeding occurs between different clonal groups from the same lineage as well as between individuals from different lineages. These results also provide evidence that thelytoky and arrhenotoky are not fixed phenotypes among members of different T. tabaci lineages that have been generally associated with either reproductive mode. Possible biological and ecological factors contributing to these observations are discussed. PMID:27690317

  8. ACTIVATION OF A CRYPTIC D-SERINE DEAMINASE (DSD) GENE FROM PSEUDOMONAS CEPACIA 17616

    Science.gov (United States)

    D-serine inhibits growth of P. cepacia 17616; however, resistant mutants able to express an ordinarily cryptic D-serine deaminase (dsd) gene were isolated readily. The resistant strains formed high levels of a D-serine deaminase active on D-threonine as well as D-serine. IS eleme...

  9. The effect of cryptic female choice on sex allocation in simultaneous hermaphrodites

    NARCIS (Netherlands)

    van Velzen, Ellen; Scharer, Lukas; Pen, Ido

    2009-01-01

    Sex allocation theory for simultaneous hermaphrodites has focused primarily on the effects of sperm competition, but the role of mate choice has so far been neglected. We present a model to study the coevolution of cryptic female choice and sex allocation in simultaneous hermaphrodites. We show that

  10. The Pragmatic Functions and Cultural Differences of Color Words

    Institute of Scientific and Technical Information of China (English)

    陈俊屹

    2015-01-01

    Color relates to people very closely; with the development of society and culture, people’s understanding of color is not confided to the visual characteristics of color itself, besides, people give color cultural connotation and actual meanings. In language, the unique glamour that the color words demonstrate makes people regard them with special esteem. Color words describe colors of nature with different cultural implications. They have unique linguistic functions and symbolic connotations. Colors play an indispensable part in our life and it's an effective way to learn the different culture. There is an increase in mis-understanding and communicative barriers because of frequent cross-cultural communication. Chinese and English color words possess different cultural meanings and connotation due to the difference in customs and habits, history and traditions, religions and beliefs, geographic locations, national psychology and ways of thinking. Thus, it’s easy to make mistakes on understanding and comprehension. The methods used in the research procedure are like this: collect some representative color words both from Chinese and English and take them as samples, then make a comparison between cultural connotations. According to the comparison, make a summary about the differences of color words between China and England. This thesis brings a discussion of cultural differences between English and Chinese color words. Color words in learning English is very important. It can help us t make a better understanding of the culture difference of both nations, and achieve the effective cross-culture communication.

  11. Colors, colored overlays, and reading skills

    Directory of Open Access Journals (Sweden)

    Arcangelo eUccula

    2014-07-01

    Full Text Available In this article, we are concerned with the role of colors in reading written texts. It has been argued that colored overlays applied above written texts positively influence both reading fluency and reading speed. These effects would be particularly evident for those individuals affected by the so called Meares-Irlen syndrome, i.e. who experience eyestrain and/or visual distortions – e.g. color, shape or movement illusions – while reading. This condition would interest the 12-14% of the general population and up to the 46% of the dyslexic population. Thus, colored overlays have been largely employed as a remedy for some aspects of the difficulties in reading experienced by dyslexic individuals, as fluency and speed. Despite the wide use of colored overlays, how they exert their effects has not been made clear yet. Also, according to some researchers, the results supporting the efficacy of colored overlays as a tool for helping readers are at least controversial. Furthermore, the very nature of the Meares-Irlen syndrome has been questioned. Here we provide a concise, critical review of the literature.

  12. Color Reproduction with a Smartphone

    Science.gov (United States)

    Thoms, Lars-Jochen; Colicchia, Giuseppe; Girwidz, Raimund

    2013-01-01

    The world is full of colors. Most of the colors we see around us can be created on common digital displays simply by superposing light with three different wavelengths. However, no mixture of colors can produce a fully pure color identical to a spectral color. Using a smartphone, students can investigate the main features of primary color addition…

  13. Codon optimization of the human papillomavirus E7 oncogene induces a CD8+ T cell response to a cryptic epitope not harbored by wild-type E7.

    Directory of Open Access Journals (Sweden)

    Felix K M Lorenz

    Full Text Available Codon optimization of nucleotide sequences is a widely used method to achieve high levels of transgene expression for basic and clinical research. Until now, immunological side effects have not been described. To trigger T cell responses against human papillomavirus, we incubated T cells with dendritic cells that were pulsed with RNA encoding the codon-optimized E7 oncogene. All T cell receptors isolated from responding T cell clones recognized target cells expressing the codon-optimized E7 gene but not the wild type E7 sequence. Epitope mapping revealed recognition of a cryptic epitope from the +3 alternative reading frame of codon-optimized E7, which is not encoded by the wild type E7 sequence. The introduction of a stop codon into the +3 alternative reading frame protected the transgene product from recognition by T cell receptor gene-modified T cells. This is the first experimental study demonstrating that codon optimization can render a transgene artificially immunogenic through generation of a dominant cryptic epitope. This finding may be of great importance for the clinical field of gene therapy to avoid rejection of gene-corrected cells and for the design of DNA- and RNA-based vaccines, where codon optimization may artificially add a strong immunogenic component to the vaccine.

  14. Characterization of pUCD5000 involved in pink disease color formation by Pantoea citrea.

    Science.gov (United States)

    Pujol, C J; Kado, C I

    1998-09-01

    Pantoea citrea, the causal agent of pink disease of pineapple, harbors a cryptic plasmid of 5229 bp. designated pUCD5000. On the basis of nucleotide and amino acid sequence analyses, pUCD5000 contains both replication and mobilization loci (bom and mobCABD) that are similar to those in plasmids pSW100 and pSW200 in Pantoea stewartii and pEC3 in Erwinia carotovora subsp. carotovora. The survival of P. citrea on pineapple does not depend on pUCD5000. However, full pink coloration development, which is characteristic of the pink disease, appears to require this plasmid. PMID:9735319

  15. Color (RGB) imaging laser radar

    Science.gov (United States)

    Ferri De Collibus, M.; Bartolini, L.; Fornetti, G.; Francucci, M.; Guarneri, M.; Nuvoli, M.; Paglia, E.; Ricci, R.

    2008-03-01

    We present a new color (RGB) imaging 3D laser scanner prototype recently developed in ENEA, Italy). The sensor is based on AM range finding technique and uses three distinct beams (650nm, 532nm and 450nm respectively) in monostatic configuration. During a scan the laser beams are simultaneously swept over the target, yielding range and three separated channels (R, G and B) of reflectance information for each sampled point. This information, organized in range and reflectance images, is then elaborated to produce very high definition color pictures and faithful, natively colored 3D models. Notable characteristics of the system are the absence of shadows in the acquired reflectance images - due to the system's monostatic setup and intrinsic self-illumination capability - and high noise rejection, achieved by using a narrow field of view and interferential filters. The system is also very accurate in range determination (accuracy better than 10 -4) at distances up to several meters. These unprecedented features make the system particularly suited to applications in the domain of cultural heritage preservation, where it could be used by conservators for examining in detail the status of degradation of frescoed walls, monuments and paintings, even at several meters of distance and in hardly accessible locations. After providing some theoretical background, we describe the general architecture and operation modes of the color 3D laser scanner, by reporting and discussing first experimental results and comparing high-definition color images produced by the instrument with photographs of the same subjects taken with a Nikon D70 digital camera.

  16. Affective Image Colorization

    Institute of Scientific and Technical Information of China (English)

    Xiao-Hui Wang; Jia Jia; Han-Yu Liao; Lian-Hong Cai

    2012-01-01

    Colorization of gray-scale images has attracted many attentions for a long time.An important role of image color is the conveyer of emotions (through color themes).The colorization with an undesired color theme is less useful,even it is semantically correct.However this has been rarely considered.Automatic colorization respecting both the semantics and the emotions is undoubtedly a challenge.In this paper,we propose a complete system for affective image colorization.We only need the user to assist object segmentation along with text labels and an affective word.First,the text labels along with other object characters are jointly used to filter the internet images to give each object a set of semantically correct reference images.Second,we select a set of color themes according to the affective word based on art theories.With these themes,a generic algorithm is used to select the best reference for each object,balancing various requirements.Finally,we propose a hybrid texture synthesis approach for colorization.To the best of our knowledge,it is the first system which is able to efficiently colorize a gray-scale image semantically by an emotionally controllable fashion.Our experiments show the effectiveness of our system,especially the benefit compared with the previous Markov random field (MRF) based method.

  17. Phylogeny of deepwater snappers (Genus Etelis) reveals a cryptic species pair in the Indo-Pacific and Pleistocene invasion of the Atlantic.

    Science.gov (United States)

    Andrews, Kimberly R; Williams, Ashley J; Fernandez-Silva, Iria; Newman, Stephen J; Copus, Joshua M; Wakefield, Corey B; Randall, John E; Bowen, Brian W

    2016-07-01

    Evolutionary genetic patterns in shallow coastal fishes are documented with dozens of studies, but corresponding surveys of deepwater fishes (>200m) are scarce. Here we investigate the evolutionary history of deepwater snappers (genus Etelis), comprised of three recognized Indo-Pacific species and one Atlantic congener, by constructing a phylogeny of the genus with two mtDNA loci and two nuclear introns. Further, we apply range-wide Indo-Pacific sampling to test for the presence and distribution of a putative cryptic species pair within E. carbunculus using morphological analyses and mtDNA cytochrome b sequences from 14 locations across the species range (N=1696). These analyses indicate that E. carbunculus is comprised of two distinct, non-interbreeding lineages separated by deep divergence (d=0.081 in cytochrome b). Although these species are morphologically similar, we identified qualitative differences in coloration of the upper-caudal fin tip and the shape of the opercular spine, as well as significant differences in adult body length, body depth, and head length. These two species have overlapping Indo-Pacific distributions, but one species is more widespread across the Indo-Pacific, whereas the other species is documented in the Indian Ocean and Western Central Pacific. The dated Etelis phylogeny places the cryptic species divergence in the Pliocene, indicating that the biogeographic barrier between the Indian and Pacific Oceans played a role in speciation. Based on historic taxonomy and nomenclature, the species more widespread in the Pacific Ocean is E. carbunculus, and the other species is previously undescribed (referred to here as E. sp.). The Atlantic congener E. oculatus has only recently (∼0.5Ma) diverged from E. coruscans in the Indo-Pacific, indicating colonization via southern Africa. The pattern of divergence at the Indo-Pacific barrier, and Pleistocene colonization from the Indian Ocean into the Atlantic, is concordant with patterns observed

  18. Detection of {open_quotes}cryptic{close_quotes}karyotypic rearrangements in closely related primate species by fluorescence in situ hybridization (FISH) using human subtelomeric DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Youngblom, J.J. [California State University-Stanislaus, Turlock, CA (United States); Trask, B.J.; Friedman, C. [Univ. of Washington, Seattle, WA (United States)] [and others

    1994-09-01

    Specific human subtelomeric DNA probes were used to reveal cryptic chromosomal rearrangements that cannot be detected by conventional high resolution cytogenetic techniques, or by chromosomal in situ suppression hybridization using whole chromosome paint analysis. Two cosmids containing different subtelomeric DNA sequences were derived from human chromosome 19 and designated as 7501 and 16432. Cosmid 7501 was hybridized to chromosomes from humans, chimpanzee, gorilla and orangutan. In humans, 7501 consistently labeled chromosomes 3q, 15q, and 19p. Additional chromosomes were labeled in different individuals, indicating a polymorphic distribution of this sequence in the human genome. In contrast, 7501 consistently and strongly labeled only the q arm terminus of chromosome 3 in both chimp and gorilla. The identification of the chromosome was made by two-color FISH analysis using human chromosome 4-specific paint and homologous to human chromosome 4. None of the human subjects showed labeling of chromosome 4 with 7501. This finding suggests that in the course of human evolution, subsequent to the divergence of humans and African apes, a cryptic translocation occurred between the ancestral human chromosome 4 and one or more of the other human chromosomes that now contain this DNA segment. In orangutan, 7501 labeled a single acrocentric chromosome pair, a distinctly different chromosome than that labeled in chimp and gorilla. Comparison of chromosome sites labeled with cosmid 16432 showed the distribution of signals on chromosome 1q arm is the same for humans and chimp, but different in the gorilla. Humans and chimps show distinct labeling on sites 1q terminus and 1q41-42. In gorilla, there is instead a large cluster of intense signal near the terminus of 1q that clearly does not extend all the way to the terminus. A paracentric inversion or an unequal cross-over event may account for the observed difference between these species.

  19. Enhancing Color Representation for the Color Vision Impaired

    OpenAIRE

    Huang, Jia-Bin; Wu, Sih-Ying; Chen, Chu-Song

    2008-01-01

    In this paper, we propose a fast re-coloring algorithm to improve the accessibility for the color vision impaired. Compared to people with normal color vision, people with color vision impairment have difficulty in distinguishing between certain combinations of colors. This may hinder visual communication owing to the increasing use of colors in recent years. To address this problem, we re-map the hue components in the HSV color space based on the statistics of local characteristics of the or...

  20. Color image segmentation

    Science.gov (United States)

    McCrae, Kimberley A.; Ruck, Dennis W.; Rogers, Steven K.; Oxley, Mark E.

    1994-03-01

    The most difficult stage of automated target recognition is segmentation. Current segmentation problems include faces and tactical targets; previous efforts to segment these objects have used intensity and motion cues. This paper develops a color preprocessing scheme to be used with the other segmentation techniques. A neural network is trained to identify the color of a desired object, eliminating all but that color from the scene. Gabor correlations and 2D wavelet transformations will be performed on stationary images; and 3D wavelet transforms on multispectral data will incorporate color and motion detection into the machine visual system. The paper will demonstrate that color and motion cues can enhance a computer segmentation system. Results from segmenting faces both from the AFIT data base and from video taped television are presented; results from tactical targets such as tanks and airplanes are also given. Color preprocessing is shown to greatly improve the segmentation in most cases.

  1. The road coloring problem

    CERN Document Server

    Trahtman, A N

    2007-01-01

    The synchronizing word of deterministic automaton is a word in the alphabet of colors (considered as letters) of its edges that maps the automaton to a single state. A coloring of edges of a directed graph is synchronizing if the coloring turns the graph into deterministic finite automaton possessing a synchronizing word. The road coloring problem is a problem of synchronizing coloring of directed finite strongly connected graph with constant outdegree of all its vertices if the greatest common divisor of lengths of all its cycles is one. The problem was posed by Adler, Goodwyn and Weiss over 30 years ago and evoked a noticeable interest among the specialists in theory of graphs, deterministic automata and symbolic dynamics. The problem is described even in "Vikipedia" - the popular Internet Encyclopedia. The positive solution of the road coloring problem is presented.

  2. Masters Colors -meikkisarjan lanseeraus

    OpenAIRE

    Muhonen, Veera; Renlund, Siri

    2013-01-01

    Toiminnallisen opinnäytetyön tarkoituksena oli suunnitella ja toteuttaa Masters Colors –meikkisarjan lanseeraustoimenpiteet. Opinnäytetyö toteutettiin yhteistyössä hoitolakosmetiikan maahantuontiyritys Benecom Oy:n kanssa. Yrityksen päätoimisena maahantuontisarjana toimii Guinot-hoitolakosmetiikkasarja, jonka lisäksi Benecom Oy tuo maahan Guinot-konsernin Masters Colors –meikkisarjaa sekä Cosmecology –kosmetiikkaa. Masters Colors on kehitetty laajentamaan Guinot-kauneushoitoloiden palveluvali...

  3. The Translation Of Colors

    Institute of Scientific and Technical Information of China (English)

    王冰

    2012-01-01

    Different nations have different or even opposite perception of color, which results in non-equivalence of color words in mutual translation between Chinese and English. This paper is to discuss non-equivalence of color words between Chinese and English on the two aspects and emphasizes the importance of transmitting cultural message accurately in the mutual translation between Chinese and English. Studying the cultural connotations of the words is of great importance for successful communication.

  4. Color mixing models

    Science.gov (United States)

    Harrington, Steven J.

    1992-05-01

    In black-and-white printing the page image can be represented within a computer as an array of binary values indicating whether or not pixels should be inked. The Boolean operators of AND, OR, and EXCLUSIVE-OR are often used when adding new objects to the image array. For color printing the page may be represented as an array of continuous tone color values, and the generalization of these logic functions to gray-scale or full-color images is, in general, not defined or understood. When incrementally composing a page image new colors can replace old in an image buffer, or new colors and old can be combined according to some mixing function to form a composite color which is stored. This paper examines the properties of the Boolean operations and suggests full-color mixing functions which preserve the desired properties. These functions can be used to combine colored images, giving various transparency effects. The relationships between the mixing functions and physical models of color mixing are also discussed.

  5. How color effekts communication

    OpenAIRE

    Sachilovich, K. P.

    2013-01-01

    When speaking about communication, there are, in fact two aspects that come into mind, namely, verbal and non-verbal communication. By nonverbal means of communication people usually mean mimics, gestures, posture, voice, intonation, etc. But very few of them are aware of the fact that color is also a means of non-verbal communication, and a very powerful one. When talking about color I mean color in every meaning of the word. For instance, let’s take the color of walls in classrooms or a...

  6. Polarization encoded color camera.

    Science.gov (United States)

    Schonbrun, Ethan; Möller, Guðfríður; Di Caprio, Giuseppe

    2014-03-15

    Digital cameras would be colorblind if they did not have pixelated color filters integrated into their image sensors. Integration of conventional fixed filters, however, comes at the expense of an inability to modify the camera's spectral properties. Instead, we demonstrate a micropolarizer-based camera that can reconfigure its spectral response. Color is encoded into a linear polarization state by a chiral dispersive element and then read out in a single exposure. The polarization encoded color camera is capable of capturing three-color images at wavelengths spanning the visible to the near infrared. PMID:24690806

  7. Color fusion of SAR and FLIR images using a natural color transfer technique

    Institute of Scientific and Technical Information of China (English)

    Shaoyuan Sun; Zhongliang Jing; Zhenhua Li; Gang Liu

    2005-01-01

    Fusion of synthetic aperture radar (SAR) and forward looking infrared (FLIR) images is an important subject for aerospace and sensor surveillance. This paper presents a scheme to achieve a natural color image based on the contours feature of SAR and the target region feature of FLIR so that the overall scene recognition and situational awareness can be improved. The SAR and FLIR images are first decomposed into steerable pyramids, and the contour maps in the SAR image and the region maps in the FLIR image are calculated. The contour and region features are fused at each level of the steerable pyramids. A color image is then formed by transferring daytime color to the monochromic image by using the natural color transfer technique. Experimental results show that the proposed method is effective in providing a color fusion of SAR and FLIR images.

  8. A framework for interactive image color editing

    KAUST Repository

    Musialski, Przemyslaw

    2012-11-09

    We propose a new method for interactive image color replacement that creates smooth and naturally looking results with minimal user interaction. Our system expects as input a source image and rawly scribbled target color values and generates high quality results in interactive rates. To achieve this goal we introduce an algorithm that preserves pairwise distances of the signatures in the original image and simultaneously maps the color to the user defined target values. We propose efficient sub-sampling in order to reduce the computational load and adapt semi-supervised locally linear embedding to optimize the constraints in one objective function. We show the application of the algorithm on typical photographs and compare the results to other color replacement methods. © 2012 Springer-Verlag Berlin Heidelberg.

  9. Natural color image segmentation using integrated mechanism

    Institute of Scientific and Technical Information of China (English)

    Jie Xu (徐杰); Pengfei Shi (施鹏飞)

    2003-01-01

    A new method for natural color image segmentation using integrated mechanism is proposed in this paper.Edges are first detected in term of the high phase congruency in the gray-level image. K-mean cluster is used to label long edge lines based on the global color information to estimate roughly the distribution of objects in the image, while short ones are merged based on their positions and local color differences to eliminate the negative affection caused by texture or other trivial features in image. Region growing technique is employed to achieve final segmentation results. The proposed method unifies edges, whole and local color distributions, as well as spatial information to solve the natural image segmentation problem.The feasibility and effectiveness of this method have been demonstrated by various experiments.

  10. Why most Brand Manuals fail when it comes to defining Brand Colors

    DEFF Research Database (Denmark)

    Abildgaard, Michael

    2016-01-01

    and describing their Brand Colors, they all fail. By examining and analyzing more than 300 different Brand Colors from 156 Brand Manuals by reputable local and global Brands including 28 of the 100 Best Global Brands (see Appendix) and by numerous of visits and interviews with responsible professionals from both...... CMYK-values even though only 45.8 % of those Brand Colors are achievable by using the process colors CMYK. This will result in unpredicted color differences of up to 35 ΔEab or 8.3 ΔE2000 when some of those Brand Colors are reproduced. Nevertheless, none of the Brand Manuals has neither any remarks......, comments or warnings of color deviations nor indications of acceptable color tolerances. Only 1.3 % of the Brand Manuals also define their Brand Colors with device independent CIELAB-values. It appears that when designers and Brand Owners select and specifies Brand Colors they tend to choose colors which...

  11. Cloning vectors based on cryptic plasmids isolated from lactic acid bacteria: their characteristics and potential applications in biotechnology.

    Science.gov (United States)

    Shareck, Julie; Choi, Young; Lee, Byong; Miguez, Carlos B

    2004-01-01

    Lactic acid bacteria (LAB) are Gram positive bacteria, widely distributed in nature, and industrially important as they are used in a variety of industrial food fermentations. The use of genetic engineering techniques is an effective means of enhancing the industrial applicability of LAB. However, when using genetic engineering technology, safety becomes an essential factor for the application of improved LAB to the food industry. Cloning and expression systems should be derived preferably from LAB cryptic plasmids that generally encode genes for which functions can be proposed, but no phenotypes can be observed. However, some plasmid-encoded functions have been discovered in cryptic plasmids originating from Lactobacillus, Streptococcus thermophilus, and Pediococcus spp. and can be used as selective marker systems in vector construction. This article presents information concerning LAB cryptic plasmids, and their structures, functions, and applications. A total of 134 cryptic plasmids collated are discussed.

  12. Colorization of Gray Level Images by Using Optimization

    Directory of Open Access Journals (Sweden)

    Hossein Ghayoumi Zadeh

    2011-07-01

    Full Text Available This article discusses the colorization of gray level images. Because of the technique applied in this paper, this method can be used in colorizing medical images. Color images achieved have good distinction and separation. The proposed method can be used to separate the objects in gray images. Our method is based on a simple premise: neighboring pixels in space-time that have similar intensities should have similar colors. We formalize this premise using a quadratic cost function and obtain an optimization problem that can be solved efficiently using standard techniques. In our approach an artist only needs to annotate the image with a few color scribbles, and the indicated colors are automatically propagated in both space and time to produce a fully colorized image or sequence.

  13. Omni-Lie Color Algebras and Lie Color 2-Algebras

    OpenAIRE

    Zhang, Tao

    2013-01-01

    Omni-Lie color algebras over an abelian group with a bicharacter are studied. The notions of 2-term color $L_{\\infty}$-algebras and Lie color 2-algebras are introduced. It is proved that there is a one-to-one correspondence between Lie color 2-algebras and 2-term color $L_{\\infty}$-algebras.

  14. Encyclopedia of color science and technology

    CERN Document Server

    2016-01-01

    The Encyclopedia of Color Science and Technology provides an authoritative single source for understanding and applying the concepts of color to all fields of science and technology, including artistic and historical aspects of color. Many topics are discussed in this timely reference, including an introduction to the science of color, and entries on the physics, chemistry and perception of color. Color is described as it relates to optical phenomena of color and continues on through colorants and materials used to modulate color and also to human vision of color. The measurement of color is provided as is colorimetry, color spaces, color difference metrics, color appearance models, color order systems and cognitive color. Other topics discussed include industrial color, color imaging, capturing color, displaying color and printing color. Descriptions of color encodings, color management, processing color and applications relating to color synthesis for computer graphics are included in this work. The Encyclo...

  15. Navigation lights color study

    Science.gov (United States)

    Barbosa, Jose G.; Alberg, Matthew T.

    2015-05-01

    The chromaticity of navigation lights are defined by areas on the International Commission on Illumination (CIE) 1931 chromaticity diagram. The corner coordinates for these areas are specified in the International Regulations for Prevention of Collisions at Sea, 1972 (72 COLREGS). The navigation light's color of white, red, green, and yellow are bounded by these areas. The chromaticity values specified by the COLREGS for navigation lights were intended for the human visual system (HVS). The HVS can determine the colors of these lights easily under various conditions. For digital color camera imaging systems the colors of these lights are dependent on the camera's color spectral sensitivity, settings, and color correction. At night the color of these lights are used to quickly determine the relative course of vessels. If these lights are incorrectly identified or there is a delay in identifying them this could be a potential safety of ship concern. Vessels that use camera imaging systems exclusively for sight, at night, need to detect, identify, and discriminate navigation lights for navigation and collision avoidance. The introduction of light emitting diode (LED) lights and lights with different spectral signatures have the potential to be imaged very differently with an RGB color filter array (CFA) color camera than with the human eye. It has been found that some green navigation lights' images appear blue verse green. This has an impact on vessels that use camera imaging systems exclusively for navigation. This paper will characterize color cameras ability to properly reproducing navigation lights' color and survey a set of navigation light to determine if they conform to the COLREGS.

  16. Color change and camouflage in juvenile shore crabs Carcinus maenas

    OpenAIRE

    Martin eStevens; Alice E Lown; Wood, Louisa E.

    2014-01-01

    Camouflage is perhaps the most widespread anti-predator defense in nature, with many different types thought to exist. Of these, resembling the general color and pattern of the background (background matching) is likely to be the most common. Background matching can be achieved by adaptation of individual appearance to different habitats or substrates, behavioral choice, and color change. Although the ability to change coloration for camouflage over a period of hours or days is likely to be w...

  17. 3-D Color Wheels

    Science.gov (United States)

    DuBois, Ann

    2010-01-01

    The blending of information from an academic class with projects from art class can do nothing but strengthen the learning power of the student. Creating three-dimensional color wheels provides the perfect opportunity to combine basic geometry knowledge with color theory. In this article, the author describes how her seventh-grade painting…

  18. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... use of colored contact lenses , from the U.S. Food and Drug Administration (FDA). Are the colored lenses ... keratoconus have a new treatment option. The U.S. Food and Drug Administration (FDA) has approved corneal collagen ...

  19. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... use of colored contact lenses , from the U.S. Food and Drug Administration (FDA). Are the colored lenses ... Cheryl terHorst On one of his regular mid-day swims, 78-year old Leroy Muffler noticed a ...

  20. Dynamic egg color mimicry.

    Science.gov (United States)

    Hanley, Daniel; Šulc, Michal; Brennan, Patricia L R; Hauber, Mark E; Grim, Tomáš; Honza, Marcel

    2016-06-01

    Evolutionary hypotheses regarding the function of eggshell phenotypes, from solar protection through mimicry, have implicitly assumed that eggshell appearance remains static throughout the laying and incubation periods. However, recent research demonstrates that egg coloration changes over relatively short, biologically relevant timescales. Here, we provide the first evidence that such changes impact brood parasite-host eggshell color mimicry during the incubation stage. First, we use long-term data to establish how rapidly the Acrocephalus arundinaceus Linnaeus (great reed warbler) responded to natural parasitic eggs laid by the Cuculus canorus Linnaeus (common cuckoo). Most hosts rejected parasitic eggs just prior to clutch completion, but the host response period extended well into incubation (~10 days after clutch completion). Using reflectance spectrometry and visual modeling, we demonstrate that eggshell coloration in the great reed warbler and its brood parasite, the common cuckoo, changes rapidly, and the extent of eggshell color mimicry shifts dynamically over the host response period. Specifically, 4 days after being laid, the host should notice achromatic color changes to both cuckoo and warbler eggs, while chromatic color changes would be noticeable after 8 days. Furthermore, we demonstrate that the perceived match between host and cuckoo eggshell color worsened over the incubation period. These findings have important implications for parasite-host coevolution dynamics, because host egg discrimination may be aided by disparate temporal color changes in host and parasite eggs. PMID:27516874

  1. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... colored contact lenses , from the U.S. Food and Drug Administration (FDA). Are the colored lenses you are ... a new treatment option. The U.S. Food and Drug Administration (FDA) has approved corneal collagen cross-linking ( ...

  2. The Color of Lobsters

    NARCIS (Netherlands)

    Wijk, Arjan van

    2005-01-01

    Synthesis of 13C-enriched carotenoids. Carotenoids are natural colorants, ranging in color from pale yellow to deep purple, with important biological functions. Carotenoids in the human diet have a beneficial health effect, playing a role in the prevention of cardiovascular disease and cancer. To ge

  3. Gauge color codes

    DEFF Research Database (Denmark)

    Bombin Palomo, Hector

    2015-01-01

    Color codes are topological stabilizer codes with unusual transversality properties. Here I show that their group of transversal gates is optimal and only depends on the spatial dimension, not the local geometry. I also introduce a generalized, subsystem version of color codes. In 3D they allow the...

  4. Improving color saturation for color managed images rendered using the perceptual intent

    Science.gov (United States)

    Marcu, Gabriel G.

    2008-01-01

    In many cases, rendering images using color management approach may result in unsatisfactory color, particularly for cases when the gamut mismatch is large and the source / destination profile pair does not lead to a satisfactory color. This more often the case when images on laptop computer screens with limited color gamut are transferred to print and color management is used. For those cases, we present a method of improving image quality by manipulating the display profile such that the color quality of the printouts is not compromised by the small gamut of the portable display and color management. The basic idea consists of using in the color management pipeline of a virtual gamut that has the role of either the source or of the destination depending on the type of transformation and the gamut size of the source and destination in the color management pipeline. In case the mismatch between the source and destination gamut is under a threshold the virtual gamut is not used. This virtual gamut is constructed directly in the CIE 1931 chromaticity diagram, although other color spaces may be used. A procedure to derive a constant hue line from two adjacent lines is presented. The chromaticities of the virtual gamut are computed based on the replaced gamut chromaticities and a weighting factor computed automatically at the time of rendering. The method proves to give very pleasing results in prints for example and the boost in saturation approximates very well the color enhancement achieved in silver halide photographic prints even for relatively modest print media.

  5. Color Constancy by Deep Learning

    NARCIS (Netherlands)

    Z. Lou; T. Gevers; N. Hu; M.P. Lucassen

    2015-01-01

    Computational color constancy aims to estimate the color of the light source. The performance of many vision tasks, such as object detection and scene understanding, may benefit from color constancy by estimating the correct object colors. Since traditional color constancy methods are based on speci

  6. "Focal" Color Areas and the Development of Color Names

    Science.gov (United States)

    Heider, Eleanor Rosch

    1971-01-01

    Three experiments using 3- and 4-year-olds as subjects tested the hypothesis that focal colors are more salient than nonfocal colors for young children and are the areas to which color names initially become attached. (NH)

  7. Large cryptic internal sequence repeats in protein structures from Homo sapiens

    Indian Academy of Sciences (India)

    R Sarani; N A Udayaprakash; R Subashini; P Mridula; T Yamane; K Sekar

    2009-03-01

    Amino acid sequences are known to constantly mutate and diverge unless there is a limiting condition that makes such a change deleterious. However, closer examination of the sequence and structure reveals that a few large, cryptic repeats are nevertheless sequentially conserved. This leads to the question of why only certain repeats are conserved at the sequence level. It would be interesting to find out if these sequences maintain their conservation at the three-dimensional structure level. They can play an active role in protein and nucleotide stability, thus not only ensuring proper functioning but also potentiating malfunction and disease. Therefore, insights into any aspect of the repeats – be it structure, function or evolution – would prove to be of some importance. This study aims to address the relationship between protein sequence and its three-dimensional structure, by examining if large cryptic sequence repeats have the same structure.

  8. High-throughput sequencing offers insight into mechanisms of resource partitioning in cryptic bat species

    DEFF Research Database (Denmark)

    Razgour, Orly; Clare, Elizabeth L.; Zeale, Matt R.K.;

    2011-01-01

    cryptic bat species that are sympatric in southern England (Plecotus austriacus and P. auritus) (Fig. 1). Using Roche FLX 454 (Roche, Basel, CH) high-throughput sequencing (HTS) and uniquely tagged generic arthropod primers, we identified 142 prey Molecular Operational Taxonomic Units (MOTUs) in the diet...... of the cryptic bats, 60% of which were assigned to a likely species or genus. The findings from the molecular study supported the results of microscopic analyses in showing that the diets of both species were dominated by lepidopterans. However, HTS provided a sufficiently high resolution of prey...... identification to determine fine-scale differences in resource use. Although both bat species appeared to have a generalist diet, eared-moths from the family Noctuidae were the main prey consumed. Interspecific niche overlap was greater than expected by chance (O(jk) = 0.72, P <0.001) due to overlap in the...

  9. Three sisters in the same dress: cryptic speciation in African odonates.

    Science.gov (United States)

    Cordero-Rivera, A; Lorenzo-Carballa, M O

    2010-09-01

    The discovery of cryptic species (i.e. two or more distinct but morphologically undistinguishable species) has grown exponentially in the last two decades, due mainly to the increasing availability of DNA sequences. This suggests that hidden in the known species, many of which have been described based solely on morphological information, there might be a high number of species waiting to be discovered. In this issue Damm et al. (2010) use a combination of genetic, morphological and ecological evidence to identify the first cryptic species complex found within dragonflies (insect order Odonata). Their findings add more evidence for the importance of combining information from different disciplines to new species' discovery (DeSalle et al. 2005). PMID:20854273

  10. Natural and seamless image composition with color control.

    Science.gov (United States)

    Yang, Wenxian; Zheng, Jianmin; Cai, Jianfei; Rahardja, Susanto; Chen, Chang Wen

    2009-11-01

    While the state-of-the-art image composition algorithms subtly handle the object boundary to achieve seamless image copy-and-paste, it is observed that they are unable to preserve the color fidelity of the source object, often require quite an amount of user interactions, and often fail to achieve realism when there exists salient discrepancy between the background textures in the source and destination images. These observations motivate our research towards color controlled natural and seamless image composition with least user interactions. In particular, based on the Poisson image editing framework, we first propose a variational model that considers both the gradient constraint and the color fidelity. The proposed model allows users to control the coloring effect caused by gradient domain fusion. Second, to have less user interactions, we propose a distance-enhanced random walks algorithm, through which we avoid the necessity of accurate image segmentation while still able to highlight the foreground object. Third, we propose a multiresolution framework to perform image compositions at different subbands so as to separate the texture and color components to simultaneously achieve smooth texture transition and desired color control. The experimental results demonstrate that our proposed framework achieves better and more realistic results for images with salient background color or texture differences, while providing comparable results as the state-of-the-art algorithms for images without the need of preserving the object color fidelity and without significant background texture discrepancy. PMID:19596637

  11. Isolation of eight microsatellite markers from Moina macrocopa for assessing cryptic genetic structure in the wild.

    Science.gov (United States)

    Tatsuta, Haruki; Yao, Izumi; Tanaka, Yoshinari

    2009-05-01

    We isolated eight polymorphic microsatellite loci from the zooplankton Moina macrocopa (Straus), which is sensitive to pollutants such as insecticides and heavy metals. The isolated loci were polymorphic, with three to seven alleles among 23 individuals. Expected heterozygosities ranged from 0.167 to 0.787. These loci can be used to examine cryptic genetic structure and to infer the connectivity among metapopulations. PMID:21564785

  12. Hidden biodiversity in an ecologically important freshwater amphipod: differences in genetic structure between two cryptic species.

    Directory of Open Access Journals (Sweden)

    Anja Marie Westram

    Full Text Available Cryptic species, i.e. species that are morphologically hard to distinguish, have been detected repeatedly in various taxa and ecosystems. In order to evaluate the importance of this finding, we have to know in how far cryptic species differ in various aspects of their biology. The amphipod Gammarus fossarum is a key invertebrate in freshwater streams and contains several cryptic species. We examined the population genetic structure, genetic diversity and demographic history of two of them (type A and type B using microsatellite markers and asked whether they show significant differences. We present results of population genetic analyses based on a total of 37 populations from the headwaters of two major European drainages, Rhine and Rhone. We found that, in both species, genetic diversity was geographically structured among and within drainages. For type A in the Rhine and type B in the Rhone, we detected significant patterns of isolation by distance. The increase of genetic differentiation with geographical distance, however, was much higher in type A than in type B. This result indicates substantial interspecific differences in population history and/or the extent of current gene flow between populations. In the Rhine, type B does not show evidence of isolation by distance, and population differentiation is relatively low across hundreds of kilometres. The majority of these populations also show signatures of recent bottlenecks. These patterns are consistent with a recent expansion of type B into the Rhine drainage. In summary, our results suggest considerable and previously unrecognized interspecific differences in the genetic structure of these cryptic keystone species.

  13. Mitogenomics reveals high synteny and long evolutionary histories of sympatric cryptic nematode species.

    Science.gov (United States)

    Grosemans, Tara; Morris, Krystalynne; Thomas, William Kelley; Rigaux, Annelien; Moens, Tom; Derycke, Sofie

    2016-03-01

    Species with seemingly identical morphology but with distinct genetic differences are abundant in the marine environment and frequently co-occur in the same habitat. Such cryptic species are typically delineated using a limited number of mitochondrial and/or nuclear marker genes, which do not yield information on gene order and gene content of the genomes under consideration. We used next-generation sequencing to study the composition of the mitochondrial genomes of four sympatrically distributed cryptic species of the Litoditis marina species complex (PmI, PmII, PmIII, and PmIV). The ecology, biology, and natural occurrence of these four species are well known, but the evolutionary processes behind this cryptic speciation remain largely unknown. The gene order of the mitochondrial genomes of the four species was conserved, but differences in genome length, gene length, and codon usage were observed. The atp8 gene was lacking in all four species. Phylogenetic analyses confirm that PmI and PmIV are sister species and that PmIII diverged earliest. The most recent common ancestor of the four cryptic species was estimated to have diverged 16 MYA. Synonymous mutations outnumbered nonsynonymous changes in all protein-encoding genes, with the Complex IV genes (coxI-III) experiencing the strongest purifying selection. Our mitogenomic results show that morphologically similar species can have long evolutionary histories and that PmIII has several differences in genetic makeup compared to the three other species, which may explain why it is better adapted to higher temperatures than the other species. PMID:26933490

  14. Early detection of cryptic memory and glucose uptake deficits in pre-pathological APP mice

    OpenAIRE

    Beglopoulos, V.; Tulloch, J; Roe, A D; Daumas, S.; Ferrington, L; Watson, R; Fan, Z.; Hyman, B. T.; Kelly, P. A. T.; Bard, F; Morris, R G M

    2016-01-01

    International audience Earlier diagnosis and treatment of Alzheimer's disease would greatly benefit from the identification of biomarkers at the prodromal stage. Using a prominent animal model of aspects of the disease, we here show using clinically relevant methodologies that very young, pre-pathological PDAPP mice, which overexpress mutant human amyloid precursor protein in the brain, exhibit two cryptic deficits that are normally undetected using standard methods of assessment. Despite ...

  15. The cryptic tetracycline resistance determinant on Tn4400 mediates tetracycline degradation as well as tetracycline efflux.

    OpenAIRE

    Park, B. H.; Levy, S. B.

    1988-01-01

    Escherichia coli containing the cryptic tetracycline resistance determinant (class F) from the Bacteroides fragilis transposon Tn4400 on plasmid pGAT400 expressed a detoxification of tetracycline as well as an active efflux of tetracycline. This finding concurs with the report of detoxification for a related tetracycline resistance determinant from B. fragilis on Tn4351 (B. S. Speer and A. Salyers, J. Bacteriol. 170:1423-1429, 1987), which specifies a 10-fold-higher resistance than Tn4400. In...

