WorldWideScience

Sample records for accurate operon predictions

  1. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  2. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  3. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  5. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  6. Highly Accurate Prediction of Jobs Runtime Classes

    OpenAIRE

    Reiner-Benaim, Anat; Grabarnick, Anna; Shmueli, Edi

    2016-01-01

    Separating the short jobs from the long is a known technique to improve scheduling performance. In this paper we describe a method we developed for accurately predicting the runtimes classes of the jobs to enable this separation. Our method uses the fact that the runtimes can be represented as a mixture of overlapping Gaussian distributions, in order to train a CART classifier to provide the prediction. The threshold that separates the short jobs from the long jobs is determined during the ev...

  7. Mental models accurately predict emotion transitions.

    Science.gov (United States)

    Thornton, Mark A; Tamir, Diana I

    2017-06-06

    Successful social interactions depend on people's ability to predict others' future actions and emotions. People possess many mechanisms for perceiving others' current emotional states, but how might they use this information to predict others' future states? We hypothesized that people might capitalize on an overlooked aspect of affective experience: current emotions predict future emotions. By attending to regularities in emotion transitions, perceivers might develop accurate mental models of others' emotional dynamics. People could then use these mental models of emotion transitions to predict others' future emotions from currently observable emotions. To test this hypothesis, studies 1-3 used data from three extant experience-sampling datasets to establish the actual rates of emotional transitions. We then collected three parallel datasets in which participants rated the transition likelihoods between the same set of emotions. Participants' ratings of emotion transitions predicted others' experienced transitional likelihoods with high accuracy. Study 4 demonstrated that four conceptual dimensions of mental state representation-valence, social impact, rationality, and human mind-inform participants' mental models. Study 5 used 2 million emotion reports on the Experience Project to replicate both of these findings: again people reported accurate models of emotion transitions, and these models were informed by the same four conceptual dimensions. Importantly, neither these conceptual dimensions nor holistic similarity could fully explain participants' accuracy, suggesting that their mental models contain accurate information about emotion dynamics above and beyond what might be predicted by static emotion knowledge alone.

  8. Mental models accurately predict emotion transitions

    Science.gov (United States)

    Thornton, Mark A.; Tamir, Diana I.

    2017-01-01

    Successful social interactions depend on people’s ability to predict others’ future actions and emotions. People possess many mechanisms for perceiving others’ current emotional states, but how might they use this information to predict others’ future states? We hypothesized that people might capitalize on an overlooked aspect of affective experience: current emotions predict future emotions. By attending to regularities in emotion transitions, perceivers might develop accurate mental models of others’ emotional dynamics. People could then use these mental models of emotion transitions to predict others’ future emotions from currently observable emotions. To test this hypothesis, studies 1–3 used data from three extant experience-sampling datasets to establish the actual rates of emotional transitions. We then collected three parallel datasets in which participants rated the transition likelihoods between the same set of emotions. Participants’ ratings of emotion transitions predicted others’ experienced transitional likelihoods with high accuracy. Study 4 demonstrated that four conceptual dimensions of mental state representation—valence, social impact, rationality, and human mind—inform participants’ mental models. Study 5 used 2 million emotion reports on the Experience Project to replicate both of these findings: again people reported accurate models of emotion transitions, and these models were informed by the same four conceptual dimensions. Importantly, neither these conceptual dimensions nor holistic similarity could fully explain participants’ accuracy, suggesting that their mental models contain accurate information about emotion dynamics above and beyond what might be predicted by static emotion knowledge alone. PMID:28533373

  9. Accurate predictions for the LHC made easy

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    The data recorded by the LHC experiments is of a very high quality. To get the most out of the data, precise theory predictions, including uncertainty estimates, are needed to reduce as much as possible theoretical bias in the experimental analyses. Recently, significant progress has been made in computing Next-to-Leading Order (NLO) computations, including matching to the parton shower, that allow for these accurate, hadron-level predictions. I shall discuss one of these efforts, the MadGraph5_aMC@NLO program, that aims at the complete automation of predictions at the NLO accuracy within the SM as well as New Physics theories. I’ll illustrate some of the theoretical ideas behind this program, show some selected applications to LHC physics, as well as describe the future plans.

  10. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  12. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Hounsfield unit density accurately predicts ESWL success.

    Science.gov (United States)

    Magnuson, William J; Tomera, Kevin M; Lance, Raymond S

    2005-01-01

    Extracorporeal shockwave lithotripsy (ESWL) is a commonly used non-invasive treatment for urolithiasis. Helical CT scans provide much better and detailed imaging of the patient with urolithiasis including the ability to measure density of urinary stones. In this study we tested the hypothesis that density of urinary calculi as measured by CT can predict successful ESWL treatment. 198 patients were treated at Alaska Urological Associates with ESWL between January 2002 and April 2004. Of these 101 met study inclusion with accessible CT scans and stones ranging from 5-15 mm. Follow-up imaging demonstrated stone freedom in 74.2%. The overall mean Houndsfield density value for stone-free compared to residual stone groups were significantly different ( 93.61 vs 122.80 p ESWL for upper tract calculi between 5-15mm.

  14. A new, accurate predictive model for incident hypertension

    DEFF Research Database (Denmark)

    Völzke, Henry; Fung, Glenn; Ittermann, Till

    2013-01-01

    Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures.......Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures....

  15. Prediction of DtxR regulon: Identification of binding sites and operons controlled by Diphtheria toxin repressor in Corynebacterium diphtheriae

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed

    2004-09-01

    Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase

  16. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  17. Accurate Multisteps Traffic Flow Prediction Based on SVM

    Directory of Open Access Journals (Sweden)

    Zhang Mingheng

    2013-01-01

    Full Text Available Accurate traffic flow prediction is prerequisite and important for realizing intelligent traffic control and guidance, and it is also the objective requirement for intelligent traffic management. Due to the strong nonlinear, stochastic, time-varying characteristics of urban transport system, artificial intelligence methods such as support vector machine (SVM are now receiving more and more attentions in this research field. Compared with the traditional single-step prediction method, the multisteps prediction has the ability that can predict the traffic state trends over a certain period in the future. From the perspective of dynamic decision, it is far important than the current traffic condition obtained. Thus, in this paper, an accurate multi-steps traffic flow prediction model based on SVM was proposed. In which, the input vectors were comprised of actual traffic volume and four different types of input vectors were compared to verify their prediction performance with each other. Finally, the model was verified with actual data in the empirical analysis phase and the test results showed that the proposed SVM model had a good ability for traffic flow prediction and the SVM-HPT model outperformed the other three models for prediction.