  16. Characterization of a cryptic gene pair from Neisseria gonorrhoeae that is common to pathogenic Neisseria species.

    Science.gov (United States)

    Seifert, H S; Wilson, D

    1992-03-01

    A pair of genes, each of which produces in Escherichia coli a 20-kDa, periplasmically localized protein that cross-reacts with anti-rpoN monoclonal antibody, was isolated from Neisseria gonorrhoeae. Homologs of the two genes were detected in pathogenic Neisseria species but not in commensal species. These genes are designated cnp1 and cnp2 (cryptic neisserial protein). PMID:1541538

  17. Evidence for cryptic speciation in directly transmitted gyrodactylid parasites of Trinidadian guppies.

    Directory of Open Access Journals (Sweden)

    Raquel Xavier

    Full Text Available Cryptic species complexes are common among parasites, which tend to have large populations and are subject to rapid evolution. Such complexes may arise through host-parasite co-evolution and/or host switching. For parasites that reproduce directly on their host, there might be increased opportunities for sympatric speciation, either by exploiting different hosts or different micro-habitats within the same host. The genus Gyrodactylus is a specious group of viviparous monogeneans. These ectoparasites transfer between teleosts during social contact and cause significant host mortality. Their impact on the guppy (Poecilia reticulata, an iconic evolutionary and ecological model species, is well established and yet the population genetics and phylogenetics of these parasites remains understudied. Using mtDNA sequencing of the host and its parasites, we provide evidence of cryptic speciation in Gyrodactylus bullatarudis, G. poeciliae and G. turnbulli. For the COII gene, genetic divergence of lineages within each parasite species ranged between 5.7 and 17.2%, which is typical of the divergence observed between described species in this genus. Different lineages of G. turnbulli and G. poeciliae appear geographically isolated, which could imply allopatric speciation. In addition, for G. poeciliae, co-evolution with a different host species cannot be discarded due to its host range. This parasite was originally described on P. caucana, but for the first time here it is also recorded on the guppy. The two cryptic lineages of G. bullatarudis showed considerable geographic overlap. G. bullatarudis has a known wide host range and it can also utilize a killifish (Anablepsoides hartii as a temporary host. This killifish is capable of migrating overland and it could act as a transmission vector between otherwise isolated populations. Additional genetic markers are needed to confirm the presence of these cryptic Gyrodactylus species complexes, potentially leading

  18. Cryptic speciation or global spread? The case of a cosmopolitan marine invertebrate with limited dispersal capabilities

    OpenAIRE

    Pérez-Portela, R.; Arranz, V.; Rius, Marc; Turon, Xavier

    2013-01-01

    The existence of globally-distributed species with low dispersal capabilities is a paradox that has been explained as a result of human-mediated transport and by hidden diversity in the form of unrecognized cryptic species. Both factors are not mutually exclusive, but relatively few studies have demonstrated the presence of both. Here we analyse the genetic patterns of the colonial ascidian Diplosoma listerianum, a species nowadays distributed globally. The study of a fragment of ...

  19. Genomic basis of ecological niche divergence among cryptic sister species of non-biting midges

    OpenAIRE

    Schmidt, Hanno; Greshake, Bastian; Feldmeyer, Barbara; Hankeln, Thomas; Pfenninger, Markus

    2013-01-01

    Background: There is a lack of understanding the evolutionary forces driving niche segregation of closely related organisms. In addition, pinpointing the genes driving ecological divergence is a key goal in molecular ecology. Here, larval transcriptome sequences obtained by next-generation-sequencing are used to address these issues in a morphologically cryptic sister species pair of non-biting midges (Chironomus riparius and C. piger). Results: More than eight thousand orthologous open re...

  20. Temperature effects on gametophyte life-history traits and geographic distribution of two cryptic kelp species.

    Directory of Open Access Journals (Sweden)

    L Valeria Oppliger

    Full Text Available A major determinant of the geographic distribution of a species is expected to be its physiological response to changing abiotic variables over its range. The range of a species often corresponds to the geographic extent of temperature regimes the organism can physiologically tolerate. Many species have very distinct life history stages that may exhibit different responses to environmental factors. In this study we emphasized the critical role of the haploid microscopic stage (gametophyte of the life cycle to explain the difference of edge distribution of two related kelp species. Lessonia nigrescens was recently identified as two cryptic species occurring in parapatry along the Chilean coast: one located north and the other south of a biogeographic boundary at latitude 29-30°S. Six life history traits from microscopic stages were identified and estimated under five treatments of temperature in eight locations distributed along the Chilean coast in order to (1 estimate the role of temperature in the present distribution of the two cryptic L. nigrescens species, (2 compare marginal populations to central populations of the two cryptic species. In addition, we created a periodic matrix model to estimate the population growth rate (λ at the five temperature treatments. Differential tolerance to temperature was demonstrated between the two species, with the gametophytes of the Northern species being more tolerant to higher temperatures than gametophytes from the south. Second, the two species exhibited different life history strategies with a shorter haploid phase in the Northern species contrasted with considerable vegetative growth in the Southern species haploid stage. These results provide strong ecological evidence for the differentiation process of the two cryptic species and show local adaptation of the life cycle at the range limits of the distribution. Ecological and evolutionary implications of these findings are discussed.

  1. Spatially structured populations with a low level of cryptic diversity in European marine Gastrotricha

    OpenAIRE

    Kieneke, Alexander; Martinez Arbizu, Pedro; Fontaneto, Diego

    2012-01-01

    Species of the marine meiofauna such as Gastrotricha are known to lack dispersal stages and are thus assumed to have low dispersal ability and low levels of gene flow between populations. Yet, most species are widely distributed, and this creates a paradox. To shed light on this apparent paradox, we test (i) whether such wide distribution may be due to misidentification and lumping of cryptic species with restricted distributions and (ii) whether spatial structures exist for the phylogeograph...

  2. Evidence for horizontal transmission of secondary endosymbionts in the Bemisia tabaci cryptic species complex.

    Directory of Open Access Journals (Sweden)

    Muhammad Z Ahmed

    Full Text Available Bemisia tabaci (Hemiptera: Aleyrodidae is a globally distributed pest composed of at least 34 morphologically indistinguishable cryptic species. At least seven species of endosymbiont have been found infecting some or all members of the complex. The origin(s of the associations between specific endosymbionts and their whitefly hosts is unknown. Infection is normally vertical, but horizontal transmission does occur and is one way for new infections to be introduced into individuals. The relationships between the different members of the cryptic species complex and the endosymbionts have not been well explored. In this study, the phylogenies of different cryptic species of the host with those of their endosymbionts were compared. Of particular interest was whether there was evidence for both coevolution and horizontal transmission. Congruence was observed for the primary endosymbiont, Portiera aleyrodidarum, and partial incongruence in the case of two secondary endosymbionts, Arsenophonus and Cardinium and incongruence for a third, Wolbachia. The patterns observed for the primary endosymbiont supported cospeciation with the host while the patterns for the secondary endosymbionts, and especially Wolbachia showed evidence of host shifts and extinctions through horizontal transmission rather than cospeciation. Of particular note is the observation of several very recent host shift events in China between exotic invader and indigenous members of the complex. These shifts were from indigenous members of the complex to the invader as well as from the invader to indigenous relatives.

  3. Phylogeny and cryptic diversity in geckos (Phyllopezus; Phyllodactylidae; Gekkota) from South America's open biomes.

    Science.gov (United States)

    Gamble, Tony; Colli, Guarino R; Rodrigues, Miguel T; Werneck, Fernanda P; Simons, Andrew M

    2012-03-01

    The gecko genus Phyllopezus occurs across South America's open biomes: Cerrado, Seasonally Dry Tropical Forests (SDTF, including Caatinga), and Chaco. We generated a multi-gene dataset and estimated phylogenetic relationships among described Phyllopezus taxa and related species. We included exemplars from both described Phyllopezus pollicaris subspecies, P. p. pollicaris and P. p.przewalskii. Phylogenies from the concatenated data as well as species trees constructed from individual gene trees were largely congruent. All phylogeny reconstruction methods showed Bogertia lutzae as the sister species of Phyllopezus maranjonensis, rendering Phyllopezus paraphyletic. We synonymized the monotypic genus Bogertia with Phyllopezus to maintain a taxonomy that is isomorphic with phylogenetic history. We recovered multiple, deeply divergent, cryptic lineages within P. pollicaris. These cryptic lineages possessed mtDNA distances equivalent to distances among other gekkotan sister taxa. Described P. pollicaris subspecies are not reciprocally monophyletic and current subspecific taxonomy does not accurately reflect evolutionary relationships among cryptic lineages. We highlight the conservation significance of these results in light of the ongoing habitat loss in South America's open biomes.

  4. Acoustic divergence in the communication of cryptic species of nocturnal primates (Microcebus ssp.

    Directory of Open Access Journals (Sweden)

    Zimmermann Elke

    2008-05-01

    Full Text Available Abstract Background A central question in evolutionary biology is how cryptic species maintain species cohesiveness in an area of sympatry. The coexistence of sympatrically living cryptic species requires the evolution of species-specific signalling and recognition systems. In nocturnal, dispersed living species, specific vocalisations have been suggested to act as an ideal premating isolation mechanism. We studied the structure and perception of male advertisement calls of three nocturnal, dispersed living mouse lemur species, the grey mouse lemur (Microcebus murinus, the golden brown mouse lemur (M. ravelobensis and the Goodman's mouse lemur (M. lehilahytsara. The first two species occur sympatrically, the latter lives allopatrically to them. Results A multi-parameter sound analysis revealed prominent differences in the frequency contour and in the duration of advertisement calls. To test whether mouse lemurs respond specifically to calls of the different species, we conducted a playback experiment with M. murinus from the field using advertisement calls and alarm whistle calls of all three species. Individuals responded significantly stronger to conspecific than to heterospecific advertisement calls but there were no differences in response behaviour towards statistically similar whistle calls of the three species. Furthermore, sympatric calls evoked weaker interest than allopatric advertisement calls. Conclusion Our results provide the first evidence for a specific relevance of social calls for speciation in cryptic primates. They furthermore support that specific differences in signalling and recognition systems represent an efficient premating isolation mechanism contributing to species cohesiveness in sympatrically living species.

  5. Multiple cryptic species in the blue-spotted maskray (Myliobatoidei: Dasyatidae: Neotrygon spp.): An update.

    Science.gov (United States)

    Borsa, Philippe; Shen, Kang-Ning; Arlyza, Irma S; Hoareau, Thierry B

    2016-01-01

    Previous investigations have uncovered divergent mitochondrial clades within the blue-spotted maskray, previously Neotrygon kuhlii (Müller and Henle). The hypothesis that the blue-spotted maskray may consist of a complex of multiple cryptic species has been proposed, and four species have been recently described or resurrected. To test the multiple cryptic species hypothesis, we investigated the phylogenetic relationships and coalescence patterns of mitochondrial sequences in a sample of 127 new individuals from the Indian Ocean and the Coral Triangle region, sequenced at both the CO1 and cytochrome b loci. The maximum-likelihood (ML) tree of concatenated CO1+cytochrome b gene sequences, rooted by the New Caledonian maskray N. trigonoides, yielded 9 strongly supported, main clades. Puillandre's ABGD algorithm detected gaps in nucleotide distance consistent with the ML phylogeny. The general mixed Yule-coalescent algorithm partitioned the dataset into putative species generally consistent with the ML phylogeny. Nuclear markers generally confirmed that distinct mitochondrial clades correspond to genetically isolated lineages. The nine main lineages identified by ML analysis were geographically distributed in a parapatric fashion, indicating reproductive isolation. The hypothesis of multiple cryptic species is thus validated.

  6. Theoretical aspects of color vision

    Science.gov (United States)

    Wolbarsht, M. L.

    1972-01-01

    The three color receptors of Young-Helmholtz and the opponent colors type of information processing postulated by Hering are both present in the human visual system. This mixture accounts for both the phenomena of color matching or hue discrimination and such perceptual qualities of color as the division of the spectrum into color bands. The functioning of the cells in the visual system, especially within the retina, and the relation of this function to color perception are discussed.

  7. Image Segmentation by Hierarchical Spatial and Color Spaces Clustering

    Institute of Scientific and Technical Information of China (English)

    YU Wei

    2005-01-01

    Image segmentation, as a basic building block for many high-level image analysis problems, has attracted many research attentions over years. Existing approaches, however, are mainly focusing on the clustering analysis in the single channel information, i.e., either in color or spatial space, which may lead to unsatisfactory segmentation performance. Considering the spatial and color spaces jointly, this paper proposes a new hierarchical image segmentation algorithm, which alternately clusters the image regions in color and spatial spaces in a fine to coarse manner. Without losing the perceptual consistence, the proposed algorithm achieves the segmentation result using only very few number of colors according to user specification.

  8. Color and neighbor edge directional difference feature for image retrieval

    Institute of Scientific and Technical Information of China (English)

    Chaobing Huang; Shengsheng Yu; Jingli Zhou; Hongwei Lu

    2005-01-01

    @@ A novel image feature termed neighbor edge directional difference unit histogram is proposed, in which the neighbor edge directional difference unit is defined and computed for every pixel in the image, and is used to generate the neighbor edge directional difference unit histogram. This histogram and color histogram are used as feature indexes to retrieve color image. The feature is invariant to image scaling and translation and has more powerful descriptive for the natural color images. Experimental results show that the feature can achieve better retrieval performance than other color-spatial features.

  9. CD4+ T cells targeting dominant and cryptic epitopes from Bacillus anthracis Lethal Factor

    Directory of Open Access Journals (Sweden)

    Stephanie eAscough

    2016-01-01

    Full Text Available Anthrax is an endemic infection in many countries, particularly in the developing world. The causative agent, Bacillus anthracis, mediates disease through the secretion of binary exotoxins. Until recently, research into adaptive immunity targeting this bacterial pathogen has largely focused on the humoral response to these toxins. There is, however, growing recognition that cellular immune responses involving IFNγ producing CD4+ T cells also contribute significantly to a protective memory response. An established concept in adaptive immunity to infection is that during infection of host cells, new microbial epitopes may be revealed, leading to immune recognition of so called ‘cryptic’ or ‘subdominant’ epitopes. We analysed the response to both cryptic and immunodominant T cell epitopes derived from the toxin component lethal factor and presented by a range of HLA-DR alleles. Using IFNγ-ELISPOT assays we characterised epitopes that elicited a response following immunisation with synthetic peptide and the whole protein and tested their capacities to bind purified HLA-DR molecules in vitro. We found that DR1 transgenics demonstrated T cell responses to a greater number of domain III cryptic epitopes than other HLA-DR transgenics, and that this pattern was repeated with the immunodominant epitopes, a greater proportion of these epitopes induced a T cell response when presented within the context of the whole protein. Immunodominant epitopes LF457-476 and LF467-487 were found to induce a T cell response to the peptide, as well as to the whole native LF protein in DR1 and DR15, but not in DR4 trangenics. The analysis of Domain I revealed the presence of several unique cryptic epitopes all of which showed a strong to moderate relative binding affinity to HLA-DR4 molecules. However, none of the cryptic epitopes from either domain III or I displayed notably high binding affinities across all HLA-DR alleles assayed. These responses were

  10. Achievement report for fiscal 1998. Research and development on a new manufacturing method for functional thin films suitable for recycling, and their application to colored glasses (the second year); 1998 nendo seika hokokusho. Recycle ni tekishita kinosei usumaku no shinki seizoho to chakushoku glass eno oyo ni kansuru kenkyu kaihatsu (dai 2 nendo)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    A new thin film manufacturing method is established to add a function to glass material surface, as a new material technology which harmonizes with global environment, and is suitable for resource re-utilization and energy conservation. It is intended to develop a leading technology to promote recycling of colored glasses by applying this technical method to colored glasses. Fiscal 1998 has implemented subsequently to fiscal 1997 the following subjects in the three research items composed of a new manufacturing method of functional thin films, application of the functional thin films to colored glasses, and the comprehensive investigative studies: establishment of an industrial manufacturing method for color coating liquid and evaluation of basic characteristics of the colored functional thin films, optimization of element technology for photo-sensitive gel films by means of chemically modifying metallic alkoxide, tests of forming films on glass bottles and plate glasses by using a coating machine installed in fiscal 1997, design and prototype fabrication of a new demonstration coating machine, and analysis on thermal decomposition of the colored thin films. Optimization was performed on the element technology for manufacturing sol-gel functional thin films, and a survey was carried out on recycling systems of colored glasses adopted in Europe. (NEDO)

  11. Color vision test

    Science.gov (United States)

    ... vision problems: Achromatopsia -- complete color blindness , seeing only shades of gray Deuteranopia -- difficulty telling the difference between red/purple and green/purple Protanopia -- difficulty telling the difference between blue/ ...

  12. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... like a suction cup." Halloween is a popular time for people to use colored contact lenses to ... wear costume contact lenses for Halloween or any time of year, follow these guidelines: Get an eye ...

  13. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... popping touch. But colored contact lenses are popular year-round, not just at Halloween. But few know ... contact lenses for Halloween or any time of year, follow these guidelines: Get an eye exam from ...

  14. Phoenix Color Targets

    Science.gov (United States)

    2008-01-01

    These images of three Phoenix color targets were taken on sols 1 and 2 by the Surface Stereo Imager (SSI) on board the Phoenix lander. The bottom target was imaged in approximate color (SSI's red, green, and blue filters: 600, 530, and 480 nanometers), while the others were imaged with an infrared filter (750 nanometers). All of them will be imaged many times over the mission to monitor the color calibration of the camera. The two at the top show grains 2 to 3 millimeters in size that were likely lifted to the Phoenix deck during landing. Each of the large color chips on each target contains a strong magnet to protect the interior material from Mars' magnetic dust. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  15. The color of money

    DEFF Research Database (Denmark)

    Ásgeirsson, Árni Gunnar; Kristjánsson, Árni; Einarsdóttir, Kristin Vala;

    2014-01-01

    of attention are affected by reward, and whether the effect involves general enhancement or is specific to discrete components of attention. Observers viewed brief displays of differentially colored letters and reported their identity. Each color signified a consistent monetary value and we measured...... the accuracy of identification under different color-pairing conditions. At the end of the session, observers were paid the balance earned during the experiment. By fitting a model based on the Theory of Visual Attention (Bundesen, 1990) to the data, we estimated processing speed, selectivity, visual short......, by including conditions with color-contingent negative values. This gave an opportunity to compare high-gain with high-loss conditions. We found clear effects of value on selectivity when comparing high- and low-value conditions. When comparing equally valuable high-loss and high-gain conditions there were...

  16. Neutron color image intensifier

    International Nuclear Information System (INIS)

    Neutron radiography is expanding from the conventional reactor based imaging to the imaging by accelerator based pulsed neutron source. Among them, an expectation for image intensifier technology is increasing especially for video rate dynamic image detection or time dependent imaging in a pulsed neutron source. Based on the X-ray color image intensifier technology, Toshiba has developed neutron color image intensifiers as a powerful imaging tool for dynamic and time dependent neutron radiographics. In this paper, the construction and the feature of the developed neutron color image intensifier and some examples of neutron images are presented. I would be grateful if this paper helps for wide application of neutron color image intensifiers. (author)

  17. A Colorful Equatorial Wonderland

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ Papua New Guinea (PNG) is one of the least visited countries in the world... a last frontier for international travelers. PNG is a colorful equatorial wonderland as well as a living example of human's culture 1000 years ago.

  18. THE COLOR GLASS CONDENSATE.

    Energy Technology Data Exchange (ETDEWEB)

    MCLERRAN,L.

    2001-08-26

    The Color Glass Condensate is a state of high density gluonic matter which controls the high energy limit of hadronic interactions. Its properties are important for the initial conditions for matter produced at RHIC.

  19. Skin color - patchy

    Science.gov (United States)

    ... such as from the sun) Exposure to heavy metals Changes in hormone levels Exposure to sun or ultraviolet (UV) light, especially after taking a medicine called psoralens, may increase skin color (pigmentation). Increased ...

  20. Relighting multiple color textures

    Institute of Scientific and Technical Information of China (English)

    DIAO Chang-yu; LU Dong-ming; LIU Gang

    2005-01-01

    With the development of digital library technology, library books made of paper can be digital released and read, and Endangered Cultural Heritages can be preserved. Traditional library's contents and functions can be greatly enhanced by digital technologies. For these new library objects, the primary key problem is precisely reconstructing their 3D models. When constructing complete 3D models, multiple color texture maps are often necessary. A commonly encountered problem uncounted during fusing of textures from multiple color images is color distortion. Each texture of a single 3D model may be obtained under possibly different lighting conditions and color response of the camera. To remove any visible seam and improve color consistency between the textures while avoiding color distortion, we propose a new efficient algorithm to relight all the texture images globally,spread residual light difference, and recolor each image by homogeneous transformation. A relative illumination model was adopted to obtain the relighting function. We choose lαβ color space with minimal correlation between channels for many natural scenes, for calculating the relighting result. Looking into two overlapped images A and B, we can pairwise relight B into A's luminosity condition in two steps. We first scale B's l channel by the lA/lB ratio of the overlapped region. We can assume A and B are in a same color plane now. Then a homogeneous transformation is applied to B's α and β channels which moves B into A's hue and saturation condition. For multiple overlapped color textures, a patch based weighted global relighting method was proposed to minimize the total color difference. The pairwise relighting method was used between each two overlapped images, and the difference in every overlapped region after relighting was weighted and summed up to construct an energy value. We used Nelder-Mead method to find a minimal energy value and the relighting parameters for every image. After

  1. Color names, color categories, and color-cued visual search: Sometimes, color perception is not categorical

    OpenAIRE

    Brown, Angela M.; Lindsey, Delwin T.; Guckes, Kevin M

    2011-01-01

    The relation between colors and their names is a classic case-study for investigating the Sapir-Whorf hypothesis that categorical perception is imposed on perception by language. Here, we investigate the Sapir-Whorf prediction that visual search for a green target presented among blue distractors (or vice versa) should be faster than search for a green target presented among distractors of a different color of green (or for a blue target among different blue distractors). Gilbert, Regier, Kay...

  2. Unfolding the color code

    OpenAIRE

    Kubica, Aleksander; Yoshida, Beni; Pastawski, Fernando

    2015-01-01

    The topological color code and the toric code are two leading candidates for realizing fault-tolerant quantum computation. Here we show that the color code on a $d$-dimensional closed manifold is equivalent to multiple decoupled copies of the $d$-dimensional toric code up to local unitary transformations and adding or removing ancilla qubits. Our result not only generalizes the proven equivalence for $d=2$, but also provides an explicit recipe of how to decouple independent components of the ...

  3. Static Filtered Sky Color Constancy

    Directory of Open Access Journals (Sweden)

    Ali Alkhalifah

    2016-05-01

    Full Text Available In Computer Vision, the sky color is used for lighting correction, image color enhancement, horizon alignment, image indexing, and outdoor image classification and in many other applications. In this article, for robust color based sky segmentation and detection, usage of lighting correction for sky color detection is investigated. As such, the impact of color constancy on sky color detection algorithms is evaluated and investigated. The color correction (constancy algorithms used includes Gray-Edge (GE, Gray-World (GW, Max-RGB (MRGB and Shades-of-Gray (SG. The algorithms GE, GW, MRGB, and SG, are tested on the static filtered sky modeling. The static filter is developed in the LAB color space. This evaluation and analysis is essential for detection scenarios, especially, color based object detection in outdoor scenes. From the results, it is concluded that the color constancy before sky color detection using LAB static filters has the potential of improving sky color detection performance. However, the application of the color constancy can impart adverse effects on the detection results. For images, the color constancy algorithms depict a compact and stable representative of the sky chroma loci, however, the sky color locus might have a shifting and deviation in a particular color representation. Since the sky static filters are using the static chromatic values, different results can be obtained by applying color constancy algorithms on various datasets.

  4. Novikov Color Algebra and Tortken Color Algebra%Novikov Color 代数与 Tortken Color 代数

    Institute of Scientific and Technical Information of China (English)

    高秀娟; 徐丽媛

    2016-01-01

    Three concepts of Novikov color algebra,Tortken color algebra and Jordan color algebra were defined,then the relations among three algebras were discussed.We gave the basic properties of Novikov color algebra and Tortken color algebra.Then we proved a Tortken color algebra with an identity element is both associative and color commutative.We also showed how to use Novikov color algebra to construct a Tortken color algebra.%给出 Novikov color 代数、Tortken color 和 Jordan color 代数的定义,并讨论它们之间的关系,证明了有单位元的 Tortken color 代数是结合的,也是 color 交换的。给出 Novikov color 代数和 Tortken color 代数的基本性质以及利用 Novikov color 代数构造 Tortken color代数的方法。

  5. Color planner for designers based on color emotions

    Science.gov (United States)

    Cheng, Ka-Man; Xin, John H.; Taylor, Gail

    2002-06-01

    During the color perception process, an associated feeling or emotion is induced in our brains, and this kind of emotion is termed as 'color emotion.' The researchers in the field of color emotions have put many efforts in quantifying color emotions with the standard color specifications and evaluating the influence of hue, lightness and chroma to the color emotions of human beings. In this study, a color planner was derived according to these findings so that the correlation of color emotions and standard color specifications was clearly indicated. Since people of different nationalities usually have different color emotions as different cultural and traditional backgrounds, the subjects in this study were all native Hong Kong Chinese and the color emotion words were all written in Chinese language in the visual assessments. Through the color planner, the designers from different areas, no matter fashion, graphic, interior or web site etc., can select suitable colors for inducing target color emotions to the customers or product-users since different colors convey different meanings to them. In addition, the designers can enhance the functionality and increase the attractiveness of their designed products by selecting suitable colors.

  6. Luminance contours can gate afterimage colors and 'real' colors

    NARCIS (Netherlands)

    Anstis, S.; Vergeer, M.L.T.; Lier, R.J. van

    2012-01-01

    It has long been known that colored images may elicit afterimages in complementary colors. We have already shown (Van Lier, Vergeer, & Anstis, 2009) that one and the same adapting image may result in different afterimage colors, depending on the test contours presented after the colored image. The c

  7. Randomized $\\Delta$-Edge-Coloring via Quaternion of Complex Colors

    OpenAIRE

    Lee, Tony T.; Wan, Yujie; Guan, Hao

    2011-01-01

    This paper explores the application of a new algebraic method of color exchanges to the edge coloring of simple graphs. Vizing's theorem states that the edge coloring of a simple graph $G$ requires either $\\Delta$ or $\\Delta+1$ colors, where $\\Delta$ is the maximum vertex degree of $G$. Holyer proved that it is {\\bf NP}-complete to decide whether $G$ is $\\Delta$-edge-colorable even for cubic graphs. By introducing the concept of complex colors, we show that the color-exchange operation follow...

  8. A modified image enhancement algorithm based on color constancy

    Institute of Scientific and Technical Information of China (English)

    Cheng Li; Shan Gao; Duyan Bi

    2009-01-01

    According to the color constancy theory,a modified variation Retinex is proposed for improving the visibility of the dark regions in images under insufficient and/or non-uniform lighting conditions.A new penalty functional based on nonlinear diffusion and correlation between the reflectance and the given image is designed for the intensity image enhancement,followed by adaptive color compensation.With high computational efficiency achieved by an improved multi-resolution algorithm,simulation results prove that the proposed method shows more colorful and vivid visual performance,and achieves wider dynamic range with higher objective standard values.

  9. Museum lighting for golden artifacts, with low correlated color temperature, high color uniformity and high color rendering index, using diffusing color mixing of red, cyan, and white-light-emitting diodes

    DEFF Research Database (Denmark)

    Thorseth, Anders; Corell, Dennis Dan; Poulsen, Peter Behrensdorff;

    2012-01-01

    Museum lighting presents challenges mainly due to the demand for precise color rendering and the damaging effects of radiation. Golden objects must normally be illuminated by the non-standard CCT of 2200 K. An LED system that conforms to these requirements has been developed and implemented...... at the Royal Danish Collection at Rosenborg Castle. Color mixing of red, cyan, and white LEDs was employed to achieve the spectral power distribution needed for the required CCT and a CRI above 90. Color uniformity is achieved by the use of a highly diffusing reflector. The system has shown energy saving above...

  10. Color calibration of swine gastrointestinal tract images acquired by radial imaging capsule endoscope

    Science.gov (United States)

    Ou-Yang, Mang; Jeng, Wei-De; Lai, Chien-Cheng; Wu, Hsien-Ming; Lin, Jyh-Hung

    2016-01-01

    The type of illumination systems and color filters used typically generate varying levels of color difference in capsule endoscopes, which influence medical diagnoses. In order to calibrate the color difference caused by the optical system, this study applied a radial imaging capsule endoscope (RICE) to photograph standard color charts, which were then employed to calculate the color gamut of RICE. Color gamut was also measured using a spectrometer in order to get a high-precision color information, and the results obtained using both methods were compared. Subsequently, color-correction methods, namely polynomial transform and conformal mapping, were used to improve the color difference. Before color calibration, the color difference value caused by the influences of optical systems in RICE was 21.45±1.09. Through the proposed polynomial transformation, the color difference could be reduced effectively to 1.53±0.07. Compared to another proposed conformal mapping, the color difference value was substantially reduced to 1.32±0.11, and the color difference is imperceptible for human eye because it is color correction was achieved using this algorithm combined with a field-programmable gate array, and the results of the color correction can be viewed from real-time images.

  11. Transparent organic light-emitting diodes with different bi-directional emission colors using color-conversion capping layers

    International Nuclear Information System (INIS)

    We report a study on transparent organic light-emitting diodes (OLEDs) with different bi-directional emission colors, enabled by color-conversion organic capping layers. Starting from a transparent blue OLED with an uncapped Ag top electrode exhibiting an average transmittance of 33.9%, a 4-(dicyanomethylene)-2-methyl-6-(4-dimethylaminostyryl)-4H-pyran (DCM)-doped tris-(8-hydroxy-quinolinato)-aluminum (Alq3) capping layer is applied to achieve color-conversion from blue to orange-red on the top side while maintaining almost unchanged device transmittance. This color-conversion capping layer does not only change the color of the top side emission, but also enhances the overall device efficiency due to the optical interaction of the capping layer with the primary blue transparent OLED. Top white emission from the transparent bi-directional OLED exhibits a correlated color temperature around 6000–7000 K, with excellent color stability as evidenced by an extremely small variation in color coordinate of Δ(x,y)=(0.002, 0.002) in the forward luminance range of 100–1000 cd m−2. At the same time, the blue emission color of bottom side is not influenced by the color conversion capping layer, which finally results in different emission colors of the two opposite sides of our transparent OLEDs. - Highlights: • We report transparent organic light-emitting diodes (OLEDs) with different bi-directional emission colors. • Transparent blue OLED with color-conversion organic capping layers (CCL) shows orange top side emission. • Top white emission exhibits a CCT around 7000 K, with excellent color stability on a driving voltage

  12. Backbone colorings along perfect matchings

    NARCIS (Netherlands)

    Broersma, H.J.; Fujisawa, J.; Yoshimoto, K.

    2003-01-01

    Given a graph $G=(V,E)$ and a spanning subgraph $H$ of $G$ (the backbone of $G$), a backbone coloring for $G$ and $H$ is a proper vertex coloring $V\\rightarrow \\{1,2,\\ldots\\}$ of $G$ in which the colors assigned to adjacent vertices in $H$ differ by at least two. In a recent paper, backbone coloring

  13. Graded Achievement, Tested Achievement, and Validity

    Science.gov (United States)

    Brookhart, Susan M.

    2015-01-01

    Twenty-eight studies of grades, over a century, were reviewed using the argument-based approach to validity suggested by Kane as a theoretical framework. The review draws conclusions about the meaning of graded achievement, its relation to tested achievement, and changes in the construct of graded achievement over time. "Graded…

  14. Color Face Recognition Based on Steerable Pyramid Transform and Extreme Learning Machines

    Directory of Open Access Journals (Sweden)

    Ayşegül Uçar

    2014-01-01

    Full Text Available This paper presents a novel color face recognition algorithm by means of fusing color and local information. The proposed algorithm fuses the multiple features derived from different color spaces. Multiorientation and multiscale information relating to the color face features are extracted by applying Steerable Pyramid Transform (SPT to the local face regions. In this paper, the new three hybrid color spaces, YSCr, ZnSCr, and BnSCr, are firstly constructed using the Cb and Cr component images of the YCbCr color space, the S color component of the HSV color spaces, and the Zn and Bn color components of the normalized XYZ color space. Secondly, the color component face images are partitioned into the local patches. Thirdly, SPT is applied to local face regions and some statistical features are extracted. Fourthly, all features are fused according to decision fusion frame and the combinations of Extreme Learning Machines classifiers are applied to achieve color face recognition with fast and high correctness. The experiments show that the proposed Local Color Steerable Pyramid Transform (LCSPT face recognition algorithm improves seriously face recognition performance by using the new color spaces compared to the conventional and some hybrid ones. Furthermore, it achieves faster recognition compared with state-of-the-art studies.

  15. Color face recognition based on steerable pyramid transform and extreme learning machines.

    Science.gov (United States)

    Uçar, Ayşegül

    2014-01-01

    This paper presents a novel color face recognition algorithm by means of fusing color and local information. The proposed algorithm fuses the multiple features derived from different color spaces. Multiorientation and multiscale information relating to the color face features are extracted by applying Steerable Pyramid Transform (SPT) to the local face regions. In this paper, the new three hybrid color spaces, YSCr, ZnSCr, and BnSCr, are firstly constructed using the Cb and Cr component images of the YCbCr color space, the S color component of the HSV color spaces, and the Zn and Bn color components of the normalized XYZ color space. Secondly, the color component face images are partitioned into the local patches. Thirdly, SPT is applied to local face regions and some statistical features are extracted. Fourthly, all features are fused according to decision fusion frame and the combinations of Extreme Learning Machines classifiers are applied to achieve color face recognition with fast and high correctness. The experiments show that the proposed Local Color Steerable Pyramid Transform (LCSPT) face recognition algorithm improves seriously face recognition performance by using the new color spaces compared to the conventional and some hybrid ones. Furthermore, it achieves faster recognition compared with state-of-the-art studies. PMID:24558319

  16. Harmonious coloring of uniform hypergraphs

    OpenAIRE

    Bartłomiej Bosek; Sebastian Czerwiński; Jarosław Grytczuk; Paweł Rzążewski

    2016-01-01

    A \\emph{harmonious coloring} of a $k$-uniform hypergraph $H$ is a vertex coloring such that no two vertices in the same edge share the same color, and each $k$-element subset of colors appears on at most one edge. The \\emph{% harmonious number} $h(H)$ is the least number of colors needed for such a coloring. %These notions arose as a natural extension of a widely studied %topic of harmonious coloring of simple graphs. We prove that $k$-uniform hypergraphs of bounded maxim...

  17. Phylogenetic relationships of geckos of the Hemiphyllodactylus harterti group, a new species from Penang Island, Peninsular Malaysia, and a likely case of true cryptic speciation.

    Science.gov (United States)

    Cobos, Anthony; Grismer, L Lee; Wood, Perry L; Quah, Evan S H; Anuar, Shahrul; Muin, Mohd Abdul

    2016-05-03

    An integrative taxonomic analysis based on the mitochondrial gene ND2 and its flanking tRNAs, morphology, and color pattern indicates that a newly discovered gecko described herein as Hemiphyllodactylus cicak sp. nov. from Penang Hill on the Island of Penang, Peninsular Malaysia is a member of the H. harterti group. Hemiphyllodactylus cicak sp. nov. is most closely related to the clade composed of the sister species H. harterti from Bukit Larut, Perak in the Bintang Mountain Range and H. bintik from Gunung Tebu, Terengganu from the Timur Mountain Range. These three allopatric species form a monophyletic group that extends approximately 270 km across three isolated mountain ranges in northern Peninsular Malaysia. The molecular analysis also indicates that H. titiwangsaensis from the Titiwangsa Mountain Range is composed of three genetically distinct allopatric populations. The southern two populations from Fraser's Hill and Genting Highlands, Pahang have an uncorrected pairwise sequence divergence of 3.5% whereas these two populations have 12.4 and 12.8 % sequence divergences, respectively, from the northern population at Cameron Highlands, Pahang. Although the high sequence divergence clearly distinguishes the southern two populations from the former as a different species, all three populations are morphologically indistinguishable, leading to the hypothesis of a true, cryptic speciation event.

  18. Phylogenetic relationships of geckos of the Hemiphyllodactylus harterti group, a new species from Penang Island, Peninsular Malaysia, and a likely case of true cryptic speciation.

    Science.gov (United States)

    Cobos, Anthony; Grismer, L Lee; Wood, Perry L; Quah, Evan S H; Anuar, Shahrul; Muin, Mohd Abdul

    2016-01-01

    An integrative taxonomic analysis based on the mitochondrial gene ND2 and its flanking tRNAs, morphology, and color pattern indicates that a newly discovered gecko described herein as Hemiphyllodactylus cicak sp. nov. from Penang Hill on the Island of Penang, Peninsular Malaysia is a member of the H. harterti group. Hemiphyllodactylus cicak sp. nov. is most closely related to the clade composed of the sister species H. harterti from Bukit Larut, Perak in the Bintang Mountain Range and H. bintik from Gunung Tebu, Terengganu from the Timur Mountain Range. These three allopatric species form a monophyletic group that extends approximately 270 km across three isolated mountain ranges in northern Peninsular Malaysia. The molecular analysis also indicates that H. titiwangsaensis from the Titiwangsa Mountain Range is composed of three genetically distinct allopatric populations. The southern two populations from Fraser's Hill and Genting Highlands, Pahang have an uncorrected pairwise sequence divergence of 3.5% whereas these two populations have 12.4 and 12.8 % sequence divergences, respectively, from the northern population at Cameron Highlands, Pahang. Although the high sequence divergence clearly distinguishes the southern two populations from the former as a different species, all three populations are morphologically indistinguishable, leading to the hypothesis of a true, cryptic speciation event. PMID:27394826

  19. Application of the Mechanism Design to Develop the RGB LEDs Color Mixing

    OpenAIRE

    Chih-Ching Hung; Yan-Huei Li; Ping-Han Yang

    2015-01-01

    The big advantage of LED is the flexible spectral design to make white light using different color mixing schemes. Recently, the color mixing of RGB LEDs is mostly done by sealing all three chips at single package and regulated the mix ratio of these three colors to produce the color of light. And, by changing the LEDs array alignment, RGB chips can achieve overlapping colors of light and create the fun of changing colors in light mixing. Therefore, the purpose of this study is to propose an ...

  20. Optical/digital color photography based on white-light information processing

    Institute of Scientific and Technical Information of China (English)

    罗罡; 刘福来; 林列; 方志良; 王肇圻; 母国光; 翁志成

    2001-01-01

    The achievement in optical/digital color photography based on white-light information processing including the color-encoding camera, the color image decoder, the integral window Fourier algorithm of the Fourier transform in digital decoding, the color correction of the retrieval color image and the fusion of zero order diffraction is reported. This technique has found its important applications in the fields of aerial reconnaissance photography and far-distance ground photography due to its features of large information capacity, convenience in archival storage, the capability of color enhancement, particularly easy transportation by Internet.

  1. Artificial color perception using microwaves

    CERN Document Server

    Choudhury, Debesh

    2013-01-01

    We report the feasibility of artificial color perception under microwave illumination using a standard microwave source and an antenna. We have sensed transmitted microwave power through color objects and have distinguished the colors by analyzing the sensed transmitted power. Experiments are carried out using a Gunn diode as the microwave source, some colored liquids as the objects and a microwave diode as the detector. Results are presented which open up an unusual but new way of perceiving colors using microwaves.

  2. Precision of Synesthetic Color Matching Resembles That for Recollected Colors Rather than Physical Colors

    Science.gov (United States)

    Arnold, Derek H.; Wegener, Signy V.; Brown, Francesca; Mattingley, Jason B.

    2012-01-01

    Grapheme-color synesthesia is an atypical condition in which individuals experience sensations of color when reading printed graphemes such as letters and digits. For some grapheme-color synesthetes, seeing a printed grapheme triggers a sensation of color, but "hearing" the name of a grapheme does not. This dissociation allowed us to compare the…

  3. Color Memory of University Students: Influence of Color Experience and Color Characteristic

    Science.gov (United States)

    Bynum, Carlisle; Epps, Helen H.; Kaya, Naz

    2006-01-01

    The ability to select a previously viewed color specimen from an array of specimens that differ in hue, value, or chroma varies among individuals, and may be related to one's basic color discrimination ability or to prior experience with color. This study investigated short-term color memory of 40 college students, 20 of whom were interior design…

  4. The color "fruit": object memories defined by color.

    Science.gov (United States)

    Lewis, David E; Pearson, Joel; Khuu, Sieu K

    2013-01-01

    Most fruits and other highly color-diagnostic objects have color as a central aspect of their identity, which can facilitate detection and visual recognition. It has been theorized that there may be a large amount of overlap between the neural representations of these objects and processing involved in color perception. In accordance with this theory we sought to determine if the recognition of highly color diagnostic fruit objects could be facilitated by the visual presentation of their known color associates. In two experiments we show that color associate priming is possible, but contingent upon multiple factors. Color priming was found to be maximally effective for the most highly color diagnostic fruits, when low spatial-frequency information was present in the image, and when determination of the object's specific identity, not merely its category, was required. These data illustrate the importance of color for determining the identity of certain objects, and support the theory that object knowledge involves sensory specific systems.

  5. Color control of the multi-color printing device

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-hua; XIU Xiao-jie; ZHU Wen-hua; TANG Hong-jun

    2006-01-01

    Conventional color-printing systems often use inks of three hues, such as CMY, CMYK and CMYKLcLm, but in order to obtain more realistic color reproductions, the ink set of more than three hues has been adopted by some color-printing systems. It is difficult, however, to model the composed color with the multiple inks when the number of the output ink hues exceeds three due to the none-unique mapping between the color spaces of the CIE Lab and the multi-color printing device. In this paper, we propose a fine color-printing method for multi-color printing device with the ink set of more than three hues. The proposed approach has good color expression ability and provides fine control of the printed color. By dividing the output color space into several subspaces, our method allows one-to-one mapping between the standard color space and the multi-color output color space. It has been proved effective when applied to the digital inkjet printer-Mutoh8000.

  6. America's Leaky Pipeline for Teachers of Color: Getting More Teachers of Color into the Classroom

    Science.gov (United States)

    Ahmad, Farah Z.; Boser, Ulrich

    2014-01-01

    To prepare American students for lives of high achievement, America's schools need a teaching corps that is not only highly effective but also racially and ethnically diverse. Progress has been made in recent decades in attracting people of color to the teaching profession. But major barriers--including a scarcity of high-quality, teacher-training…

  7. The carotenoid-continuum: carotenoid-based plumage ranges from conspicuous to cryptic and back again

    Directory of Open Access Journals (Sweden)

    Roberts Mark L

    2010-05-01

    Full Text Available Abstract Background Carotenoids are frequently used by birds to colour their plumage with green, yellow, orange or red hues, and carotenoid-based colours are considered honest signals of quality, although they may have other functions, such as crypsis. It is usually assumed that red through yellow colours have a signalling function while green is cryptic. Here we challenge this notion using the yellow and green colouration of blue tits (Cyanistes caeruleus, great tits (Parus major and greenfinches (Carduelis chloris as a model. Results The relationship between colouration (chroma, computed using visual sensitivities of conspecifics and detectability (contrast against natural backgrounds as perceived by conspecifics and avian predators followed a similar curvilinear pattern for yellow and green plumage with minimum detectability at intermediate levels of carotenoid deposition. Thus, for yellow and green plumage, colours at or close to the point of minimum detectability may aid in crypsis. This may be the case for blue and great tit green and yellow plumage, and greenfinch green plumage, all of which had comparably low levels of detectability, while greenfinch yellow plumage was more chromatic and detectable. As yellow and green blue tit colouration are strongly affected by carotenoid availability during moult, variation in pigment availability between habitats may affect the degree of background-matching or the costliness of producing cryptic plumage. Conclusions Increasing carotenoid-deposition in the integument does not always lead to more conspicuous colours. In some cases, such as in blue or great tits, carotenoid deposition may be selected through enhanced background-matching, which in turn suggests that producing cryptic plumage may entail costs. We stress however, that our data do not rule out a signalling function of carotenoid-based plumage in tits. Rather, it shows that alternative functions are plausible and that assuming a signalling

  8. Cryptic speciation patterns in Iranian rock lizards uncovered by integrative taxonomy.

    Directory of Open Access Journals (Sweden)

    Faraham Ahmadzadeh

    Full Text Available While traditionally species recognition has been based solely on morphological differences either typological or quantitative, several newly developed methods can be used for a more objective and integrative approach on species delimitation. This may be especially relevant when dealing with cryptic species or species complexes, where high overall resemblance between species is coupled with comparatively high morphological variation within populations. Rock lizards, genus Darevskia, are such an example, as many of its members offer few diagnostic morphological features. Herein, we use a combination of genetic, morphological and ecological criteria to delimit cryptic species within two species complexes, D. chlorogaster and D. defilippii, both distributed in northern Iran. Our analyses are based on molecular information from two nuclear and two mitochondrial genes, morphological data (15 morphometric, 16 meristic and four categorical characters and eleven newly calculated spatial environmental predictors. The phylogeny inferred for Darevskia confirmed monophyly of each species complex, with each of them comprising several highly divergent clades, especially when compared to other congeners. We identified seven candidate species within each complex, of which three and four species were supported by Bayesian species delimitation within D. chlorogaster and D. defilippii, respectively. Trained with genetically determined clades, Ecological Niche Modeling provided additional support for these cryptic species. Especially those within the D. defilippii-complex exhibit well-differentiated niches. Due to overall morphological resemblance, in a first approach PCA with mixed variables only showed the separation between the two complexes. However, MANCOVA and subsequent Discriminant Analysis performed separately for both complexes allowed for distinction of the species when sample size was large enough, namely within the D. chlorogaster-complex. In conclusion

  9. Please mind the gap - Visual census and cryptic biodiversity assessment at central Red Sea coral reefs.

    Science.gov (United States)

    Pearman, John K; Anlauf, Holger; Irigoien, Xabier; Carvalho, Susana

    2016-07-01

    Coral reefs harbor the most diverse assemblages in the ocean, however, a large proportion of the diversity is cryptic and, therefore, undetected by standard visual census techniques. Cryptic and exposed communities differ considerably in species composition and ecological function. This study compares three different coral reef assessment protocols: i) visual benthic reef surveys: ii) visual census of Autonomous Reef Monitoring Structures (ARMS) plates; and iii) metabarcoding techniques of the ARMS (including sessile, 106-500 μm and 500-2000 μm size fractions), that target the cryptic and exposed communities of three reefs in the central Red Sea. Visual census showed a dominance of Cnidaria (Anthozoa) and Rhodophyta on the reef substrate, while Porifera, Bryozoa and Rhodophyta were the most abundant groups on the ARMS plates. Metabarcoding, targeting the 18S rRNA gene, significantly increased estimates of the species diversity (p reefs. Furthermore, metabarcoding detected microbial eukaryotic groups such as Syndiniophyceae, Mamiellophyceae and Bacillariophyceae as relevant components of the sessile fraction. ANOSIM analysis showed that the three reef sites showed no differences based on the visual census data. Metabarcoding showed a higher sensitivity for identifying differences between reef communities at smaller geographic scales than standard visual census techniques as significant differences in the assemblages were observed amongst the reefs. Comparison of the techniques showed no similar patterns for the visual techniques while the metabarcoding of the ARMS showed similar patterns amongst fractions. Establishing ARMS as a standard tool in reef monitoring will not only advance our understanding of local processes and ecological community response to environmental changes, as different faunal components will provide complementary information but also improve the estimates of biodiversity in coral reef benthic communities. This study lays the foundations

  10. The Grounded Expertise Components Approach in the Novel Area of Cryptic Crossword Solving.

    Science.gov (United States)

    Friedlander, Kathryn J; Fine, Philip A

    2016-01-01

    This paper presents a relatively unexplored area of expertise research which focuses on the solving of British-style cryptic crossword puzzles. Unlike its American "straight-definition" counterparts, which are primarily semantically-cued retrieval tasks, the British cryptic crossword is an exercise in code-cracking detection work. Solvers learn to ignore the superficial "surface reading" of the clue, which is phrased to be deliberately misleading, and look instead for a grammatical set of coded instructions which, if executed precisely, will lead to the correct (and only) answer. Sample clues are set out to illustrate the task requirements and demands. Hypothesized aptitudes for the field might include high fluid intelligence, skill at quasi-algebraic puzzles, pattern matching, visuospatial manipulation, divergent thinking and breaking frame abilities. These skills are additional to the crystallized knowledge and word-retrieval demands which are also a feature of American crossword puzzles. The authors present results from an exploratory survey intended to identify the characteristics of the cryptic crossword solving population, and outline the impact of these results on the direction of their subsequent research. Survey results were strongly supportive of a number of hypothesized skill-sets and guided the selection of appropriate test content and research paradigms which formed the basis of an extensive research program to be reported elsewhere. The paper concludes by arguing the case for a more grounded approach to expertise studies, termed the Grounded Expertise Components Approach. In this, the design and scope of the empirical program flows from a detailed and objectively-based characterization of the research population at the very onset of the program. PMID:27199805

  11. Cryptic species? Patterns of maternal and paternal gene flow in eight neotropical bats.

    Directory of Open Access Journals (Sweden)

    Elizabeth L Clare

    Full Text Available Levels of sequence divergence at mitochondrial loci are frequently used in phylogeographic analysis and species delimitation though single marker systems cannot assess bi-parental gene flow. In this investigation I compare the phylogeographic patterns revealed through the maternally inherited mitochondrial COI region and the paternally inherited 7(th intron region of the Dby gene on the Y-chromosome in eight common Neotropical bat species. These species are diverse and include members of two families from the feeding guilds of sanguivores, nectarivores, frugivores, carnivores and insectivores. In each case, the currently recognized taxon is comprised of distinct, substantially divergent intraspecific mitochondrial lineages suggesting cryptic species complexes. In Chrotopterus auritus, and Saccopteryx bilineata I observed congruent patterns of divergence in both genetic regions suggesting a cessation of gene flow between intraspecific groups. This evidence supports the existence of cryptic species complexes which meet the criteria of the genetic species concept. In Glossophaga soricina two intraspecific groups with largely sympatric South American ranges show evidence for incomplete lineage sorting or frequent hybridization while a third group with a Central American distribution appears to diverge congruently at both loci suggesting speciation. Within Desmodus rotundus and Trachops cirrhosus the paternally inherited region was monomorphic and thus does not support or refute the potential for cryptic speciation. In Uroderma bilobatum, Micronycteris megalotis and Platyrrhinus helleri the gene regions show conflicting patterns of divergence and I cannot exclude ongoing gene flow between intraspecific groups. This analysis provides a comprehensive comparison across taxa and employs both maternally and paternally inherited gene regions to validate patterns of gene flow. I present evidence for previously unrecognized species meeting the criteria of

  12. Cryptic self-incompatibility and distyly in Hedyotis acutangula Champ. (Rubiaceae).

    Science.gov (United States)

    Wu, X; Li, A; Zhang, D

    2010-05-01

    Distyly, floral polymorphism frequently associated with reciprocal herkogamy, self- and intramorph incompatibility and secondary dimorphism, constitutes an important sexual system in the Rubiaceae. Here we report an unusual kind of distyly associated with self- and/or intramorph compatibility in a perennial herb, Hedyotis acutangula. Floral morphology, ancillary dimorphisms and compatibility of the two morphs were studied. H. acutangula did not exhibit precise reciprocal herkogamy, but this did not affect the equality of floral morphs in the population, as usually found in distylous plants. Both pin and thrum pollen retained relatively high viability for 8 h. The pollen to ovule ratio was 72.5 in pin flowers and 54.4 in thrum flowers. Pistils of pin flowers remained receptive for longer than those of thrum flowers. No apparent difference in the germination rate of pin and thrum pollen grains was observed when cultured in vitro, although growth of thrum pollen tubes was much faster than that of pin pollen tubes. Artificial pollination revealed that pollen tube growth in legitimate intermorph crosses was faster than in either intramorph crosses or self-pollination, suggesting the occurrence of cryptic self-incompatibility in this species. Cryptic self-incompatibility functioned differently in the two morphs, with pollen tube growth rates after legitimate and illegitimate pollination much more highly differentiated in pin flowers than in thrum flowers. No fruit was produced in emasculated netted flowers, suggesting the absence of apomixis. Our results indicate that H. acutangula is distylous, with a cryptic self-incompatibility breeding system. PMID:20522185

  13. The Grounded Expertise Components Approach in the novel area of cryptic crossword solving

    Directory of Open Access Journals (Sweden)

    Kathryn J Friedlander

    2016-05-01

    Full Text Available This paper presents a relatively unexplored area of expertise research which focuses on the solving of British-style cryptic crossword puzzles. Unlike its American ‘straight-definition’ counterparts, which are primarily semantically-cued retrieval tasks, the British cryptic crossword is an exercise in code-cracking detection work. Solvers learn to ignore the superficial ‘surface reading’ of the clue, which is phrased to be deliberately misleading, and look instead for a grammatical set of coded instructions which, if executed precisely, will lead to the correct (and only answer. Sample clues are set out to illustrate the task requirements and demands. Hypothesized aptitudes for the field might include high fluid intelligence, skill at quasi-algebraic puzzles, pattern matching, visuospatial manipulation, divergent thinking and breaking frame abilities. These skills are additional to the crystallized knowledge and word-retrieval demands which are also a feature of American crossword puzzles. The authors present results from an exploratory survey intended to identify the characteristics of the cryptic crossword solving population, and outline the impact of these results on the direction of their subsequent research. Survey results were strongly supportive of a number of hypothesized skill-sets and guided the selection of appropriate test content and research paradigms which formed the basis of an extensive research program to be reported elsewhere. The paper concludes by arguing the case for a more grounded approach to expertise studies, termed the Grounded Expertise Components Approach. In this, the design and scope of the empirical program flows from a detailed and objectively-based characterization of the research population at the very onset of the program.

  14. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae from the Western Ghats, India.

    Directory of Open Access Journals (Sweden)

    H Priti

    Full Text Available A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members--R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults formed during the Late Quaternary period (1.8-2.58 Ma. Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats.

  15. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India.

    Science.gov (United States)

    Priti, H; Roshmi, Rekha Sarma; Ramya, Badrinath; Sudhira, H S; Ravikanth, G; Aravind, Neelavara Anantharam; Gururaja, Kotambylu Vasudeva

    2016-01-01

    A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members--R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults) formed during the Late Quaternary period (1.8-2.58 Ma). Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats.

  16. Optimized tumor cryptic peptides: the basis for universal neo-antigen-like tumor vaccines.

    Science.gov (United States)

    Menez-Jamet, Jeanne; Gallou, Catherine; Rougeot, Aude; Kosmatopoulos, Kostas

    2016-07-01

    The very impressive clinical results recently obtained in cancer patients treated with immune response checkpoint inhibitors boosted the interest in immunotherapy as a therapeutic choice in cancer treatment. However, these inhibitors require a pre-existing tumor specific immune response and the presence of tumor infiltrating T cells to be efficient. This immune response can be triggered by cancer vaccines. One of the main issues in tumor vaccination is the choice of the right antigen to target. All vaccines tested to date targeted tumor associated antigens (TAA) that are self-antigens and failed to show a clinical efficacy because of the immune self-tolerance to TAA. A new class of tumor antigens has recently been described, the neo-antigens that are created by point mutations of tumor expressing proteins and are recognized by the immune system as non-self. Neo-antigens exhibit two main properties: they are not involved in the immune self-tolerance process and are immunogenic. However, the majority of the neo-antigens are patient specific and their use as cancer vaccines requires their previous identification in each patient individualy that can be done only in highly specialized research centers. It is therefore evident that neo-antigens cannot be used for patient vaccination worldwide. This raises the question of whether we can find neo-antigen like vaccines, which would not be patient specific. In this review we show that optimized cryptic peptides from TAA are neo-antigen like peptides. Optimized cryptic peptides are recognized by the immune system as non-self because they target self-cryptic peptides that escape self-tolerance; in addition they are strongly immunogenic because their sequence is modified in order to enhance their affinity for the HLA molecule. The first vaccine based on the optimized cryptic peptide approach, Vx-001, which targets the widely expressed tumor antigen telomerase reverse transcriptase (TERT), has completed a large phase I clinical

  17. Advances in radiometry for ocean color

    Science.gov (United States)

    Brown, S.W.; Clark, D.K.; Johnson, B.C.; Yoon, H.; Lykke, K.R.; Flora, S.J.; Feinholz, M.E.; Souaidia, N.; Pietras, C.; Stone, T.C.; Yarbrough, M.A.; Kim, Y.S.; Barnes, R.A.; Mueller, J.L.

    2004-01-01

    We have presented a number of recent developments in radiometry that directly impact the uncertainties achievable in ocean-color research. Specifically, a new (2000) U. S. national irradiance scale, a new LASER-based facility for irradiance and radiance responsivity calibrations, and applications of the LASER facility for the calibration of sun photometers and characterization of spectrographs were discussed. For meaningful long-time-series global chlorophyll-a measurements, all instruments involved in radiometric measurements, including satellite sensors, vicarious calibration sensors, sensors used in the development of bio-optical algorithms and atmospheric characterization need to be fully characterized and corrected for systematic errors, including, but not limited to, stray light. A unique, solid-state calibration source is under development to reduce the radiometric uncertainties in ocean color instruments, in particular below 400 nm. Lunar measurements for trending of on-orbit sensor channel degradation were described. Unprecedented assessments, within 0.1 %, of temporal stability and drift in a satellite sensor's radiance responsivity are achievable with this approach. These developments advance the field of ocean color closer to the desired goal of reducing the uncertainty in the fundamental radiometry to a small component of the overall uncertainty in the derivation of remotely sensed ocean-color data products such as chlorophyll a.

  18. Future of color

    Science.gov (United States)

    Ladson, Jack A.; Turner, Laraine B.; Green-Armytage, Paul; Hunt, Robert W. G.

    2002-06-01

    We live in a world in which styles and technologies are nearly the same from place to place, but change daily. This changing global culture is unprecedented, and reinforced by emerging new technologies that affect us all. The Future of Color, examines new technologies, how they will affect the selection and promulgation of color in the near future, and their impact upon us. We examine this topic from many perspectives - technological, business and commercial. Most importantly, as we understand how our world is emerging, we can position ourselves strategically for tomorrow.

  19. Plate Full of Color

    Centers for Disease Control (CDC) Podcasts

    2008-08-04

    The Eagle Books are a series of four books that are brought to life by wise animal characters - Mr. Eagle, Miss Rabbit, and Coyote - who engage Rain That Dances and his young friends in the joy of physical activity, eating healthy foods, and learning from their elders about health and diabetes prevention. Plate Full of Color teaches the value of eating a variety of colorful and healthy foods.  Created: 8/4/2008 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 8/5/2008.

  20. The Colors of Saturn

    Science.gov (United States)

    DeVogel, Kayla; Chanover, Nancy; Thelen, Alexander

    2015-11-01

    Very little is known about the coloring agents, or chromophores, that color the clouds of Saturn’s belts and zones. Although the clouds of Saturn are more muted in their coloration and do not exhibit the more striking variations seen among Jupiter’s belts, zones, and cyclonic storm features, the physical processes that render Saturn’s clouds a yellowish hue are likely similar to those at work on Jupiter. Thus, a comprehensive color study that includes both Jupiter and Saturn is warranted to advance our understanding of chromophores in the giant planet atmospheres. Here we report on our efforts to characterize the colors of Saturn’s clouds.This study involves the analysis of two imaging data sets: those from Cassini’s Imaging Science Subsystem (ISS), and Wide Field Planetary Camera 2 images taken with the Hubble Space Telescope (HST). The HST data were acquired in 1994, 1998, 2002 and 2004 using eleven different filters spanning 255-973 nm. After the images were photometrically and geometrically calibrated, we used them to create low resolution spectra for six different latitude regions: the Equatorial Zone, the Equatorial Belt, the South Equatorial Belt, the South Temperate Zone, the South Temperate Belt and the South South Temperate Belt. The Cassini ISS images were acquired in 2004 and 2011 using twelve different filters spanning 258-938 nm, and corresponding low resolution spectra of the same latitude regions were generated using the ISS images. We compare these low resolution spectra to Saturn’s full-disk spectrum (Karkoschka, E., 1994, Icarus 111, 174) to examine colors of discrete latitudes versus the full-disk spectrum of Saturn. The extensive temporal coverage afforded by the combination of the HST and ISS images will enable us to explore possible seasonal variations in Saturn’s cloud colors. Finally, we examine the color evolution of the major 2011 storm on Saturn using the ISS data.This work was supported by the Discovery Scholars Program in

  1. QCD: color or glow

    International Nuclear Information System (INIS)

    The some of motivations for color and the numerous qualitative successes of QCD are presented. Non-leading higher order contributions to the (x, Q2)-dependence of scaling violations of non-singlet and singlet structure functions are discussed, especially non-perturbative correction to deep inelastic processes such as higher twist contributions. Finally the topic of how to account theoretically for the existence of free fractionally charged particles by concentrating mainly on spontaneously breaking SU(3) color is presented. (M.F.W.)

  2. Color constancy in Japanese animation

    Science.gov (United States)

    Ichihara, Yasuyo G.

    2006-01-01

    In this study, we measure the colors used in a Japanese Animations. The result can be seen on CIE-xy color spaces. It clearly shows that the color system is not a natural appearance system but an imagined and artistic appearance system. Color constancy of human vision can tell the difference in skin and hair colors between under moonlight and day light. Human brain generates a match to the memorized color of an object from daylight viewing conditions to the color of the object in different viewing conditions. For example, Japanese people always perceive the color of the Rising Sun in the Japanese flag as red even in a different viewing condition such as under moonlight. Color images captured by a camera cannot present those human perceptions. However, Japanese colorists in Animation succeeded in painting the effects of color constancy not only under moonlight but also added the memory matching colors. They aim to create a greater impact on viewer's perceptions by using the effect of the memory matching colors. In this paper, we propose the Imagined Japanese Animation Color System. This system in art is currently a subject of research in Japan. Its importance is that it could also provide an explanation on how human brain perceives the same color under different viewing conditions.

  3. Electron beam irradiation of gemstone for color enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Idris, Sarada; Ghazali, Zulkafli; Hashim, Siti A' iasah; Ahmad, Shamshad; Jusoh, Mohd Suhaimi [Malaysian Nuclear Agency, Bangi, Selangor (Malaysia); School of Chemicals and Material Engineering, NUST Islamabad (Pakistan); Malaysian Nuclear Agency, Bangi, Selangor (Malaysia)

    2012-09-26

    Numerous treatment of gemstones has been going on for hundreds of years for enhancing color and clarity of gems devoid of these attributes. Whereas previous practices included fraudulent or otherwise processes to achieve the color enhancement, the ionizing radiation has proven to be a reliable and reproducible technique. Three types of irradiation processes include exposure to gamma radiation, electron beam irradiation and the nuclear power plants. Electron Beam Irradiation of Gemstone is a technique in which a gemstone is exposed to highly ionizing radiation electron beam to knock off electrons to generate color centers culminating in introduction of deeper colors. The color centers may be stable or unstable. Below 9MeV, normally no radioactivity is introduced in the exposed gems. A study was conducted at Electron Beam Irradiation Centre (Alurtron) for gemstone color enhancement by using different kind of precious gemstones obtained from Pakistan. The study shows that EB irradiation not only enhances the color but can also improves the clarity of some type of gemstones. The treated stones included kunzite, tourmaline, topaz, quartz, aquamarine and cultured pearls. Doses ranging from 25 kGy to 200 KGy were employed to assess the influence of doses on color and clarity and to select the optimum doses. The samples used included both the natural and the faceted gemstones. It is concluded that significant revenue generation is associated with the enhancement of the color in clarity of gemstones which are available at very cheap price in the world market.

  4. Electron beam irradiation of gemstone for color enhancement

    Science.gov (United States)

    Idris, Sarada; Ghazali, Zulkafli; Hashim, Siti A'iasah; Ahmad, Shamshad; Jusoh, Mohd Suhaimi

    2012-09-01

    Numerous treatment of gemstones has been going on for hundreds of years for enhancing color and clarity of gems devoid of these attributes. Whereas previous practices included fraudulent or otherwise processes to achieve the color enhancement, the ionizing radiation has proven to be a reliable and reproducible technique. Three types of irradiation processes include exposure to gamma radiation, electron beam irradiation and the nuclear power plants. Electron Beam Irradiation of Gemstone is a technique in which a gemstone is exposed to highly ionizing radiation electron beam to knock off electrons to generate color centers culminating in introduction of deeper colors. The color centers may be stable or unstable. Below 9MeV, normally no radioactivity is introduced in the exposed gems. A study was conducted at Electron Beam Irradiation Centre (Alurtron) for gemstone color enhancement by using different kind of precious gemstones obtained from Pakistan. The study shows that EB irradiation not only enhances the color but can also improves the clarity of some type of gemstones. The treated stones included kunzite, tourmaline, topaz, quartz, aquamarine and cultured pearls. Doses ranging from 25 kGy to 200 KGy were employed to assess the influence of doses on color and clarity and to select the optimum doses. The samples used included both the natural and the faceted gemstones. It is concluded that significant revenue generation is associated with the enhancement of the color in clarity of gemstones which are available at very cheap price in the world market.

  5. A REVIEW OF COLOR MEASURMENTS IN THE TEXTILE INDUSTRY

    Directory of Open Access Journals (Sweden)

    BRAD Raluca

    2016-05-01

    Full Text Available Color is an important factor in the evaluation of aesthetic appearance and functionality of many products, but especially of textile industry ones. In textiles production process, color can be assessed in different stages: the selection of raw materials, the incoming item tests, the preparation of dyeing ingredients, the crocking resistance testing, the color fastness and in all stages, the quality control. Color evaluation can be done visually or using specialized test instruments such as colorimeters or spectrometers, therefore a high accuracy of measurements must be achieved. Standards describe different procedures and testing techniques depending on the product type and the quality level required by the customer. The paper presents the most common systems of color representation and communication, measurement methods and techniques, and standards that define them. The CIE color representation systems have been reviewed, together with the measurement methods offering the repeatability of the process. Most of the standards have been issued in US, but several European and International are stating the color assessment process. We have also conducted a review of latest published papers in the topic of color measurement, comparison and match. Several image processing applications algorithms offers new opportunities for computer assisted evaluation and control of textile color properties.

  6. Electron beam irradiation of gemstone for color enhancement

    International Nuclear Information System (INIS)

    Numerous treatment of gemstones has been going on for hundreds of years for enhancing color and clarity of gems devoid of these attributes. Whereas previous practices included fraudulent or otherwise processes to achieve the color enhancement, the ionizing radiation has proven to be a reliable and reproducible technique. Three types of irradiation processes include exposure to gamma radiation, electron beam irradiation and the nuclear power plants. Electron Beam Irradiation of Gemstone is a technique in which a gemstone is exposed to highly ionizing radiation electron beam to knock off electrons to generate color centers culminating in introduction of deeper colors. The color centers may be stable or unstable. Below 9MeV, normally no radioactivity is introduced in the exposed gems. A study was conducted at Electron Beam Irradiation Centre (Alurtron) for gemstone color enhancement by using different kind of precious gemstones obtained from Pakistan. The study shows that EB irradiation not only enhances the color but can also improves the clarity of some type of gemstones. The treated stones included kunzite, tourmaline, topaz, quartz, aquamarine and cultured pearls. Doses ranging from 25 kGy to 200 KGy were employed to assess the influence of doses on color and clarity and to select the optimum doses. The samples used included both the natural and the faceted gemstones. It is concluded that significant revenue generation is associated with the enhancement of the color in clarity of gemstones which are available at very cheap price in the world market.

  7. A color based face detection system using multiple templates

    Institute of Scientific and Technical Information of China (English)

    王涛; 卜佳俊; 陈纯

    2003-01-01

    A color based system using multiple templates was developed and implemented for detecting human faces in color images. The algorithm consists of three image processing steps. The first step is human skin color statistics. Then it separates skin regions from non-skin regions. After that, it locates the frontal human face(s) within the skin regions. In the first step, 250 skin samples from persons of different ethnicities are used to determine the color distribution of human skin in chromatic color space in order to get a chroma chart showing likelihoods of skin colors. This chroma chart is used to generate, from the original color image, a gray scale image whose gray value at a pixel shows its likelihood of representing the skin. The algorithm uses an adaptive thresholding process to achieve the optimal threshold value for dividing the gray scale image into separate skin regions from non skin regions. Finally, multiple face templates matching is used to determine if a given skin region represents a frontal human face or not. Test of the system with more than 400 color images showed that the resulting detection rate was 83%, which is better than most color-based face detection systems. The average speed for face detection is 0.8 second/image (400×300 pixels) on a Pentium 3 (800MHz) PC.

  8. The Female Bonding in The Color Purple

    Institute of Scientific and Technical Information of China (English)

    余跃

    2007-01-01

    This paper aims at a survey of the female bonding in The Color Purple,which plays an important role in the heroine's finding her voice and sense of self.By examining the black women's struggle to explore their identity and claim their selves under sexual and racial oppressions,Alice Walker,the author,shows her understanding of the process that black women must undergo to achieve their vision.

  9. Colored Contact Lens Dangers

    Medline Plus

    Full Text Available ... contact lenses , from the U.S. Food and Drug Administration (FDA). Are the colored lenses you are considering ... new treatment option. The U.S. Food and Drug Administration (FDA) has approved corneal collagen cross-linking (CXL) ...

  10. Transparency and imaginary colors

    NARCIS (Netherlands)

    Richards, W.; Koenderink, J.J.; Van Doorn, A.

    2009-01-01

    Unlike the Metelli monochrome transparencies, when overlays and their backgrounds have chromatic content, the inferred surface colors may not always be physically realizable, and are in some sense “imaginary.” In these cases, the inferred chromatic transmittance or reflectance of the overlay lies ou

  11. Dinosaurs' True Colors

    Institute of Scientific and Technical Information of China (English)

    TANG YUANKAI

    2010-01-01

    @@ On March 10,the Beijing Museum of Natural History(BMNH)announced scientists from China and abroad had decoded the full-body color patterns of a dinosaur,a small theropod named as anchiomis huxleyi,for the first time.

  12. Color appearance in stereoscopy

    Science.gov (United States)

    Gadia, Davide; Rizzi, Alessandro; Bonanomi, Cristian; Marini, Daniele; Galmonte, Alessandra; Agostini, Tiziano

    2011-03-01

    The relationship between color and lightness appearance and the perception of depth has been studied since a while in the field of perceptual psychology and psycho-physiology. It has been found that depth perception affects the final object color and lightness appearance. In the stereoscopy research field, many studies have been proposed on human physiological effects, considering e.g. geometry, motion sickness, etc., but few has been done considering lightness and color information. Goal of this paper is to realize some preliminar experiments in Virtual Reality in order to determine the effects of depth perception on object color and lightness appearance. We have created a virtual test scene with a simple 3D simultaneous contrast configuration. We have created three different versions of this scene, each with different choices of relative positions and apparent size of the objects. We have collected the perceptual responses of several users after the observation of the test scene in the Virtual Theater of the University of Milan, a VR immersive installation characterized by a semi-cylindrical screen that covers 120° of horizontal field of view from an observation distance of 3.5 m. We present a description of the experiments setup and procedure, and we discuss the obtained results.

  13. Comprehension of COLOR Metaphors

    Institute of Scientific and Technical Information of China (English)

    刘昱君

    2012-01-01

      本文试图通过对英汉颜色隐喻的比较研究,探讨隐喻的相似性及差异。%  In this thesis,I have attempted to discuss the similarities and differences of metaphor by making a comparative study of color metaphors in English and Chinese.

  14. Using Single Colors and Color Pairs to Communicate Basic Tastes

    Directory of Open Access Journals (Sweden)

    Andy T. Woods

    2016-07-01

    Full Text Available Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty with specific colors (e.g., red, green, black, and white. In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  15. Social Property of Colors and Translation of Color Words

    Institute of Scientific and Technical Information of China (English)

    曾慧彬

    2013-01-01

    The paper is about the social property of colors andtranslationofcolorwords.Colorsareveryimportantinour sociallife,accordingtothispaperwecanknowsomerelations aboutsocialandcolor.EspeciallyaboutthedifferencesofChinese and English color words. Through the differences, three basic translatingmethodsaregeneralized.

  16. Improved color reproduction based on CIELAB color space in integrated multi-scale retinex

    Science.gov (United States)

    Kyung, Wang-Jun; Lee, Tae-Hyoung; Lee, Cheol-Hee; Ha, Yeong-Ho

    2009-01-01

    Recently, tone reproduction is widely used in the field of image enhancement and HDR imaging. This method is especially used to provide the proper luminance so that captured images give the same sensation as the scene. As a result, we can get high contrast and naturalness of colors. There is ample literature on the topic of tone reproduction that has the objective of reproducing natural looking color in digital images. In recent papers, IMSR (Integrated multi-scale Retinex) shows great naturalness in the result images. Most methods, including IMSR, work in RGB or quasi-RGB color spaces, although some method adopted the use of luminance. This raises hue distortion from the point of the human visual system, that is, hue distortion in CIELAB color space. Accordingly, this paper proposes an enhanced IMSR method in a device-independent color space, CIELAB, to preserve hue and obtain high contrast and naturalness. In order to achieve the devised objectives, a captured sRGB image is transformed to the CIELAB color space. IMSR is then applied to only L* values, thus the balance of colors components are preserved. This process causes unnatural saturation, therefore saturation adjustment is performed by applying the ratio of chroma variation at the sRGB gamut boundary according to the corrected luminance. Finally, the adjusted CIELAB values are transformed to sRGB using the inverse transform function. In the result images of the proposed method, containing both high and low luminance regions, visibility in dark shadow and bright regions was improved and color distortion was reduced.

  17. Race and Color: Revisiting Perspectives in Black Education

    Science.gov (United States)

    Monroe, Carla R.

    2016-01-01

    Racial inequities, such as systematic disparities in school discipline and achievement outcomes, are a perennial characteristic of public education in the United States. Although attention to interracial chasms such as the Black-White achievement gap is common, limited efforts are devoted to understanding how and why colorism motivates imbalances…

  18. How bees distinguish colors

    Directory of Open Access Journals (Sweden)

    Horridge A

    2015-03-01

    Full Text Available Adrian Horridge Biological Sciences, Australian National University, Canberra, ACT, Australia Abstract: Behind each facet of the compound eye, bees have photoreceptors for ultraviolet, green, and blue wavelengths that are excited by sunlight reflected from the surrounding panorama. In experiments that excluded ultraviolet, bees learned to distinguish between black, gray, white, and various colors. To distinguish two targets of differing color, bees detected, learned, and later recognized the strongest preferred inputs, irrespective of which target displayed them. First preference was the position and measure of blue reflected from white or colored areas. They also learned the positions and a measure of the green receptor modulation at vertical edges that displayed the strongest green contrast. Modulation is the receptor response to contrast and was summed over the length of a contrasting vertical edge. This also gave them a measure of angular width between outer vertical edges. Third preference was position and a measure of blue modulation. When they returned for more reward, bees recognized the familiar coincidence of these inputs at that place. They cared nothing for colors, layout of patterns, or direction of contrast, even at black/white edges. The mechanism is a new kind of color vision in which a large-field tonic blue input must coincide in time with small-field phasic modulations caused by scanning vertical edges displaying green or blue contrast. This is the kind of system to expect in medium-lowly vision, as found in insects; the next steps are fresh looks at old observations and quantitative models. Keywords: vision, honey bee, visual processing, optimum system, picture sorting

  19. A bridge too far: dispersal barriers and cryptic speciation in an Arabian Peninsula grouper (Cephalopholis hemistiktos)

    KAUST Repository

    Priest, Mark

    2015-12-12

    Aim: We use genetic and age-based analyses to assess the evidence for a biogeographical barrier to larval dispersal in the yellowfin hind, Cephalopholis hemistiktos, a commercially important species found across the Arabian Peninsula. Location: Red Sea, Gulf of Aden, Gulf of Oman and Arabian Gulf. Methods: Mitochondrial DNA cytochrome-c oxidase subunit-I and nuclear DNA (S7) sequences were obtained for C. hemistiktos sampled throughout its distributional range. Phylogeographical and population-level analyses were used to assess patterns of genetic structure and to identify barriers to dispersal. Concurrently, age-based demographic analyses using otoliths determined differences in growth and longevity between regions. Results: Our analyses revealed significant genetic structure congruent with growth parameter differences observed across sampling sites, suggesting cryptic speciation between populations in the Red Sea and Gulf of Aden versus the Gulf of Oman and Arabian Gulf. Coalescence analyses indicated these two regions have been isolated for > 800,000 years. Main conclusions: Our results indicate historical disruption to gene flow and a contemporary dispersal barrier in the Arabian Sea, which C. hemistiktos larvae are unable to effectively traverse. This provides yet another example of a (cryptic) species with high dispersive potential whose range is delimited by a lack of suitable habitat between locations or an inability to successfully recruit at the range edge. © 2015 John Wiley & Sons Ltd.

  20. Quantitative Genetics Identifies Cryptic Genetic Variation Involved in the Paternal Regulation of Seed Development.

    Science.gov (United States)

    Pires, Nuno D; Bemer, Marian; Müller, Lena M; Baroux, Célia; Spillane, Charles; Grossniklaus, Ueli

    2016-01-01

    Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship) theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict.

  1. Quantitative Genetics Identifies Cryptic Genetic Variation Involved in the Paternal Regulation of Seed Development.

    Directory of Open Access Journals (Sweden)

    Nuno D Pires

    2016-01-01

    Full Text Available Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict.

  2. Cryptic Transcription and Early Termination in the Control of Gene Expression

    Directory of Open Access Journals (Sweden)

    Jessie Colin

    2011-01-01

    Full Text Available Recent studies on yeast transcriptome have revealed the presence of a large set of RNA polymerase II transcripts mapping to intergenic and antisense regions or overlapping canonical genes. Most of these ncRNAs (ncRNAs are subject to termination by the Nrd1-dependent pathway and rapid degradation by the nuclear exosome and have been dubbed cryptic unstable transcripts (CUTs. CUTs are often considered as by-products of transcriptional noise, but in an increasing number of cases they play a central role in the control of gene expression. Regulatory mechanisms involving expression of a CUT are diverse and include attenuation, transcriptional interference, and alternative transcription start site choice. This review focuses on the impact of cryptic transcription on gene expression, describes the role of the Nrd1-complex as the main actor in preventing nonfunctional and potentially harmful transcription, and details a few systems where expression of a CUT has an essential regulatory function. We also summarize the most recent studies concerning other types of ncRNAs and their possible role in regulation.

  3. Cryptic species of cardinalfish with evidence for old and new divergence

    Science.gov (United States)

    Gerlach, Gabriele; Atema, Jelle; Raupach, Michael J.; Deister, Fabian; Müller, Anke; Kingsford, Michael J.

    2016-06-01

    Larval dispersal and limited knowledge of physical boundaries challenge our understanding of the processes that drive genetic divergence and potential speciation in the marine environment. Divergence, both within and between populations of marine taxa, is not uncommon, but spatial and temporal stability of observed genetic structure is not well known. Previously, we detected large genetic differences among populations of the cardinalfish species Ostorhinchus doederleini inhabiting adjacent coral reefs. Here, we determined the spatial and temporal persistence of these genetic structures over the course of ten consecutive generations. Using microsatellite markers, we detected large changes (genetic population distance, D est, ranged from 0.04 to 0.46) in the genetic structure in some years, but some reefs maintained the same populations for nearly all sampling years. As this species' life span does not exceed 1 yr, persistence of distinct reef populations suggests natal homing. Mitochondrial identity based on two mtDNA markers corroborates the nuclear genetic evidence for genetic differences large enough to constitute different clades and even cryptic species in O. doederleini, which, based on gross morphology, was thought to be a single taxon. Habitat specialization was observed in one clade that exclusively inhabited reef lagoons, while all clades could be observed on reef slopes. We suggest that local habitat recognition combined with local population recognition and selection against hybrids can form barriers that maintain a cryptic species complex.

  4. Parallel changes in genital morphology delineate cryptic diversification of planktonic nudibranchs.

    Science.gov (United States)

    Churchill, Celia K C; Alejandrino, Alvin; Valdés, Angel; Foighil, Diarmaid O

    2013-08-22

    The relative roles of geographical and non-geographical barriers in the genesis of genetic isolation are highly debated in evolutionary biology, yet knowing how speciation occurs is essential to our understanding of biodiversity. In the open ocean, differentiating between the two is particularly difficult, because of the high levels of gene flow found in pelagic communities. Here, we use molecular phylogenetics to test the hypothesis that geography is the primary isolating mechanism in a clade of pelagic nudibranchs, Glaucinae. Our results contradict allopatric expectations: the cosmopolitan Glaucus atlanticus is panmictic, whereas the Indo-Pacific Glaucus marginatus contains two pairs of cryptic species with overlapping distributions. Within the G. marginatus species complex, a parallel reproductive change has occurred in each cryptic species pair: the loss of a bursa copulatrix. Available G. marginatus data are most consistent with non-geographical speciation events, but we cannot rule out the possibility of allopatric speciation, followed by iterative range extension and secondary overlap. Irrespective of ancestral range distributions, our results implicate a central role for reproductive character differentiation in glaucinin speciation-a novel result in a planktonic system. PMID:23825213

  5. Molecular cytogenetic search for cryptic sex chromosomes in painted turtles Chrysemys picta.

    Science.gov (United States)

    Valenzuela, Nicole; Badenhorst, Daleen; Montiel, Eugenia E; Literman, Robert

    2014-01-01

    Sex determination is triggered by factors ranging from genotypic (GSD) to environmental (ESD), or both GSD + EE (GSD susceptible to environmental effects), and its evolution remains enigmatic. The presence/absence of sex chromosomes purportedly separates species at the ESD end of the continuum from the rest (GSD and GSD + EE) because the evolutionary dynamics of sex chromosomes and autosomes differ. However, studies suggest that turtles with temperature-dependent sex determination (TSD) are cryptically GSD and possess sex chromosomes. Here, we test this hypothesis in painted turtles Chrysemys picta (TSD), using comparative-genome-hybridization (CGH), a technique known to detect morphologically indistinguishable sex chromosomes in other turtles and reptiles. Our results show no evidence for the existence of sex chromosomes in painted turtles. While it remains plausible that cryptic sex chromosomes may exist in TSD turtles that are characterized by minor genetic differences that cannot be detected at the resolution of CGH, previous attempts have failed to identify sex-specific markers. Genomic sequencing should prove useful in providing conclusive evidence in this regard. If such efforts uncover sex chromosomes in TSD turtles, it may reveal the existence of a fundamental constraint for the evolution of a full spectrum of sex determination (from pure GSD to pure TSD) that is predicted theoretically. Finding sex chromosomes in ESD organisms would question whether pure ESD mechanisms exist at all in nature, or whether those systems currently considered pure ESD simply await the characterization of an underlying GSD architecture.