  18. Bayesian calibration of power plant models for accurate performance prediction

    International Nuclear Information System (INIS)

    Boksteen, Sowande Z.; Buijtenen, Jos P. van; Pecnik, Rene; Vecht, Dick van der

    2014-01-01

    Highlights: • Bayesian calibration is applied to power plant performance prediction. • Measurements from a plant in operation are used for model calibration. • A gas turbine performance model and steam cycle model are calibrated. • An integrated plant model is derived. • Part load efficiency is accurately predicted as a function of ambient conditions. - Abstract: Gas turbine combined cycles are expected to play an increasingly important role in the balancing of supply and demand in future energy markets. Thermodynamic modeling of these energy systems is frequently applied to assist in decision making processes related to the management of plant operation and maintenance. In most cases, model inputs, parameters and outputs are treated as deterministic quantities and plant operators make decisions with limited or no regard of uncertainties. As the steady integration of wind and solar energy into the energy market induces extra uncertainties, part load operation and reliability are becoming increasingly important. In the current study, methods are proposed to not only quantify various types of uncertainties in measurements and plant model parameters using measured data, but to also assess their effect on various aspects of performance prediction. The authors aim to account for model parameter and measurement uncertainty, and for systematic discrepancy of models with respect to reality. For this purpose, the Bayesian calibration framework of Kennedy and O’Hagan is used, which is especially suitable for high-dimensional industrial problems. The article derives a calibrated model of the plant efficiency as a function of ambient conditions and operational parameters, which is also accurate in part load. The article shows that complete statistical modeling of power plants not only enhances process models, but can also increases confidence in operational decisions

  19. A new, accurate predictive model for incident hypertension.

    Science.gov (United States)

    Völzke, Henry; Fung, Glenn; Ittermann, Till; Yu, Shipeng; Baumeister, Sebastian E; Dörr, Marcus; Lieb, Wolfgang; Völker, Uwe; Linneberg, Allan; Jørgensen, Torben; Felix, Stephan B; Rettig, Rainer; Rao, Bharat; Kroemer, Heyo K

    2013-11-01

    Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures. The primary study population consisted of 1605 normotensive individuals aged 20-79 years with 5-year follow-up from the population-based study, that is the Study of Health in Pomerania (SHIP). The initial set was randomly split into a training and a testing set. We used a probabilistic graphical model applying a Bayesian network to create a predictive model for incident hypertension and compared the predictive performance with the established Framingham risk score for hypertension. Finally, the model was validated in 2887 participants from INTER99, a Danish community-based intervention study. In the training set of SHIP data, the Bayesian network used a small subset of relevant baseline features including age, mean arterial pressure, rs16998073, serum glucose and urinary albumin concentrations. Furthermore, we detected relevant interactions between age and serum glucose as well as between rs16998073 and urinary albumin concentrations [area under the receiver operating characteristic (AUC 0.76)]. The model was confirmed in the SHIP validation set (AUC 0.78) and externally replicated in INTER99 (AUC 0.77). Compared to the established Framingham risk score for hypertension, the predictive performance of the new model was similar in the SHIP validation set and moderately better in INTER99. Data mining procedures identified a predictive model for incident hypertension, which included innovative and easy-to-measure variables. The findings promise great applicability in screening settings and clinical practice.

  20. Accurate prediction of the enthalpies of formation for xanthophylls.

    Science.gov (United States)

    Lii, Jenn-Huei; Liao, Fu-Xing; Hu, Ching-Han

    2011-11-30

    This study investigates the applications of computational approaches in the prediction of enthalpies of formation (ΔH(f)) for C-, H-, and O-containing compounds. Molecular mechanics (MM4) molecular mechanics method, density functional theory (DFT) combined with the atomic equivalent (AE) and group equivalent (GE) schemes, and DFT-based correlation corrected atomization (CCAZ) were used. We emphasized on the application to xanthophylls, C-, H-, and O-containing carotenoids which consist of ∼ 100 atoms and extended π-delocaization systems. Within the training set, MM4 predictions are more accurate than those obtained using AE and GE; however a systematic underestimation was observed in the extended systems. ΔH(f) for the training set molecules predicted by CCAZ combined with DFT are in very good agreement with the G3 results. The average absolute deviations (AADs) of CCAZ combined with B3LYP and MPWB1K are 0.38 and 0.53 kcal/mol compared with the G3 data, and are 0.74 and 0.69 kcal/mol compared with the available experimental data, respectively. Consistency of the CCAZ approach for the selected xanthophylls is revealed by the AAD of 2.68 kcal/mol between B3LYP-CCAZ and MPWB1K-CCAZ. Copyright © 2011 Wiley Periodicals, Inc.

  1. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Science.gov (United States)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  2. Accurate Holdup Calculations with Predictive Modeling & Data Integration

    Energy Technology Data Exchange (ETDEWEB)

    Azmy, Yousry [North Carolina State Univ., Raleigh, NC (United States). Dept. of Nuclear Engineering; Cacuci, Dan [Univ. of South Carolina, Columbia, SC (United States). Dept. of Mechanical Engineering

    2017-04-03

    In facilities that process special nuclear material (SNM) it is important to account accurately for the fissile material that enters and leaves the plant. Although there are many stages and processes through which materials must be traced and measured, the focus of this project is material that is “held-up” in equipment, pipes, and ducts during normal operation and that can accumulate over time into significant quantities. Accurately estimating the holdup is essential for proper SNM accounting (vis-à-vis nuclear non-proliferation), criticality and radiation safety, waste management, and efficient plant operation. Usually it is not possible to directly measure the holdup quantity and location, so these must be inferred from measured radiation fields, primarily gamma and less frequently neutrons. Current methods to quantify holdup, i.e. Generalized Geometry Holdup (GGH), primarily rely on simple source configurations and crude radiation transport models aided by ad hoc correction factors. This project seeks an alternate method of performing measurement-based holdup calculations using a predictive model that employs state-of-the-art radiation transport codes capable of accurately simulating such situations. Inverse and data assimilation methods use the forward transport model to search for a source configuration that best matches the measured data and simultaneously provide an estimate of the level of confidence in the correctness of such configuration. In this work the holdup problem is re-interpreted as an inverse problem that is under-determined, hence may permit multiple solutions. A probabilistic approach is applied to solving the resulting inverse problem. This approach rates possible solutions according to their plausibility given the measurements and initial information. This is accomplished through the use of Bayes’ Theorem that resolves the issue of multiple solutions by giving an estimate of the probability of observing each possible solution. To use

  3. Simple Mathematical Models Do Not Accurately Predict Early SIV Dynamics

    Directory of Open Access Journals (Sweden)

    Cecilia Noecker

    2015-03-01

    Full Text Available Upon infection of a new host, human immunodeficiency virus (HIV replicates in the mucosal tissues and is generally undetectable in circulation for 1–2 weeks post-infection. Several interventions against HIV including vaccines and antiretroviral prophylaxis target virus replication at this earliest stage of infection. Mathematical models have been used to understand how HIV spreads from mucosal tissues systemically and what impact vaccination and/or antiretroviral prophylaxis has on viral eradication. Because predictions of such models have been rarely compared to experimental data, it remains unclear which processes included in these models are critical for predicting early HIV dynamics. Here we modified the “standard” mathematical model of HIV infection to include two populations of infected cells: cells that are actively producing the virus and cells that are transitioning into virus production mode. We evaluated the effects of several poorly known parameters on infection outcomes in this model and compared model predictions to experimental data on infection of non-human primates with variable doses of simian immunodifficiency virus (SIV. First, we found that the mode of virus production by infected cells (budding vs. bursting has a minimal impact on the early virus dynamics for a wide range of model parameters, as long as the parameters are constrained to provide the observed rate of SIV load increase in the blood of infected animals. Interestingly and in contrast with previous results, we found that the bursting mode of virus production generally results in a higher probability of viral extinction than the budding mode of virus production. Second, this mathematical model was not able to accurately describe the change in experimentally determined probability of host infection with increasing viral doses. Third and finally, the model was also unable to accurately explain the decline in the time to virus detection with increasing viral