  6. Shoot, shovel and shut up: cryptic poaching slows restoration of a large carnivore in Europe.

    Science.gov (United States)

    Liberg, Olof; Chapron, Guillaume; Wabakken, Petter; Pedersen, Hans Christian; Hobbs, N Thompson; Sand, Håkan

    2012-03-01

    Poaching is a widespread and well-appreciated problem for the conservation of many threatened species. Because poaching is illegal, there is strong incentive for poachers to conceal their activities, and consequently, little data on the effects of poaching on population dynamics are available. Quantifying poaching mortality should be a required knowledge when developing conservation plans for endangered species but is hampered by methodological challenges. We show that rigorous estimates of the effects of poaching relative to other sources of mortality can be obtained with a hierarchical state-space model combined with multiple sources of data. Using the Scandinavian wolf (Canis lupus) population as an illustrative example, we show that poaching accounted for approximately half of total mortality and more than two-thirds of total poaching remained undetected by conventional methods, a source of mortality we term as 'cryptic poaching'. Our simulations suggest that without poaching during the past decade, the population would have been almost four times as large in 2009. Such a severe impact of poaching on population recovery may be widespread among large carnivores. We believe that conservation strategies for large carnivores considering only observed data may not be adequate and should be revised by including and quantifying cryptic poaching. PMID:21849323

  7. Morphology and molecules reveal unexpected cryptic diversity in the enigmatic genus Sinobirma Bryk, 1944 (Lepidoptera: Saturniidae.

    Directory of Open Access Journals (Sweden)

    Rodolphe Rougerie

    Full Text Available The wild silkmoth genus Sinobirma Bryk, 1944 is a poorly known monotypic taxon from the eastern end of the Himalaya Range. It was convincingly proposed to be closely related to some members of an exclusively Afro-tropical group of Saturniidae, but its biogeographical and evolutionary history remains enigmatic. After examining recently collected material from Tibet, northern India, and northeastern Myanmar, we realized that this unique species, S. malaisei Bryk, 1944 only known so far from a few specimens and from a very restricted area near the border between north-eastern Myanmar and the Yunnan province of China, may in fact belong to a group of closely related cryptic species. In this work, we combined morphological comparative study, DNA barcoding, and the sequences of a nuclear marker (D2 expansion segment of the 28S rRNA gene to unequivocally delimit three distinct species in the genus Sinobirma, of which two are described as new to science: S. myanmarensis sp. n. and S. bouyeri sp. n. An informative DNA barcode sequence was obtained from the female holotype of S. malaisei--collected in 1934--ensuring the proper assignation of this name to the newly collected and studied specimens. Our findings represent another example of the potential of coupling traditional taxonomy and DNA barcoding for revealing and solving difficult cases of cryptic diversity. This approach is now being generalized to the world fauna of Saturniidae, with the participation of most of the taxonomists studying these moths.

  8. Integrative taxonomy detects cryptic and overlooked fish species in a neotropical river basin.

    Science.gov (United States)

    Gomes, Laís Carvalho; Pessali, Tiago Casarim; Sales, Naiara Guimarães; Pompeu, Paulo Santos; Carvalho, Daniel Cardoso

    2015-10-01

    The great freshwater fish diversity found in the neotropical region makes management and conservation actions challenging. Due to shortage of taxonomists and insufficient infrastructure to deal with such great biodiversity (i.e. taxonomic impediment), proposed remedies to accelerate species identification and descriptions include techniques that combine DNA-based identification and concise morphological description. The building of a DNA barcode reference database correlating meristic and genetic data was developed for 75 % of the Mucuri River basin's freshwater fish. We obtained a total of 141 DNA barcode sequences from 37 species belonging to 30 genera, 19 families, and 5 orders. Genetic distances within species, genera, and families were 0.74, 9.5, and 18.86 %, respectively. All species could be clearly identified by the DNA barcodes. Divergences between meristic morphological characteristics and DNA barcodes revealed two cryptic species among the Cyphocharax gilbert and Astyanax gr. bimaculatus specimens, and helped to identify two overlooked species within the Gymnotus and Astyanax taxa. Therefore, using a simplified model of neotropical biodiversity, we tested the efficiency of an integrative taxonomy approach for species discovery, identification of cryptic diversity, and accelerating biodiversity descriptions.

  9. Human preference for individual colors

    Science.gov (United States)

    Palmer, Stephen E.; Schloss, Karen B.

    2010-02-01

    Color preference is an important aspect of human behavior, but little is known about why people like some colors more than others. Recent results from the Berkeley Color Project (BCP) provide detailed measurements of preferences among 32 chromatic colors as well as other relevant aspects of color perception. We describe the fit of several color preference models, including ones based on cone outputs, color-emotion associations, and Palmer and Schloss's ecological valence theory. The ecological valence theory postulates that color serves an adaptive "steering' function, analogous to taste preferences, biasing organisms to approach advantageous objects and avoid disadvantageous ones. It predicts that people will tend to like colors to the extent that they like the objects that are characteristically that color, averaged over all such objects. The ecological valence theory predicts 80% of the variance in average color preference ratings from the Weighted Affective Valence Estimates (WAVEs) of correspondingly colored objects, much more variance than any of the other models. We also describe how hue preferences for single colors differ as a function of gender, expertise, culture, social institutions, and perceptual experience.

  10. Advantage of dichromats over trichromats in discrimination of color-camouflaged stimuli in nonhuman primates.

    Science.gov (United States)

    Saito, Atsuko; Mikami, Akichika; Kawamura, Shoji; Ueno, Yoshikazu; Hiramatsu, Chihiro; Widayati, Kanthi A; Suryobroto, Bambang; Teramoto, Migaku; Mori, Yusuke; Nagano, Kunitoshi; Fujita, Kazuo; Kuroshima, Hika; Hasegawa, Toshikazu

    2005-12-01

    Due to a middle- to long-wavelength-sensitive (M/LWS) cone opsin polymorphism, there is considerable phenotypic variation in the color vision of New World monkeys. Many females have trichromatic vision, whereas some females and all males have dichromatic vision. The selective pressures that maintain this polymorphism are unclear. In the present study we compared the performance of dichromats and trichromats in a discrimination task. We examined tri- and dichromatic individuals of two species: brown capuchin monkeys (Cebus apella) and long-tailed macaques (Macaca fascicularis). We also examined one protanomalous chimpanzee (Pan troglodytes). The subjects' task was to discriminate a circular pattern from other patterns in which textural elements differed in orientation and thickness from the background. After they were trained with stimuli of a single color, the subjects were presented with color-camouflaged stimuli with a green/red mosaic overlaid onto the pattern. The dichromatic monkeys and the protanomalous chimpanzee selected the correct stimulus under camouflaged conditions at rates significantly above chance levels, while the trichromats did not. These findings demonstrate that dichromatic nonhuman primates possess a superior visual ability to discriminate color-camouflaged stimuli, and that such an ability may confer selective advantages with respect to the detection of cryptic foods and/or predators. PMID:16342068

  11. A color management system for multi-colored LED lighting

    DEFF Research Database (Denmark)

    Chakrabarti, Maumita; Thorseth, Anders; Jepsen, Jørgen;

    2015-01-01

    A new color control system is described and implemented for a five–color LED light engine, covering a wide white gamut. The system combines a new way of using pre-calibrated look-up tables and a rule-based optimization of chromaticity distance from the Planckian locus with a calibrated color sens...

  12. Randomized $\\Delta$-Edge-Coloring via Quaternion of Complex Colors

    CERN Document Server

    Lee, Tony T; Guan, Hao

    2011-01-01

    This paper explores the application of a new algebraic method of color exchanges to the edge coloring of simple graphs. Vizing's theorem states that the edge coloring of a simple graph $G$ requires either $\\Delta$ or $\\Delta+1$ colors, where $\\Delta$ is the maximum vertex degree of $G$. Holyer proved that it is {\\bf NP}-complete to decide whether $G$ is $\\Delta$-edge-colorable even for cubic graphs. By introducing the concept of complex colors, we show that the color-exchange operation follows the same multiplication rules as quaternion. An initially $\\Delta$-edge-colored graph $G$ allows variable-colored edges, which can be eliminated by color exchanges in a manner similar to variable eliminations in solving systems of linear equations. The problem is solved if all variables are eliminated and a properly $\\Delta$-edge-colored graph is reached. For a randomly generated graph $G$, we prove that our algorithm returns a proper $\\Delta$-edge-coloring with a probability of at least 1/2 in $O(\\Delta|V||E|^5)$ time ...

  13. Full-Spectrum Flexible Color Printing at the Diffraction Limit

    CERN Document Server

    Richner, Patrizia; Lendenmann, Tobias; Kress, Stephan J P; Kim, David K; Norris, David J; Poulikakos, Dimos

    2016-01-01

    Color printing at the diffraction limit has been recently explored by fabricating nanoscale plasmonic structures with electron beam lithography. However, only a limited color range and constant intensity throughout the structure have been demonstrated. Here we show an alternative, facile approach relying on the direct, open-atmosphere electrohydrodynamic rapid nanodrip printing of controlled amounts of red, green and blue (RGB) quantum dots at a resolution of 250 nm. The narrow emission spectrum of the dots allows the coverage of a very broad color space, exceeding standard RGB (sRGB) of modern display devices. We print color gradients of variable intensity, which to date could not be achieved with diffraction-limited resolution. Showcasing the capabilities of the technology, we present a photo-realistic printed image of a colorful parrot with a pixel size of 250 nm.

  14. Interior space design colors and effects on psychological

    Institute of Scientific and Technical Information of China (English)

    迟亦然

    2015-01-01

    The problem of relationship between human and environment is becoming more and more get the attention of people today. Similarly, from the relation between human and environment to a high degree of understanding of environmental development and creation, but also in recent years environmental art a great progress in understanding the. Indoor color in addition to the visual impact of the environment, but also directly affect people’s emotions, psychology. The scientific use of color is conducive to work, is helpful to health, color can properly deal with the functional requirements of the United States can achieve results. Indoor color in addition to color rules must comply with the general, but also changes with the times and different aesthetic view.

  15. Climate and colored walls: in search of visual comfort

    Science.gov (United States)

    Arrarte-Grau, Malvina

    2002-06-01

    The quality of natural light, the landscape surrounds and the techniques of construction are important factors in the selection of architectural colors. Observation of exterior walls in differentiated climates allows the recognition of particularities in the use of color which satisfy the need for visual comfort. At a distance of 2000 kilometers along the coast of Peru, Lima and Mancora at 12° and 4° respectively, are well defined for their climatic characteristics: in Mancora sunlight causes high reflection, in Lima overcast sky and high humidity cause glare. The study of building color effects at these locations serves to illustrate that color values may be controlled in order to achieve visual comfort and contribute to color identity.

  16. Towards Overcoming the Guitar's Color Research Gap

    Directory of Open Access Journals (Sweden)

    Rita Torres

    2014-07-01

    Full Text Available Most (classical guitar music comes from guitarist-composers. Yet according to guitarists who collaborate with composers, color research on this instrument is better achieved by those who do not play the instrument. Thus the guitar lags behind many instruments in regard to color research. Various reasons can be faulted for the tendency of non-guitarist composers to avoid the instrument. Examples of such reasons may be: the difficulty to write for the instrument, and its weak projection and lack of sustain, all of which are intrinsic to the guitar. This is, however, not the case of the paradigmatic sound for which the instrument is also dismissed, which is rather the legacy of the conservative guitarist Andrés Segovia, who was one of the main promoters of the guitar in the twentieth century. When composers dismiss the guitar for being difficult to write for, collaboration with guitarists has proven fruitful. Given that Segovia's conservatism still prevails among many guitarists, if the sonorous possibilities of the instrument are to be expanded, it is essential that the guitarist is adventurous and has a good arsenal of techniques. New color-research results could entice composers dismissing the guitar for its limitations or its paradigmatic sound to reconsider composing for the instrument. The amplification of sounds with low intensity can be a useful tool to obtain new colors. However, sounds arising from conventional instruments require some caution. It is important to introduce novelty in order to avoid connotation with their respective non-amplified instrument. The technique of multiphonics, which produces sounds of unusual colors, is believed to be a suitable tool when the guitar is amplified with close microphone placement. Through making audible the sounds' components of a lower intensity, this situation would reveal to the audience colors otherwise only heard by the guitarist.

  17. Testing Children for Color Blindness

    Science.gov (United States)

    ... Español Eye Health / News Testing Children for Color Blindness Written by: Shirley Dang Apr. 03, 2014 New ... shows that kids can be tested for color blindness as soon as age 4, finds Caucasian boys ...

  18. Color Changes Mark Polymer Reactions.

    Science.gov (United States)

    Krieger, James H.

    1980-01-01

    Describes how polydiacetylenes can be used as educational aids. These polymers have conjugated backbones, which cause changes in color when the polydiacetylenes undergo various chemical and physical processes. Diagrams summarize all chemical reactions and their associated color changes. (CS)

  19. Personalized 2D color maps

    KAUST Repository

    Waldin, Nicholas

    2016-06-24

    2D color maps are often used to visually encode complex data characteristics such as heat or height. The comprehension of color maps in visualization is affected by the display (e.g., a monitor) and the perceptual abilities of the viewer. In this paper we present a novel method to measure a user\\'s ability to distinguish colors of a two-dimensional color map on a given monitor. We show how to adapt the color map to the user and display to optimally compensate for the measured deficiencies. Furthermore, we improve user acceptance of the calibration procedure by transforming the calibration into a game. The user has to sort colors along a line in a 3D color space in a competitive fashion. The errors the user makes in sorting these lines are used to adapt the color map to his perceptual capabilities.

  20. Identity Based Color Image Cryptography

    OpenAIRE

    Gopi Krishnan S; Loganathan D

    2011-01-01

    An Identity based cryptography based on visual cryptography scheme was proposed for protecting color image. A color image to be protected and authentic entities such as account number, password, signature image are given as input. The binary key image is obtained by distributing the digital signature of obtained authentic entities. A secret color image which needs to be communicated is decomposed into three grayscale tones of Y-Cb-Cr color component. Then these grayscale images are half-toned...

  1. Color correction using color-flow eigenspace model in color face recognition

    Science.gov (United States)

    Choi, JaeYoung; Ro, Yong Man

    2009-02-01

    We propose a new color correction approach which, as opposed to existing methods, take advantages of a given pair of two color face images (probe and gallery) in the color face recognition (FR) framework. In the proposed color correction method, the color-flow vector and color-flow eigenspace model are developed to generate color corrected probe images. The main contribution of this paper is threefold: 1) the proposed method can reliably compensate the non-linear photic variations imposed on probe face images comparing to traditional color correction techniques; 2) to the best of our knowledge, for the first time, we conduct extensive experiment studies to compare the effectiveness of various color correction methods to deal with photometrical distortions in probe images; 3) the proposed method can significantly enhance the recognition performance degraded by severely illuminant probe face images. Two standard face databases CMU PIE and XM2VTSDB were used to demonstrate the effectiveness of the proposed color correction method. The usefulness of the proposed method in the color FR is shown in terms of both absolute and comparative recognition performances against four traditional color correction solutions of White balance, Gray-world, Retinex, and Color-by-correlation.

  2. Progress in color night vision

    NARCIS (Netherlands)

    Toet, A.; Hogervorst, M.A.

    2012-01-01

    We present an overview of our recent progress and the current state-of-the-art techniques of color image fusion for night vision applications. Inspired by previously developed color opponent fusing schemes, we initially developed a simple pixel-based false color-mapping scheme that yielded fused fal

  3. Astronomy with the Color Blind

    Science.gov (United States)

    Smith, Donald A.; Melrose, Justyn

    2014-01-01

    The standard method to create dramatic color images in astrophotography is to record multiple black and white images, each with a different color filter in the optical path, and then tint each frame with a color appropriate to the corresponding filter. When combined, the resulting image conveys information about the sources of emission in the…

  4. Edge classification for color constancy

    NARCIS (Netherlands)

    A. Gijsenij; T. Gevers; J. van de Weijer

    2008-01-01

    The goal of color constancy is to measure image colors despite differences in the color of the light source. Traditionally, the computational method of obtaining this ability is by using pixel values only. Recently, methods using edges instead of pixel values have been proposed. However, different e

  5. Can Coloring Mandalas Reduce Anxiety?

    Science.gov (United States)

    Curry, Nancy A.; Kasser, Tim

    2005-01-01

    This study examined the effectiveness of different types of art activities in the reduction of anxiety. After undergoing a brief anxiety-induction, 84 undergraduate students were randomly assigned to color a mandala, to color a plaid form, or to color on a blank piece of paper. Results demonstrated that anxiety levels declined approximately the…

  6. Color Addition and Subtraction Apps

    Science.gov (United States)

    Ruiz, Frances; Ruiz, Michael J.

    2015-01-01

    Color addition and subtraction apps in HTML5 have been developed for students as an online hands-on experience so that they can more easily master principles introduced through traditional classroom demonstrations. The evolution of the additive RGB color model is traced through the early IBM color adapters so that students can proceed step by step…

  7. Violating expectations of color order

    Science.gov (United States)

    Burling, Bil; Bender, Walter R.

    1996-04-01

    An exploration of emotion in color communication is presented in this paper. It begins with an outline of a proposed theory of emotion and a hypothesis of how color may induce emotion. A discussion follows that details what is essential in a color message to predict emotional responses. Experiments are described that might assist in validating the theory put forth in this paper.

  8. The Academic Achievement Gap: The Suburban Challenge. CSR Connection.

    Science.gov (United States)

    Alson, Allan

    Suburban schoolchildren of color, in the aggregate, do not perform as well as their white counterparts. In fact, the academic achievement gaps in many suburban communities are actually greater than those in urban school districts. This research brief looks at the achievement gap in suburban schools, offering preliminary answers to the following…

  9. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity.

    Science.gov (United States)

    Dincă, Vlad; Montagud, Sergio; Talavera, Gerard; Hernández-Roldán, Juan; Munguira, Miguel L; García-Barros, Enrique; Hebert, Paul D N; Vila, Roger

    2015-01-01

    How common are cryptic species--those overlooked because of their morphological similarity? Despite its wide-ranging implications for biology and conservation, the answer remains open to debate. Butterflies constitute the best-studied invertebrates, playing a similar role as birds do in providing models for vertebrate biology. An accurate assessment of cryptic diversity in this emblematic group requires meticulous case-by-case assessments, but a preview to highlight cases of particular interest will help to direct future studies. We present a survey of mitochondrial genetic diversity for the butterfly fauna of the Iberian Peninsula with unprecedented resolution (3502 DNA barcodes for all 228 species), creating a reliable system for DNA-based identification and for the detection of overlooked diversity. After compiling available data for European butterflies (5782 sequences, 299 species), we applied the Generalized Mixed Yule-Coalescent model to explore potential cryptic diversity at a continental scale. The results indicate that 27.7% of these species include from two to four evolutionary significant units (ESUs), suggesting that cryptic biodiversity may be higher than expected for one of the best-studied invertebrate groups and regions. The ESUs represent important units for conservation, models for studies of evolutionary and speciation processes, and sentinels for future research to unveil hidden diversity. PMID:26205828

  10. T Cell Adaptive Immunity Proceeds through Environment-Induced Adaptation from the Exposure of Cryptic Genetic Variation

    Science.gov (United States)

    Whitacre, James M.; Lin, Joseph; Harding, Angus

    2011-01-01

    Evolution is often characterized as a process involving incremental genetic changes that are slowly discovered and fixed in a population through genetic drift and selection. However, a growing body of evidence is finding that changes in the environment frequently induce adaptations that are much too rapid to occur by an incremental genetic search process. Rapid evolution is hypothesized to be facilitated by mutations present within the population that are silent or “cryptic” within the first environment but are co-opted or “exapted” to the new environment, providing a selective advantage once revealed. Although cryptic mutations have recently been shown to facilitate evolution in RNA enzymes, their role in the evolution of complex phenotypes has not been proven. In support of this wider role, this paper describes an unambiguous relationship between cryptic genetic variation and complex phenotypic responses within the immune system. By reviewing the biology of the adaptive immune system through the lens of evolution, we show that T cell adaptive immunity constitutes an exemplary model system where cryptic alleles drive rapid adaptation of complex traits. In naive T cells, normally cryptic differences in T cell receptor reveal diversity in activation responses when the cellular population is presented with a novel environment during infection. We summarize how the adaptive immune response presents a well studied and appropriate experimental system that can be used to confirm and expand upon theoretical evolutionary models describing how seemingly small and innocuous mutations can drive rapid cellular evolution. PMID:22363338

  11. Museum lighting for golden artifacts, with low correlated color temperature, high color uniformity and high color rendering index, using diffusing color mixing of red, cyan, and white-light-emitting diodes

    Science.gov (United States)

    Thorseth, Anders; Corell, Dennis D.; Poulsen, Peter B.; Hansen, Søren S.; Dam-Hansen, Carsten

    2012-03-01

    Museum lighting present challenges due to the demand for a high color rendering index (CRI), color uniformity and the damaging effects of both visible and invisible radiation. Golden objects are furthermore normally displayed with illumination which has a correlated color temperature (CCT) of 2200 K, a CCT that is not commercially available from single LEDs. An LED system that conforms with these requirements has been developed and implemented at The Royal Danish Collection at Rosenborg Castle. Color mixing of commercial LEDs (red, cyan, and white) was employed to achieve the spectral power distribution needed for the CCT and a CRI above 90, for all CRI test color samples. Replacing the traditional low voltage incandescent lighting has shown energy saving above 70 %. Harmful IR radiation was reduced by 99 %. Temperature fluctuations in the display cases were reduced from several degrees Celsius to below one, despite the fact that the lighting units were placed within the display case. Spatial color uniformity of the illumination and uniformly colored shadows was achieved by use of a highly diffusing reflector dish which avoids direct illumination from the LEDs.

  12. Real Time Decoding of Color Symbol for Optical Positioning System

    OpenAIRE

    Abdul Waheed Malik; Benny Thörnberg; Qaisar Anwar; Tor Arne Johanson; Khurram Shahzad

    2015-01-01

    This paper presents the design and real-time decoding of a color symbol that can be used as a reference marker for optical navigation. The designed symbol has a circular shape and is printed on paper using two distinct colors. This pair of colors is selected based on the highest achievable signal to noise ratio. The symbol is designed to carry eight bit information. Real time decoding of this symbol is performed using a heterogeneous combination of Field Programmable Gate Array (FPGA) and a m...

  13. Estimating achievement from fame

    OpenAIRE

    Simkin, M. V.; Roychowdhury, V. P.

    2009-01-01

    We report a method for estimating people's achievement based on their fame. Earlier we discovered (cond-mat/0310049) that fame of fighter pilot aces (measured as number of Google hits) grows exponentially with their achievement (number of victories). We hypothesize that the same functional relation between achievement and fame holds for other professions. This allows us to estimate achievement for professions where an unquestionable and universally accepted measure of achievement does not exi...

  14. Differences in life-histories refute ecological equivalence of cryptic species and provide clues to the origin of bathyal Halomonhystera (Nematoda).

    Science.gov (United States)

    Van Campenhout, Jelle; Derycke, Sofie; Moens, Tom; Vanreusel, Ann

    2014-01-01

    The discovery of morphologically very similar but genetically distinct species complicates a proper understanding of the link between biodiversity and ecosystem functioning. Cryptic species have been frequently observed to co-occur and are thus expected to be ecological equivalent. The marine nematode Halomonhystera disjuncta contains five cryptic species (GD1-5) that co-occur in the Westerschelde estuary. In this study, we investigated the effect of three abiotic factors (salinity, temperature and sulphide) on life-history traits of three cryptic H. disjuncta species (GD1-3). Our results show that temperature had the most profound influence on all life-cycle parameters compared to a smaller effect of salinity. Life-history traits of closely related cryptic species were differentially affected by temperature, salinity and presence of sulphides which shows that cryptic H. disjuncta species are not ecologically equivalent. Our results further revealed that GD1 had the highest tolerance to a combination of sulphides, high salinities and low temperatures. The close phylogenetic position of GD1 to Halomonhystera hermesi, the dominant species in sulphidic sediments of the Håkon Mosby mud volcano (Barent Sea, 1280 m depth), indicates that both species share a recent common ancestor. Differential life-history responses to environmental changes among cryptic species may have crucial consequences for our perception on ecosystem functioning and coexistence of cryptic species.

  15. Differences in life-histories refute ecological equivalence of cryptic species and provide clues to the origin of bathyal Halomonhystera (Nematoda.

    Directory of Open Access Journals (Sweden)

    Jelle Van Campenhout

    Full Text Available The discovery of morphologically very similar but genetically distinct species complicates a proper understanding of the link between biodiversity and ecosystem functioning. Cryptic species have been frequently observed to co-occur and are thus expected to be ecological equivalent. The marine nematode Halomonhystera disjuncta contains five cryptic species (GD1-5 that co-occur in the Westerschelde estuary. In this study, we investigated the effect of three abiotic factors (salinity, temperature and sulphide on life-history traits of three cryptic H. disjuncta species (GD1-3. Our results show that temperature had the most profound influence on all life-cycle parameters compared to a smaller effect of salinity. Life-history traits of closely related cryptic species were differentially affected by temperature, salinity and presence of sulphides which shows that cryptic H. disjuncta species are not ecologically equivalent. Our results further revealed that GD1 had the highest tolerance to a combination of sulphides, high salinities and low temperatures. The close phylogenetic position of GD1 to Halomonhystera hermesi, the dominant species in sulphidic sediments of the Håkon Mosby mud volcano (Barent Sea, 1280 m depth, indicates that both species share a recent common ancestor. Differential life-history responses to environmental changes among cryptic species may have crucial consequences for our perception on ecosystem functioning and coexistence of cryptic species.

  16. 'Fram' in Color

    Science.gov (United States)

    2004-01-01

    [figure removed for brevity, see original site] Click on the image for 'Fram' in Color (QTVR) This view in approximately true color reveals details in an impact crater informally named 'Fram' in the Meridian Planum region of Mars. The picture is a mosaic of frames taken by the panoramic camera on NASA's Mars Exploration Rover Opportunity during the rover's 88th martian day on Mars, on April 23, 2004. The crater spans about 8 meters (26 feet) in diameter. Opportunity paused beside it while traveling from the rover's landing site toward a larger crater farther east. This view combines images taken using three of the camera's filters for different wavelengths of light: 750 nanometers, 530 nanometers and 430 nanometers.

  17. Watermarking on Colored Images

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The great success of internet and the ease of copying anddistributing the electronic data has presented a new challenge of how to protect the digital data. Digital watermarks have been proposed as a means for copyright protection of multimedia. Unlike the traditional visible watermark, the challenge here is to introduce a digital watermark that does not alter the quality of electronic content, while being extremely robust to attack. From the angle of signal processing, the two basic requirements for an effective watermarking scheme, robustness and transparency conflict with each other. So the digital watermark is information that is imperceptibly and robustly embedded in the host data such that it can not be removed without important degradation of images quality. This paper consists of two parts. In the first part, an authentication technique by embedding digital “watermarks” into colored images is proposed. In our approach, we embed the “watermarks” with visually recognizable patterns into the images by selectively modifying the middle-frequency coefficients of the image. In the second part, the technique of hiding a colored image into another colored one is proposed. The experimental results show that the proposed techniques successfully survive image processing operations, image cropping and the JPEG lossy compression.

  18. Coloring geographical threshold graphs

    Energy Technology Data Exchange (ETDEWEB)

    Bradonjic, Milan [Los Alamos National Laboratory; Percus, Allon [Los Alamos National Laboratory; Muller, Tobias [EINDHOVEN UNIV. OF TECH

    2008-01-01

    We propose a coloring algorithm for sparse random graphs generated by the geographical threshold graph (GTG) model, a generalization of random geometric graphs (RGG). In a GTG, nodes are distributed in a Euclidean space, and edges are assigned according to a threshold function involving the distance between nodes as well as randomly chosen node weights. The motivation for analyzing this model is that many real networks (e.g., wireless networks, the Internet, etc.) need to be studied by using a 'richer' stochastic model (which in this case includes both a distance between nodes and weights on the nodes). Here, we analyze the GTG coloring algorithm together with the graph's clique number, showing formally that in spite of the differences in structure between GTG and RGG, the asymptotic behavior of the chromatic number is identical: {chi}1n 1n n / 1n n (1 + {omicron}(1)). Finally, we consider the leading corrections to this expression, again using the coloring algorithm and clique number to provide bounds on the chromatic number. We show that the gap between the lower and upper bound is within C 1n n / (1n 1n n){sup 2}, and specify the constant C.

  19. Coloring and Guarding Arrangements

    CERN Document Server

    Bose, Prosenjit; Collette, Sébastien; Hurtado, Ferran; Korman, Matias; Langerman, Stefan; Taslakian, Perouz

    2012-01-01

    Given an arrangement of lines in the plane, what is the minimum number $c$ of colors required to color the lines so that no cell of the arrangement is monochromatic? In this paper we give bounds on the number c both for the above question, as well as some of its variations. We redefine these problems as geometric hypergraph coloring problems. If we define $\\Hlinecell$ as the hypergraph where vertices are lines and edges represent cells of the arrangement, the answer to the above question is equal to the chromatic number of this hypergraph. We prove that this chromatic number is between $\\Omega (\\log n / \\log\\log n)$. and $O(\\sqrt{n})$. Similarly, we give bounds on the minimum size of a subset $S$ of the intersections of the lines in $\\mathcal{A}$ such that every cell is bounded by at least one of the vertices in $S$. This may be seen as a problem on guarding cells with vertices when the lines act as obstacles. The problem can also be defined as the minimum vertex cover problem in the hypergraph $\\Hvertexcell$...

  20. Color on emergency mapping

    Science.gov (United States)

    Jiang, Lili; Qi, Qingwen; Zhang, An

    2007-06-01

    There are so many emergency issues in our daily life. Such as typhoons, tsunamis, earthquake, fires, floods, epidemics, etc. These emergencies made people lose their lives and their belongings. Every day, every hour, even every minute people probably face the emergency, so how to handle it and how to decrease its hurt are the matters people care most. If we can map it exactly before or after the emergencies; it will be helpful to the emergency researchers and people who live in the emergency place. So , through the emergency map, before emergency is occurring we can predict the situation, such as when and where the emergency will be happen; where people can refuge, etc. After disaster, we can also easily assess the lost, discuss the cause and make the lost less. The primary effect of mapping is offering information to the people who care about the emergency and the researcher who want to study it. Mapping allows the viewers to get a spatial sense of hazard. It can also provide the clues to study the relationship of the phenomenon in emergency. Color, as the basic element of the map, it can simplify and clarify the phenomenon. Color can also affects the general perceptibility of the map, and elicits subjective reactions to the map. It is to say, structure, readability, and the reader's psychological reactions can be affected by the use of color.

  1. Quasar Classification Using Color and Variability

    CERN Document Server

    Peters, Christina M; Myers, Adam D; Strauss, Michael A; Schmidt, Kasper B; Ivezić, Željko; Ross, Nicholas P; MacLeod, Chelsea L; Riegel, Ryan

    2015-01-01

    We conduct a pilot investigation to determine the optimal combination of color and variability information to identify quasars in current and future multi-epoch optical surveys. We use a Bayesian quasar selection algorithm (Richards et al. 2004) to identify 35,820 type 1 quasar candidates in a 239 square degree field of the Sloan Digital Sky Survey (SDSS) Stripe 82, using a combination of optical photometry and variability. Color analysis is performed on 5-band single- and multi-epoch SDSS optical photometry to a depth of r ~22.4. From these data, variability parameters are calculated by fitting the structure function of each object in each band with a power law model using 10 to >100 observations over timescales from ~1 day to ~8 years. Selection was based on a training sample of 13,221 spectroscopically-confirmed type-1 quasars, largely from the SDSS. Using variability alone, colors alone, and combining variability and colors we achieve 91%, 93%, and 97% quasar completeness and 98%, 98%, and 97% efficiency ...

  2. The infrared colors of the Sun

    CERN Document Server

    Casagrande, L; Melendez, J; Asplund, M

    2012-01-01

    Solar infrared colors provide powerful constraints on the stellar effective temperature scale, but to this purpose they must be measured with both accuracy and precision. We achieve this requirement by using line-depth ratios to derive in a model independent way the infrared colors of the Sun, and use the latter to test the zero-point of the Casagrande et al. (2010) effective temperature scale, confirming its accuracy. Solar colors in the widely used 2MASS -J H K- and WISE -W1 W2 W3 W4- systems are provided. A cross check of the effective temperatures derived implementing 2MASS or WISE magnitudes in the infrared flux method confirms that the absolute calibration of the two systems agree within the errors, possibly suggesting a 1% offset between the two, thus validating extant near and mid infrared absolute calibrations. While 2MASS magnitudes are usually well suited to derive effective temperatures, we find that a number of solar like stars exhibit anomalous WISE colors. In most cases this effect is spurious ...

  3. Skin Color Detection Using Region-Based Approach

    Directory of Open Access Journals (Sweden)

    Rudra PK Poudel

    2013-09-01

    Full Text Available Skin color provides a powerful cue for complex computer vision applications. Although skin color detection has been an active research area for decades, the mainstream technology is based on the individual pixels. This paper, which extended our previous work [1], presented a new region- based technique for skin color detection which outperformed the current state-of-the-art pixel- based skin color detection technique on the popular Compaq dataset [2]. Color and spatial distance based clustering technique is used to extract the regions from the images, also known as superpixels followed by a state-of-the-art non-parametric pixel-based skin color classifier called the basic skin color classifier. The pixel-based skin color evidence is then aggregated to classify the superpixels. Finally, the Conditional Random Field (CRF is applied to further improve the results. As CRF operates over superpixels, the computational overhead is minimal. Our technique achieved 91.17% true positive rate with 13.12% false negative rate on the Compaq dataset tested over approximately 14,000 web images.

  4. A color based face detection system using multiple templates

    Institute of Scientific and Technical Information of China (English)

    王涛; 卜佳酸; 陈纯

    2003-01-01

    A color based system using multiple templates was developed and implemented for detecting hu-man faces in color images.The algorithm comsists of three image processing steps.The first step is human skin color statistics.Then it separates skin regions from non-skin regions.After that,it locates the frontal human face(s) within the skin regions.In the first step,250 skin samples from persons of different ethnicities are used to determine the color distribution of human skin in chromatic color space in order to get a chroma chart showing likelihoods of skin colors.This chroma chart is used to generate,from the original color image,a gray scale image whose gray value at a pixel shows its likelihood of representing the shin,The algorithm uses an adaptive thresholding process to achieve the optimal threshold value for dividing the gray scale image into sep-arate skin regions from non skin regions.Finally,multiple face templates matching is used to determine if a given skin region represents a frontal human face or not.Test of the system with more than 400 color images showed that the resulting detection rate was 83%,which is better than most colou-based face detection sys-tems.The average speed for face detection is 0.8 second/image(400×300pixels) on a Pentium 3(800MHz) PC.

  5. Global biodiversity assessment and hyper-cryptic species complexes: more than one species of elephant in the room?

    Science.gov (United States)

    Adams, Mark; Raadik, Tarmo A; Burridge, Christopher P; Georges, Arthur

    2014-07-01

    Several recent estimates of global biodiversity have concluded that the total number of species on Earth lies near the lower end of the wide range touted in previous decades. However, none of these recent estimates formally explore the real "elephant in the room", namely, what proportion of species are taxonomically invisible to conventional assessments, and thus, as undiagnosed cryptic species, remain uncountable until revealed by multi-gene molecular assessments. Here we explore the significance and extent of so-called "hyper-cryptic" species complexes, using the Australian freshwater fish Galaxias olidus as a proxy for any organism whose taxonomy ought to be largely finalized when compared to those in little-studied or morphologically undifferentiated groups. Our comprehensive allozyme (838 fish for 54 putative loci), mtDNA (557 fish for 605 bp of cytb), and morphological (1963-3389 vouchers for 17-58 characters) assessment of this species across its broad geographic range revealed a 1500% increase in species-level biodiversity, and suggested that additional taxa may remain undiscovered. Importantly, while all 15 candidate species were morphologically diagnosable a posteriori from one another, single-gene DNA barcoding proved largely unsuccessful as an a priori method for species identification. These results lead us to draw two strong inferences of relevance to estimates of global biodiversity. First, hyper-cryptic complexes are likely to be common in many organismal groups. Second, no assessment of species numbers can be considered "best practice" in the molecular age unless it explicitly includes estimates of the extent of cryptic and hyper-cryptic biodiversity. [Galaxiidae; global estimates; hyper-diverse; mountain galaxias; species counts; species richness.]. PMID:24627185

  6. Color imaging fundamentals and applications

    CERN Document Server

    Reinhard, Erik; Oguz Akyuz, Ahmet; Johnson, Garrett

    2008-01-01

    This book provides the reader with an understanding of what color is, where color comes from, and how color can be used correctly in many different applications. The authors first treat the physics of light and its interaction with matter at the atomic level, so that the origins of color can be appreciated. The intimate relationship between energy levels, orbital states, and electromagnetic waves helps to explain why diamonds shimmer, rubies are red, and the feathers of the Blue Jay are blue. Then, color theory is explained from its origin to the current state of the art, including image captu

  7. On Dominator Colorings in Graphs

    Indian Academy of Sciences (India)

    S Arumugam; Jay Bagga; K Raja Chandrasekar

    2012-11-01

    A dominator coloring of a graph is a proper coloring of in which every vertex dominates every vertex of at least one color class. The minimum number of colors required for a dominator coloring of is called the dominator chromatic number of and is denoted by $ d(G)$. In this paper we present several results on graphs with $ d(G)=(G)$ and $ d(G)=(G)$ where $(G)$ and $(G)$ denote respectively the chromatic number and the domination number of a graph . We also prove that if $(G)$ is the Mycielskian of , then $ d(G)+1≤ d((G))≤ d(G)+2$.

  8. Cryptic species of hairworm parasites revealed by molecular data and crowdsourcing of specimen collections.

    Science.gov (United States)

    Hanelt, Ben; Schmidt-Rhaesa, Andreas; Bolek, Matthew G

    2015-01-01

    Recognizing cryptic species promotes a better understanding of biodiversity, systematics, evolutionary biology, and biogeography. When cryptic species are disease-causing organisms, such as parasites, their correct recognition has important implications for the study of epidemiology, disease ecology, and host-parasite relationships. Freshwater nematomorphs (Nematomorpha: Gordiida) or hairworms, are an enigmatic yet fascinating group of parasites that are known to manipulate host behavior to aid transition from the parasitic phase, within terrestrial insects, to the free-living aquatic stage. Hairworm taxonomy has been hampered by a paucity of informative diagnostic characters and it has long been suspected that this group contains numerous cryptic species. Study of single hairworm species over large geographical areas has been difficult due to extremely rare encounters and unreliable methods of collecting adult worms. Here we report that by using crowdsourcing, citizen scientists have collected and submitted samples of Gordius cf. robustus from throughout its range in North America making its genetic study possible. Combined with our own collections, we examined samples from 28 localities within the USA; despite the collection of numerous hairworms from Canada and Mexico, G. cf. robustus were not collected outside of the contiguous United States. Mitochondrial CO1 genetic distances revealed that specimens grouped into 8 clades separated by 8-24.3%. In addition, molecular evidence from mitochondrial (CO1 and cytB) and nuclear (partial 28S, ITS1, 5.8S and ITS2) DNA suggests that these 8 clades are distinct species and that this group of species is paraphyletic, since the North American species G. attoni and the European species G. aquaticus and G. balticus group among the G. robustus lineages. Furthermore, there was a significant correlation between genetic (CO1) and geographic distance between the 8 Gordius species. This study demonstrates the value of involving the

  9. High throughput sequencing in mice: a platform comparison identifies a preponderance of cryptic SNPs

    Directory of Open Access Journals (Sweden)

    Darakjian Priscila

    2009-08-01

    Full Text Available Abstract Background Allelic variation is the cornerstone of genetically determined differences in gene expression, gene product structure, physiology, and behavior. However, allelic variation, particularly cryptic (unknown or not annotated variation, is problematic for follow up analyses. Polymorphisms result in a high incidence of false positive and false negative results in hybridization based analyses and hinder the identification of the true variation underlying genetically determined differences in physiology and behavior. Given the proliferation of mouse genetic models (e.g., knockout models, selectively bred lines, heterogeneous stocks derived from standard inbred strains and wild mice and the wealth of gene expression microarray and phenotypic studies using genetic models, the impact of naturally-occurring polymorphisms on these data is critical. With the advent of next-generation, high-throughput sequencing, we are now in a position to determine to what extent polymorphisms are currently cryptic in such models and their impact on downstream analyses. Results We sequenced the two most commonly used inbred mouse strains, DBA/2J and C57BL/6J, across a region of chromosome 1 (171.6 – 174.6 megabases using two next generation high-throughput sequencing platforms: Applied Biosystems (SOLiD and Illumina (Genome Analyzer. Using the same templates on both platforms, we compared realignments and single nucleotide polymorphism (SNP detection with an 80 fold average read depth across platforms and samples. While public datasets currently annotate 4,527 SNPs between the two strains in this interval, thorough high-throughput sequencing identified a total of 11,824 SNPs in the interval, including 7,663 new SNPs. Furthermore, we confirmed 40 missense SNPs and discovered 36 new missense SNPs. Conclusion Comparisons utilizing even two of the best characterized mouse genetic models, DBA/2J and C57BL/6J, indicate that more than half of naturally

  10. A near-infrared spectroscopy routine for unambiguous identification of cryptic ant species.

    Science.gov (United States)

    Kinzner, Martin-Carl; Wagner, Herbert C; Peskoller, Andrea; Moder, Karl; Dowell, Floyd E; Arthofer, Wolfgang; Schlick-Steiner, Birgit C; Steiner, Florian M

    2015-01-01

    Species identification-of importance for most biological disciplines-is not always straightforward as cryptic species hamper traditional identification. Fibre-optic near-infrared spectroscopy (NIRS) is a rapid and inexpensive method of use in various applications, including the identification of species. Despite its efficiency, NIRS has never been tested on a group of more than two cryptic species, and a working routine is still missing. Hence, we tested if the four morphologically highly similar, but genetically distinct ant species Tetramorium alpestre, T. caespitum, T. impurum, and T. sp. B, all four co-occurring above 1,300 m above sea level in the Alps, can be identified unambiguously using NIRS. Furthermore, we evaluated which of our implementations of the three analysis approaches, partial least squares regression (PLS), artificial neural networks (ANN), and random forests (RF), is most efficient in species identification with our data set. We opted for a 100% classification certainty, i.e., a residual risk of misidentification of zero within the available data, at the cost of excluding specimens from identification. Additionally, we examined which strategy among our implementations, one-vs-all, i.e., one species compared with the pooled set of the remaining species, or binary-decision strategies, worked best with our data to reduce a multi-class system to a two-class system, as is necessary for PLS. Our NIRS identification routine, based on a 100% identification certainty, was successful with up to 66.7% of unambiguously identified specimens of a species. In detail, PLS scored best over all species (36.7% of specimens), while RF was much less effective (10.0%) and ANN failed completely (0.0%) with our data and our implementations of the analyses. Moreover, we showed that the one-vs-all strategy is the only acceptable option to reduce multi-class systems because of a minimum expenditure of time. We emphasise our classification routine using fibre-optic NIRS

  11. Please mind the gap - Visual census and cryptic biodiversity assessment at central Red Sea coral reefs.

    Science.gov (United States)

    Pearman, John K; Anlauf, Holger; Irigoien, Xabier; Carvalho, Susana

    2016-07-01

    Coral reefs harbor the most diverse assemblages in the ocean, however, a large proportion of the diversity is cryptic and, therefore, undetected by standard visual census techniques. Cryptic and exposed communities differ considerably in species composition and ecological function. This study compares three different coral reef assessment protocols: i) visual benthic reef surveys: ii) visual census of Autonomous Reef Monitoring Structures (ARMS) plates; and iii) metabarcoding techniques of the ARMS (including sessile, 106-500 μm and 500-2000 μm size fractions), that target the cryptic and exposed communities of three reefs in the central Red Sea. Visual census showed a dominance of Cnidaria (Anthozoa) and Rhodophyta on the reef substrate, while Porifera, Bryozoa and Rhodophyta were the most abundant groups on the ARMS plates. Metabarcoding, targeting the 18S rRNA gene, significantly increased estimates of the species diversity (p < 0.001); revealing that Annelida were generally the dominant phyla (in terms of reads) of all fractions and reefs. Furthermore, metabarcoding detected microbial eukaryotic groups such as Syndiniophyceae, Mamiellophyceae and Bacillariophyceae as relevant components of the sessile fraction. ANOSIM analysis showed that the three reef sites showed no differences based on the visual census data. Metabarcoding showed a higher sensitivity for identifying differences between reef communities at smaller geographic scales than standard visual census techniques as significant differences in the assemblages were observed amongst the reefs. Comparison of the techniques showed no similar patterns for the visual techniques while the metabarcoding of the ARMS showed similar patterns amongst fractions. Establishing ARMS as a standard tool in reef monitoring will not only advance our understanding of local processes and ecological community response to environmental changes, as different faunal components will provide complementary information but

  12. Structural Colors from Fano Resonances

    CERN Document Server

    Shen, Yichen; Wang, Imbert; Stelmakh, Veronika; Joannopoulos, John D; Soljacic, Marin

    2014-01-01

    Structural coloration is an interference phenomenon where colors emerge when visible light interacts with nanoscopically structured material, and has recently become a most interesting scientific and engineering topic. However, current structural color generation mechanisms either require thick (compared to the wavelength) structures or lack dynamic tunability. This report proposes a new structural color generation mechanism, that produces colors by the Fano resonance effect on thin photonic crystal slab. We experimentally realize the proposed idea by fabricating the samples that show resonance-induced colors with weak dependence on the viewing angle. Finally, we show that the resonance-induced colors can be dynamically tuned by stretching the photonic crystal slab fabricated on an elastic substrate.

  13. Color image and video enhancement

    CERN Document Server

    Lecca, Michela; Smolka, Bogdan

    2015-01-01

    This text covers state-of-the-art color image and video enhancement techniques. The book examines the multivariate nature of color image/video data as it pertains to contrast enhancement, color correction (equalization, harmonization, normalization, balancing, constancy, etc.), noise removal and smoothing. This book also discusses color and contrast enhancement in vision sensors and applications of image and video enhancement.   ·         Focuses on enhancement of color images/video ·         Addresses algorithms for enhancing color images and video ·         Presents coverage on super resolution, restoration, in painting, and colorization.

  14. Reasoning about color in Prolog

    Science.gov (United States)

    Batchelor, Bruce G.; Whelan, Paul F.

    1994-10-01

    The use of color as a basis for segmenting images is attractive for a wide variety of industrial inspection applications, especially in the manufacturing of domestic goods, food, pharmaceuticals, toiletries and electronics. Human beings define colors, not formulae, or computer programs. Moreover, no two people have an identical view of what a color set, such as 'canary yellow' is. The article argues that teaching by showing is more relevant than the accepted methods of Color Science, in the design of factory-floor vision systems. Fast hardware for color recognition has been available for several years but has not yet received universal acceptance. This article explains how this equipment can be used in conjunction with symbolic processing software, based on the Artificial Intelligence language Prolog. Using this hardware-software system, a programmer is able to express ideas about colors in a natural way. The concepts of color set union, intersection, generalization and interpolation are all discussed.

  15. Color metasurfaces in industrial perspective

    DEFF Research Database (Denmark)

    Højlund-Nielsen, Emil; Kristensen, Anders

    This doctoral thesis describes the utilization of color metasurfaces in an industrial perspective, where nano-scale textures and contingent post processing replace inks, dyes and pigments in plastic production. The concept of colors by structure arguably reduces the number of raw materials......, exemplified in silicon. However, only corresponding faint colors appear in polymeric materials. The concept of all-polymer pigment-free coloration seems somewhat restricted in relation to widespread industrial employment. Finally, a novel plasmon color technology for structural coloration in plastics......, and it is shown that the dependence on polarization can be controlled. In collaboration with industry, polymer-based colored metasurfaces of square-centimeter size are demonstrated by embossing, injection molding, roll-to-roll printing, and film insert molding with full compatibility. Furthermore, post production...

  16. Color standardization in whole slide imaging using a color calibration slide

    OpenAIRE

    Bautista, Pinky A.; Noriaki Hashimoto; Yukako Yagi

    2014-01-01

    Background: Color consistency in histology images is still an issue in digital pathology. Different imaging systems reproduced the colors of a histological slide differently. Materials and Methods: Color correction was implemented using the color information of the nine color patches of a color calibration slide. The inherent spectral colors of these patches along with their scanned colors were used to derive a color correction matrix whose coefficients were used to convert the pixels’ colors...

  17. A field guide to digital color

    CERN Document Server

    Stone, Maureen

    2013-01-01

    Maureen Stone's field guide to digital color presents a survey of digital color with special emphasis on those fields important for computer graphics. The book provides the foundation for understanding color and its applications, discusses color media and color management and the use of color in computer graphics, including color design and selection. The book provides a guide for anyone who wants to understand and apply digital color. An annotated bibliography provides in-depth references for further study on each topic.

  18. Determination of CRT color gamut boundaries in perceptual color space

    Science.gov (United States)

    Wang, Yong; Xu, Haisong

    2005-02-01

    CRT color gamut boundaries can be determined by two steps workflow. Firstly, the display should be calibrated with the method recommended by CIE to characterize the relationship between CIE tristimulus values and DAC values. The nonlinear relationship of each electronic channel between the color of the radiant output of CRT displays and the digital DAC values can be characterized accurately with GOG model using parameters of gain, offset, and gamma. Secondly, color gamut boundary can be determined using a fast and accurate algorithm. Generally, in a color space, any chosen degree of lightness will reduce that space to a plane. The color gamut on this equal-lightness plane can be transformed into RGB DAC value space. Since locations on the edges and surfaces of RGB DAC value space will correspond colors with relatively high saturation, the boundary of the curved surface in RGB DAC value space can be quickly computed for certain lightness. The accurate color gamut is obtained by mapping this boundary over to such a perceptual color space as CIELAB or CIELUV uniform color space. The key issue of this algorithm is to compute the equal-lightness curved surface in RGB DAC value space. The resolution of device gamut description depends on the number of segments that the lightness axis is separated into in the perceptual color space.

  19. Frequency of Color Vision Defect in Students of Mashhad Dental School and Evaluation of Related Factors

    Directory of Open Access Journals (Sweden)

    Mohammad Daryaeian

    Full Text Available Introduction: In esthetic dentistry, color matching ability is one of the influencing factors in treatment. To achieve this goal, matching the color of restoration with natural teeth is essential. The objective of this study was to determine the frequency of color vision defect in students of Mashhad Dental School and evaluation of related factors.Materials & Methods: In this descriptive analytical study, 356 students of Mashhad Dental School were evaluated. Demographic data including age, gender, color vision defect in relatives, use of glasses and contact lenses, refractive errors (myopia, hypermetropia and astigmatism were documented in the designed questionnaire. To determine the impaired color vision, Ishihara diagnostic test was used. Statistical analysis of SPSS version 19 was performed using Chi-Square and Logistic Regression tests at the significance level of 0.05%.Results: Color vision defect was found in 6% (12 persons of male students while none of the females were affected. All affected persons were red-green color blind and strong deutan. There was a significant relationship between color vision deficiency and history of color vision defect in relatives (P= 0.03, so that 25% (3 persons of affected persons had a positive family history of color vision defect. Conclusion: Considering the frequency of color vision defect in the present study as well as the importance of color matching in dental treatments and because most affected persons are unaware of this defect, color vision tests seem necessary.

  20. Early detection of cryptic memory and glucose uptake deficits in pre-pathological APP mice.

    Science.gov (United States)

    Beglopoulos, V; Tulloch, J; Roe, A D; Daumas, S; Ferrington, L; Watson, R; Fan, Z; Hyman, B T; Kelly, P A T; Bard, F; Morris, R G M

    2016-01-01

    Earlier diagnosis and treatment of Alzheimer's disease would greatly benefit from the identification of biomarkers at the prodromal stage. Using a prominent animal model of aspects of the disease, we here show using clinically relevant methodologies that very young, pre-pathological PDAPP mice, which overexpress mutant human amyloid precursor protein in the brain, exhibit two cryptic deficits that are normally undetected using standard methods of assessment. Despite learning a spatial memory task normally and displaying normal brain glucose uptake, they display faster forgetting after a long delay following performance to a criterion, together with a strong impairment of brain glucose uptake at the time of attempted memory retrieval. Preliminary observations suggest that these deficits, likely caused by an impairment in systems consolidation, could be rescued by immunotherapy with an anti-β-amyloid antibody. Our data suggest a biomarker strategy for the early detection of β-amyloid-related abnormalities. PMID:27249364

  1. Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera: Culicidae: Anopheles).

    Science.gov (United States)

    Wilkerson, R C; Parsons, T J; Albright, D G; Klein, T A; Braun, M J

    1993-01-01

    The usefulness of random amplified polymorphic DNA (RAPD) was examined as a potential tool to differentiate cryptic mosquito species. It proved to be a quick, effective means of finding genetic markers to separate two laboratory populations of morphologically indistinguishable African malaria vectors, Anopheles gambiae and An. arabiensis. In an initial screening of fifty-seven RAPD primers, 377 bands were produced, 295 of which differed between the two species. Based on criteria of interpretability, simplicity and reproducibility, thirteen primers were chosen for further screening using DNA from thirty individuals of each species. Seven primers produced diagnostic bands, five of which are described here. Some problematic characteristics of RAPD banding patterns are discussed and approaches to overcome these are suggested. PMID:8269099

  2. Detection of cryptic species of Rugopharynx (Nematoda: Strongylida) from the stomachs of Australian macropodid marsupials.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2016-08-01

    Sequences of the internal transcribed spacers of nuclear ribosomal DNA (ITS-1 and ITS-2) were determined for species of the genus Rugopharynx and Rugonema labiatum, nematodes from the stomachs of macropodid marsupials. Phylogenetic analyses of the aligned sequence data were conducted. The relationships provided molecular support for all species currently recognised, some of which are based on minor morphological differences and on multilocus enzyme electrophoretic data, but also indicated that additional, cryptic species exist within the genus. In addition, the genus Rugonema is placed as a synonym of Rugopharynx, its sole species becoming Rugopharynx labiatum n. comb. The molecular data provided some insights into the evolution of complex buccal capsule morphologies within the genus, but there was no evidence of co-evolution between the macropodid hosts and their parasites. PMID:27330983

  3. Cryptic PML-RARα positive acute promyelocytic leukemia with unusual morphology and cytogenetics

    Directory of Open Access Journals (Sweden)

    Goyal Manu

    2010-10-01

    Full Text Available Acute Promyelocytic Leukemia (APL is different from other forms of acute myeloid leukemia (AML, to the reason being the potential devastating coagulopathy and the sensitivity to all-trans retinoic acid (ATRA and arsenic trioxide (As 2 O 3 . We hereby present a case of APL, morphologically distinct from the hypergranular APL; however, the flow cytometry revealed a characteristic phenotype showing dim CD45, bright CD13, bright CD33 and dim CD117 positivity. These were negative for CD34, HLA-DR, B-lymphoid and T-lymphoid lineage markers. Conventional cytogenetics revealed a distinct karyotype of a male with translocation t(4;15(q34.2:q26.3. However, interphase florescence-in-situ hybridization (FISH revealed PML/RARA fusion signal on chromosome 15 in 90% cells. The cryptic translocations may be missed on conventional cytogenetics, however, need to be picked by other techniques as FISH.

  4. Pittosporum cryptic virus 1: genome sequence completion using next-generation sequencing.

    Science.gov (United States)

    Elbeaino, Toufic; Kubaa, Raied Abou; Tuzlali, Hasan Tuna; Digiaro, Michele

    2016-07-01

    Next-generation sequencing (NGS) was applied to dsRNAs extracted from an Italian pittosporum plant infected with pittosporum cryptic virus 1 (PiCV1). NGS allowed assembly of the full genome sequence of PiCV1, comprising dsRNA1 (1.9 kbp) and dsRNA2 (1.5 kbp), which encode the RNA-dependent RNA polymerase and capsid protein genes, respectively. Phylogenetic and sequence analyses confirmed that PiCV1 is a new member of the genus Deltapartitivirus, family Partiviridae. From the same plant, NSG also permitted assembly of the complete genome sequence of eggplant mottled dwarf virus (EMDV), which shared 86 % to 98 % nucleotide sequence identity with complete and partial sequences (ca 6750 nt) of other known EMDV isolates with sequences available in the GenBank database. PMID:27087112

  5. Epidermolytic palmoplantar keratoderma caused by activation of a cryptic splice site in KRT9.

    Science.gov (United States)

    Fuchs-Telem, D; Padalon-Brauch, G; Sarig, O; Sprecher, E

    2013-03-01

    Epidermolytic palmoplantar keratoderma (EPPK) is caused by mutations in KRT9 and less often, KRT1. All known mutations in KRT9 have been found in regions of the gene encoding the conserved central α-helix rod domain. In the present study, we investigated the molecular basis of EPPK in a patient of Ashkenazi Jewish origin. The patient was found to carry a novel missense mutation in KRT9, resulting in the substitution of a poorly conserved leucine for valine at position 11 of the amino acid sequence. Despite its unusual location, the mutation was shown to be pathogenic through activation of a cryptic donor splice site, resulting in the deletion of 162 amino acids. The present data indicate the need to screen keratin genes in their entirety, as mutations altering domains of lesser functional importance may exert their deleterious effect at the transcriptional level.

  6. Down syndrome consequent to a cryptic maternal 12p;21q chromosome translocation

    Energy Technology Data Exchange (ETDEWEB)

    Scott, J.A.; Wenger, S.L.; Chakravarti, A. [Univ. of Pittsburgh, PA (United States)] [and others

    1995-03-13

    A 9-year-old, mildly mentally retarded girl presented with phenotypic manifestations of Down syndrome. G-banded chromosomal analyses of peripheral blood lymphocytes from the patient and her parents, and skin fibroblasts from the patient, did not detect any abnormality. Molecular analysis of 15 highly polymorphic chromosome 21 dinucleotide repeat markers demonstrated a partial duplication of the Down syndrome critical region (D21S55, subband 21q22.2) of maternal origin in the patient. The segmental trisomy was confirmed by FISH analysis using the cosmid probe D21S55. Further analysis demonstrated that the trisomy was due to segregation of an apparently balanced cryptic translocation from the mother. The patient`s karyotype is 46,XX,-12,tder(12)t(12;21)(p13.1;q22.2)mat. 21 refs., 3 figs., 1 tab.

  7. Exploring the effect of asymmetric mitochondrial DNA introgression on estimating niche divergence in morphologically cryptic species.

    Directory of Open Access Journals (Sweden)

    Ben Wielstra

    Full Text Available If potential morphologically cryptic species, identified based on differentiated mitochondrial DNA, express ecological divergence, this increases support for their treatment as distinct species. However, mitochondrial DNA introgression hampers the correct estimation of ecological divergence. We test the hypothesis that estimated niche divergence differs when considering nuclear DNA composition or mitochondrial DNA type as representing the true species range. We use empirical data of two crested newt species (Amphibia: Triturus which possess introgressed mitochondrial DNA from a third species in part of their ranges. We analyze the data in environmental space by determining Fisher distances in a principal component analysis and in geographical space by determining geographical overlap of species distribution models. We find that under mtDNA guidance in one of the two study cases niche divergence is overestimated, whereas in the other it is underestimated. In the light of our results we discuss the role of estimated niche divergence in species delineation.

  8. A cryptic cytoplasmic male sterility unveils a possible gynodioecious past for Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Nicolas Gobron

    Full Text Available Gynodioecy, the coexistence of hermaphrodites and females (i.e. male-sterile plants in natural plant populations, most often results from polymorphism at genetic loci involved in a particular interaction between the nuclear and cytoplasmic genetic compartments (cytonuclear epistasis: cytoplasmic male sterility (CMS. Although CMS clearly contributes to the coevolution of involved nuclear loci and cytoplasmic genomes in gynodioecious species, the occurrence of CMS genetic factors in the absence of sexual polymorphism (cryptic CMS is not easily detected and rarely taken in consideration. We found cryptic CMS in the model plant Arabidopsis thaliana after crossing distantly related accessions, Sha and Mr-0. Male sterility resulted from an interaction between the Sha cytoplasm and two Mr-0 genomic regions located on chromosome 1 and chromosome 3. Additional accessions with either nuclear sterility maintainers or sterilizing cytoplasms were identified from crosses with either Sha or Mr-0. By comparing two very closely related cytoplasms with different male-sterility inducing abilities, we identified a novel mitochondrial ORF, named orf117Sha, that is most likely the sterilizing factor of the Sha cytoplasm. The presence of orf117Sha was investigated in worldwide natural accessions. It was found mainly associated with a single chlorotype in accessions belonging to a clade predominantly originating from Central Asia. More than one-third of accessions from this clade carried orf117Sha, indicating that the sterilizing-inducing cytoplasm had spread in this lineage. We also report the coexistence of the sterilizing cytoplasm with a non-sterilizing cytoplasm at a small, local scale in a natural population; in addition a correlation between cytotype and nuclear haplotype was detected in this population. Our results suggest that this CMS system induced sexual polymorphism in A. thaliana populations, at the time when the species was mainly outcrossing.

  9. Characterization of cryptic rearrangements, deletion, complex variants of PML, RARA in acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Pratibha Kadam Amare

    2011-01-01

    Full Text Available Acute promyelocytic leukemia (APL is characterized by a reciprocal translocation t(15;17(q22;q21 leading to the disruption of Promyelocytic leukemia (PML and Retionic Acid Receptor Alpha (RARA followed by reciprocal PML-RARA fusion in 90% of the cases. Fluorescence in situ hybridization (FISH has overcome the hurdles of unavailability of abnormal and/or lack of metaphase cells, and detection of cryptic, submicroscopic rearrangements. In the present study, besides diagnostic approach we sought to analyze these cases for identification and characterization of cryptic rearrangements, deletion variants and unknown RARA translocation variants by application of D-FISH and RARA break-apart probe strategy on interphase and metaphase cells in a large series of 200 cases of APL. Forty cases (20% had atypical PML-RARA and/or RARA variants. D-FISH with PML/RARA probe helped identification of RARA insertion to PML. By application of D-FISH on metaphase cells, we documented that translocation of 15 to 17 leads to 17q deletion which results in loss of reciprocal fusion and/or residual RARA on der(17. Among the complex variants of t(15;17, PML-RARA fusion followed by residual RARA insertion closed to PML-RARA on der(15 was unique and unusual. FISH with break-apart RARA probe on metaphase cells was found to be a very efficient strategy to detect unknown RARA variant translocations like t(11;17(q23;q21, t(11;17(q13;q21 and t(2;17(p21;q21. These findings proved that D-FISH and break-apart probe strategy has potential to detect primary as well as secondary additional aberrations of PML, RARA and other additional loci. The long-term clinical follow-up is essential to evaluate the clinical importance of these findings.

  10. Cryptic lineages and diversification of an endemic anole lizard (Squamata, Dactyloidae) of the Cerrado hotspot.

    Science.gov (United States)

    Guarnizo, Carlos E; Werneck, Fernanda P; Giugliano, Lilian G; Santos, Marcella G; Fenker, Jéssica; Sousa, Lucas; D'Angiolella, Annelise B; Dos Santos, Adriana R; Strüssmann, Christine; Rodrigues, Miguel T; Dorado-Rodrigues, Tainá F; Gamble, Tony; Colli, Guarino R

    2016-01-01

    The Cerrado is a wide Neotropical savanna with tremendously high endemic diversity. Yet, it is not clear what the prevalent processes leading to such diversification are. We used the Cerrado-endemic lizard Norops meridionalis to investigate the main abiotic factors that promoted genetic divergence, the timings of these divergence events, and how these relate to cryptic diversity in the group. We sequenced mitochondrial and nuclear genes from 21 sites of N. meridionalis to generate species tree, divergence time estimations, and estimate species limits. We also performed population-level analysis and estimated distribution models to test the roles of niche conservatism and divergence in the group diversification. We found that N. meridionalis is composed by at least five cryptic species. Divergence time estimations suggest that the deepest branches split back into the early-mid Miocene, when most of the geophysical activity of the Cerrado took place. The deep divergences found in N. meridionalis suggest that beta anoles invaded South America much earlier than previously thought. Recent published evidence supports this view, indicating that the Panama gap closed as early as 15 mya, allowing for an early invasion of Norops into South America. The spatial pattern of diversification within N. meridionalis follows a northwest-southeast direction, which is consistent across several species of vertebrates endemic to the Cerrado. Also, we found evidence for non-stationary isolation by distance, which occurs when genetic differentiation depends on space. Our preliminary data in two out of five lineages suggest that niche conservatism is an important mechanism that promoted geographic fragmentation in the group. PMID:26385121

  11. Cryptic genomic rearrangements in three patients with 46,XY disorders of sex development.

    Directory of Open Access Journals (Sweden)

    Maki Igarashi

    Full Text Available BACKGROUND: 46,XY disorders of sex development (46,XY DSD are genetically heterogeneous conditions. Recently, a few submicroscopic genomic rearrangements have been reported as novel genetic causes of 46,XY DSD. METHODOLOGY/PRINCIPAL FINDINGS: To clarify the role of cryptic rearrangements in the development of 46,XY DSD, we performed array-based comparative genomic hybridization analysis for 24 genetic males with genital abnormalities. Heterozygous submicroscopic deletions were identified in three cases (cases 1-3. A ∼8.5 Mb terminal deletion at 9p24.1-24.3 was detected in case 1 that presented with complete female-type external genitalia and mental retardation; a ∼2.0 Mb interstitial deletion at 20p13 was identified in case 2 with ambiguous external genitalia and short stature; and a ∼18.0 Mb interstitial deletion at 2q31.1-32 was found in case 3 with ambiguous external genitalia, mental retardation and multiple anomalies. The genital abnormalities of case 1 could be ascribed to gonadal dysgenesis caused by haploinsufficiency of DMRT1, while those of case 3 were possibly associated with perturbed organogenesis due to a deletion of the HOXD cluster. The deletion in case 2 affected 36 genes, none of which have been previously implicated in sex development. CONCLUSIONS/SIGNIFICANCE: The results indicate that cryptic genomic rearrangements constitute an important part of the molecular bases of 46,XY DSD and that submicroscopic deletions can lead to various types of 46,XY DSD that occur as components of contiguous gene deletion syndromes. Most importantly, our data provide a novel candidate locus for 46,XY DSD at 20p13.

  12. Deep mtDNA divergences indicate cryptic species in a fig-pollinating wasp

    Directory of Open Access Journals (Sweden)

    Martin Joanne

    2006-10-01

    Full Text Available Abstract Background Figs and fig-pollinating wasps are obligate mutualists that have coevolved for ca 90 million years. They have radiated together, but do not show strict cospeciation. In particular, it is now clear that many fig species host two wasp species, so there is more wasp speciation than fig speciation. However, little is known about how fig wasps speciate. Results We studied variation in 71 fig-pollinating wasps from across the large geographic range of Ficus rubiginosa in Australia. All wasps sampled belong to one morphological species (Pleistodontes imperialis, but we found four deep mtDNA clades that differed from each other by 9–17% nucleotides. As these genetic distances exceed those normally found within species and overlap those (10–26% found between morphologically distinct Pleistodontes species, they strongly suggest cryptic fig wasp species. mtDNA clade diversity declines from all four present in Northern Queensland to just one in Sydney, near the southern range limit. However, at most sites multiple clades coexist and can be found in the same tree or even the same fig fruit and there is no evidence for parallel sub-division of the host fig species. Both mtDNA data and sequences from two nuclear genes support the monophyly of the "P. imperialis complex" relative to other Pleistodontes species, suggesting that fig wasp divergence has occurred without any host plant shift. Wasps in clade 3 were infected by a single strain (W1 of Wolbachia bacteria, while those in other clades carried a double infection (W2+W3 of two other strains. Conclusion Our study indicates that cryptic fig-pollinating wasp species have developed on a single host plant species, without the involvement of host plant shifts, or parallel host plant divergence. Despite extensive evidence for coevolution between figs and fig wasps, wasp speciation may not always be linked strongly with fig speciation.

  13. Cryptic mosaicism involving a second chromosome X in patients with Turner syndrome

    Directory of Open Access Journals (Sweden)

    A. Araújo

    2008-05-01

    Full Text Available The high abortion rate of 45,X embryos indicates that patients with Turner syndrome and 45,X karyotype could be mosaics, in at least one phase of embryo development or cellular lineage, due to the need for the other sex chromosome presence for conceptus to be compatible with life. In cases of structural chromosomal aberrations or hidden mosaicism, conventional cytogenetic techniques can be ineffective and molecular investigation is indicated. Two hundred and fifty patients with Turner syndrome stigmata were studied and 36 who had female genitalia and had been cytogenetically diagnosed as having "pure" 45,X karyotype were selected after 100 metaphases were analyzed in order to exclude mosaicism and the presence of genomic Y-specific sequences (SRY, TSPY, and DAZ was excluded by PCR. Genomic DNA was extracted from peripheral blood and screened by the human androgen receptor (HUMARA assay. The HUMARA gene has a polymorphic CAG repeat and, in the presence of a second chromosome with a different HUMARA allele, a second band will be amplified by PCR. Additionally, the CAG repeats contain two methylation-sensitive HpaII enzyme restriction sites, which can be used to verify skewed inactivation. Twenty-five percent (9/36 of the cases showed a cryptic mosaicism involving a second X and approximately 14% (5/36, or 55% (5/9 of the patients with cryptic mosaicism, also presented skewed inactivation. The laboratory identification of the second X chromosome and its inactivation pattern are important for the clinical management (hormone replacement therapy, and inclusion in an oocyte donation program and prognostic counseling of patients with Turner syndrome.

  14. Testing for intraspecific postzygotic isolation between cryptic lineages of Pseudacris crucifer.

    Science.gov (United States)

    Stewart, Kathryn A; Lougheed, Stephen C

    2013-11-01

    Phenotypically cryptic lineages appear common in nature, yet little is known about the mechanisms that initiate and/or maintain barriers to gene flow, or how secondary contact between them might influence evolutionary trajectories. The consequences of such contact between diverging lineages depend on hybrid fitness, highlighting the potential for postzygotic isolating barriers to play a role in the origins of biological species. Previous research shows that two cryptic, deeply diverged intraspecific mitochondrial lineages of a North American chorus frog, the spring peeper (Pseudacris crucifer), meet in secondary contact in Southwestern Ontario, Canada. Our study quantified hatching success, tadpole survival, size at metamorphosis, and development time for experimentally generated pure lineage and hybrid tadpoles. Results suggest that lineages differ in tadpole survival and that F1 hybrids may have equal fitness and higher than average mass at metamorphosis compared with pure parental crosses. These findings imply hybrid early life viability may not be the pivotal reproductive isolation barrier helping to maintain lineage boundaries. However, we observed instances of tadpole gigantism, failure to metamorphose, and bent tails in some tadpoles from hybrid families. We also speculate and provide some evidence that apparent advantages or similarities of hybrids compared with pure lineage tadpoles may disappear when tadpoles are raised with competitors of different genetic makeup. This pilot study implies that ecological context and consideration of extrinsic factors may be a key to revealing mechanisms causing negative hybrid fitness during early life stages, a provocative avenue for future investigations on barriers to gene flow among these intraspecific lineages. PMID:24363891

  15. Familial cryptic translocation resulting in Angelman syndrome: Implications for imprinting or location of the Angelman gene?

    Energy Technology Data Exchange (ETDEWEB)

    Burke, L.W.; Wiley, J.E.; Smith, A.J.W.; Kushnick, T. [East Carolina Univ. School of Medicine, Greenville, NC (United States)] [and others

    1996-04-01

    Angelman syndrome (AS) is associated with a loss of maternal genetic information, which typically occurs as a result of a deletion at 15q11-q13 or paternal uniparental disomy of chromosome 15. We report a patient with AS as a result of an unbalanced cryptic translocation whose breakpoint, at 15q11.2, falls within this region. The proband was diagnosed clinically as having Angelman syndrome, but without a detectable cytogenetic deletion, by using high-resolution G-banding. FISH detected a deletion of D15S11 (IR4-3R), with an intact GABRB3 locus. Subsequent studies of the proband`s mother and sister detected a cryptic reciprocal translocation between chromosomes 14 and 15 with the breakpoint being between SNRPN and D15S10. The proband was found to have inherited an unbalanced form, being monosomic from 15pter through SNRPN and trisomic for 14pter to 14q11.2. DNA methylation studies showed that the proband had a paternal-only DNA methylation pattern at SNRPN, D15S63 (PW71), and ZNF127. The mother and unaffected sister, both having the balanced translocation, demonstrated normal DNA methylation patterns at all three loci. These data suggest that the gene for AS most likely lies proximal to D15S10, in contrast to the previously published position, although a less likely possibility is that the maternally inherited imprinting center acts in trans in the unaffected balanced translocation carrier sister. 27 refs., 6 figs.

  16. Habitat usage by the cryptic copepods Pseudocalanus moultoni and P. newmani on Georges Bank (Northwest Atlantic)

    Science.gov (United States)

    Bucklin, Ann; McGillicuddy, Dennis J.; Wiebe, Peter H.; Davis, Cabell S.

    2015-12-01

    The cryptic copepod species, Pseudocalanus moultoni and P. newmani, co-occur on Georges Bank and in the Gulf of Maine (Northwest Atlantic); even recent studies have reported results and conclusions based on examination of the combined species. Species-specific PCR (SS-PCR) based on mitochondrial cytochrome oxidase I (COI) sequence divergence was used in this study to discriminate the species. Species-specific descriptions of habitat usage and predicted patterns of transport and retention on Georges Bank were made by mapping distributions and calculating abundances of each species from January to June, 1999 for four vertical strata (0-15 m, 15-40 m, 40-100 m, and 0-100 m) and five regions (Northern Flank, Bank Crest, Northeast Peak, Southern Flank, and Slope Water) identified on the basis of bathymetry and circulation. Patterns of distribution and abundance for the two species during January to June, 1999 were largely consistent with those described based on vertically integrating mapping and analysis for the same period in 1997 by McGillicuddy and Bucklin (2002). The region-specific and depth-stratified analyses allowed further discrimination in habitat usage by the species and confirmed the distinctive patterns for the two species. The observed differences between the species in abundances among the five regions and three depth strata over Georges Bank impact their transport trajectories. The concentration of P. moultoni in deep layers likely explains the higher rates of retention and lower rates of advective loss of this species from the Bank, compared to P. newmani, which may be more subject to wind-driven transport in the surface layer. Accurate identification and discrimination of even closely-related and cryptic species is needed to ensure full understanding and realistic predictions of changes in diversity of zooplankton and the functioning of pelagic ecosystems.

  17. Prevalent Color Extraction and Indexing

    Directory of Open Access Journals (Sweden)

    K.K.Thyagharajan

    2014-01-01

    Full Text Available Colors in an image provides tremendous amount of information. Using this color information images can be segmented, analyzed, labeled and indexed. In content based image retrieval system, color is one of the basic primitive features used. In Prevalent Color Extraction and indexing, the most extensive color on an image is identified and it is used for indexing. For implementation, Asteroideae flower family image dataset is used. It consist of more than 16,000 species, among them nearly 100 species are considered and indexed by dominating colors. To extract the most appealable color from the user defined images, the overall color of an image has to be quantized. Spatially, quantizing the color of an image to extract the prevalent color is the major objective of this paper. A combination of K-Mean and Expectation Minimization clustering algorithm called hidden-value learned K-mean clustering quantization algorithm is used to avoid the over clustering behavior of K-Mean algorithm. The experimental result shows the marginal differences between these algorithms.

  18. Spatial processing in color reproduction

    Science.gov (United States)

    Liu, Li; Yang, Yongyi; Stark, Henry

    2005-08-01

    We consider the reproduction of color subject to material and neighborhood constraints. By 'material constraints,' we mean any constraints that are applied to the amount of ink, lights, voltages, and currents that are used in the generation of color. In the first instance we consider the problem of reproducing a target color constrained by maximum additive color signals, such as in the phosphorescence process in a cathode ray tube. In the second instance we consider the more difficult problem of reproducing color subject to constraints on the maximum primary color variations in a (spatial) neighborhood. We introduce the idea of adjacent color variance (ACV) and then attempt to reproduce colors subject to an upper bound on the ACV. An algorithm that is suitable for this task is the method of vector space projections (VSP). In order to use VSP for constrained color reproduction, we use a novel approach to linearize nonlinear CIE-Lab space constraints. Experimental results are furnished that demonstrate that using the ACV as a bound helps to reduce reproduction artifacts in a color image.

  19. 'Snow White' in Color

    Science.gov (United States)

    2008-01-01

    This color image taken by the Surface Stereo Imager on NASA's Phoenix Mars Lander shows the trench dubbed 'Snow White,' after further digging on the 25th Martian day, or sol, of the mission (June 19, 2008). The lander's solar panel is casting a shadow over a portion of the trench. The trench is about 5 centimeters (2 inches) deep and 30 centimeters (12 inches) long. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  20. Pseudogap of Color Superconductivity

    CERN Document Server

    Kitazawa, M; Kunihiro, T; Nemoto, Y; Kitazawa, Masakiyo; Koide, Tomoi; Kunihiro, Teiji; Nemoto, Yukio

    2004-01-01

    We show that the pseudogap of the quark density of states is formed in hot quark matter as a precursory phenomenon of the color superconductivity on the basis of a low-energy effective theory. We clarify that the soft mode of the di-quark pair field gives rise to a peculiar behavior of the quark dispersion relation and a short life-time of the quasiparticles near the Fermi surface, both of which make a depression of the density of states of quarks. Our result suggests that the appearance of the pseudogap is a universal phenomenon of strong coupling superconductors, irrespective of the dimensionality.

  1. "Color Revolutions" and Beyond

    Institute of Scientific and Technical Information of China (English)

    Ji Zhiye; Xu Tao; Jiang Li; Da Wei; Chen Xiangyang; Ding Xiaoxing

    2005-01-01

    @@ Astring of media-coined "color revolutions" broke out in Georgia, Ukraine and Kirgyzstan one after another inside the Commonwealth of Independent States since October 2003,reminiscent of the drama of collapse of the former Soviet bloc at the turn of the 1990s. Why those upheavals came hot on the heels of the Soviet disintegration merely a dozen or so years ago? Are we expecting more Domino effects down the road? What geographical repercussions will they spark? We have invited some experts over from the China Institutes of Contemporary International Relations to air their views on these interesting issues.

  2. Color measurement of methylene blue dye/clay mixtures and its application using economical methods

    Science.gov (United States)

    Milosevic, Maja; Kaludjerovic, Lazar; Logar, Mihovil

    2016-04-01

    Identifying the clay mineral components of clay materials by staining tests is rapid and simple, but their applicability is restricted because of the mutual interference of the common components of clay materials and difficulties in color determination. The change of color with concentration of the dye is related to the use of colorants as a field test for identifying clay minerals and has been improved over the years to assure the accuracy of the tests (Faust G. T., 1940). The problem of measurement and standardization of color may be solved by combination of colors observed in staining tests with prepared charts of color chips available in the Munsell Book of Color, published by Munsell Color Co. Under a particular set of illumination conditions, a human eye can achieve an approximate match between the color of the dyed clay sample and that of a standard color chip, even though they do have different spectral reflectance characteristics. Experiments were carried out with diffuse reflectance spectroscopy on selected clay samples (three montmorillonite, three kaolinite and one mix-layer clay samples) saturated with different concentration of methylene blue dye solution. Dominant wavelength and purity of the color was obtained on oriented dry samples and calculated by use of the I. C. I. (x, y) - diagram in the region of 400-700 nm (reflectance spectra) without MB and after saturation with different concentrations of MB solutions. Samples were carefully photographed in the natural light environment and processed with user friendly and easily accessible applications (Adobe color CC and ColorHexa encyclopedia) available for android phones or tablets. Obtained colors were compared with Munsell standard color chips, RGB and Hexa color standards. Changes in the color of clay samples in their interaction with different concentration of the applied dye together with application of economical methods can still be used as a rapid fieldwork test. Different types of clay

  3. Edge detection of color images using the HSL color space

    Science.gov (United States)

    Weeks, Arthur R.; Felix, Carlos E.; Myler, Harley R.

    1995-03-01

    Various edge detectors have been proposed as well as several different types of adaptive edge detectors, but the performance of many of these edge detectors depends on the features and the noise present in the grayscale image. Attempts have been made to extend edge detection to color images by applying grayscale edge detection methods to each of the individual red, blue, and green color components as well as to the hue, saturation, and intensity color components of the color image. The modulus 2(pi) nature of the hue color component makes its detection difficult. For example, a hue of 0 and 2(pi) yields the same color tint. Normal edge detection of a color image containing adjacent pixels with hue of 0 and 2(pi) could yield the presence of an edge when an edge is really not present. This paper presents a method of mapping the 2(pi) modulus hue space to a linear space enabling the edge detection of the hue color component using the Sobel edge detector. The results of this algorithm are compared against the edge detection methods using the red, blue, and green color components. By combining the hue edge image with the intensity and saturation edge images, more edge information is observed.

  4. Genetic diversity in two introduced biofouling amphipods (Amphipods valida and Jassa marmorata) along the Pacific North American coast: investigation into molecular identification and cryptic diversity

    Science.gov (United States)

    We investigated patterns of genetic diversity among invasive populations of A. valida and J. marmorata from the Pacific North American coast to assess the accuracy of morphological identification and determine whether or not cryptic diversity and multiple introductions contribute...

  5. Boundary emphasis transfer function generation based on HSL color space

    Science.gov (United States)

    Li, Xiao; Wu, Jianhuang; Luo, Shengzhou; Ma, Xin

    2011-10-01

    Direct volume rendering has been received much attention since it need not to extract geometric primitives for visualization and its performance is generally better than surface rendering. Transfer functions, which are used for mapping scalar field to optical properties, are of vital importance in obtaining a sensible rendering result from volume data. Though traditional color transfer functions are in RGB color space, HSL color space that conveys semantic meanings is more intuitive and user-friendly. In this paper, we present a novel approach aims to emphasize and distinguish strong boundaries between different materials. We achieve it by using data value, gradient magnitude and dimension of the volumetric data to set opacity. Then, through a linear map from data value, gradient magnitude and second derivative to hue, saturation and lightness respectively, a color transfer function is obtained in HSL color space. Experimental tests on real-world datasets indicate that our method could achieve desirable rendering results with revealing important boundaries between different structures and indicating data value's distribution in the volume by using different colors.