  4. An Overview of Practical Applications of Protein Disorder Prediction and Drive for Faster, More Accurate Predictions.

    Science.gov (United States)

    Deng, Xin; Gumm, Jordan; Karki, Suman; Eickholt, Jesse; Cheng, Jianlin

    2015-07-07

    Protein disordered regions are segments of a protein chain that do not adopt a stable structure. Thus far, a variety of protein disorder prediction methods have been developed and have been widely used, not only in traditional bioinformatics domains, including protein structure prediction, protein structure determination and function annotation, but also in many other biomedical fields. The relationship between intrinsically-disordered proteins and some human diseases has played a significant role in disorder prediction in disease identification and epidemiological investigations. Disordered proteins can also serve as potential targets for drug discovery with an emphasis on the disordered-to-ordered transition in the disordered binding regions, and this has led to substantial research in drug discovery or design based on protein disordered region prediction. Furthermore, protein disorder prediction has also been applied to healthcare by predicting the disease risk of mutations in patients and studying the mechanistic basis of diseases. As the applications of disorder prediction increase, so too does the need to make quick and accurate predictions. To fill this need, we also present a new approach to predict protein residue disorder using wide sequence windows that is applicable on the genomic scale.

  5. An Overview of Practical Applications of Protein Disorder Prediction and Drive for Faster, More Accurate Predictions

    Directory of Open Access Journals (Sweden)

    Xin Deng

    2015-07-01

    Full Text Available Protein disordered regions are segments of a protein chain that do not adopt a stable structure. Thus far, a variety of protein disorder prediction methods have been developed and have been widely used, not only in traditional bioinformatics domains, including protein structure prediction, protein structure determination and function annotation, but also in many other biomedical fields. The relationship between intrinsically-disordered proteins and some human diseases has played a significant role in disorder prediction in disease identification and epidemiological investigations. Disordered proteins can also serve as potential targets for drug discovery with an emphasis on the disordered-to-ordered transition in the disordered binding regions, and this has led to substantial research in drug discovery or design based on protein disordered region prediction. Furthermore, protein disorder prediction has also been applied to healthcare by predicting the disease risk of mutations in patients and studying the mechanistic basis of diseases. As the applications of disorder prediction increase, so too does the need to make quick and accurate predictions. To fill this need, we also present a new approach to predict protein residue disorder using wide sequence windows that is applicable on the genomic scale.

  6. Feedforward signal prediction for accurate motion systems using digital filters

    NARCIS (Netherlands)

    Butler, H.

    2012-01-01

    A positioning system that needs to accurately track a reference can benefit greatly from using feedforward. When using a force actuator, the feedforward needs to generate a force proportional to the reference acceleration, which can be measured by means of an accelerometer or can be created by

  7. Accurate Prediction of Coronary Artery Disease Using Bioinformatics Algorithms

    Directory of Open Access Journals (Sweden)

    Hajar Shafiee

    2016-06-01

    Full Text Available Background and Objectives: Cardiovascular disease is one of the main causes of death in developed and Third World countries. According to the statement of the World Health Organization, it is predicted that death due to heart disease will rise to 23 million by 2030. According to the latest statistics reported by Iran’s Minister of health, 3.39% of all deaths are attributed to cardiovascular diseases and 19.5% are related to myocardial infarction. The aim of this study was to predict coronary artery disease using data mining algorithms. Methods: In this study, various bioinformatics algorithms, such as decision trees, neural networks, support vector machines, clustering, etc., were used to predict coronary heart disease. The data used in this study was taken from several valid databases (including 14 data. Results: In this research, data mining techniques can be effectively used to diagnose different diseases, including coronary artery disease. Also, for the first time, a prediction system based on support vector machine with the best possible accuracy was introduced. Conclusion: The results showed that among the features, thallium scan variable is the most important feature in the diagnosis of heart disease. Designation of machine prediction models, such as support vector machine learning algorithm can differentiate between sick and healthy individuals with 100% accuracy.

  8. Towards more accurate and reliable predictions for nuclear applications

    International Nuclear Information System (INIS)

    Goriely, S.

    2015-01-01

    The need for nuclear data far from the valley of stability, for applications such as nuclear astrophysics or future nuclear facilities, challenges the robustness as well as the predictive power of present nuclear models. Most of the nuclear data evaluation and prediction are still performed on the basis of phenomenological nuclear models. For the last decades, important progress has been achieved in fundamental nuclear physics, making it now feasible to use more reliable, but also more complex microscopic or semi-microscopic models in the evaluation and prediction of nuclear data for practical applications. In the present contribution, the reliability and accuracy of recent nuclear theories are discussed for most of the relevant quantities needed to estimate reaction cross sections and beta-decay rates, namely nuclear masses, nuclear level densities, gamma-ray strength, fission properties and beta-strength functions. It is shown that nowadays, mean-field models can be tuned at the same level of accuracy as the phenomenological models, renormalized on experimental data if needed, and therefore can replace the phenomenogical inputs in the prediction of nuclear data. While fundamental nuclear physicists keep on improving state-of-the-art models, e.g. within the shell model or ab initio models, nuclear applications could make use of their most recent results as quantitative constraints or guides to improve the predictions in energy or mass domain that will remain inaccessible experimentally. (orig.)

  9. PredictSNP: robust and accurate consensus classifier for prediction of disease-related mutations.

    Directory of Open Access Journals (Sweden)

    Jaroslav Bendl

    2014-01-01

    Full Text Available Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp.

  10. Can numerical simulations accurately predict hydrodynamic instabilities in liquid films?

    Science.gov (United States)

    Denner, Fabian; Charogiannis, Alexandros; Pradas, Marc; van Wachem, Berend G. M.; Markides, Christos N.; Kalliadasis, Serafim

    2014-11-01

    Understanding the dynamics of hydrodynamic instabilities in liquid film flows is an active field of research in fluid dynamics and non-linear science in general. Numerical simulations offer a powerful tool to study hydrodynamic instabilities in film flows and can provide deep insights into the underlying physical phenomena. However, the direct comparison of numerical results and experimental results is often hampered by several reasons. For instance, in numerical simulations the interface representation is problematic and the governing equations and boundary conditions may be oversimplified, whereas in experiments it is often difficult to extract accurate information on the fluid and its behavior, e.g. determine the fluid properties when the liquid contains particles for PIV measurements. In this contribution we present the latest results of our on-going, extensive study on hydrodynamic instabilities in liquid film flows, which includes direct numerical simulations, low-dimensional modelling as well as experiments. The major focus is on wave regimes, wave height and wave celerity as a function of Reynolds number and forcing frequency of a falling liquid film. Specific attention is paid to the differences in numerical and experimental results and the reasons for these differences. The authors are grateful to the EPSRC for their financial support (Grant EP/K008595/1).