  6. Estimating the colors of paintings

    OpenAIRE

    Nascimento, Sérgio M. C.; Linhares, João M. M.; João, Catarina A. R.; Amano, Kinjiro; Montagner, Cristina; Melo, Maria J.; Vilarigues, Marcia

    2015-01-01

    Observers can adjust the spectrum of illumination on paintings for optimal viewing experience. But can they adjust the colors of paintings for the best visual impression? In an experiment carried out on a calibrated color moni- tor images of four abstract paintings obtained from hyperspectral data were shown to observers that were unfamiliar with the paintings. The color volume of the images could be manipulated by rotating the volume around the axis through the average (a*, b*) point for eac...

  7. Bosonic colored group field theory

    Energy Technology Data Exchange (ETDEWEB)

    Ben Geloun, Joseph [Universite Paris XI, Laboratoire de Physique Theorique, Orsay Cedex (France); University of Abomey-Calavi, Cotonou (BJ). International Chair in Mathematical Physics and Applications (ICMPA-UNESCO Chair); Universite Cheikh Anta Diop, Departement de Mathematiques et Informatique, Faculte des Sciences et Techniques, Dakar (Senegal); Magnen, Jacques [Ecole Polytechnique, Centre de Physique Theorique, Palaiseau Cedex (France); Rivasseau, Vincent [Universite Paris XI, Laboratoire de Physique Theorique, Orsay Cedex (France)

    2010-12-15

    Bosonic colored group field theory is considered. Focusing first on dimension four, namely the colored Ooguri group field model, the main properties of Feynman graphs are studied. This leads to a theorem on optimal perturbative bounds of Feynman amplitudes in the ''ultraspin'' (large spin) limit. The results are generalized in any dimension. Finally, integrating out two colors we write a new representation, which could be useful for the constructive analysis of this type of models. (orig.)

  8. Color Strategies for Image Databases

    OpenAIRE

    Süsstrunk, Sabine

    2001-01-01

    In this paper, color encoding strategies for different image database applications are discussed. The color image workflow is examined in detail, and master and derivative file encoding strategies are outlined in relation to capture, maintenance, and deployment of image files. For the most common image database purposes, recommendations are given as to which type of color encoding is most suitable. Advantages and disadvantages of sensor, input-referred, output-referred, and output device spec...

  9. Color in context: psychological context moderates the influence of red on approach- and avoidance-motivated behavior.

    OpenAIRE

    Brian P Meier; Paul R D'Agostino; Elliot, Andrew J.; Maier, Markus A.; Wilkowski, Benjamin M.

    2012-01-01

    BACKGROUND: A basic premise of the recently proffered color-in-context model is that the influence of color on psychological functioning varies as a function of the psychological context in which color is perceived. Some research has examined the appetitive and aversive implications of viewing the color red in romance- and achievement-relevant contexts, respectively, but in all existing empirical work approach and avoidance behavior has been studied in separate tasks and separate experiments....

  10. Color tunable LED spot lighting

    Science.gov (United States)

    Hoelen, C.; Ansems, J.; Deurenberg, P.; van Duijneveldt, W.; Peeters, M.; Steenbruggen, G.; Treurniet, T.; Valster, A.; ter Weeme, J. W.

    2006-08-01

    A new trend in illumination is to use dynamic light to set or dynamically vary the ambience of a room or office. For this we need color tunable spots that can reliably vary over at least a wide range of color temperatures, and preferably also more saturated colors. LEDs are in principle ideally suited for this application thanks to their nature of emitting light in a relatively narrow band. For color tunable spot lighting based on the concept of mixing RGB LED colors, the key results have been presented before. Limitations of these 3-intrinsic-color mixing systems with high color rendering properties are found in a limited operating temperature range due to wavelength shifts, a limited color temperature range, and a low maximum operating temperature due to a strong flux decrease with increasing temperature. To overcome these limitations, a 3-color R pcGB system with phosphor-converted red (R pc) and a 4-color RAGB system have been investigated. With both systems, a CRI of at least 80 can be maintained over the relevant color temperature range of approximately 2700 K to 6500 K. In this paper we compare these concepts on overall system aspects and report on the performance of prototype spot lamps. The main features of the RAGB and R pcGB spot lamp concepts can be summarized as: 1) The RAGB spot overcomes CRI and gamut shortcomings of RGB light sources and gives much freedom in wavelength selection, but suffers from temperature sensitivity and complex controls; 2) The R pcGB spot overcomes shortcomings concerning CRI and thermal dependence of RGB sources and enables relatively simple controls, but needs an improved overall red efficacy. With both color concepts, prototype spot lamps have been built. The amber to red emitting nitridosilicate-based phosphors can be wavelength-tuned for optimal performance, which is found at a peak emission around 610 nm for high color quality systems. This results in a simple and very robust system with good color consistency. For the

  11. Color and the worldwide web

    Science.gov (United States)

    Kinlock, Raymond S.

    2002-06-01

    Guidelines to publishing and transmitting color via the Internet. An introduction to how individuals can cope with color issues using off the shelf package solutions and a glimpse to what there is on the development frontier. Topics to be discussed include: (1) Optimizing your files for transfer via the net with an off the shelf software package. (2) Embedded color management packages in some off the shelf packages. (3) Mac and Window differences. (4) A look at compression pros and cons. (5) An introduction to some of the high end color calibration systems and equipment.

  12. A nuclear single-nucleotide polymorphism (SNP) potentially useful for the separation of Rhodnius prolixus from members of the Rhodnius robustus cryptic species complex (Hemiptera: Reduviidae)

    Science.gov (United States)

    Pavan, Márcio G.; Mesquita, Rafael D.; Lawrence, Gena G.; Lazoski, Cristiano; Dotson, Ellen M.; Abubucker, Sahar; Mitreva, Makedonka; Randall-Maher, Jennifer; Monteiro, Fernando A.

    2013-01-01

    The design and application of rational strategies that rely on accurate species identification are pivotal for effective vector control. When morphological identification of the target vector species is impractical, the use of molecular markers is required. Here we describe a non-coding, single-copy nuclear DNA fragment that contains a single-nucleotide polymorphism (SNP) with the potential to distinguish the important domestic Chagas disease vector, Rhodnius prolixus, from members of the four sylvatic Rhodnius robustus cryptic species complex. A total of 96 primer pairs obtained from whole genome shotgun sequencing of the R. prolixus genome (12,626 random reads) were tested on 43 R. prolixus and R. robustus s.l. samples. One of the seven amplicons selected (AmpG) presented a SNP, potentially diagnostic for R. prolixus, on the 280th site. The diagnostic nature of this SNP was then performed on 154 R. prolixus and R. robustus s.l. samples aimed at achieving the widest possible geographic coverage. The results of a 60% majority rule Bayesian consensus tree and a median-joining network constructed based on the genetic variability observed reveal the paraphyletic nature of the R. robustus species complex, with respect to R. prolixus. AmpG region is located in the fourth intron of the Transmembrane protein 165 gene, which seems to be in the R. prolixus X chromosome. Other possible chromosomal locations of the AmpG region in the R. prolixus genome are also presented and discussed. PMID:23219914

  13. Cryptic species composition and genetic diversity within Bemisia tabaci complex in soybean in India revealed by mtCOI DNA sequence

    Institute of Scientific and Technical Information of China (English)

    Prasanna H C[1; Kanakala S[2; Archana K[2; Jvothsna p[2; Varma R K[3; Malathi V G[2

    2015-01-01

    Bemisia tabaci is a cryptic species complex, causing signifi(:ant loss on many agriculturally important crops worldwide. Knowledge on species composition and diversity within B. tabaci complex is critical for evolving sustainable pest management strategies. Here we investigate the whitefly species complex in soybean in major soybean growing states of India. The mitochondrial cytochrome oxidase gene subunit-1 (mtCOI) based phylogenetic relationships established using Bayesian methods indicated the existence of three cryptic species namely Asia I, Asia II 1, and Asia II 7. All the haplotypes detected in the study could be assigned to these three cryptic species following the species demarcation criteria of 3.5% divergence threshold. Of these, Asia II 1 was found to be predominant with wide spread distribution across the surveyed regions from cool temperate zones to hot and humid tropical plains. On the contrary, cryptic species Asia II 7 showed localized distribu- tion. The Asia II 1 exhibited the highest haplotype diversity and Asia I showed high level of nucleotide diversity. There was a significantly high genetic differentiation among these three cryptic species. The MEAM 1, a dreadful invasive species was not detected in the specimens tested in the current study. The diversity and distribution of three cryptic species is discussed in the light of current knowledge on distribution of whitefly species in India and yellow mosaic disease observed during sampling survey.

  14. Optimization of sharp and viewing-angle-independent structural color

    CERN Document Server

    Hsu, Chia Wei; Johnson, Steven G; Soljačić, Marin

    2014-01-01

    Structural coloration produces some of the most brilliant colors in nature and has many applications. However, sharp color (narrow frequency response) and wide viewing angle (broad angular response) are competing properties and have not been achieved simultaneously in previous studies. Here, we use numerical optimization to discover geometries where the structural color is sharp, yet the hue, saturation, and brightness all remain the same over broad viewing angles (0-90$^\\circ$) under directional illumination. Our model system consists of dipole scatterers arranged into several rings; interference among the scattered waves is optimized to yield the wavelength-selective and angle-insensitive response. Such designs can be useful for display, painting, and biosensing applications.

  15. Experimental color encryption in a joint transform correlator architecture

    International Nuclear Information System (INIS)

    We present an experimental color image encryption by using a photorefractive crystal and a joint transform correlator (JTC) architecture. We achieve the color storing by changing the illumination wavelength. One JTC aperture has the input image information corresponding to a determined color channel bonded to a random phase mask (object aperture), and the other JTC aperture contains the key code mask. The joint power spectrum is stored in a photorefractive crystal. Each color data is stored as a modulation of birefringence in this photosensitive medium. The adequate wavelength change produces a corresponding power spectrum modification that avoids image encryption cross talk in the read out step. An analysis in terms of the sensitivity of the photorefractive silenite crystal for different recording wavelengths is carried out. It should be highlighted that the multiplexed power spectrum shows neither the multiplexing operation nor the amount of stored information increasing the system security. We present experimental results that support our approach

  16. Resource Letter CCV-1: Color and Color Vision.

    Science.gov (United States)

    Stuewer, Roger H., Ed.; Pease, Paul L.

    1980-01-01

    Listed are selected resource materials on color vision and the measurement and specification of the stimulus for vision, photometry, and colorimetry. The author's purpose is to equip teachers and students with an understanding of normal and abnormal color vision. References are categorized relative to content level. (Author/DS)

  17. Color the night : applying daytime colors to nighttime imagery

    NARCIS (Netherlands)

    Toet, A.

    2003-01-01

    We present a method to give (fused) multiband night-time imagery a natural day-time color appearance. For input, the method requires a false color RGB image that is produced by mapping 3 individual bands (or the first 3 principal components) of a multiband nightvision system to the respective channe

  18. Adding Texture to Color: Quantitative Analysis of Color Emotions

    NARCIS (Netherlands)

    M.P. Lucassen; T. Gevers; A. Gijsenij

    2010-01-01

    What happens to color emotion responses when texture is added to color samples? To quantify this we performed an experiment in which subjects ordered samples (displayed on a computer monitor) along four scales: Warm-Cool, Masculine-Feminine, Hard-Soft and Heavy-Light. Three sample types were used: u

  19. Colorful solar selective absorber integrated with different colored units.

    Science.gov (United States)

    Chen, Feiliang; Wang, Shao-Wei; Liu, Xingxing; Ji, Ruonan; Li, Zhifeng; Chen, Xiaoshuang; Chen, Yuwei; Lu, Wei

    2016-01-25

    Solar selective absorbers are the core part for solar thermal technologies such as solar water heaters, concentrated solar power, solar thermoelectric generators and solar thermophotovoltaics. Colorful solar selective absorber can provide new freedom and flexibility beyond energy performance, which will lead to wider utilization of solar technologies. In this work, we present a monolithic integration of colored solar absorber array with different colors on a single substrate based on a multilayered structure of Cu/TiN(x)O(y)/TiO(2)/Si(3)N(4)/SiO(2). A colored solar absorber array with 16 color units is demonstrated experimentally by using combinatorial deposition technique via changing the thickness of SiO(2) layer. The solar absorptivity and thermal emissivity of all the color units is higher than 92% and lower than 5.5%, respectively. The colored solar selective absorber array can have colorful appearance and designable patterns while keeping high energy performance at the same time. It is a new candidate for a number of solar applications, especially for architecture integration and military camouflage. PMID:26832602

  20. Alice Walker's Womanism Colored in The Color Purple

    Institute of Scientific and Technical Information of China (English)

    蒋慧慧

    2009-01-01

    In her famous novel The Color Purple,Alice Walker's womanism is colored by four kinds of conseiousness-female consciousness,racial consciousness,root-seeking consciousness,and universal consciousness.It is owing to the womanism that the heroine celie grown from an abused woman to an independent selfhood.

  1. COLORING PROPERTIES OF WOOL FABRIC COLORED BY NEW DYESTUFFS - AZOMETHINES

    Directory of Open Access Journals (Sweden)

    DJORDJEVIC Dragan

    2016-05-01

    Full Text Available The azomethines have broad applications in food and dyestuff industries, and in analytical chemistry, catalysis and also in the field of agrochemical. These have played an influential part in the improvement of modern coordination chemistry, but also they can also be found at key points in the development of inorganic biochemistry, catalysis and also in optical materials. The present paper describes coloring properties of wool fabric colored by new dyestuffs - azomethines, derivate of isatin. Synthesizing of dyestuffs can often have one to six chromogen, which can be defined as the photoactive components that contain colored or uncolored absorbent components. In addition of monoazo, diazo, poly-azo, anthraquinone, xanthan and similar systems, the azomethines or imines, also includes to the chromogen groups. Azomethines, such as, isatin-3-hydrazone, isatin-3-thiosemicarbazone and isatin-3-phenylhydrazone, were synthesized and their coloring performance on wool fabric assessed. The synthesized azomethines showed very good substantively for wool fibers with good coloring performance according to CIEL*a*b* system which characterized quantitative and qualitative coloring property. Dyestuff 3 or isatin-3-phenylhydrazone bound to woolen textiles to a greater extent and greater intensity (minimum value of L. Dyestuff 2 or isatin-3-thiosemicarbazone linked to the minimum amount for textiles (the largest value of L. Although it must be noted that it is a lighter shade (yellow color as opposed to the dyestuff 3 (red color.

  2. Spectral broadening of Cu–In–Zn–S quantum dot color converters for high color rendering white lighting device

    International Nuclear Information System (INIS)

    We report the synthesis of quaternay Cu–In–Zn–S (CIZS) core/ZnS shell quantum dots (QDs) that possess the emission wavelengths suitable as color converters for white light-emitting diode (LED) fabrication. For the demonstration of high color rendering white QD-LEDs enabled by a more complete white spectral coverage, the synthetic effort on CIZS QDs exhibiting the photoluminescence (PL) as broad as possible is made. The amount of 1-dodecanethiol (DDT) used in CIZS core synthesis is found to critically affect the spectral shape and consequent bandwidth of QD emission. The QD PL is systematically, progressively broadened with increasing DDT amount, achieving an unprecedented bandwidth up to ~240 nm. The CIZS/ZnS QDs that are synthesized with different DDT amounts are indiviually tested as color converters for the fabrication of white QD-LEDs and thier performance is compared. The resulting devices exhibit color rendering index (CRI) values in the range of 74–95, depending on CIZS/ZnS QDs used. This exceptional CRI of 95 is a record quantitiy obtainable by use of a single QD color converter. - Highlights: • Emission of quaternay CIZS/ZnS QDs was systematically broadened. • CIZS/ZnS QD color converters were utilized for white QD-LED fabrication. • An exceptionally high CRI of 95 was obtainable by use of a single QD color converter

  3. Spectral broadening of Cu–In–Zn–S quantum dot color converters for high color rendering white lighting device

    Energy Technology Data Exchange (ETDEWEB)

    Jo, Dae-Yeon; Yang, Heesun, E-mail: hyang@hongik.ac.kr

    2015-10-15

    We report the synthesis of quaternay Cu–In–Zn–S (CIZS) core/ZnS shell quantum dots (QDs) that possess the emission wavelengths suitable as color converters for white light-emitting diode (LED) fabrication. For the demonstration of high color rendering white QD-LEDs enabled by a more complete white spectral coverage, the synthetic effort on CIZS QDs exhibiting the photoluminescence (PL) as broad as possible is made. The amount of 1-dodecanethiol (DDT) used in CIZS core synthesis is found to critically affect the spectral shape and consequent bandwidth of QD emission. The QD PL is systematically, progressively broadened with increasing DDT amount, achieving an unprecedented bandwidth up to ~240 nm. The CIZS/ZnS QDs that are synthesized with different DDT amounts are indiviually tested as color converters for the fabrication of white QD-LEDs and thier performance is compared. The resulting devices exhibit color rendering index (CRI) values in the range of 74–95, depending on CIZS/ZnS QDs used. This exceptional CRI of 95 is a record quantitiy obtainable by use of a single QD color converter. - Highlights: • Emission of quaternay CIZS/ZnS QDs was systematically broadened. • CIZS/ZnS QD color converters were utilized for white QD-LED fabrication. • An exceptionally high CRI of 95 was obtainable by use of a single QD color converter.

  4. Hidden Diversity in Sardines: Genetic and Morphological Evidence for Cryptic Species in the Goldstripe Sardinella, Sardinella gibbosa (Bleeker, 1849)

    Science.gov (United States)

    Thomas, Rey C.; Willette, Demian A.; Carpenter, Kent E.; Santos, Mudjekeewis D.

    2014-01-01

    Cryptic species continue to be uncovered in many fish taxa, posing challenges for fisheries conservation and management. In Sardinella gibbosa, previous investigations revealed subtle intra-species variations, resulting in numerous synonyms and a controversial taxonomy for this sardine. Here, we tested for cryptic diversity within S. gibbosa using genetic data from two mitochondrial and one nuclear gene regions of 248 individuals of S. gibbosa, collected from eight locations across the Philippine archipelago. Deep genetic divergence and subsequent clustering was consistent across both mitochondrial and nuclear markers. Clade distribution is geographically limited: Clade 1 is widely distributed in the central Philippines, while Clade 2 is limited to the northernmost sampling site. In addition, morphometric analyses revealed a unique head shape that characterized each genetic clade. Hence, both genetic and morphological evidence strongly suggests a hidden diversity within this common and commercially-important sardine. PMID:24416271

  5. Hidden diversity in sardines: genetic and morphological evidence for cryptic species in the goldstripe sardinella, Sardinella gibbosa (Bleeker, 1849.

    Directory of Open Access Journals (Sweden)

    Rey C Thomas

    Full Text Available Cryptic species continue to be uncovered in many fish taxa, posing challenges for fisheries conservation and management. In Sardinella gibbosa, previous investigations revealed subtle intra-species variations, resulting in numerous synonyms and a controversial taxonomy for this sardine. Here, we tested for cryptic diversity within S. gibbosa using genetic data from two mitochondrial and one nuclear gene regions of 248 individuals of S. gibbosa, collected from eight locations across the Philippine archipelago. Deep genetic divergence and subsequent clustering was consistent across both mitochondrial and nuclear markers. Clade distribution is geographically limited: Clade 1 is widely distributed in the central Philippines, while Clade 2 is limited to the northernmost sampling site. In addition, morphometric analyses revealed a unique head shape that characterized each genetic clade. Hence, both genetic and morphological evidence strongly suggests a hidden diversity within this common and commercially-important sardine.

  6. Color-color Relations for Red Giants in Star Clusters

    CERN Document Server

    Von Braun, K; Minske, J K; Salgado, J F J; Worthey, G; Braun, Kaspar von; Chiboucas, Kristin; Minske, Jocelyn Kelly; Salgado, Jose Francisco; Worthey, Guy

    1998-01-01

    New Johnson-Cousins UBVRI photometry of giants in globular clusters is combined with JHK photometry on the CIT system to produce color sequences for giants from the globular clusters M3, M5, M13, and M92. UBVRI data are also presented for giants in the metal-rich open cluster NGC 6791. These data fill a gap in the literature, especially for the R & I bands. We provide the empirical relations between broad band colors for various [Fe/H] values for metal-poor giants. The color sequences for U-B and B-V show clear separations for different [Fe/H] values. We also find weak, though unexpected, metallicity dependences of V-R, V-I, and J-K colors. H-K is metal-insensitive. The above colors are plotted as a function of V-K, and a literature (V-K) - T_{eff} relation is given.

  7. Color of turbulence

    CERN Document Server

    Zare, Armin; Georgiou, Tryphon T

    2016-01-01

    Second-order statistics of turbulent flows can be obtained either experimentally or via direct numerical simulations. Statistics reflect fundamentals of flow physics and can be used to develop low-complexity turbulence models. Due to experimental or numerical limitations it is often the case that only partial flow statistics can be reliably known, i.e., only certain correlations between a limited number of flow field components are available. Thus, it is of interest to complete the statistical signature of the flow field in a way that is consistent with the known dynamics. This is an inverse problem and our approach utilizes stochastically-forced linearization around turbulent mean velocity profile. In general, white-in-time stochastic forcing is not sufficient to explain turbulent flow statistics. In contrast, colored-in-time forcing of the linearized equations allows for exact matching of available correlations. To accomplish this, we develop dynamical models that generate the required stochastic excitation...

  8. False color viewing device

    International Nuclear Information System (INIS)

    A viewing device for observing objects in near-infrared false-color comprising a pair of goggles with one or more filters in the apertures, and pads that engage the face for blocking stray light from the sides so that all light reaching the user's eyes come through the filters. The filters attenuate most visible light and pass near-infrared (having wavelengths longer than approximately 700 nm) and a small amount of blue-green and blue-violet (having wavelengths in the 500 to 520 nm and shorter than 435 nm, respectively). The goggles are useful for looking at vegetation to identify different species and for determining the health of the vegetation, and to detect some forms of camouflage. 7 figs

  9. Light Vision Color

    Science.gov (United States)

    Valberg, Arne

    2005-04-01

    Light Vision Color takes a well-balanced, interdisciplinary approach to our most important sensory system. The book successfully combines basics in vision sciences with recent developments from different areas such as neuroscience, biophysics, sensory psychology and philosophy. Originally published in 1998 this edition has been extensively revised and updated to include new chapters on clinical problems and eye diseases, low vision rehabilitation and the basic molecular biology and genetics of colour vision. Takes a broad interdisciplinary approach combining basics in vision sciences with the most recent developments in the area Includes an extensive list of technical terms and explanations to encourage student understanding Successfully brings together the most important areas of the subject in to one volume

  10. False color viewing device

    Science.gov (United States)

    Kronberg, J.W.

    1992-10-20

    A viewing device for observing objects in near-infrared false-color comprising a pair of goggles with one or more filters in the apertures, and pads that engage the face for blocking stray light from the sides so that all light reaching the user's eyes come through the filters. The filters attenuate most visible light and pass near-infrared (having wavelengths longer than approximately 700 nm) and a small amount of blue-green and blue-violet (having wavelengths in the 500 to 520 nm and shorter than 435 nm, respectively). The goggles are useful for looking at vegetation to identify different species and for determining the health of the vegetation, and to detect some forms of camouflage. 7 figs.

  11. Colored Group Field Theory

    CERN Document Server

    Gurau, Razvan

    2009-01-01

    Group field theories are higher dimensional generalizations of matrix models. Their Feynman graphs are fat and in addition to vertices, edges and faces, they also contain higher dimensional cells, called bubbles. In this paper, we propose a new, fermionic Group Field Theory, posessing a color symmetry, and take the first steps in a systematic study of the topological properties of its graphs. Unlike its bosonic counterpart, the bubbles of the Feynman graphs of this theory are well defined and readily identified. We prove that this graphs are combinatorial cellular complexes. We define and study the cellular homology of this graphs. Furthermore we define a homotopy transformation appropriate to this graphs. Finally, the amplitude of the Feynman graphs is shown to be related to the fundamental group of the cellular complex.

  12. Color rendering ability and luminous efficacy enhancements in white light-emitting diodes

    Science.gov (United States)

    Mirhosseini, Roya; Schubert, Martin; Chhajed, Sameer; Cho, Jaehee; Kim, Jong Kyu; Schubert, E. Fred

    2009-08-01

    There exists a fundamental trade-off relation between color rendering index (CRI) and luminous efficacy; in other words, improvements in one are generally detrimental to the other. We analyze and demonstrate through simulation that phosphor-converted white LEDs with dual-blue emitting active regions, as opposed to single-blue emitting active regions, significantly enhance color rendering ability while maximizing the output luminous flux. The improvements are achieved over a broad range of correlated color temperatures.

  13. Joint transform correlator based on CIELAB model with encoding technique for color pattern recognition

    Science.gov (United States)

    Lin, Tiengsheng; Chen, Chulung; Liu, Chengyu; Chen, Yuming

    2010-10-01

    The CIELAB standard color vision model instead of the traditional RGB color model is utilized for polychromatic pattern recognition. The image encoding technique is introduced. The joint transform correlator is set to be the optical configuration. To achieve the distortion invariance in discrimination processes, we have used the minimum average correlation energy approach to yield sharp correlation peak. From the numerical results, it is found that the recognition ability based on CIELAB color specification system is accepted.

  14. Heritability and Evolutionary Potential in Thermal Tolerance Traits in the Invasive Mediterranean Cryptic Species of Bemisia tabaci (Hemiptera: Aleyrodidae)

    OpenAIRE

    Ma, Fang-Zhou; Lü, Zhi-Chuang; Wang, Ren; Wan, Fang-Hao

    2014-01-01

    With advancing global climate change, the analysis of thermal tolerance and evolutionary potential is important in explaining the ecological adaptation and changes in the distribution of invasive species. To reveal the variation of heat resistance and evolutionary potential in the invasive Mediterranean cryptic species of Bemisia tabaci, we selected two Chinese populations—one from Harbin, N China, and one from Turpan, S China—that experience substantial heat and cold stress and conducted kno...

  15. Cryptic tetracycline resistance determinant (class F) from Bacteroides fragilis mediates resistance in Escherichia coli by actively reducing tetracycline accumulation.

    OpenAIRE

    Park, B. H.; Hendricks, M; Malamy, M H; Tally, F P; Levy, S. B.

    1987-01-01

    Escherichia coli bearing a cryptic tetracycline resistance determinant from Bacteroides fragilis expressed low-level constitutive resistance to tetracycline under aerobic, but not anaerobic, growth conditions and accumulated less tetracycline aerobically than did isogenic susceptible cells. This decreased uptake was energy dependent and reversible by increased concentrations of tetracycline, suggesting a saturable carrier-mediated active efflux mechanism. Decreased uptake was not seen when th...

  16. Cryptic vector divergence masks vector-specific patterns of infection : an example from the marine cycle of Lyme borreliosis

    OpenAIRE

    Gómez-Díaz, Elena; Doherty, Paul F.; Duneau, David; McCoy, Karen D.

    2010-01-01

    Vector organisms are implicated in the transmission of close to a third of all infectious diseases. In many cases, multiple vectors (species or populations) can participate in transmission but may contribute differently to disease ecology and evolution. The presence of cryptic vector populations can be particularly problematic as differences in infection can be difficult to evaluate and may lead to erroneous evolutionary and epidemiological inferences. Here, we combine site-occupancy modeling...

  17. Diversification and reproductive isolation: cryptic species in the only New World high-duty cycle bat, Pteronotus parnellii

    Directory of Open Access Journals (Sweden)

    Clare Elizabeth L

    2013-01-01

    Full Text Available Abstract Background Molecular techniques are increasingly employed to recognize the presence of cryptic species, even among commonly observed taxa. Previous studies have demonstrated that bats using high-duty cycle echolocation may be more likely to speciate quickly. Pteronotus parnellii is a widespread Neotropical bat and the only New World species to use high-duty cycle echolocation, a trait otherwise restricted to Old World taxa. Here we analyze morphological and acoustic variation and genetic divergence at the mitochondrial COI gene, the 7th intron region of the y-linked Dby gene and the nuclear recombination-activating gene 2, and provide extensive evidence that P. parnellii is actually a cryptic species complex. Results Central American populations form a single species while three additional species exist in northern South America: one in Venezuela, Trinidad and western Guyana and two occupying sympatric ranges in Guyana and Suriname. Reproductive isolation appears nearly complete (only one potential hybrid individual found. The complex likely arose within the last ~6 million years with all taxa diverging quickly within the last ~1-2 million years, following a pattern consistent with the geological history of Central and northern South America. Significant variation in cranial measures and forearm length exists between three of the four groups, although no individual morphological character can discriminate these in the field. Acoustic analysis reveals small differences (5–10 kHz in echolocation calls between allopatric cryptic taxa that are unlikely to provide access to different prey resources but are consistent with divergence by drift in allopatric species or through selection for social recognition. Conclusions This unique approach, considering morphological, acoustic and multi-locus genetic information inherited maternally, paternally and bi-parentally, provides strong support to conclusions about the cessation of gene flow and

  18. Quasar Classification Using Color and Variability

    Science.gov (United States)

    Peters, Christina M.; Richards, Gordon

    2015-08-01

    We use the Non-parametric Bayesian Classification Kernel Density Estimation (NBC KDE) quasar selection algorithm (Richards et al. 2004) to identify 36,569 type 1 quasar candidates in the Sloan Digital Sky Survey (SDSS) Stripe 82 field using the combination of optical photometry and variability. 5-band coadded optical photometry is taken from the SDSS-I/II to a depth of r ~ 22.4; from these data variability parameters are calculated by fitting the structure function of each object in each band with a power law using 10 to >100 observations for timescales from ~1 day to ~8 years. Selection was based on a training sample of 13,221 spectroscopically-confirmed type 1 quasars from SDSS-I/II and the Baryon Oscillation Spectroscopic Survey (BOSS). Using variability alone, colors alone, and combining variability and colors we achieve 91%, 93%, and 97% quasar completeness and 98%, 98%, and 97% efficiency respectively, with particular improvement in the selection of quasars at 2.7 < z < 3.5 where quasars and stars have similar optical colors. The 23,043 quasar candidates that are not spectroscopically confirmed reach a depth of coadd i ~ 22: 0 and 21,380 (92.8%) are dimmer than coadded i -band magnitude of 20.2, the cut off for spectroscopic follow-up for SDSSDR7.

  19. DNA barcodes and cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste, Costa Rica.

    Science.gov (United States)

    Burns, John M; Janzen, Daniel H; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hebert, Paul D N

    2008-04-29

    DNA barcodes can be used to identify cryptic species of skipper butterflies previously detected by classic taxonomic methods and to provide first clues to the existence of yet other cryptic species. A striking case is the common geographically and ecologically widespread neotropical skipper butterfly Perichares philetes (Lepidoptera, Hesperiidae), described in 1775, which barcoding splits into a complex of four species in Area de Conservación Guanacaste (ACG) in northwestern Costa Rica. Three of the species are new, and all four are described. Caterpillars, pupae, and foodplants offer better distinguishing characters than do adults, whose differences are mostly average, subtle, and blurred by intraspecific variation. The caterpillars of two species are generalist grass-eaters; of the other two, specialist palm-eaters, each of which feeds on different genera. But all of these cryptic species are more specialized in their diet than was the morphospecies that held them. The four ACG taxa discovered to date belong to a panneotropical complex of at least eight species. This complex likely includes still more species, whose exposure may require barcoding. Barcoding ACG hesperiid morphospecies has increased their number by nearly 10%, an unexpectedly high figure for such relatively well known insects.

  20. Out of the deep: cryptic speciation in a Neotropical gecko (Squamata, Phyllodactylidae) revealed by species delimitation methods.

    Science.gov (United States)

    Domingos, Fabricius M C B; Bosque, Renan J; Cassimiro, José; Colli, Guarino R; Rodrigues, Miguel T; Santos, Marcella G; Beheregaray, Luciano B

    2014-11-01

    Levels of biodiversity in the Neotropics are largely underestimated despite centuries of research interest in this region. This is particularly true for the Cerrado, the largest Neotropical savanna and a formally recognized biodiversity hotspot. Molecular species delimitation methods have become essential tools to uncover cryptic species and can be notably robust when coupled with morphological information. We present the first evaluation of the monophyly and cryptic speciation of a widespread Cerrado endemic lizard, Gymnodactylus amarali, using phylogenetic and species-trees methods, as well as a coalescent-based Bayesian species delimitation method. We tested whether lineages resulting from the analyses of molecular data are morphologically diagnosed by traditional meristic scale characters. We recovered eight deeply divergent molecular clades within G. amarali, and two additional ones from seasonally dry tropical forest enclaves between the Cerrado and the Caatinga biomes. Analysis of morphological data statistically corroborated the molecular delimitation for all groups, in a pioneering example of the use of support vector machines to investigate morphological differences in animals. The eight G. amarali clades appear monophyletic and endemic to the Cerrado. They display several different properties used by biologists to delineate species and are therefore considered here as candidates for formal taxonomic description. We also present a preliminary account of the biogeographic history of these lineages in the Cerrado, evidence for speciation of sister lineages in the Cerrado-Caatinga contact, and highlight the need for further morphological and genetic studies to assess cryptic diversity in this biodiversity hotspot. PMID:25109652

  1. Identification of novel mureidomycin analogues via rational activation of a cryptic gene cluster in Streptomyces roseosporus NRRL 15998.

    Science.gov (United States)

    Jiang, Lingjuan; Wang, Lu; Zhang, Jihui; Liu, Hao; Hong, Bin; Tan, Huarong; Niu, Guoqing

    2015-01-01

    Antimicrobial agents are urgently needed to tackle the growing threat of antibiotic-resistant pathogens. An important source of new antimicrobials is the large repertoire of cryptic gene clusters embedded in microbial genomes. Genome mining revealed a napsamycin/mureidomycin biosynthetic gene cluster in the chromosome of Streptomyces roseosporus NRRL 15998. The cryptic gene cluster was activated by constitutive expression of a foreign activator gene ssaA from sansanmycin biosynthetic gene cluster of Streptomyces sp. strain SS. Expression of the gene cluster was verified by RT-PCR analysis of key biosynthetic genes. The activated metabolites demonstrated potent inhibitory activity against the highly refractory pathogen Pseudomonas aeruginosa, and characterization of the metabolites led to the discovery of eight acetylated mureidomycin analogues. To our surprise, constitutive expression of the native activator gene SSGG_02995, a ssaA homologue in S. roseosporus NRRL 15998, has no beneficial effect on mureidomycin stimulation. This study provides a new way to activate cryptic gene cluster for the acquisition of novel antibiotics and will accelerate the exploitation of prodigious natural products in Streptomyces. PMID:26370924

  2. Reliability of conventional shade guides in teeth color determination

    Directory of Open Access Journals (Sweden)

    Todorović Ana

    2013-01-01

    Full Text Available Background/Aim. Color matching in prosthodontic therapy is a very important task because it influences the esthetic value of dental restorations. Visual shade matching represents the most frequently applied method in clinical practice. Instrumental measurements provide objective and quantified data in color assessment of natural teeth and restorations. In instrumental shade analysis, the goal is to achieve the smallest ΔE value possible, indicating the most accurate shade match. The aim of this study was to evaluate the reliability of commercially available ceramic shade guides. Methods. VITA Easyshade spectrophotometer (VITA, Germany was used for instrumental color determination. Utilizing this device, color samples of ten VITA Classical and ten VITA 3D - Master shade guides were analyzed. Each color sample from all shade guides was measured three times and the basic parameters of color quality were examined: ΔL, ΔC, ΔH, ΔE, ΔElc. Based on these parameters spectrophotometer marks the shade matching as good, fair or adjust. Results. After performing 1,248 measurements of ceramic color samples, frequency of evaluations adjust, fair and good were statistically significantly different between VITA Classical and VITA 3D Master shade guides (p = 0.002. There were 27.1% cases scored as adjust, 66.3% as fair and 6.7% as good. In VITA 3D - Master shade guides 30.9% cases were evaluated as adjust, 66.4% as fair and 2.7% cases as good. Conclusion. Color samples from different shade guides, produced by the same manufacturer, show variability in basic color parameters, which once again proves the lack of precision and nonuniformity of the conventional method.

  3. Modelling, Measuring and Compensating Color Weak Vision

    OpenAIRE

    Oshima, Satoshi; Mochizuki, Rica; Lenz, Reiner; Chao, Jinhui

    2015-01-01

    We use methods from Riemann geometry to investigate transformations between the color spaces of color-normal and color weak observers. The two main applications are the simulation of the perception of a color weak observer for a color normal observer and the compensation of color images in a way that a color weak observer has approximately the same perception as a color normal observer. The metrics in the color spaces of interest are characterized with the help of ellipsoids defined by the ju...

  4. Color in machine vision and its application

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Color is the phenomenon of human visual perception and the module of machine vision. Color information is widely used in the areas of virtual reality and humancomputer interaction. Color is the product of a visual environment, illumination and the human brain. Research on color information representation and its processing is typically interdisciplinary. Based on our research work on human color perception and machine color vision and its application, we summarized the hotspots of color studies in recent developments and new approaches to color vision,including basic theories and the application of color information in virtual reality, content-based image retrieval, and face recognition.

  5. Gold color in dental alloys.

    Science.gov (United States)

    Cameron, T

    1997-01-01

    This article will help the dental laboratory with alloy selection by exploring how the relationship among color, ductility and strength applies to gold and how color can be quantified. Because higher quality materials translate into higher profits, upselling to the dentist and patient is also discussed.

  6. The Chemistry of Color Photography

    Science.gov (United States)

    Guida, Wayne C.; Raber, Douglas J.

    1975-01-01

    Presents several topics in color photography which can serve as an introduction of scientific concepts into the classroom, such as: photochemistry (energy transport), organic chemistry (dye formation), physics (nature of light), psychology (color perception), and engineering (isolation of different chemical processes within layers of the film).…

  7. Integrative taxonomy resolves the cryptic and pseudo-cryptic Radula buccinifera complex (Porellales, Jungermanniopsida, including two reinstated and five new species

    Directory of Open Access Journals (Sweden)

    Matt Renner

    2013-10-01

    Full Text Available Molecular data from three chloroplast markers resolve individuals attributable to Radula buccinifera in six lineages belonging to two subgenera, indicating the species is polyphyletic as currently circumscribed. All lineages are morphologically diagnosable, but one pair exhibits such morphological overlap that they can be considered cryptic. Molecular and morphological data justify the re-instatement of a broadly circumscribed ecologically variable R. strangulata, of R. mittenii, and the description of five new species. Two species Radula mittenii Steph. and R. notabilis sp. nov. are endemic to the Wet Tropics Bioregion of north-east Queensland, suggesting high diversity and high endemism might characterise the bryoflora of this relatively isolated wet-tropical region. Radula demissa sp. nov. is endemic to southern temperate Australasia, and like R. strangulata occurs on both sides of the Tasman Sea. Radula imposita sp. nov. is a twig and leaf epiphyte found in association with waterways in New South Wales and Queensland. Another species, R. pugioniformis sp. nov., has been confused with Radula buccinifera but was not included in the molecular phylogeny. Morphological data suggest it may belong to subg. Odontoradula. Radula buccinifera is endemic to Australia including Western Australia and Tasmania, and to date is known from south of the Clarence River on the north coast of New South Wales. Nested within R. buccinifera is a morphologically distinct plant from Norfolk Island described as R. anisotoma sp. nov. Radula australiana is resolved as monophyletic, sister to a species occurring in east coast Australian rainforests, and nesting among the R.buccinifera lineages with strong support. The molecular phylogeny suggests several long-distance dispersal events may have occurred. These include two east-west dispersal events from New Zealand to Tasmania and south-east Australia in R. strangulata, one east-west dispersal event from Tasmania to

  8. Application of the Mechanism Design to Develop the RGB LEDs Color Mixing

    Directory of Open Access Journals (Sweden)

    Chih-Ching Hung

    2015-01-01

    Full Text Available The big advantage of LED is the flexible spectral design to make white light using different color mixing schemes. Recently, the color mixing of RGB LEDs is mostly done by sealing all three chips at single package and regulated the mix ratio of these three colors to produce the color of light. And, by changing the LEDs array alignment, RGB chips can achieve overlapping colors of light and create the fun of changing colors in light mixing. Therefore, the purpose of this study is to propose an innovative technique of light mixing. By applying the mechanism design, a RGB light mixing mechanism is produced. Each of the RGB LEDs lamp-type is installed on the couple link of the three mechanisms, respectively. By driving a crank makes the couple link and an output link to produce the relative motion, this will result in the fact that the RGB lamps can project lights on the same plane in order to obtain the color mixing. Unlike mixing technique by control system, this design generates light mixing and changes of color with the synchronized driving of three mechanisms, thus achieving the dazzling perception of single-color lights or mixing of multiple colors for creating ambience of a space.

  9. 7 CFR 28.403 - Middling Color.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Color. 28.403 Section 28.403 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.403 Middling Color. Middling Color is color which is within the...

  10. Portable real-time color night vision

    NARCIS (Netherlands)

    Toet, A.; Hogervorst, M.A.

    2008-01-01

    We developed a simple and fast lookup-table based method to derive and apply natural daylight colors to multi-band night-time images. The method deploys an optimal color transformation derived from a set of samples taken from a daytime color reference image. The colors in the resulting colorized mul

  11. The Psychological Four-Color Mapping Problem

    Science.gov (United States)

    Francis, Gregory; Bias, Keri; Shive, Joshua

    2010-01-01

    Mathematicians have proven that four colors are sufficient to color 2-D maps so that no neighboring regions share the same color. Here we consider the psychological 4-color problem: Identifying which 4 colors should be used to make a map easy to use. We build a model of visual search for this design task and demonstrate how to apply it to the task…

  12. A color local dimming algorithm for liquid crystals displays using color light emitting diode backlight systems

    Science.gov (United States)

    Cho, Hyunsuk; Cho, Byong Chul; Hong, Hee Jung; Oh, Eui-Yeol; Kwon, Oh-Kyong

    2013-04-01

    A color local dimming algorithm is proposed to reduce the image distortion and power consumption of liquid crystal displays (LCDs) by using color light emitting diode (LED) backlights. The proposed algorithm is demonstrated using a 55-in. LCD panel with a RGB LED backlight system. In the proposed algorithm, the dimming rate of local blocks is determined by calculating the image distortion of the dimming image, and this is used to achieve steady image quality. The image data of the LCD panel are modified to reduce color distortion by removing the differences in chromaticity. Simulated test results show that the average, standard deviation, and relative variation of PSNRs for the test video are 43.74 dB, 3.57 dB, and 0.082, respectively. The average color differences using the proposed algorithm are 9.6, 5.0, 5.6, and 4.2 for the test patterns with 2×2, 4×2, 4×4, and 8×4 white boxes, respectively. The measured average power saving ratio for the test video is 67.3%.

  13. Cryptic diversity in the Western Balkan endemic copepod: Four species in one?

    Science.gov (United States)

    Previšić, Ana; Gelemanović, Andrea; Urbanič, Gorazd; Ternjej, Ivančica

    2016-07-01

    We use mitochondrial (mtCOI) and nuclear (nH3) sequence data to investigate differentiation of Eudiaptomus hadzici, a freshwater copepod endemic to the Western Balkans. E. hadzici has a disjunct distribution and morphological differences were observed at regional scale. In the current study 6 out of 7 known populations are included. We applied several species delimiting approaches, distance based methods (K2P p-distance and Automatic Barcode Gap Discovery, ABGD) using the mtCOI, Bayesian phylogeny and the Bayesian method implemented in bPTP and BPP programs using the concatenated sequences of both genes. Phylogenetic and species delimitation analyses all suggest that the nominal species E. hadzici consists of four isolated, cryptic evolutionary lineages in the Western Balkans. Each of the four lineages inhabits a single lake or a group of lakes in close proximity. They exhibit major differences in secondary sexual characters, e.g. right antennule in males. Denticulation of spine on 13th segment is substantially distinct among the four lineages, having different number and shape of tooth-like protrusions. Gene flow and dispersal are restricted to very small spatial scale, but with local differences, implying that diverse historical and contemporary processes are operating at small spatial scales in E. hadzici. In order to further examine spatial and temporal diversification patterns, we constructed a dated species tree analysis using (*)BEAST. Due to lack of reliable calibration points and taxa specific evolutionary rates, two evolutionary rates were applied and the faster one (2.6% myr) seems more plausible considering the geological history of the region. The divergence of E. hadzici lineages is dated from Early Miocene onwards with geographically close lineages diverging more recently, Late Miocene to Pleistocene and Pleistocene, respectively. Overall, our findings shed light on cryptic genetic complexity of endemics in one of European biodiversity hotspots

  14. Evolution of poecilogony from planktotrophy: cryptic speciation, phylogeography, and larval development in the gastropod genus Alderia.

    Science.gov (United States)

    Ellingson, Ryan A; Krug, Patrick J

    2006-11-01

    Poecilogony, a rare phenomenon in marine invertebrates, occurs when alternative larval morphs differing in dispersal potential or trophic mode are produced from a single genome. Because both poecilogony and cryptic species are prevalent among sea slugs in the suborder Sacoglossa (Gastropoda: Opisthobranchia), molecular data are needed to confirm cases of variable development and to place them in a phylogenetic context. The nominal species Alderia modesta produces long-lived, feeding larvae throughout the North Atlantic and Pacific, but in California can also produce short-lived larvae that metamorphose without feeding. We collected morphological, developmental, and molecular data for Alderia from 17 sites spanning the eastern and western Pacific and North Atlantic. Estuaries south of Bodega Harbor, California, contained a cryptic species (hereafter Alderia sp.) with variable development, sister to the strictly planktotrophic A. modesta. The smaller Alderia sp. seasonally toggled between planktotrophy and lecithotrophy, with some individuals differing in development but sharing mitochondrial DNA haplotypes. The sibling species overlapped in Tomales Bay, California, but showed no evidence of hybridization; laboratory mating trials suggest postzygotic isolation has arisen. Intra- and interspecific divergence times were estimated using a molecular clock calibrated with geminate sacoglossans. Speciation occurred about 4.1 million years ago during a major marine radiation in the eastern Pacific, when large inland embayments in California may have isolated ancestral populations. Atlantic and Pacific A. modesta diverged about 1.7 million years ago, suggesting trans-Arctic gene flow was interrupted by Pleistocene glaciation. Both Alderia species showed evidence of late Pleistocene population expansion, but the southern Alderia sp. likely experienced a more pronounced bottleneck. Reduced body size may have incurred selection against obligate planktotrophy in Alderia sp. by

  15. CTL escape mediated by proteasomal destruction of an HIV-1 cryptic epitope.

    Directory of Open Access Journals (Sweden)

    Sylvain Cardinaud

    2011-05-01

    Full Text Available Cytotoxic CD8+ T cells (CTLs play a critical role in controlling viral infections. HIV-infected individuals develop CTL responses against epitopes derived from viral proteins, but also against cryptic epitopes encoded by viral alternative reading frames (ARF. We studied here the mechanisms of HIV-1 escape from CTLs targeting one such cryptic epitope, Q9VF, encoded by an HIVgag ARF and presented by HLA-B*07. Using PBMCs of HIV-infected patients, we first cloned and sequenced proviral DNA encoding for Q9VF. We identified several polymorphisms with a minority of proviruses encoding at position 5 an aspartic acid (Q9VF/5D and a majority encoding an asparagine (Q9VF/5N. We compared the prevalence of each variant in PBMCs of HLA-B*07+ and HLA-B*07- patients. Proviruses encoding Q9VF/5D were significantly less represented in HLA-B*07+ than in HLA-B*07- patients, suggesting that Q9FV/5D encoding viruses might be under selective pressure in HLA-B*07+ individuals. We thus analyzed ex vivo CTL responses directed against Q9VF/5D and Q9VF/5N. Around 16% of HLA-B*07+ patients exhibited CTL responses targeting Q9VF epitopes. The frequency and the magnitude of CTL responses induced with Q9VF/5D or Q9VF/5N peptides were almost equal indicating a possible cross-reactivity of the same CTLs on the two peptides. We then dissected the cellular mechanisms involved in the presentation of Q9VF variants. As expected, cells infected with HIV strains encoding for Q9VF/5D were recognized by Q9VF/5D-specific CTLs. In contrast, Q9VF/5N-encoding strains were neither recognized by Q9VF/5N- nor by Q9VF/5D-specific CTLs. Using in vitro proteasomal digestions and MS/MS analysis, we demonstrate that the 5N variation introduces a strong proteasomal cleavage site within the epitope, leading to a dramatic reduction of Q9VF epitope production. Our results strongly suggest that HIV-1 escapes CTL surveillance by introducing mutations leading to HIV ARF-epitope destruction by proteasomes.

  16. Inheritance of goat coat colors.

    Science.gov (United States)

    Adalsteinsson, S; Sponenberg, D P; Alexieva, S; Russel, A J

    1994-01-01

    Goat color inheritance was evaluated based on color description of 218 kids and their parents (10 sires, 178 dams) from mixed crosses between several goat populations in an experiment on cashmere fiber production. Altogether 10 color patterns were observed. They were postulated to be caused by 10 alleles at the Agouti locus, with the allele for white or tan color being the top dominant allele, and the nine others codominant. The bottom recessive allele, for nonagouti color, was the 11th allele at this locus. The postulated alleles are white or tan (A(wt)), black mask (A(blm)), bezoar (A(bz)), badgerface (A(b)), grey (A(g)), lightbelly (A(lb)), swiss markings (A(sm)), lateral stripes (A(ls)), mahogany (A(mh)), red cheek (A(rc)), and nonagouti (Aa). Two types of eumelanin pigment were observed, black and light brown, the latter being dominant. Recessive brown was not observed.

  17. Color calibration and fusion of lens-free and mobile-phone microscopy images for high-resolution and accurate color reproduction

    Science.gov (United States)

    Zhang, Yibo; Wu, Yichen; Zhang, Yun; Ozcan, Aydogan

    2016-06-01

    Lens-free holographic microscopy can achieve wide-field imaging in a cost-effective and field-portable setup, making it a promising technique for point-of-care and telepathology applications. However, due to relatively narrow-band sources used in holographic microscopy, conventional colorization methods that use images reconstructed at discrete wavelengths, corresponding to e.g., red (R), green (G) and blue (B) channels, are subject to color artifacts. Furthermore, these existing RGB colorization methods do not match the chromatic perception of human vision. Here we present a high-color-fidelity and high-resolution imaging method, termed “digital color fusion microscopy” (DCFM), which fuses a holographic image acquired at a single wavelength with a color-calibrated image taken by a low-magnification lens-based microscope using a wavelet transform-based colorization method. We demonstrate accurate color reproduction of DCFM by imaging stained tissue sections. In particular we show that a lens-free holographic microscope in combination with a cost-effective mobile-phone-based microscope can generate color images of specimens, performing very close to a high numerical-aperture (NA) benchtop microscope that is corrected for color distortions and chromatic aberrations, also matching the chromatic response of human vision. This method can be useful for wide-field imaging needs in telepathology applications and in resource-limited settings, where whole-slide scanning microscopy systems are not available.

  18. Color calibration and fusion of lens-free and mobile-phone microscopy images for high-resolution and accurate color reproduction.

    Science.gov (United States)

    Zhang, Yibo; Wu, Yichen; Zhang, Yun; Ozcan, Aydogan

    2016-01-01

    Lens-free holographic microscopy can achieve wide-field imaging in a cost-effective and field-portable setup, making it a promising technique for point-of-care and telepathology applications. However, due to relatively narrow-band sources used in holographic microscopy, conventional colorization methods that use images reconstructed at discrete wavelengths, corresponding to e.g., red (R), green (G) and blue (B) channels, are subject to color artifacts. Furthermore, these existing RGB colorization methods do not match the chromatic perception of human vision. Here we present a high-color-fidelity and high-resolution imaging method, termed "digital color fusion microscopy" (DCFM), which fuses a holographic image acquired at a single wavelength with a color-calibrated image taken by a low-magnification lens-based microscope using a wavelet transform-based colorization method. We demonstrate accurate color reproduction of DCFM by imaging stained tissue sections. In particular we show that a lens-free holographic microscope in combination with a cost-effective mobile-phone-based microscope can generate color images of specimens, performing very close to a high numerical-aperture (NA) benchtop microscope that is corrected for color distortions and chromatic aberrations, also matching the chromatic response of human vision. This method can be useful for wide-field imaging needs in telepathology applications and in resource-limited settings, where whole-slide scanning microscopy systems are not available. PMID:27283459

  19. Color response and color transport in a quark-gluon plasma

    International Nuclear Information System (INIS)

    Using color kinetic theory, we discuss color conduction and color response in a quark-gluon plasma. Collective color oscillations and their damping rates are investigated. An instability of the thermal equilibrium state in high T QCD is discovered

  20. Color response and color transport in a quark-gluon plasma

    Energy Technology Data Exchange (ETDEWEB)

    Heinz, U.

    1986-01-01

    Using color kinetic theory, we discuss color conduction and color response in a quark-gluon plasma. Collective color oscillations and their damping rates are investigated. An instability of the thermal equilibrium state in high T QCD is discovered.

  1. Molecular identification of a cryptic species in the Amazonian predatory catfish genus Pseudoplatystoma (Bleeker, 1962) from Peru.

    Science.gov (United States)

    García-Dávila, Carmen; Duponchelle, Fabrice; Castro-Ruiz, Diana; Villacorta, José; Quérouil, Sophie; Chota-Macuyama, Werner; Núñez, Jesus; Römer, Uwe; Carvajal-Vallejos, Fernando; Renno, Jean-François

    2013-09-01

    Pseudoplatystoma species are highly prized South American Pimelodid migratory catfishes. Until recently, their taxonomy was not clearly established, with discrepancies between morphological and molecular analyses. Here, Pseudoplatystoma species from the Peruvian Amazon were characterized at the molecular level from a sample representing the observed range of their color pattern variations in the study area. Analyses were performed using seven microsatellite loci for 103 specimens and, for part of them (52), using sequences of two regions of their mitochondrial genome [Cytochrome Oxidase subunit I (COI) and Control Region (CR)]. Factorial correspondence analysis and assignment tests based on microsatellite polymorphism showed that the specimens originally identified as P. punctifer belonged to two different gene pools highly differentiated from P. tigrinum. Morphological examination identified two different morphotypes (with and without black stripes), suggesting the existence of two distinct taxa within P. punctifer. This result was corroborated by the ML tree based on CR sequences, where all individuals but four clustered in a similar way as in the FCA and Bayesian assignment tests. For these four individuals, mitochondrial introgression or retention of ancestral polymorphism was likely. In contrast, the ML tree based on COI sequences showed that reciprocal monophyly was not yet achieved for this marker for the two P. punctifer taxa. The existence of three sympatric species of Pseudoplatystoma in the Peruvian Amazon is discussed in relation to their molecular characteristics, color patterns and ecology. Evolutionary scenarios regarding their divergence are hypothesized.

  2. Barcoding against a paradox? Combined molecular species delineations reveal multiple cryptic lineages in elusive meiofaunal sea slugs

    Directory of Open Access Journals (Sweden)

    Jörger Katharina M

    2012-12-01

    Full Text Available Abstract Background Many marine meiofaunal species are reported to have wide distributions, which creates a paradox considering their hypothesized low dispersal abilities. Correlated with this paradox is an especially high taxonomic deficit for meiofauna, partly related to a lower taxonomic effort and partly to a high number of putative cryptic species. Molecular-based species delineation and barcoding approaches have been advocated for meiofaunal biodiversity assessments to speed up description processes and uncover cryptic lineages. However, these approaches show sensitivity to sampling coverage (taxonomic and geographic and the success rate has never been explored on mesopsammic Mollusca. Results We collected the meiofaunal sea-slug Pontohedyle (Acochlidia, Heterobranchia from 28 localities worldwide. With a traditional morphological approach, all specimens fall into two morphospecies. However, with a multi-marker genetic approach, we reveal multiple lineages that are reciprocally monophyletic on single and concatenated gene trees in phylogenetic analyses. These lineages are largely concordant with geographical and oceanographic parameters, leading to our primary species hypothesis (PSH. In parallel, we apply four independent methods of molecular based species delineation: General Mixed Yule Coalescent model (GMYC, statistical parsimony, Bayesian Species Delineation (BPP and Automatic Barcode Gap Discovery (ABGD. The secondary species hypothesis (SSH is gained by relying only on uncontradicted results of the different approaches (‘minimum consensus approach’, resulting in the discovery of a radiation of (at least 12 mainly cryptic species, 9 of them new to science, some sympatric and some allopatric with respect to ocean boundaries. However, the meiofaunal paradox still persists in some Pontohedyle species identified here with wide coastal and trans-archipelago distributions. Conclusions Our study confirms extensive, morphologically

  3. The integument of Psittacosaurus from Liaoning Province, China: taphonomy, epidermal patterns and color of a ceratopsian dinosaur

    Science.gov (United States)

    Lingham-Soliar, Theagarten; Plodowski, Gerhard

    2010-05-01

    Preserved skin of small dinosaurs is rare. Here, a specimen of the ceratopsian dinosaur, Psittacosaurus, presents some of the best preserved epidermal scales observed to date in a relatively small dinosaur, over wide areas extending from the head to the tail. We study the preserved epidermis of SMF R 4970, the different types of scales, color, and patterns, and their respective locations in the body. We use modern application of high-power digital imaging for close-up analysis of the tubercles and fragments of preserved color. Three types of scales are preserved, large plate-like scales, smaller polygonal scales or tubercles, and round pebble-like scales. The sizes of the plate-like scales vary in different parts of the body and vanish altogether posteriorly. Light and dark cryptic patterns are created by the associations of the tubercle and plate-like scales, and there is also evidence of countershading in the proximal caudal region, the body darker dorsally and lighter ventrally. Perhaps most impressive are the distinctive pigmented impressions of scales over most of the skeletal elements. The pigmentation follows the curvature of the bones implying that when it was deposited, the skin was still pliable and able to wrap around the visible parts of the elements. The present record of color is the first in a non-theropod dinosaur and only the second record in a non-avian dinosaur. Because of its resistance to degradation and ability to produce various color tones from yellows to blacks, we suggest that melanin was the dominant chemical involved in the coloration of Psittacosaurus. The data here enable us to reconstruct the colors of Psittacosaurus as predominantly black and amber/brown, in cryptic patterns, somewhat dull, but useful to a prey animal. Indeed, skin pigment within a partially degraded bone indicates that Psittacosaurus was scavenged shortly after death. The theropod dinosaur Sinosauropteryx has recently been reported to have naturally pigmented

  4. Color Naming Experiment in Mongolian Language

    Directory of Open Access Journals (Sweden)

    Nandin-Erdene Osorjamaa

    2015-11-01

    Full Text Available There are numerous researches on color terms and names in many languages. In Mongolian language there are few doctoral theses on color naming. Cross cultural studies of color naming have demonstrated Semantic relevance in French and Mongolian color name Gerlee Sh. (2000; Comparisons of color naming across English and Mongolian Uranchimeg B. (2004; Semantic comparison between Russian and Mongolian idioms Enhdelger O. (1996; across symbolism Dulam S. (2007 and few others. Also a few articles on color naming by some Mongolian scholars are Tsevel, Ya. (1947, Baldan, L. (1979, Bazarragchaa, M. (1997 and others. Color naming studies are not sufficiently studied in Modern Mongolian. Our research is considered to be the first intended research on color naming in Modern Mongolian, because it is one part of Ph.D dissertation on color naming. There are two color naming categories in Mongolian, basic color terms and non- basic color terms. There are seven basic color terms in Mongolian. This paper aims to consider how Mongolian color names are derived from basic colors by using psycholinguistics associative experiment. It maintains the students and researchers to acquire the specific understanding of the differences and similarities of color naming in Mongolian and  English languages from the psycho-linguistic aspect.Keywords: modern Mongolian, basic color terms, non-basic color terms, associative experiment, signal word, response word, color naming 

  5. College Achievement and Earnings

    OpenAIRE

    Gemus, Jonathan

    2010-01-01

    I study the size and sources of the monetary return to college achievement as measured by cumulative Grade Point Average (GPA). I first present evidence that the return to achievement is large and statistically significant. I find, however, that this masks variation in the return across different groups of people. In particular, there is no relationship between GPA and earnings for graduate degree holders but a large and positive relationship for people without a graduate degree. To reconcile...

  6. Strong color fields and heavy flavor production

    OpenAIRE

    Pajares, C.; Bautista, I.

    2010-01-01

    The clustering of color sources provides a natural framework for soft partonic interactions producing strong color fields. We study the consequences of these color fields in the production of heavy flavor and the behavior of the nuclear modification factor.

  7. DNA Barcoding Reveals High Cryptic Diversity of the Freshwater Halfbeak Genus Hemirhamphodon from Sundaland

    Science.gov (United States)

    Zainal Abidin, Muchlisin; Pulungan, Chaidir Parlindungan

    2016-01-01

    DNA barcoding of the cytochrome oxidase subunit I (COI) gene was utilized to assess the species diversity of the freshwater halfbeak genus Hemirhamphodon. A total of 201 individuals from 46 locations in Peninsular Malaysia, north Borneo (Sarawak) and Sumatra were successfully amplified for 616 base pairs of the COI gene revealing 231 variable and 213 parsimony informative sites. COI gene trees showed that most recognized species form monophyletic clades with high bootstrap support. Pairwise within species comparisons exhibited a wide range of intraspecific diversity from 0.0% to 14.8%, suggesting presence of cryptic diversity. This finding was further supported by barcode gap analysis, ABGD and the constructed COI gene trees. In particular, H. pogonognathus from Kelantan (northeast Peninsular Malaysia) diverged from the other H. pogonognathus groups with distances ranging from 7.8 to 11.8%, exceeding the nearest neighbor taxon. High intraspecific diversity was also observed in H. byssus and H. kuekanthali, but of a lower magnitude. This study also provides insights into endemism and phylogeographic structuring, and limited support for the Paleo-drainage divergence hypothesis as a driver of speciation in the genus Hemirhamphodon. PMID:27657915

  8. The first molecular phylogeny of Chilodontidae (Teleostei: Ostariophysi: Characiformes) reveals cryptic biodiversity and taxonomic uncertainty.

    Science.gov (United States)

    Melo, Bruno F; Sidlauskas, Brian L; Hoekzema, Kendra; Vari, Richard P; Oliveira, Claudio

    2014-01-01

    Chilodontidae is a small family of eight described characiform species popularly known as headstanders. These small to moderately sized fishes are well known to aquarists, who prize their striking spotted pigmentation and unusual behaviors, and to systematists, who have revised both chilodontid genera in recent memory and studied their phylogenetic relationships using a comprehensive morphological dataset. However, no molecular phylogeny for the family has ever been proposed. Here, we reconstruct phylogenetic relationships for all eight known chilodontid species using three mitochondrial and two nuclear loci. Results largely agree with the previous morphological hypothesis, and confirm the monophyly of the family as well as its included genera, Caenotropus and Chilodus. The molecular topology differs slightly from the morphological hypothesis by placing Caenotropus maculosus rather than C. mestomorgmatos as the sister to the remaining three congeners, and by reconstructing the Curimatidae as the closest outgroup family, rather than the Anostomidae. However, the topologies supported by the morphological data were only slightly less likely and could not be rejected via Shimodaira-Hasegawa tests. Within Chilodus, two described species with distinctive pigmentation (C. fritillus and C. zunevei) appear embedded within the broad distributed C. punctatus clade, suggesting the presence of cryptic taxa with polymorphic pigmentation within the present concept of C. punctatus. Future work should combine morphological and molecular data to revisit the taxonomy and systematics of Chilodus and determine species limits within the C. punctatus-group sensu lato. PMID:24120449

  9. Cryptic Translocation Identification in Human and Mouse using Several Telomeric Multiplex FISH (TM-FISH) Strategies

    Energy Technology Data Exchange (ETDEWEB)

    Henegariu, O; Artan, S; Greally, J M; Chen, X-N; Korenberg, J R; Vance, G H; Stubbs, L; Bray-Ward, P; Ward, D C

    2003-08-19

    Experimental data published in recent years showed that up to 10% of all cases with mild to severe idiopathic mental retardation may result from small rearrangements of the subtelomeric regions of human chromosomes. To detect such cryptic translocations, we developed a ''telomeric'' multiplex FISH assay, using a set of previously published and commercially available subtelomeric probes. This set of probes includes 41 cosmid/PAC/P1 clones located from less than 100kb to about 1 Mb from the end of the chromosomes. Similarly, a published mouse probe set, comprised of BACs hybridizing to the closest known marker toward the centromere and telomere of each mouse chromosome, was used to develop a mouse-specific ''telomeric'' M-FISH. Three different combinatorial labeling strategies were used to simultaneously detect all human sub-telomeric regions on one slide. The simplest approach uses only three fluors, and can be performed in laboratories lacking sophisticated imaging equipment or personnel highly trained in cytogenetics. A standard fluorescence microscope equipped with only three filters is sufficient. Fluor-dUTPs and labeled probes can be custom-made, thus dramatically reducing costs. Images can be prepared using generic imaging software (Adobe Photoshop), and analysis performed by simple visual inspection.

  10. Cunea n. g. (Amoebozoa, Dactylopodida) with two cryptic species isolated from different areas of the ocean

    KAUST Repository

    Kudryavtsev, Alexander

    2015-06-01

    © 2015 Elsevier GmbH. This paper describes a new genus, Cunea n. g., of marine naked amoebae with two cryptic species, Cunea profundata and Cunea thuwala, isolated from distant localities in the ocean and different depths (Brazilian abyssal plain, Western Atlantic Ocean, depth >5. km and the Red Sea off the Saudi Arabian coast, depth ca. 58.7. m). Both species are very similar to each other in the set of light microscopic and ultrastructural characters and might be described as a single species, yet their genetic divergence based on 3 molecular markers (small-subunit ribosomal RNA, actin and cytochrome c oxidase subunit 1) corresponds to the level of variation typically observed between different morphospecies of Amoebozoa. In addition, the studied strains differ strongly in their temperature tolerance ranges, C. profundata isolated from the cold Atlantic deep-sea habitat being able to reproduce under lower temperatures than C. thuwala isolated from the warm Red Sea benthos. Molecular phylogenetic analysis based on SSU rRNA gene shows that the new genus robustly branches within the Dactylopodida, but forms an independent clade within this order that does not group with any of its known genera.

  11. Biochemical genetics of the cryptic gene system for cellobiose utilization in Escherichia coli K12.

    Science.gov (United States)

    Kricker, M; Hall, B G

    1987-03-01

    The cellobiose catabolic system of Escherichia coli K12 is being used to study the role of cryptic genes in microbial evolution. Wild-type E. coli K12 do not utilize the beta-glucoside sugars, arbutin, salicin and cellobiose. A Cel+ (cellobiose utilizing) mutant which grows on cellobiose, arbutin, and salicin was isolated previously from wild-type E. coli K12. Biochemical assays indicate that a cel structural gene (celT) specifies a single transport protein that is a beta-glucoside specific enzyme of the phosphoenolpyruvate-dependent phosphotransferase system. The transport protein phosphorylates beta-glucosides at the expense of phosphoenolpyruvate. A single phosphoglucosidase, specified by celH, hydrolyzes phosphorylated cellobiose, arbutin, and salicin. The genes of the cel system are expressed constitutively in the Cel+ mutant, whereas they are not expressed at a detectable level in the wild-type strain. The transport and hydrolase genes are simultaneously silenced or simultaneously expressed and thus constitute an operon. Cel+ strains which fail to utilize one or more beta-glucosides express the transport system at a lower level than do Cel+ strains which grow on all three beta-glucosides. Other strains inducibly express a gene which specifies transport of arbutin but not the other beta-glucosides. The arbutin transport gene, arbT, maps outside of the cel locus.

  12. Cryptic organisation within an apparently irregular rostrocaudal distribution of interneurons in the embryonic zebrafish spinal cord

    International Nuclear Information System (INIS)

    The molecules and mechanisms involved in patterning the dorsoventral axis of the developing vertebrate spinal cord have been investigated extensively and many are well known. Conversely, knowledge of mechanisms patterning cellular distributions along the rostrocaudal axis is relatively more restricted. Much is known about the rostrocaudal distribution of motoneurons and spinal cord cells derived from neural crest but there is little known about the rostrocaudal patterning of most of the other spinal cord neurons. Here we report data from our analyses of the distribution of dorsal longitudinal ascending (DoLA) interneurons in the developing zebrafish spinal cord. We show that, although apparently distributed irregularly, these cells have cryptic organisation. We present a novel cell-labelling technique that reveals that DoLA interneurons migrate rostrally along the dorsal longitudinal fasciculus of the spinal cord during development. This cell-labelling strategy may be useful for in vivo analysis of factors controlling neuron migration in the central nervous system. Additionally, we show that DoLA interneurons persist in the developing spinal cord for longer than previously reported. These findings illustrate the need to investigate factors and mechanisms that determine 'irregular' patterns of cell distribution, particularly in the central nervous system but also in other tissues of developing embryos.

  13. DNA Barcode Analysis of Thrips (Thysanoptera Diversity in Pakistan Reveals Cryptic Species Complexes.

    Directory of Open Access Journals (Sweden)

    Romana Iftikhar

    Full Text Available Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27% at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%. BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci, and one predatory thrips (Aeolothrips intermedius showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips.

  14. Mitochondrial genes reveal cryptic diversity in plant-breeding frogs from Madagascar (Anura, Mantellidae, Guibemantis).

    Science.gov (United States)

    Lehtinen, Richard M; Nussbaum, Ronald A; Richards, Christina M; Cannatella, David C; Vences, Miguel

    2007-09-01

    One group of mantellid frogs from Madagascar (subgenus Pandanusicola of Guibemantis) includes species that complete larval development in the water-filled leaf axils of rainforest plants. This group consists of six described species: G. albolineatus, G. bicalcaratus, G. flavobrunneus, G. liber, G. pulcher, and G. punctatus. We sequenced the 12S and 16S mitochondrial rRNA genes ( approximately 1.8 kb) from multiple specimens (35 total) of all six species to assess phylogenetic relationships within this group. All reconstructions strongly supported G. liber as part of the Pandanusicola clade, even though this species does not breed in plant leaf axils. This result confirms a striking reversal of reproductive specialization. However, all analyses also indicated that specimens assigned to G. liber include genetically distinct allopatric forms that do not form a monophyletic group. Most other taxa that were adequately sampled (G. bicalcaratus, G. flavobrunneus, and G. pulcher) likewise consist of several genetically distinct lineages that do not form monophyletic groups. These results suggest that many of the recognized species in this group are complexes of cryptic species.

  15. Is there a cryptic species of the golden snapper (Lutjanus johnii)?

    Science.gov (United States)

    Adibah, A B; Darlina, M N

    2014-10-07

    For centuries, morphology-based fish identification has been applied without molecular evaluation. Many studies showed that specimens with a similar morphology are frequently found to be quite genetically distinct. One of the fish species that still remains taxonomically problematic is a commercial snapper species, Lutjanus johnii. Because of morphological ambiguities among local fish taxonomists in Malaysia, we examined the ability of the cytochrome oxidase I (COI) gene to genetically examine the taxonomic status of L. johnii. A 626-base pair COI region was successfully amplified and aligned with conspecific sequences that were retrieved from GenBank. The phylogenetic tree obtained showed two major clusters; the first cluster consists of L. johnii from Straits of Malacca, Thailand, Australia, and China while the second cluster comprises L. johnii from China and India. The latter group showed sequence divergence greater than 3.5%. After observing this, we suspected that there might be a cryptic species between the South China Sea and Indian Ocean. This is the first molecular report concerning the commercial species of snapper, L. johnii, in Malaysia, which had only gained provisional recognition from morphological examination.

  16. Cryptic assemblages in coral-rubble interstices along a terrestrial-sediment gradient

    Science.gov (United States)

    Takada, Y.; Abe, O.; Shibuno, T.

    2008-09-01

    The assemblage composition of cryptic mobile animals inhabiting coral rubble was sampled using mesh traps containing clean coral rubble, and used as indicators of land-based pollution at 14 sites in three coral lagoons at Ishigaki Island, southern Japan. Cluster analyses identified three groups of large mobile animal assemblages (molluscs, echinoderms, fishes, decapod and stomatopod crustaceans). Using a distance-based redundancy analysis (db-RDA) there was a significant relationship between the assemblage composition and environmental variables. The 1st axis of the db-RDA ordination was regarded as the land-based pollution gradient because of the strong relationship with silicate sediment, turbidity, and salinity, indicating effects of terrestrial-sediment runoff. Species response curves were derived from a plot of the number of individuals against the 1st axis of the db-RDA sites sample score. The response curves of Galathea mauritiana, an indicator species for the intermediate sites, were unimodal along the land-based pollution gradient. This study demonstrates the use of traps containing clean coral rubble for nondestructive quantitative sampling and environmental monitoring in coral lagoons, and their potential for monitoring changes in the reef environment.

  17. Rapid radiation and cryptic speciation in mediterranean triplefin blennies (Pisces: Tripterygiidae) combining multiple genes.

    Science.gov (United States)

    Carreras-Carbonell, Josep; Macpherson, Enrique; Pascual, Marta

    2005-12-01

    The genus Tripterygion is the unique genus of the family Tripterygiidae in the Mediterranean Sea and in the northeastern Atlantic coast. Three species and four subspecies had been described: Tripterygion tripteronotus and Tripterygion melanurus (T. m. melanurus and T. m. minor) are endemic of the Mediterranean, and T. delaisi (T. d. delaisi and T. d. xanthosoma) is found in both areas. We used five different genes (12S, 16S, tRNA-val, COI, and 18S) to elucidate their taxonomy status and their phylogenetic relationships. We employed different phylogenetic reconstructions that yielded different tree topologies. This discrepancy may be caused by the speciation process making difficult the reconstruction of a highly supported tree. All pair comparisons between these three species showed the same genetic divergence indicating that the speciation process could have been resolved by a rapid radiation event after the Messinian Salinity Crisis (5.2Mya) leading to a trichotomy. Our molecular data revealed two clearly supported clades within T. tripteronotus, whose divergence largely exceeded that found between other fish species, consequently these two groups should be considered two cryptic species diverging 2.75-3.32Mya along the Pliocene glaciations. On the contrary, none of the genes studied supported the existence of two subspecies of T. melanurus. Finally, the two subspecies of T. delaisi were validated and probably originated during the Quaternary climatic fluctuations (1.10-1.23Mya), however their distribution ranges should be redefined. PMID:15964768

  18. Cryptic diversity revealed by DNA barcoding in Colombian illegally traded bird species.

    Science.gov (United States)

    Mendoza, Ángela María; Torres, María Fernanda; Paz, Andrea; Trujillo-Arias, Natalia; López-Alvarez, Diana; Sierra, Socorro; Forero, Fernando; Gonzalez, Mailyn A

    2016-07-01

    Colombia is the country with the largest number of bird species worldwide, yet its avifauna is seriously threatened by habitat degradation and poaching. We built a DNA barcode library of nearly half of the bird species listed in the CITES appendices for Colombia, thereby constructing a species identification reference that will help in global efforts for controlling illegal species trade. We obtained the COI barcode sequence of 151 species based on 281 samples, representing 46% of CITES bird species registered for Colombia. The species analysed belong to nine families, where Trochilidae and Psittacidae are the most abundant ones. We sequenced for the first time the DNA barcode of 47 species, mainly hummingbirds endemic of the Northern Andes region. We found a correct match between morphological and genetic identification for 86-92% of the species analysed, depending on the cluster analysis performed (BIN, ABGD and TaxonDNA). Additionally, we identified eleven cases of high intraspecific divergence based on K2P genetic distances (up to 14.61%) that could reflect cryptic diversity. In these cases, the specimens were collected in geographically distant sites such as different mountain systems, opposite flanks of the mountain or different elevations. Likewise, we found two cases of possible hybridization and incomplete lineage sorting. This survey constitutes the first attempt to build the DNA barcode library of endangered bird species in Colombia establishing as a reference for management programs of illegal species trade, and providing major insights of phylogeographic structure that can guide future taxonomic research. PMID:26929271

  19. Small mammals as indicators of cryptic plant species diversity in the central Chilean plant endemicity hotspot

    Directory of Open Access Journals (Sweden)

    Meredith Root-Bernstein

    2014-12-01

    Full Text Available Indicator species could help to compensate for a shortfall of knowledge about the diversity and distributions of undersampled and cryptic species. This paper provides background knowledge about the ecological interactions that affect and are affected by herbaceous diversity in central Chile, as part of the indicator species selection process. We focus on the ecosystem engineering role of small mammals, primarily the degu Octodon degus. We also consider the interacting effects of shrubs, trees, avian activity, livestock, slope, and soil quality on herbaceous communities in central Chile. We sampled herbaceous diversity on a private landholding characterized by a mosaic of savanna, grassland and matorral, across a range of degu disturbance intensities. We find that the strongest factors affecting endemic herbaceous diversity are density of degu runways, shrub cover and avian activity. Our results show that the degu, a charismatic and easily identifiable and countable species, could be used as an indicator species to aid potential conservation actions such as private protected area uptake. We map areas in central Chile where degus may indicate endemic plant diversity. This area is larger than expected, and suggests that significant areas of endemic plant communities may still exist, and should be identified and protected.

  20. Uncovering cryptic species diversity of a termite community in a West African savanna.

    Science.gov (United States)

    Hausberger, Barbara; Kimpel, Dorothea; van Neer, Abbo; Korb, Judith

    2011-12-01

    To uncover the termite species diversity of a natural African savanna ecosystem, we combined morphological analyses and sequencing of three gene fragments (cytochrome oxidase I, cytochrome oxidase II and 28SrDNA, total length about 2450 bp) to infer putative species from phylogenetic trees. We identified 18 putative species clusters with high support values and which we retrieved consistently. Samples from two genera (Ancistrotermes and Microcerotermes) were excluded from the mitochondrial phylogenetic analyses as they might represent nuclear mitochondrial sequences (NUMTs). In total, our data suggest a species richness of at least 20 species, all but one belonging to the Termitidae (higher termites), and among them the fungus-growing Macrotermitinae were most prevalent with at least nine putative species. Within the fungus-growers the most species-rich genus was Microtermes and its four putative species were all cryptic species. Their abundance in the samples suggests that they play an important ecological role which is completely unstudied also due to the lack of reliable identification means. Our study shows that morphological traits are unreliable means of species identification for several termite taxa. Yet reliable and consistent identification is necessary for studying the functional role of termites in ecosystem and global processes.

  1. Habitat segregation and ecological character displacement in cryptic African malaria mosquitoes

    Science.gov (United States)

    Tene Fossog, Billy; Ayala, Diego; Acevedo, Pelayo; Kengne, Pierre; Ngomo Abeso Mebuy, Ignacio; Makanga, Boris; Magnus, Julie; Awono-Ambene, Parfait; Njiokou, Flobert; Pombi, Marco; Antonio-Nkondjio, Christophe; Paupy, Christophe; Besansky, Nora J; Costantini, Carlo

    2015-01-01

    Understanding how divergent selection generates adaptive phenotypic and population diversification provides a mechanistic explanation of speciation in recently separated species pairs. Towards this goal, we sought ecological gradients of divergence between the cryptic malaria vectors Anopheles coluzzii and An. gambiae and then looked for a physiological trait that may underlie such divergence. Using a large set of occurrence records and eco-geographic information, we built a distribution model to predict the predominance of the two species across their range of sympatry. Our model predicts two novel gradients along which the species segregate: distance from the coastline and altitude. Anopheles coluzzii showed a ‘bimodal’ distribution, predominating in xeric West African savannas and along the western coastal fringe of Africa. To test whether differences in salinity tolerance underlie this habitat segregation, we assessed the acute dose–mortality response to salinity of thirty-two larval populations from Central Africa. In agreement with its coastal predominance, Anopheles coluzzii was overall more tolerant than An. gambiae. Salinity tolerance of both species, however, converged in urban localities, presumably reflecting an adaptive response to osmotic stress from anthropogenic pollutants. When comparing degree of tolerance in conjunction with levels of syntopy, we found evidence of character displacement in this trait. PMID:25926878

  2. Escape from the cryptic species trap: lichen evolution on both sides of a cyanobacterial acquisition event.

    Science.gov (United States)

    Schneider, Kevin; Resl, Philipp; Spribille, Toby

    2016-07-01

    Large, architecturally complex lichen symbioses arose only a few times in evolution, increasing thallus size by orders of magnitude over those from which they evolved. The innovations that enabled symbiotic assemblages to acquire and maintain large sizes are unknown. We mapped morphometric data against an eight-locus fungal phylogeny across one of the best-sampled thallus size transition events, the origins of the Placopsis lichen symbiosis, and used a phylogenetic comparative framework to explore the role of nitrogen-fixing cyanobacteria in size differences. Thallus thickness increased by >150% and fruiting body core volume increased ninefold on average after acquisition of cyanobacteria. Volume of cyanobacteria-containing structures (cephalodia), once acquired, correlates with thallus thickness in both phylogenetic generalized least squares and phylogenetic generalized linear mixed-effects analyses. Our results suggest that the availability of nitrogen is an important factor in the formation of large thalli. Cyanobacterial symbiosis appears to have enabled lichens to overcome size constraints in oligotrophic environments such as acidic, rain-washed rock surfaces. In the case of the Placopsis fungal symbiont, this has led to an adaptive radiation of more than 60 recognized species from related crustose members of the genus Trapelia. Our data suggest that precyanobacterial symbiotic lineages were constrained to forming a narrow range of phenotypes, so-called cryptic species, leading systematists until now to recognize only six of the 13 species clusters we identified in Trapelia. PMID:27037681

  3. A cost of cryptic female choice in the yellow dung fly.

    Science.gov (United States)

    Ward, Paul I; Wilson, Alastair J; Reim, Constanze

    2008-09-01

    Female dung flies Scathophaga stercoraria (L.) store sperm from several males in three or four spermathecae. Selection on the number of spermathecae was successful and the morphological intermediate stages in the evolution from three to four spermathecae are illustrated. The genetic quality of a male from a female's perspective depends on an interaction between their genotypes and the microhabitat in which the offspring will grow. Females influence the paternity pattern of their offspring, and do this differently in different microhabitats. Females with four spermathecae are better able to influence paternity than are those with three spermathecae. However, there must be a cost to building and maintaining an extra spermatheca. We estimate, using the animal model on pedigree data, that this cost is approximately five eggs per clutch, i.e. around 8% of the mean clutch size. This is a substantial cost and such costs should not be ignored in discussions of the benefits to females of assessing the genetic qualities of their mating partners. We suggest that the number of spermathecae in the study population is stable because the relative benefits in quality of offspring through cryptic female choice is balanced by the costs in total numbers of offspring.