  11. Predicting accurate absolute binding energies in aqueous solution

    DEFF Research Database (Denmark)

    Jensen, Jan Halborg

    2015-01-01

    Recent predictions of absolute binding free energies of host-guest complexes in aqueous solution using electronic structure theory have been encouraging for some systems, while other systems remain problematic. In this paper I summarize some of the many factors that could easily contribute 1-3 kcal......-represented by continuum models. While I focus on binding free energies in aqueous solution the approach also applies (with minor adjustments) to any free energy difference such as conformational or reaction free energy differences or activation free energies in any solvent....

  12. CFD-FEM coupling for accurate prediction of thermal fatigue

    International Nuclear Information System (INIS)

    Hannink, M.H.C.; Kuczaj, A.K.; Blom, F.J.; Church, J.M.; Komen, E.M.J.

    2009-01-01

    Thermal fatigue is a safety related issue in primary pipework systems of nuclear power plants. Life extension of current reactors and the design of a next generation of new reactors lead to growing importance of research in this direction. The thermal fatigue degradation mechanism is induced by temperature fluctuations in a fluid, which arise from mixing of hot and cold flows. Accompanied physical phenomena include thermal stratification, thermal striping, and turbulence [1]. Current plant instrumentation systems allow monitoring of possible causes as stratification and temperature gradients at fatigue susceptible locations [1]. However, high-cycle temperature fluctuations associated with turbulent mixing cannot be adequately detected by common thermocouple instrumentations. For a proper evaluation of thermal fatigue, therefore, numerical simulations are necessary that couple instantaneous fluid and solid interactions. In this work, a strategy for the numerical prediction of thermal fatigue is presented. The approach couples Computational Fluid Dynamics (CFD) and the Finite Element Method (FEM). For the development of the computational approach, a classical test case for the investigation of thermal fatigue problems is studied, i.e. mixing in a T-junction. Due to turbulent mixing of hot and cold fluids in two perpendicularly connected pipes, temperature fluctuations arise in the mixing zone downstream in the flow. Subsequently, these temperature fluctuations are also induced in the pipes. The stresses that arise due to the fluctuations may eventually lead to thermal fatigue. In the first step of the applied procedure, the temperature fluctuations in both fluid and structure are calculated using the CFD method. Subsequently, the temperature fluctuations in the structure are imposed as thermal loads in a FEM model of the pipes. A mechanical analysis is then performed to determine the thermal stresses, which are used to predict the fatigue lifetime of the structure

  13. Change in BMI accurately predicted by social exposure to acquaintances.

    Science.gov (United States)

    Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

    2013-01-01

    Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

  14. Change in BMI accurately predicted by social exposure to acquaintances.

    Directory of Open Access Journals (Sweden)

    Rahman O Oloritun

    Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

  15. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  16. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  17. Towards accurate performance prediction of a vertical axis wind turbine operating at different tip speed ratios

    NARCIS (Netherlands)

    Rezaeiha, A.; Kalkman, I.; Blocken, B.J.E.

    2017-01-01

    Accurate prediction of the performance of a vertical-axis wind turbine (VAWT) using CFD simulation requires the employment of a sufficiently fine azimuthal increment (dθ) combined with a mesh size at which essential flow characteristics can be accurately resolved. Furthermore, the domain size needs

  18. Prediction of Accurate Mixed Mode Fatigue Crack Growth Curves using the Paris' Law

    Science.gov (United States)

    Sajith, S.; Krishna Murthy, K. S. R.; Robi, P. S.

    2017-12-01

    Accurate information regarding crack growth times and structural strength as a function of the crack size is mandatory in damage tolerance analysis. Various equivalent stress intensity factor (SIF) models are available for prediction of mixed mode fatigue life using the Paris' law. In the present investigation these models have been compared to assess their efficacy in prediction of the life close to the experimental findings as there are no guidelines/suggestions available on selection of these models for accurate and/or conservative predictions of fatigue life. Within the limitations of availability of experimental data and currently available numerical simulation techniques, the results of present study attempts to outline models that would provide accurate and conservative life predictions.

  19. Accurate Prediction of Motor Failures by Application of Multi CBM Tools: A Case Study

    Science.gov (United States)

    Dutta, Rana; Singh, Veerendra Pratap; Dwivedi, Jai Prakash

    2018-02-01

    Motor failures are very difficult to predict accurately with a single condition-monitoring tool as both electrical and the mechanical systems are closely related. Electrical problem, like phase unbalance, stator winding insulation failures can, at times, lead to vibration problem and at the same time mechanical failures like bearing failure, leads to rotor eccentricity. In this case study of a 550 kW blower motor it has been shown that a rotor bar crack was detected by current signature analysis and vibration monitoring confirmed the same. In later months in a similar motor vibration monitoring predicted bearing failure and current signature analysis confirmed the same. In both the cases, after dismantling the motor, the predictions were found to be accurate. In this paper we will be discussing the accurate predictions of motor failures through use of multi condition monitoring tools with two case studies.

  20. Influential Factors for Accurate Load Prediction in a Demand Response Context

    DEFF Research Database (Denmark)

    Wollsen, Morten Gill; Kjærgaard, Mikkel Baun; Jørgensen, Bo Nørregaard

    2016-01-01

    Accurate prediction of a buildings electricity load is crucial to respond to Demand Response events with an assessable load change. However, previous work on load prediction lacks to consider a wider set of possible data sources. In this paper we study different data scenarios to map the influence....... Next, the time of day that is being predicted greatly influence the prediction which is related to the weather pattern. By presenting these results we hope to improve the modeling of building loads and algorithms for Demand Response planning.......Accurate prediction of a buildings electricity load is crucial to respond to Demand Response events with an assessable load change. However, previous work on load prediction lacks to consider a wider set of possible data sources. In this paper we study different data scenarios to map the influence...

  1. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  2. Heart rate during basketball game play and volleyball drills accurately predicts oxygen uptake and energy expenditure.

    Science.gov (United States)

    Scribbans, T D; Berg, K; Narazaki, K; Janssen, I; Gurd, B J

    2015-09-01

    There is currently little information regarding the ability of metabolic prediction equations to accurately predict oxygen uptake and exercise intensity from heart rate (HR) during intermittent sport. The purpose of the present study was to develop and, cross-validate equations appropriate for accurately predicting oxygen cost (VO2) and energy expenditure from HR during intermittent sport participation. Eleven healthy adult males (19.9±1.1yrs) were recruited to establish the relationship between %VO2peak and %HRmax during low-intensity steady state endurance (END), moderate-intensity interval (MOD) and high intensity-interval exercise (HI), as performed on a cycle ergometer. Three equations (END, MOD, and HI) for predicting %VO2peak based on %HRmax were developed. HR and VO2 were directly measured during basketball games (6 male, 20.8±1.0 yrs; 6 female, 20.0±1.3yrs) and volleyball drills (12 female; 20.8±1.0yrs). Comparisons were made between measured and predicted VO2 and energy expenditure using the 3 equations developed and 2 previously published equations. The END and MOD equations accurately predicted VO2 and energy expenditure, while the HI equation underestimated, and the previously published equations systematically overestimated VO2 and energy expenditure. Intermittent sport VO2 and energy expenditure can be accurately predicted from heart rate data using either the END (%VO2peak=%HRmax x 1.008-17.17) or MOD (%VO2peak=%HRmax x 1.2-32) equations. These 2 simple equations provide an accessible and cost-effective method for accurate estimation of exercise intensity and energy expenditure during intermittent sport.