  4. Cryptic sex? Estimates of genome exchange in unisexual mole salamanders (Ambystoma sp.).

    Science.gov (United States)

    Gibbs, H Lisle; Denton, Robert D

    2016-06-01

    Cryptic sex has been argued to explain the exceptional longevity of certain parthenogenetic vertebrate lineages, yet direct measurements of genetic exchange between sexual and apparently parthenogenetic forms are rare. Female unisexual mole salamanders (Ambystoma sp.) are the oldest known unisexual vertebrate lineage (~5 million years), and one hypothesis for their persistence is that allopolyploid female unisexuals periodically exchange haploid genomes 'genome exchange' during gynogenetic reproduction with males from sympatric sexual species. We test this hypothesis by using genome-specific microsatellite DNA markers to estimate the rates of genome exchange between sexual males and unisexual females in two ponds in NE Ohio. We also test the prediction that levels of gene flow should be higher for 'sympatric' (sexual males present) genomes in unisexuals compared to 'allopatric' (sexual males absent) unisexual genomes. We used a model testing framework in the coalescent-based program MIGRATE-N to compare models where unidirectional gene flow is present and absent between sexual species and unisexuals. As predicted, our results show higher levels of gene flow between sexuals and sympatric unisexual genomes compared to lower (likely artefactual) levels of gene flow between sexuals and allopatric unisexual genomes. Our results provide direct evidence that genome exchange between sexual and unisexual Ambystoma occurs and demonstrate that the magnitude depends on which sexual species are present. The relatively high levels of gene flow suggest that unisexuals must be at a selective advantage over sexual forms so as to avoid extinction due to genetic swamping through genome exchange. PMID:27100619

  5. Cryptic organisation within an apparently irregular rostrocaudal distribution of interneurons in the embryonic zebrafish spinal cord

    Energy Technology Data Exchange (ETDEWEB)

    Wells, Simon, E-mail: simon.wells@adelaide.edu.au [Discipline of Genetics, School of Molecular and Biomedical Sciences, University of Adelaide, Adelaide, South Australia 5005 (Australia); The Special Research Centre for the Molecular Genetics of Development, University of Adelaide, Adelaide, South Australia 5005 (Australia); Conran, John G., E-mail: john.conran@adelaide.edu.au [Ecology and Evolutionary Biology, School of Earth and Environmental Sciences, University of Adelaide, Adelaide, South Australia 5005 (Australia); Tamme, Richard, E-mail: rtamme@ttu.ee [Discipline of Genetics, School of Molecular and Biomedical Sciences, University of Adelaide, Adelaide, South Australia 5005 (Australia); Gaudin, Arnaud, E-mail: a.gaudin@uq.edu.au [School of Biomedical Sciences, University of Queensland, Brisbane, Queensland 4072 (Australia); Webb, Jonathan, E-mail: jonathan.webb@worc.ox.ac.uk [Discipline of Genetics, School of Molecular and Biomedical Sciences, University of Adelaide, Adelaide, South Australia 5005 (Australia); Lardelli, Michael, E-mail: michael.lardelli@adelaide.edu.au [Discipline of Genetics, School of Molecular and Biomedical Sciences, University of Adelaide, Adelaide, South Australia 5005 (Australia); The Special Research Centre for the Molecular Genetics of Development, University of Adelaide, Adelaide, South Australia 5005 (Australia)

    2010-11-15

    The molecules and mechanisms involved in patterning the dorsoventral axis of the developing vertebrate spinal cord have been investigated extensively and many are well known. Conversely, knowledge of mechanisms patterning cellular distributions along the rostrocaudal axis is relatively more restricted. Much is known about the rostrocaudal distribution of motoneurons and spinal cord cells derived from neural crest but there is little known about the rostrocaudal patterning of most of the other spinal cord neurons. Here we report data from our analyses of the distribution of dorsal longitudinal ascending (DoLA) interneurons in the developing zebrafish spinal cord. We show that, although apparently distributed irregularly, these cells have cryptic organisation. We present a novel cell-labelling technique that reveals that DoLA interneurons migrate rostrally along the dorsal longitudinal fasciculus of the spinal cord during development. This cell-labelling strategy may be useful for in vivo analysis of factors controlling neuron migration in the central nervous system. Additionally, we show that DoLA interneurons persist in the developing spinal cord for longer than previously reported. These findings illustrate the need to investigate factors and mechanisms that determine 'irregular' patterns of cell distribution, particularly in the central nervous system but also in other tissues of developing embryos.

  6. Differential responses to woodland character and landscape context by cryptic bats in urban environments.

    Science.gov (United States)

    Lintott, Paul R; Bunnefeld, Nils; Minderman, Jeroen; Fuentes-Montemayor, Elisa; Mayhew, Rebekah J; Olley, Lena; Park, Kirsty J

    2015-01-01

    Urbanisation is one of the most dramatic forms of land use change which relatively few species can adapt to. Determining how and why species respond differently to urban habitats is important in predicting future biodiversity loss as urban areas rapidly expand. Understanding how morphological or behavioural traits can influence species adaptability to the built environment may enable us to improve the effectiveness of conservation efforts. Although many bat species are able to exploit human resources, bat species richness generally declines with increasing urbanisation and there is considerable variation in the responses of different bat species to urbanisation. Here, we use acoustic recordings from two cryptic, and largely sympatric European bat species to assess differential responses in their use of fragmented urban woodland and the surrounding urban matrix. There was a high probability of P. pygmaeus activity relative to P. pipistrellus in woodlands with low clutter and understory cover which were surrounded by low levels of built environment. Additionally, the probability of recording P. pygmaeus relative to P. pipistrellus was considerably higher in urban woodland interior or edge habitat in contrast to urban grey or non-wooded green space. These results show differential habitat use occurring between two morphologically similar species; whilst the underlying mechanism for this partitioning is unknown it may be driven by competition avoidance over foraging resources. Their differing response to urbanisation indicates the difficulties involved when attempting to assess how adaptable a species is to urbanisation for conservation purposes. PMID:25978034

  7. Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina).

    Science.gov (United States)

    Seraphim, N; Marín, M A; Freitas, A V L; Silva-Brandão, K L

    2014-01-01

    The genus Hermeuptychia is common and widespread through the Americas, from Argentina to the southern United States of America. All eight recognized species within Hermeuptychia are small and brown, with very similar interspecific external morphologies and intraspecifically variable ocelli patterns that render taxonomic identification based on morphology difficult. In our study, we surveyed variability within Hermeuptychia, and evaluated species boundaries based on molecular data (sequences of the 'barcode' mitochondrial DNA COI gene) and morphology (mainly male genitalia), using a phylogenetic approach. We found eight DNA-based and 12 morphological groups in our sampling. Species names were assigned based mainly on comparisons with male genitalia morphology descriptions corresponding to name-bearing type specimens. Morphological and DNA variability were highly congruent, with the exception of group H, the Hermeuptychia cucullina complex. Also, the barcode region showed a clear threshold for intra- and interspecific mean distances around 2%. Based on these results, we circumscribe the species boundaries in the genus Hermeuptychia and discuss conflicts between mitochondrial genes and classic morphological approaches for identifying and delimiting species. Our study revealed cryptic diversity within an ubiquitous genus of Neotropical butterflies. PMID:24034669

  8. Spawning segregation and philopatry are major prezygotic barriers in sympatric cryptic Mugil cephalus species.

    Science.gov (United States)

    Shen, Kang-Ning; Chang, Chih-Wei; Durand, Jean-Dominique

    2015-12-01

    The flathead mullet, Mugil cephalus, is a commercially vital fish in fisheries and aquaculture worldwide. Genetic analyses have recently revealed three cryptic species of M. cephalus in the Northwest Pacific. These species are sympatric in Taiwanese waters and specific reproductive behaviors have been suggested to be a major prezygotic barrier. Species composition was evaluated in samples of M. cephalus at different growth stages collected from various habitats (offshore spawning ground, estuarine nursery and feeding areas) over several months or years. The gonadosomatic index of adults and the body length of juveniles were recorded to determine the reproductive season and recruitment periods in estuaries. The results revealed partially temporal spawning isolation between species pairs, spatial segregation on specific spawning grounds and strong philopatry preclude hybridization. Thus, the results imply that traditional fisheries of mature fish in the Taiwan Strait target only one species, whereas aquaculture in Taiwan contain juveniles of all three species collected in estuaries. The ecological niche and demography of these species must be investigated further to estimate the impact of juvenile sources on aquaculture. PMID:26563557

  9. Colour patterns do not diagnose species: quantitative evaluation of a DNA barcoded cryptic bumblebee complex.

    Directory of Open Access Journals (Sweden)

    James C Carolan

    Full Text Available Cryptic diversity within bumblebees (Bombus has the potential to undermine crucial conservation efforts designed to reverse the observed decline in many bumblebee species worldwide. Central to such efforts is the ability to correctly recognise and diagnose species. The B. lucorum complex (Bombus lucorum, B. cryptarum and B. magnus comprises one of the most abundant and important group of wild plant and crop pollinators in northern Europe. Although the workers of these species are notoriously difficult to diagnose morphologically, it has been claimed that queens are readily diagnosable from morphological characters. Here we assess the value of colour-pattern characters in species identification of DNA-barcoded queens from the B. lucorum complex. Three distinct molecular operational taxonomic units were identified each representing one species. However, no uniquely diagnostic colour-pattern character state was found for any of these three molecular units and most colour-pattern characters showed continuous variation among the units. All characters previously deemed to be unique and diagnostic for one species were displayed by specimens molecularly identified as a different species. These results presented here raise questions on the reliability of species determinations in previous studies and highlights the benefits of implementing DNA barcoding prior to ecological, taxonomic and conservation studies of these important key pollinators.

  10. DNA Barcode Analysis of Thrips (Thysanoptera) Diversity in Pakistan Reveals Cryptic Species Complexes.

    Science.gov (United States)

    Iftikhar, Romana; Ashfaq, Muhammad; Rasool, Akhtar; Hebert, Paul D N

    2016-01-01

    Although thrips are globally important crop pests and vectors of viral disease, species identifications are difficult because of their small size and inconspicuous morphological differences. Sequence variation in the mitochondrial COI-5' (DNA barcode) region has proven effective for the identification of species in many groups of insect pests. We analyzed barcode sequence variation among 471 thrips from various plant hosts in north-central Pakistan. The Barcode Index Number (BIN) system assigned these sequences to 55 BINs, while the Automatic Barcode Gap Discovery detected 56 partitions, a count that coincided with the number of monophyletic lineages recognized by Neighbor-Joining analysis and Bayesian inference. Congeneric species showed an average of 19% sequence divergence (range = 5.6% - 27%) at COI, while intraspecific distances averaged 0.6% (range = 0.0% - 7.6%). BIN analysis suggested that all intraspecific divergence >3.0% actually involved a species complex. In fact, sequences for three major pest species (Haplothrips reuteri, Thrips palmi, Thrips tabaci), and one predatory thrips (Aeolothrips intermedius) showed deep intraspecific divergences, providing evidence that each is a cryptic species complex. The study compiles the first barcode reference library for the thrips of Pakistan, and examines global haplotype diversity in four important pest thrips. PMID:26741134

  11. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  12. Ecomorphology and disease: cryptic effects of parasitism on host habitat use, thermoregulation, and predator avoidance.

    Science.gov (United States)

    Goodman, Brett A; Johnson, Pieter T J

    2011-03-01

    Parasites can cause dramatic changes in the phenotypes of their hosts, sometimes leading to a higher probability of predation and parasite transmission. Because an organism's morphology directly affects its locomotion, even subtle changes in key morphological traits may affect survival and behavior. However, despite the ubiquity of parasites in natural communities, few studies have incorporated parasites into ecomorphological research. Here, we evaluated the effects of parasite-induced changes in host phenotype on the habitat use, thermal biology, and simulated predator-escape ability of Pacific chorus frogs (Pseudacris regilla) in natural environments. Frogs with parasite-induced limb malformations were more likely to use ground microhabitats relative to vertical refugia and selected less-angled perches closer to the ground in comparison with normal frogs. Although both groups had similar levels of infection, malformed frogs used warmer microhabitats, which resulted in higher body temperatures. Likely as a result of their morphological abnormalities, malformed frogs allowed a simulated predator to approach closer before escaping and escaped shorter distances relative to normal frogs. These data indicate that parasite-induced morphological changes can significantly alter host behavior and habitat use, highlighting the importance of incorporating the ubiquitous, albeit cryptic, role of parasites into ecomorphological research. PMID:21608461

  13. Novel Infection Site and Ecology of Cryptic Didymocystis sp. (Trematoda) in the Fish Scomberomorus maculatus.

    Science.gov (United States)

    Schrandt, Meagan N; Andres, Michael J; Powers, Sean P; Overstreet, Robin M

    2016-06-01

    An undescribed, cryptic species of Didymocystis, as determined from sequences of 2 ribosomal genes and superficially similar to Didymocystis scomberomori ( MacCallum and MacCallum, 1916 ), infected the skin of the Spanish mackerel, Scomberomorus maculatus , in the north-central Gulf of Mexico (GOM). An analysis of 558 fish from 2011 to 2013 from Louisiana, Mississippi, Alabama, and the Florida panhandle showed the prevalence of the trematode varied both spatially and temporally but not with sex of the fish host. Month, year, and geographic location were identified by a negative binomial generalized linear model as indicators of the abundance and intensity of infection. Prevalence, abundance, and intensity of infection were greatest in spring and fall months off the Florida panhandle. Furthermore, the abundance and intensity of infection correlated negatively with fork length, weight, and gonad weight of mature fish but positively with longitude. Therefore, smaller adult fish tended to be more infected than larger adults, and prevalence and intensity increased from west to east (Louisiana to Florida). Spatial and temporal trends seemed to result from physical factors (e.g., water temperature, salinity, bottom type), but they also coincided with the annual migration of S. maculatus as fish moved northward along the GOM coastline from the southern tip of Florida in the spring months and returned in the fall, being present in the north-central GOM from late spring through fall. This pattern suggests the possibility that acquisition of infections occurred from a molluscan host in waters off the Florida panhandle. PMID:26981762

  14. Hiding in Plain Sight: A Case for Cryptic Metapopulations in Brook Trout (Salvelinus fontinalis.

    Directory of Open Access Journals (Sweden)

    David C Kazyak

    Full Text Available A fundamental issue in the management and conservation of biodiversity is how to define a population. Spatially contiguous fish occupying a stream network have often been considered to represent a single, homogenous population. However, they may also represent multiple discrete populations, a single population with genetic isolation-by-distance, or a metapopulation. We used microsatellite DNA and a large-scale mark-recapture study to assess population structure in a spatially contiguous sample of Brook Trout (Salvelinus fontinalis, a species of conservation concern. We found evidence for limited genetic exchange across small spatial scales and in the absence of barriers to physical movement. Mark-recapture and stationary passive integrated transponder antenna records demonstrated that fish from two tributaries very seldom moved into the opposite tributary, but movements between the tributaries and mainstem were more common. Using Bayesian genetic clustering, we identified two genetic groups that exhibited significantly different growth rates over three years of study, yet survival rates were very similar. Our study highlights the importance of considering the possibility of multiple genetically distinct populations occurring within spatially contiguous habitats, and suggests the existence of a cryptic metapopulation: a spatially continuous distribution of organisms exhibiting metapopulation-like behaviors.

  15. Differential responses to woodland character and landscape context by cryptic bats in urban environments.

    Directory of Open Access Journals (Sweden)

    Paul R Lintott

    Full Text Available Urbanisation is one of the most dramatic forms of land use change which relatively few species can adapt to. Determining how and why species respond differently to urban habitats is important in predicting future biodiversity loss as urban areas rapidly expand. Understanding how morphological or behavioural traits can influence species adaptability to the built environment may enable us to improve the effectiveness of conservation efforts. Although many bat species are able to exploit human resources, bat species richness generally declines with increasing urbanisation and there is considerable variation in the responses of different bat species to urbanisation. Here, we use acoustic recordings from two cryptic, and largely sympatric European bat species to assess differential responses in their use of fragmented urban woodland and the surrounding urban matrix. There was a high probability of P. pygmaeus activity relative to P. pipistrellus in woodlands with low clutter and understory cover which were surrounded by low levels of built environment. Additionally, the probability of recording P. pygmaeus relative to P. pipistrellus was considerably higher in urban woodland interior or edge habitat in contrast to urban grey or non-wooded green space. These results show differential habitat use occurring between two morphologically similar species; whilst the underlying mechanism for this partitioning is unknown it may be driven by competition avoidance over foraging resources. Their differing response to urbanisation indicates the difficulties involved when attempting to assess how adaptable a species is to urbanisation for conservation purposes.

  16. The first molecular phylogeny of Chilodontidae (Teleostei: Ostariophysi: Characiformes) reveals cryptic biodiversity and taxonomic uncertainty.

    Science.gov (United States)

    Melo, Bruno F; Sidlauskas, Brian L; Hoekzema, Kendra; Vari, Richard P; Oliveira, Claudio

    2014-01-01

    Chilodontidae is a small family of eight described characiform species popularly known as headstanders. These small to moderately sized fishes are well known to aquarists, who prize their striking spotted pigmentation and unusual behaviors, and to systematists, who have revised both chilodontid genera in recent memory and studied their phylogenetic relationships using a comprehensive morphological dataset. However, no molecular phylogeny for the family has ever been proposed. Here, we reconstruct phylogenetic relationships for all eight known chilodontid species using three mitochondrial and two nuclear loci. Results largely agree with the previous morphological hypothesis, and confirm the monophyly of the family as well as its included genera, Caenotropus and Chilodus. The molecular topology differs slightly from the morphological hypothesis by placing Caenotropus maculosus rather than C. mestomorgmatos as the sister to the remaining three congeners, and by reconstructing the Curimatidae as the closest outgroup family, rather than the Anostomidae. However, the topologies supported by the morphological data were only slightly less likely and could not be rejected via Shimodaira-Hasegawa tests. Within Chilodus, two described species with distinctive pigmentation (C. fritillus and C. zunevei) appear embedded within the broad distributed C. punctatus clade, suggesting the presence of cryptic taxa with polymorphic pigmentation within the present concept of C. punctatus. Future work should combine morphological and molecular data to revisit the taxonomy and systematics of Chilodus and determine species limits within the C. punctatus-group sensu lato.

  17. Cryptic differentiation in the endemic micromoth Galagete darwini (Lepidoptera, Autostichidae) on Galápagos volcanoes.

    Science.gov (United States)

    Schmitz, Patrick; Cibois, Alice; Landry, Bernard

    2008-10-27

    To gain insight into the early stages of speciation, we reconstructed a DNA-based phylogeny, using combined mitochondrial (cytochrome c oxidase subunits I and II: 1008 bp) and nuclear (elongation factor 1-alpha and wingless: 1062 bp) markers of populations of the moth Galagete darwini endemic to the Galápagos, which belongs to an insular radiation similar in size to that of Darwin's finches. Adults of G. darwini were collected in the arid lowlands of 11 of the Galápagos Islands (Baltra, Española, Fernandina, Floreana, Isabela, Pinta, Pinzón, San Cristobal, Santa Cruz, Santiago and Seymour) and the humid highlands of a subset of 5 of them (Fernandina, Floreana, Isabela, Santa Cruz and Santiago). The combined phylogeographic analysis surprisingly revealed that G. darwini populations at higher elevation on the western islands (Fernandina, Isabela and Santiago) represent a distinct lineage from the one in the low arid zones of these same islands. This is the first reported case in the archipelago of genetic cryptic differentiation correlated with elevation on the western Galápagos volcanoes.

  18. Multiple cryptic species of sympatric generalists within the avian blood parasite Haemoproteus majoris.

    Science.gov (United States)

    Nilsson, E; Taubert, H; Hellgren, O; Huang, X; Palinauskas, V; Markovets, M Y; Valkiūnas, G; Bensch, S

    2016-09-01

    The avian haemosporidian parasite Haemoproteus majoris has been reported to infect a wide range of passerine birds throughout the Holarctic ecozone. Five cytochrome b (cyt b) lineages have been described as belonging to the morphological species H. majoris, and these form a tight phylogenetic cluster together with 13 undescribed lineages that differ from each other by < 1.2% in sequence divergence. Records in a database (MalAvi) that contains global findings of haemosporidian lineages generated by universal primers suggest that these lineages vary substantially in host distribution. We confirm this pattern in a data set collected at Lake Kvismaren, Sweden, where three of the generalist lineages have local transmission. However, whether these lineages represent intraspecific mitochondrial diversity or clusters of cryptic species has previously not been examined. In this study, we developed novel molecular markers to amplify the partial segments of four nuclear genes to determine the level of genetic diversity and gene phylogenies among the five morphologically described cyt b lineages of H. majoris. All five cyt b lineages were strongly associated with unique nuclear alleles at all four nuclear loci, indicating that each mitochondrial lineage represents a distinct biological species. Within lineages, there was no apparent association between nuclear alleles and host species, indicating that they form genetically unstructured populations across multiple host species. PMID:27262030

  19. LOVE IS COLOR BLIND

    Institute of Scientific and Technical Information of China (English)

    陈梦扬

    2013-01-01

    <正>看完这部电影,突然想起小时候看完《辛德勒的名单》后,问过母亲一个问题:"为什么有些人要嘲笑和歧视那些与众不同的人?"母亲告诉我:"我们都是一样的,没有人应当受到责备,每个人都应当为自己而活,要始终坚信‘Love is color blind(爱无定界)’。"爱究竟有无定界?有太多故事让我们相信这句话并非纸上谈兵。《汤姆叔叔的小屋》、《美国往事》、《为黛西小姐开车》……是的,"Love"是"Listen(倾听)",是无条件无偏见地倾听对方的需求,并予以协助;是"Obligate(感恩)",需要不断地感恩,付出爱来灌

  20. Development of softcopy environment for primary color banding visibility assessment

    Science.gov (United States)

    Min, Byungseok; Pizlo, Zygmunt; Allebach, Jan P.

    2008-01-01

    Fine-pitch banding is one of the most unwanted artifacts in laser electrophotographic (EP) printers. It is perceived as a quasiperiodic fluctuation in the process direction. Therefore, it is essential for printer vendors to know how banding is perceived by humans in order to improve print quality. Monochrome banding has been analyzed and assessed by many researchers; but there is no literature that deals with the banding of color laser printers as measured from actual prints. The study of color banding is complicated by the fact that the color banding signal is physically defined in a three-dimensional color space, while banding perception is described in a one-dimensional sense such as more banding or less banding. In addition, the color banding signal arises from the independent contributions of the four primary colorant banding signals. It is not known how these four distinct signals combine to give rise to the perception of color banding. In this paper, we develop a methodology to assess the banding visibility of the primary colorant cyan based on human visual perception. This is our first step toward studying the more general problem of color banding in combinations of two or more colorants. According to our method, we print and scan the cyan test patch, and extract the banding profile as a one dimensional signal so that we can freely adjust the intensity of banding. Thereafter, by exploiting the pulse width modulation capability of the laser printer, the extracted banding profile is used to modulate a pattern consisting of periodic lines oriented in the process direction, to generate extrinsic banding. This avoids the effect of the halftoning algorithm on the banding. Furthermore, to conduct various banding assessments more efficiently, we also develop a softcopy environment that emulates a hardcopy image on a calibrated monitor, which requires highly accurate device calibration throughout the whole system. To achieve the same color appearance as the hardcopy

  1. METAPHOR OF COLORS IN INDONESIAN

    Directory of Open Access Journals (Sweden)

    I Dewa Putu Wijana

    2015-02-01

    Full Text Available This brief article deals with the use of Indonesian words referring to colors for creating metaphorical expressions. All data presented are collected from various sources, such as Kamus Besar Bahasa Indonesia (Indonesian Standard Dictionary, and added with data obtained from Oxford Advanced Leaner’s Dictionary, Indonesian proverb book, encyclopedia, terminology collection book, poetry anthology, song lyrics, and data of the author’s own creation as an Indonesian native speaker. Set aside from their literal meanings, the metaphorically used color words are collected and classified into two categories, i.e. achromatic and chromatic colors. Then, their universalities are determined by comparing them with English color metaphors. Finally the existence of specific Indonesian color metaphors are identified by correlating them with extra linguistic factors, such as environment, history, religion, politic and other socio cultural activities. A careful analysis on the data shows that there is nearly no significant difference in metaphorical uses of achromatic colors in English and Indonesian. However, despite universal nuances of chromatic color metaphors, some specific ones emerge due to various external factors, such as environment, education, history, politic, law, religion, literature, and other socio cultural facts that are specifically found and practiced in Indonesia.

  2. Color contrast processing in human striate cortex

    OpenAIRE

    Kentridge, R. W.; Heywood, C. A.; Weiskrantz, L.

    2007-01-01

    Color constancy refers to the unchanging nature of the perceived color of an object despite considerable variation in the wavelength composition of the light illuminating it. The color contrasts between objects and their backgrounds play a crucial role in color constancy. We tested a patient whose right striate cortex had been removed and demonstrated that he made no use of color contrast in judging color appearance but instead made judgments based simply on wavelength comparison. This was sh...

  3. Symbolism of Colors in English

    Institute of Scientific and Technical Information of China (English)

    李蔚

    2013-01-01

    There are so many words to convey different colors in English. We should pay attention to not only their basic mean-ing, but also their deeply symbolized meaning. They express different meaning owing to different cultures. In western society, col-ors have their exotic symbolized meaning. This is a permanent cultural phenomenon. In the thesis, the author discusses the sym-bolic meaning of five basic colors:red, white, black, yellow and green, and the background of the symbolic meaning of each col-or.Color is very close to people’s life. It is important for people to understand the world. Colors not only have physical character, but also have rich intension and stretchy meanings. People of different nations often have different feeling about the same color as a result of their different cultural and historical background. So colors show differences between different cultures. The author dis-cusses seven main reasons that lead to the differences of colors’symbolic meaning between Chinese and western culture, such as different political systems, different historic vicissitudes, different cultural tradition and custom, different habits of thinking and way of expressing, different natural environments and living standards, different mentality, different emotion. These words are used frequently and have plenty of sentiment. What should pay more attention to is that because of the differences between differ-ent nationalities and cultural background, or different social classes, each color has its special meaning. It is active in terms of lin-guistics. That endows color words with associative meaning.

  4. Symbolic Significance of Colors in the Novel The Color Purple

    Institute of Scientific and Technical Information of China (English)

    王卓珏

    2007-01-01

    This paper mainly explains the symbolic significance of colors in the novel The Color Purple by using theory of Alice Walker's Womaism. Black,in The Color Purple stands for humbleness,blue for a life of impulse,red for liberty and hope ,purple for women's consummate happiness. And the choice of "purple" as its title ,conceives a purple centered symbolic color system,which reveals the black women's expectation for living an ideal happy life. Walker gives an expression of black women's political condition ,state of life under the racial and sexual oppression. Her intentions are to arouse women's consciousness of self and to call on them to be self-respected ,self-supported and eventually be self-liberated.

  5. Modules Over Color Hom-Poisson Algebras

    OpenAIRE

    Bakayoko, Ibrahima

    2014-01-01

    In this paper we introduce color Hom-Poisson algebras and show that every color Hom-associative algebra has a non-commutative Hom-Poisson algebra structure in which the Hom-Poisson bracket is the commutator bracket. Then we show that color Poisson algebras (respectively morphism of color Poisson algebras) turn to color Hom-Poisson algebras (respectively morphism of Color Hom-Poisson algebras) by twisting the color Poisson structure. Next we prove that modules over color Hom–associative algebr...

  6. Improved bound on facial parity edge coloring

    OpenAIRE

    Lužar, Borut; Škrekovski, Riste

    2013-01-01

    A facial parity edge coloring of a 2-edge connected plane graph is an edge coloring where no two consecutive edges of a facial walk of any face receive the same color. Additionally, for every face f and every color c either no edge or an odd number of edges incident to f are colored by c. Czap, Jendrol', Kardo\\v{s} and Sotak showed that every 2-edge connected plane graph admits a facial parity edge coloring with at most 20 colors. We improve this bound to 16 colors.

  7. Color Energy Of A Unitary Cayley Graph

    Directory of Open Access Journals (Sweden)

    Adiga Chandrashekar

    2014-11-01

    Full Text Available Let G be a vertex colored graph. The minimum number χ(G of colors needed for coloring of a graph G is called the chromatic number. Recently, Adiga et al. [1] have introduced the concept of color energy of a graph Ec(G and computed the color energy of few families of graphs with χ(G colors. In this paper we derive explicit formulas for the color energies of the unitary Cayley graph Xn, the complement of the colored unitary Cayley graph (Xnc and some gcd-graphs.

  8. Filter-free image sensor pixels comprising silicon nanowires with selective color absorption.

    Science.gov (United States)

    Park, Hyunsung; Dan, Yaping; Seo, Kwanyong; Yu, Young J; Duane, Peter K; Wober, Munib; Crozier, Kenneth B

    2014-01-01

    The organic dye filters of conventional color image sensors achieve the red/green/blue response needed for color imaging, but have disadvantages related to durability, low absorption coefficient, and fabrication complexity. Here, we report a new paradigm for color imaging based on all-silicon nanowire devices and no filters. We fabricate pixels consisting of vertical silicon nanowires with integrated photodetectors, demonstrate that their spectral sensitivities are governed by nanowire radius, and perform color imaging. Our approach is conceptually different from filter-based methods, as absorbed light is converted to photocurrent, ultimately presenting the opportunity for very high photon efficiency. PMID:24588103

  9. A Review of Studies on Color Preference%颜色偏好研究进展

    Institute of Scientific and Technical Information of China (English)

    孙青青; 陈本友; 赵伶俐

    2011-01-01

    .Usually people used geometry color cards,color words to research color,and meaningful geometry color cards,life items to study specific color.Both required the subjects to choose their favor colors or to rank colors according to their preference.color preference research reveals people's general color preferences.Specific color preference reflects the favorite color of particular objects in life,highlighting the relationship between the subject and the object.Compared with the study of color preference,specific color preference is more specific and practical.The studies have found that people show preference for both,but neither is the same,and the favorite colors of different objects are also different.Color preference is influenced by many factors,such as personality,gender,age,nationality, etc.Researchers have made different theoretical interpretation of color preference such as biological mechanism,color emotion, and put forward the ecological valence theory.Although the researches have achieved a lot,some limitations have been found in the previous research's content,materials and subjects.Research content is simple:people often not only accept monochrome in their daily life,but face more complex stimulations.Therefore,only monochrome color preference research is not enough.Future research should use much more complex color materials.Furthermore,the research neglected color attributes,color appearance modes,and environment, which may affect color preferences.In addition,most of researches adopted subjective survey methods.Recently,the research use more objective methods,such as eye movements,which may be the research direction in the future.

  10. Autophagy supports color vision.

    Science.gov (United States)

    Zhou, Zhenqing; Vinberg, Frans; Schottler, Frank; Doggett, Teresa A; Kefalov, Vladimir J; Ferguson, Thomas A

    2015-01-01

    Cones comprise only a small portion of the photoreceptors in mammalian retinas. However, cones are vital for color vision and visual perception, and their loss severely diminishes the quality of life for patients with retinal degenerative diseases. Cones function in bright light and have higher demand for energy than rods; yet, the mechanisms that support the energy requirements of cones are poorly understood. One such pathway that potentially could sustain cones under basal and stress conditions is macroautophagy. We addressed the role of macroautophagy in cones by examining how the genetic block of this pathway affects the structural integrity, survival, and function of these neurons. We found that macroautophagy was not detectable in cones under normal conditions but was readily observed following 24 h of fasting. Consistent with this, starvation induced phosphorylation of AMPK specifically in cones indicating cellular starvation. Inhibiting macroautophagy in cones by deleting the essential macroautophagy gene Atg5 led to reduced cone function following starvation suggesting that cones are sensitive to systemic changes in nutrients and activate macroautophagy to maintain their function. ATG5-deficiency rendered cones susceptible to light-induced damage and caused accumulation of damaged mitochondria in the inner segments, shortening of the outer segments, and degeneration of all cone types, revealing the importance of mitophagy in supporting cone metabolic needs. Our results demonstrate that macroautophagy supports the function and long-term survival of cones providing for their unique metabolic requirements and resistance to stress. Targeting macroautophagy has the potential to preserve cone-mediated vision during retinal degenerative diseases.

  11. Semantics of color in chromatism

    Science.gov (United States)

    Serov, Nikolai V.

    2002-06-01

    The aim of this investigation is to describe the semantics of color in chromatism (from the ancient Greek triune notion of >: (1) color as ideal (Id- plan), psychic; (2) tint as physical, verbal; material (M- plan), physiological, syntonic (S-plan), and (3) emotion as their informative-energetic correlation). Being a new field of science, chromatism links humanitarian and natural subjects by means of interdiscipline investigation of a real (f-m) man living in a real (color) surrounding environment. According to the definition for >, color may be considered to be the most universal notion, permitting to assume the unity of both a man and an environment. Due to this assumption, we may give models of human intellect.

  12. Crystalline color superconductors: A review

    CERN Document Server

    Anglani, Roberto; Ciminale, Marco; Gatto, Raoul; Ippolito, Nicola; Mannarelli, Massimo; Ruggieri, Marco

    2013-01-01

    Non-homogenous superconductors and non-homogenous superfluids appear in a variety of contexts which include quark matter at extreme densities, fermionic systems of cold atoms, type-II cuprates and organic superconductors. In the present review we shall focus on the properties of quark matter at high baryonic density which can exist in the interior of compact stars. The conditions that are realized in this stellar objects tend to disfavor standard symmetric BCS pairing and may be in favor of a non-homogenous color superconducting phase. We discuss in details the properties of non-homogenous color superconductors and in particular of crystalline color superconductors. We also review the possible astrophysical signatures associated with the presence of non-homogenous color superconducting phases within the core of compact stars.

  13. Retrieval for color artistry concepts.

    Science.gov (United States)

    Lay, Jose A; Guan, Ling

    2004-03-01

    This paper presents a work on the retrieval of artworks for color artistry concepts. First we affirm the view that the Query-by-Example paradigm fundamental to the current content-based retrieval systems is able to extend only limited usefulness. We then propose a concept-based retrieval engine based on the generative grammar of elemental concepts methodology. In the latter, the language by which color artistry concepts are communicated in artworks is used to operate semantic searches. The color artistry language is explicated into elemental concepts and the associated generative grammar. The elemental concepts are used to index the artworks, while the generative grammar is used to facilitate post-coordinate expression of color artistry concept queries by using the elemental concepts. PMID:15376925

  14. Solid phase based DNA solution of the coloring problem

    Institute of Scientific and Technical Information of China (English)

    PAN Linqiang; LIU Guangwu; XU Jin; LIU Yachun

    2004-01-01

    DNA computing has the potential to tackle computationally difficult problems that have real-world implications.The parallel search capabilities of DNA make it a valuable tool for approaching intractable computational problems,for which conventional computers have limited potentials.Up to now,many accomplishments have been achieved to improve its performance and increase its reliability.In this paper,the coloring problem has been solved by means of molecular biology techniques.The coloring problem is a well-known NP-complete problem.This work represents further evidence for the ability of DNA computing to solve NP-complete problems.

  15. Riemann Geometric Color-Weak Compensationfor Individual Observers

    OpenAIRE

    Kojima, Takanori; Mochizuki, Rika; Lenz, Reiner; Chao, Jinhui

    2014-01-01

    We extend a method for color weak compensation based on the criterion of preservation of subjective color differences between color normal and color weak observers presented in [2]. We introduce a new algorithm for color weak compensation using local affine maps between color spaces of color normal and color weak observers. We show howto estimate the local affine map and how to determine correspondences between the origins of local coordinates in color spaces of color normal and color weak ob...

  16. Color-flavor locked strangelets

    OpenAIRE

    Madsen, Jes

    2001-01-01

    Finite lumps of color-flavor locked strange quark matter (CFL-strangelets) are significantly more stable than strangelets without color-flavor locking for wide ranges of parameters, increasing the likelihood of strangelet metastability, or even absolute stability beyond some minimum baryon number $A_{min}$. Whereas bulk CFL strange quark matter is electrically neutral, CFL-strangelets are positively charged, with $Z\\approx 0.3 A^{2/3}$. This is quite different from ``ordinary'' strangelets an...

  17. A color sensor wavelength meter

    Science.gov (United States)

    Durfee, Dallin; Jackson, Jarom; Otterstrom, Nils; Jones, Tyler; Archibald, James

    2016-05-01

    We will discuss a laser wavelength meter based on a commercial color sensor chip consisting of an array of photodiodes with different absorptive color filters. By comparing the relative amplitudes of light on the photodiodes, the wavelength of light can be determined with picometer-level precision and with picometer-scale calibration drift over a period longer than a month. This work was supported by NSF Grant Number PHY-1205736.

  18. The color lexicon of the Somali language.

    Science.gov (United States)

    Brown, Angela M; Isse, Abdirizak; Lindsey, Delwin T

    2016-01-01

    This empirical study had three goals: (a) to describe Somali color naming and its motifs, (b) to relate color naming by Somali informants to their color vision, and (c) to search for historical and demographic clues about the diversity of Somali color naming. Somali-speaking informants from Columbus, Ohio provided monolexemic color terms for 83 or 145 World Color Survey (WCS) color samples. Proximity analysis reduced the 103 color terms to the eight chromatic color meanings from the WCS plus black, white, and gray. Informants' data sets were grouped by spectral clustering analysis into four WCS color naming motifs named after the terms for the cool colors: (a) Green-Blue, (b) Grue (a single term meaning "green or blue"), (c) Gray, and (d) Dark. The results show that, first, the Somali language has about four motifs among its speakers. Second, individuals' color vision test results and their motifs were not correlated, suggesting that multiple motifs do not arise from individual variation in color vision. Last, the Somali color lexicon has changed over the past century. New color terms often came from the names of familiar colored objects, and informants' motifs were closely related to their ages and genders, suggesting that the diversity of color naming across speakers of Somali probably results from ongoing language change. PMID:26982527

  19. The Three-Color and Two-Color Tantrix(TM) Rotation Puzzle Problems are NP-Complete via Parsimonious Reductions

    CERN Document Server

    Baumeister, Dorothea

    2007-01-01

    Holzer and Holzer (Discrete Applied Mathematics 144(3):345--358, 2004) proved the Tantrix(TM) rotation puzzle problem with four colors NP-complete. Baumeister and Rothe (MCU 2007) modified their construction to achieve a parsimonious reduction from satisfiability to this problem. Since parsimonious reductions preserve the number of solutions, it follows that the unique version of the four-color Tantrix(TM) rotation puzzle problem is DP-complete under randomized reductions. In this paper, we study the three-color and the two-color Tantrix(TM) rotation puzzle problem. Restricting the number of allowed colors to three (respectively, to two) reduces the set of available Tantrix(TM) tiles from 56 to 14 (respectively, to 8). We prove that both the three-color and the two-color Tantrix(TM) rotation puzzle problem is NP-complete, which answers a question raised by Holzer and Holzer in the affirmative. Since both these reductions are parsimonious, it follows that both the unique three-color and the unique two-color Ta...

  20. Identity Based Color Image Cryptography

    Directory of Open Access Journals (Sweden)

    Gopi Krishnan S

    2011-05-01

    Full Text Available An Identity based cryptography based on visual cryptography scheme was proposed for protecting color image. A color image to be protected and authentic entities such as account number, password, signature image are given as input. The binary key image is obtained by distributing the digital signature of obtained authentic entities. A secret color image which needs to be communicated is decomposed into three grayscale tones of Y-Cb-Cr color component. Then these grayscale images are half-toned to binary image, and finally the obtained binary images are encrypted using binary key image to obtain binary cipher images. To encrypt Exclusive-OR operation is done on binary key image and three half-tones of secret color image separately. These binary images are combined to obtain cipher. In decryption the shares are decrypted by applying Exclusive-OR operation on cipher and key, then the recovered binary images are inverse half-toned and combined to get secret color image. This scheme is more efficient for communicating natural images across diffident channel.