  3. Accurate and dynamic predictive model for better prediction in medicine and healthcare.

    Science.gov (United States)

    Alanazi, H O; Abdullah, A H; Qureshi, K N; Ismail, A S

    2018-05-01

    Information and communication technologies (ICTs) have changed the trend into new integrated operations and methods in all fields of life. The health sector has also adopted new technologies to improve the systems and provide better services to customers. Predictive models in health care are also influenced from new technologies to predict the different disease outcomes. However, still, existing predictive models have suffered from some limitations in terms of predictive outcomes performance. In order to improve predictive model performance, this paper proposed a predictive model by classifying the disease predictions into different categories. To achieve this model performance, this paper uses traumatic brain injury (TBI) datasets. TBI is one of the serious diseases worldwide and needs more attention due to its seriousness and serious impacts on human life. The proposed predictive model improves the predictive performance of TBI. The TBI data set is developed and approved by neurologists to set its features. The experiment results show that the proposed model has achieved significant results including accuracy, sensitivity, and specificity.

  4. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  5. NNLOPS accurate predictions for $W^+W^-$ production arXiv

    CERN Document Server

    Re, Emanuele; Zanderighi, Giulia

    We present novel predictions for the production of $W^+W^-$ pairs in hadron collisions that are next-to-next-to-leading order accurate and consistently matched to a parton shower (NNLOPS). All diagrams that lead to the process $pp\\to e^- \\bar \

  6. Towards cycle-accurate performance predictions for real-time embedded systems

    NARCIS (Netherlands)

    Triantafyllidis, K.; Bondarev, E.; With, de P.H.N.; Arabnia, H.R.; Deligiannidis, L.; Jandieri, G.

    2013-01-01

    In this paper we present a model-based performance analysis method for component-based real-time systems, featuring cycle-accurate predictions of latencies and enhanced system robustness. The method incorporates the following phases: (a) instruction-level profiling of SW components, (b) modeling the

  7. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  8. ASTRAL, DRAGON and SEDAN scores predict stroke outcome more accurately than physicians.

    Science.gov (United States)

    Ntaios, G; Gioulekas, F; Papavasileiou, V; Strbian, D; Michel, P

    2016-11-01

    ASTRAL, SEDAN and DRAGON scores are three well-validated scores for stroke outcome prediction. Whether these scores predict stroke outcome more accurately compared with physicians interested in stroke was investigated. Physicians interested in stroke were invited to an online anonymous survey to provide outcome estimates in randomly allocated structured scenarios of recent real-life stroke patients. Their estimates were compared to scores' predictions in the same scenarios. An estimate was considered accurate if it was within 95% confidence intervals of actual outcome. In all, 244 participants from 32 different countries responded assessing 720 real scenarios and 2636 outcomes. The majority of physicians' estimates were inaccurate (1422/2636, 53.9%). 400 (56.8%) of physicians' estimates about the percentage probability of 3-month modified Rankin score (mRS) > 2 were accurate compared with 609 (86.5%) of ASTRAL score estimates (P DRAGON score estimates (P DRAGON score estimates (P DRAGON and SEDAN scores predict outcome of acute ischaemic stroke patients with higher accuracy compared to physicians interested in stroke. © 2016 EAN.

  9. Accurate wavelength prediction of photonic crystal resonant reflection and applications in refractive index measurement

    DEFF Research Database (Denmark)

    Hermannsson, Pétur Gordon; Vannahme, Christoph; Smith, Cameron L. C.

    2014-01-01

    and superstrate materials. The importance of accounting for material dispersion in order to obtain accurate simulation results is highlighted, and a method for doing so using an iterative approach is demonstrated. Furthermore, an application for the model is demonstrated, in which the material dispersion......In the past decade, photonic crystal resonant reflectors have been increasingly used as the basis for label-free biochemical assays in lab-on-a-chip applications. In both designing and interpreting experimental results, an accurate model describing the optical behavior of such structures...... is essential. Here, an analytical method for precisely predicting the absolute positions of resonantly reflected wavelengths is presented. The model is experimentally verified to be highly accurate using nanoreplicated, polymer-based photonic crystal grating reflectors with varying grating periods...

  10. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  11. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  12. A highly accurate predictive-adaptive method for lithium-ion battery remaining discharge energy prediction in electric vehicle applications

    International Nuclear Information System (INIS)

    Liu, Guangming; Ouyang, Minggao; Lu, Languang; Li, Jianqiu; Hua, Jianfeng

    2015-01-01

    Highlights: • An energy prediction (EP) method is introduced for battery E RDE determination. • EP determines E RDE through coupled prediction of future states, parameters, and output. • The PAEP combines parameter adaptation and prediction to update model parameters. • The PAEP provides improved E RDE accuracy compared with DC and other EP methods. - Abstract: In order to estimate the remaining driving range (RDR) in electric vehicles, the remaining discharge energy (E RDE ) of the applied battery system needs to be precisely predicted. Strongly affected by the load profiles, the available E RDE varies largely in real-world applications and requires specific determination. However, the commonly-used direct calculation (DC) method might result in certain energy prediction errors by relating the E RDE directly to the current state of charge (SOC). To enhance the E RDE accuracy, this paper presents a battery energy prediction (EP) method based on the predictive control theory, in which a coupled prediction of future battery state variation, battery model parameter change, and voltage response, is implemented on the E RDE prediction horizon, and the E RDE is subsequently accumulated and real-timely optimized. Three EP approaches with different model parameter updating routes are introduced, and the predictive-adaptive energy prediction (PAEP) method combining the real-time parameter identification and the future parameter prediction offers the best potential. Based on a large-format lithium-ion battery, the performance of different E RDE calculation methods is compared under various dynamic profiles. Results imply that the EP methods provide much better accuracy than the traditional DC method, and the PAEP could reduce the E RDE error by more than 90% and guarantee the relative energy prediction error under 2%, proving as a proper choice in online E RDE prediction. The correlation of SOC estimation and E RDE calculation is then discussed to illustrate the

  13. Improving medical decisions for incapacitated persons: does focusing on "accurate predictions" lead to an inaccurate picture?

    Science.gov (United States)

    Kim, Scott Y H

    2014-04-01

    The Patient Preference Predictor (PPP) proposal places a high priority on the accuracy of predicting patients' preferences and finds the performance of surrogates inadequate. However, the quest to develop a highly accurate, individualized statistical model has significant obstacles. First, it will be impossible to validate the PPP beyond the limit imposed by 60%-80% reliability of people's preferences for future medical decisions--a figure no better than the known average accuracy of surrogates. Second, evidence supports the view that a sizable minority of persons may not even have preferences to predict. Third, many, perhaps most, people express their autonomy just as much by entrusting their loved ones to exercise their judgment than by desiring to specifically control future decisions. Surrogate decision making faces none of these issues and, in fact, it may be more efficient, accurate, and authoritative than is commonly assumed.

  14. LocARNA-P: Accurate boundary prediction and improved detection of structural RNAs

    DEFF Research Database (Denmark)

    Will, Sebastian; Joshi, Tejal; Hofacker, Ivo L.

    2012-01-01

    Current genomic screens for noncoding RNAs (ncRNAs) predict a large number of genomic regions containing potential structural ncRNAs. The analysis of these data requires highly accurate prediction of ncRNA boundaries and discrimination of promising candidate ncRNAs from weak predictions. Existing...... methods struggle with these goals because they rely on sequence-based multiple sequence alignments, which regularly misalign RNA structure and therefore do not support identification of structural similarities. To overcome this limitation, we compute columnwise and global reliabilities of alignments based...... on sequence and structure similarity; we refer to these structure-based alignment reliabilities as STARs. The columnwise STARs of alignments, or STAR profiles, provide a versatile tool for the manual and automatic analysis of ncRNAs. In particular, we improve the boundary prediction of the widely used nc...

  15. Multi-fidelity machine learning models for accurate bandgap predictions of solids

    International Nuclear Information System (INIS)

    Pilania, Ghanshyam; Gubernatis, James E.; Lookman, Turab

    2016-01-01

    Here, we present a multi-fidelity co-kriging statistical learning framework that combines variable-fidelity quantum mechanical calculations of bandgaps to generate a machine-learned model that enables low-cost accurate predictions of the bandgaps at the highest fidelity level. Additionally, the adopted Gaussian process regression formulation allows us to predict the underlying uncertainties as a measure of our confidence in the predictions. In using a set of 600 elpasolite compounds as an example dataset and using semi-local and hybrid exchange correlation functionals within density functional theory as two levels of fidelities, we demonstrate the excellent learning performance of the method against actual high fidelity quantum mechanical calculations of the bandgaps. The presented statistical learning method is not restricted to bandgaps or electronic structure methods and extends the utility of high throughput property predictions in a significant way.

  16. Can phenological models predict tree phenology accurately under climate change conditions?

    Science.gov (United States)

    Chuine, Isabelle; Bonhomme, Marc; Legave, Jean Michel; García de Cortázar-Atauri, Inaki; Charrier, Guillaume; Lacointe, André; Améglio, Thierry

    2014-05-01

    The onset of the growing season of trees has been globally earlier by 2.3 days/decade during the last 50 years because of global warming and this trend is predicted to continue according to climate forecast. The effect of temperature on plant phenology is however not linear because temperature has a dual effect on bud development. On one hand, low temperatures are necessary to break bud dormancy, and on the other hand higher temperatures are necessary to promote bud cells growth afterwards. Increasing phenological changes in temperate woody species have strong impacts on forest trees distribution and productivity, as well as crops cultivation areas. Accurate predictions of trees phenology are therefore a prerequisite to understand and foresee the impacts of climate change on forests and agrosystems. Different process-based models have been developed in the last two decades to predict the date of budburst or flowering of woody species. They are two main families: (1) one-phase models which consider only the ecodormancy phase and make the assumption that endodormancy is always broken before adequate climatic conditions for cell growth occur; and (2) two-phase models which consider both the endodormancy and ecodormancy phases and predict a date of dormancy break which varies from year to year. So far, one-phase models have been able to predict accurately tree bud break and flowering under historical climate. However, because they do not consider what happens prior to ecodormancy, and especially the possible negative effect of winter temperature warming on dormancy break, it seems unlikely that they can provide accurate predictions in future climate conditions. It is indeed well known that a lack of low temperature results in abnormal pattern of bud break and development in temperate fruit trees. An accurate modelling of the dormancy break date has thus become a major issue in phenology modelling. Two-phases phenological models predict that global warming should delay

  17. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Directory of Open Access Journals (Sweden)

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  18. Fast and Accurate Prediction of Stratified Steel Temperature During Holding Period of Ladle

    Science.gov (United States)

    Deodhar, Anirudh; Singh, Umesh; Shukla, Rishabh; Gautham, B. P.; Singh, Amarendra K.

    2017-04-01

    Thermal stratification of liquid steel in a ladle during the holding period and the teeming operation has a direct bearing on the superheat available at the caster and hence on the caster set points such as casting speed and cooling rates. The changes in the caster set points are typically carried out based on temperature measurements at the end of tundish outlet. Thermal prediction models provide advance knowledge of the influence of process and design parameters on the steel temperature at various stages. Therefore, they can be used in making accurate decisions about the caster set points in real time. However, this requires both fast and accurate thermal prediction models. In this work, we develop a surrogate model for the prediction of thermal stratification using data extracted from a set of computational fluid dynamics (CFD) simulations, pre-determined using design of experiments technique. Regression method is used for training the predictor. The model predicts the stratified temperature profile instantaneously, for a given set of process parameters such as initial steel temperature, refractory heat content, slag thickness, and holding time. More than 96 pct of the predicted values are within an error range of ±5 K (±5 °C), when compared against corresponding CFD results. Considering its accuracy and computational efficiency, the model can be extended for thermal control of casting operations. This work also sets a benchmark for developing similar thermal models for downstream processes such as tundish and caster.

  19. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  20. An accurate model for numerical prediction of piezoelectric energy harvesting from fluid structure interaction problems

    International Nuclear Information System (INIS)

    Amini, Y; Emdad, H; Farid, M

    2014-01-01

    Piezoelectric energy harvesting (PEH) from ambient energy sources, particularly vibrations, has attracted considerable interest throughout the last decade. Since fluid flow has a high energy density, it is one of the best candidates for PEH. Indeed, a piezoelectric energy harvesting process from the fluid flow takes the form of natural three-way coupling of the turbulent fluid flow, the electromechanical effect of the piezoelectric material and the electrical circuit. There are some experimental and numerical studies about piezoelectric energy harvesting from fluid flow in literatures. Nevertheless, accurate modeling for predicting characteristics of this three-way coupling has not yet been developed. In the present study, accurate modeling for this triple coupling is developed and validated by experimental results. A new code based on this modeling in an openFOAM platform is developed. (paper)

  1. Machine learning predictions of molecular properties: Accurate many-body potentials and nonlocality in chemical space

    International Nuclear Information System (INIS)

    Hansen, Katja; Biegler, Franziska; Ramakrishnan, Raghunathan; Pronobis, Wiktor; Lilienfeld, O. Anatole von; Müller, Klaus-Robert; Tkatchenko, Alexandre

    2015-01-01

    Simultaneously accurate and efficient prediction of molecular properties throughout chemical compound space is a critical ingredient toward rational compound design in chemical and pharmaceutical industries. Aiming toward this goal, we develop and apply a systematic hierarchy of efficient empirical methods to estimate atomization and total energies of molecules. These methods range from a simple sum over atoms, to addition of bond energies, to pairwise interatomic force fields, reaching to the more sophisticated machine learning approaches that are capable of describing collective interactions between many atoms or bonds. In the case of equilibrium molecular geometries, even simple pairwise force fields demonstrate prediction accuracy comparable to benchmark energies calculated using density functional theory with hybrid exchange-correlation functionals; however, accounting for the collective many-body interactions proves to be essential for approaching the 'holy grail' of chemical accuracy of 1 kcal/mol for both equilibrium and out-of-equilibrium geometries. This remarkable accuracy is achieved by a vectorized representation of molecules (so-called Bag of Bonds model) that exhibits strong nonlocality in chemical space. The same representation allows us to predict accurate electronic properties of molecules, such as their polarizability and molecular frontier orbital energies

  2. Accurate approximation method for prediction of class I MHC affinities for peptides of length 8, 10 and 11 using prediction tools trained on 9mers

    DEFF Research Database (Denmark)

    Lundegaard, Claus; Lund, Ole; Nielsen, Morten

    2008-01-01

    Several accurate prediction systems have been developed for prediction of class I major histocompatibility complex (MHC):peptide binding. Most of these are trained on binding affinity data of primarily 9mer peptides. Here, we show how prediction methods trained on 9mer data can be used for accurate...

  3. Development and Validation of a Multidisciplinary Tool for Accurate and Efficient Rotorcraft Noise Prediction (MUTE)

    Science.gov (United States)

    Liu, Yi; Anusonti-Inthra, Phuriwat; Diskin, Boris

    2011-01-01

    A physics-based, systematically coupled, multidisciplinary prediction tool (MUTE) for rotorcraft noise was developed and validated with a wide range of flight configurations and conditions. MUTE is an aggregation of multidisciplinary computational tools that accurately and efficiently model the physics of the source of rotorcraft noise, and predict the noise at far-field observer locations. It uses systematic coupling approaches among multiple disciplines including Computational Fluid Dynamics (CFD), Computational Structural Dynamics (CSD), and high fidelity acoustics. Within MUTE, advanced high-order CFD tools are used around the rotor blade to predict the transonic flow (shock wave) effects, which generate the high-speed impulsive noise. Predictions of the blade-vortex interaction noise in low speed flight are also improved by using the Particle Vortex Transport Method (PVTM), which preserves the wake flow details required for blade/wake and fuselage/wake interactions. The accuracy of the source noise prediction is further improved by utilizing a coupling approach between CFD and CSD, so that the effects of key structural dynamics, elastic blade deformations, and trim solutions are correctly represented in the analysis. The blade loading information and/or the flow field parameters around the rotor blade predicted by the CFD/CSD coupling approach are used to predict the acoustic signatures at far-field observer locations with a high-fidelity noise propagation code (WOPWOP3). The predicted results from the MUTE tool for rotor blade aerodynamic loading and far-field acoustic signatures are compared and validated with a variation of experimental data sets, such as UH60-A data, DNW test data and HART II test data.

  4. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  5. The MIDAS touch for Accurately Predicting the Stress-Strain Behavior of Tantalum

    Energy Technology Data Exchange (ETDEWEB)

    Jorgensen, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-03-02

    Testing the behavior of metals in extreme environments is not always feasible, so material scientists use models to try and predict the behavior. To achieve accurate results it is necessary to use the appropriate model and material-specific parameters. This research evaluated the performance of six material models available in the MIDAS database [1] to determine at which temperatures and strain-rates they perform best, and to determine to which experimental data their parameters were optimized. Additionally, parameters were optimized for the Johnson-Cook model using experimental data from Lassila et al [2].

  6. Accurate bearing remaining useful life prediction based on Weibull distribution and artificial neural network

    Science.gov (United States)

    Ben Ali, Jaouher; Chebel-Morello, Brigitte; Saidi, Lotfi; Malinowski, Simon; Fnaiech, Farhat

    2015-05-01

    Accurate remaining useful life (RUL) prediction of critical assets is an important challenge in condition based maintenance to improve reliability and decrease machine's breakdown and maintenance's cost. Bearing is one of the most important components in industries which need to be monitored and the user should predict its RUL. The challenge of this study is to propose an original feature able to evaluate the health state of bearings and to estimate their RUL by Prognostics and Health Management (PHM) techniques. In this paper, the proposed method is based on the data-driven prognostic approach. The combination of Simplified Fuzzy Adaptive Resonance Theory Map (SFAM) neural network and Weibull distribution (WD) is explored. WD is used just in the training phase to fit measurement and to avoid areas of fluctuation in the time domain. SFAM training process is based on fitted measurements at present and previous inspection time points as input. However, the SFAM testing process is based on real measurements at present and previous inspections. Thanks to the fuzzy learning process, SFAM has an important ability and a good performance to learn nonlinear time series. As output, seven classes are defined; healthy bearing and six states for bearing degradation. In order to find the optimal RUL prediction, a smoothing phase is proposed in this paper. Experimental results show that the proposed method can reliably predict the RUL of rolling element bearings (REBs) based on vibration signals. The proposed prediction approach can be applied to prognostic other various mechanical assets.

  7. Accurate prediction of severe allergic reactions by a small set of environmental parameters (NDVI, temperature).

    Science.gov (United States)

    Notas, George; Bariotakis, Michail; Kalogrias, Vaios; Andrianaki, Maria; Azariadis, Kalliopi; Kampouri, Errika; Theodoropoulou, Katerina; Lavrentaki, Katerina; Kastrinakis, Stelios; Kampa, Marilena; Agouridakis, Panagiotis; Pirintsos, Stergios; Castanas, Elias

    2015-01-01

    Severe allergic reactions of unknown etiology,necessitating a hospital visit, have an important impact in the life of affected individuals and impose a major economic burden to societies. The prediction of clinically severe allergic reactions would be of great importance, but current attempts have been limited by the lack of a well-founded applicable methodology and the wide spatiotemporal distribution of allergic reactions. The valid prediction of severe allergies (and especially those needing hospital treatment) in a region, could alert health authorities and implicated individuals to take appropriate preemptive measures. In the present report we have collecterd visits for serious allergic reactions of unknown etiology from two major hospitals in the island of Crete, for two distinct time periods (validation and test sets). We have used the Normalized Difference Vegetation Index (NDVI), a satellite-based, freely available measurement, which is an indicator of live green vegetation at a given geographic area, and a set of meteorological data to develop a model capable of describing and predicting severe allergic reaction frequency. Our analysis has retained NDVI and temperature as accurate identifiers and predictors of increased hospital severe allergic reactions visits. Our approach may contribute towards the development of satellite-based modules, for the prediction of severe allergic reactions in specific, well-defined geographical areas. It could also probably be used for the prediction of other environment related diseases and conditions.

  8. XenoSite: accurately predicting CYP-mediated sites of metabolism with neural networks.

    Science.gov (United States)

    Zaretzki, Jed; Matlock, Matthew; Swamidass, S Joshua

    2013-12-23

    Understanding how xenobiotic molecules are metabolized is important because it influences the safety, efficacy, and dose of medicines and how they can be modified to improve these properties. The cytochrome P450s (CYPs) are proteins responsible for metabolizing 90% of drugs on the market, and many computational methods can predict which atomic sites of a molecule--sites of metabolism (SOMs)--are modified during CYP-mediated metabolism. This study improves on prior methods of predicting CYP-mediated SOMs by using new descriptors and machine learning based on neural networks. The new method, XenoSite, is faster to train and more accurate by as much as 4% or 5% for some isozymes. Furthermore, some "incorrect" predictions made by XenoSite were subsequently validated as correct predictions by revaluation of the source literature. Moreover, XenoSite output is interpretable as a probability, which reflects both the confidence of the model that a particular atom is metabolized and the statistical likelihood that its prediction for that atom is correct.

  9. An Interpretable Machine Learning Model for Accurate Prediction of Sepsis in the ICU.

    Science.gov (United States)

    Nemati, Shamim; Holder, Andre; Razmi, Fereshteh; Stanley, Matthew D; Clifford, Gari D; Buchman, Timothy G

    2018-04-01

    Sepsis is among the leading causes of morbidity, mortality, and cost overruns in critically ill patients. Early intervention with antibiotics improves survival in septic patients. However, no clinically validated system exists for real-time prediction of sepsis onset. We aimed to develop and validate an Artificial Intelligence Sepsis Expert algorithm for early prediction of sepsis. Observational cohort study. Academic medical center from January 2013 to December 2015. Over 31,000 admissions to the ICUs at two Emory University hospitals (development cohort), in addition to over 52,000 ICU patients from the publicly available Medical Information Mart for Intensive Care-III ICU database (validation cohort). Patients who met the Third International Consensus Definitions for Sepsis (Sepsis-3) prior to or within 4 hours of their ICU admission were excluded, resulting in roughly 27,000 and 42,000 patients within our development and validation cohorts, respectively. None. High-resolution vital signs time series and electronic medical record data were extracted. A set of 65 features (variables) were calculated on hourly basis and passed to the Artificial Intelligence Sepsis Expert algorithm to predict onset of sepsis in the proceeding T hours (where T = 12, 8, 6, or 4). Artificial Intelligence Sepsis Expert was used to predict onset of sepsis in the proceeding T hours and to produce a list of the most significant contributing factors. For the 12-, 8-, 6-, and 4-hour ahead prediction of sepsis, Artificial Intelligence Sepsis Expert achieved area under the receiver operating characteristic in the range of 0.83-0.85. Performance of the Artificial Intelligence Sepsis Expert on the development and validation cohorts was indistinguishable. Using data available in the ICU in real-time, Artificial Intelligence Sepsis Expert can accurately predict the onset of sepsis in an ICU patient 4-12 hours prior to clinical recognition. A prospective study is necessary to determine the

  10. An Extrapolation of a Radical Equation More Accurately Predicts Shelf Life of Frozen Biological Matrices.

    Science.gov (United States)

    De Vore, Karl W; Fatahi, Nadia M; Sass, John E

    2016-08-01

    Arrhenius modeling of analyte recovery at increased temperatures to predict long-term colder storage stability of biological raw materials, reagents, calibrators, and controls is standard practice in the diagnostics industry. Predicting subzero temperature stability using the same practice is frequently criticized but nevertheless heavily relied upon. We compared the ability to predict analyte recovery during frozen storage using 3 separate strategies: traditional accelerated studies with Arrhenius modeling, and extrapolation of recovery at 20% of shelf life using either ordinary least squares or a radical equation y = B1x(0.5) + B0. Computer simulations were performed to establish equivalence of statistical power to discern the expected changes during frozen storage or accelerated stress. This was followed by actual predictive and follow-up confirmatory testing of 12 chemistry and immunoassay analytes. Linear extrapolations tended to be the most conservative in the predicted percent recovery, reducing customer and patient risk. However, the majority of analytes followed a rate of change that slowed over time, which was fit best to a radical equation of the form y = B1x(0.5) + B0. Other evidence strongly suggested that the slowing of the rate was not due to higher-order kinetics, but to changes in the matrix during storage. Predicting shelf life of frozen products through extrapolation of early initial real-time storage analyte recovery should be considered the most accurate method. Although in this study the time required for a prediction was longer than a typical accelerated testing protocol, there are less potential sources of error, reduced costs, and a lower expenditure of resources. © 2016 American Association for Clinical Chemistry.

  11. Microbiome Data Accurately Predicts the Postmortem Interval Using Random Forest Regression Models

    Directory of Open Access Journals (Sweden)

    Aeriel Belk

    2018-02-01

    Full Text Available Death investigations often include an effort to establish the postmortem interval (PMI in cases in which the time of death is uncertain. The postmortem interval can lead to the identification of the deceased and the validation of witness statements and suspect alibis. Recent research has demonstrated that microbes provide an accurate clock that starts at death and relies on ecological change in the microbial communities that normally inhabit a body and its surrounding environment. Here, we explore how to build the most robust Random Forest regression models for prediction of PMI by testing models built on different sample types (gravesoil, skin of the torso, skin of the head, gene markers (16S ribosomal RNA (rRNA, 18S rRNA, internal transcribed spacer regions (ITS, and taxonomic levels (sequence variants, species, genus, etc.. We also tested whether particular suites of indicator microbes were informative across different datasets. Generally, results indicate that the most accurate models for predicting PMI were built using gravesoil and skin data using the 16S rRNA genetic marker at the taxonomic level of phyla. Additionally, several phyla consistently contributed highly to model accuracy and may be candidate indicators of PMI.

  12. Predicting Falls in People with Multiple Sclerosis: Fall History Is as Accurate as More Complex Measures

    Directory of Open Access Journals (Sweden)

    Michelle H. Cameron

    2013-01-01

    Full Text Available Background. Many people with MS fall, but the best method for identifying those at increased fall risk is not known. Objective. To compare how accurately fall history, questionnaires, and physical tests predict future falls and injurious falls in people with MS. Methods. 52 people with MS were asked if they had fallen in the past 2 months and the past year. Subjects were also assessed with the Activities-specific Balance Confidence, Falls Efficacy Scale-International, and Multiple Sclerosis Walking Scale-12 questionnaires, the Expanded Disability Status Scale, Timed 25-Foot Walk, and computerized dynamic posturography and recorded their falls daily for the following 6 months with calendars. The ability of baseline assessments to predict future falls was compared using receiver operator curves and logistic regression. Results. All tests individually provided similar fall prediction (area under the curve (AUC 0.60–0.75. A fall in the past year was the best predictor of falls (AUC 0.75, sensitivity 0.89, specificity 0.56 or injurious falls (AUC 0.69, sensitivity 0.96, specificity 0.41 in the following 6 months. Conclusion. Simply asking people with MS if they have fallen in the past year predicts future falls and injurious falls as well as more complex, expensive, or time-consuming approaches.

  13. ILT based defect simulation of inspection images accurately predicts mask defect printability on wafer

    Science.gov (United States)

    Deep, Prakash; Paninjath, Sankaranarayanan; Pereira, Mark; Buck, Peter

    2016-05-01

    At advanced technology nodes mask complexity has been increased because of large-scale use of resolution enhancement technologies (RET) which includes Optical Proximity Correction (OPC), Inverse Lithography Technology (ILT) and Source Mask Optimization (SMO). The number of defects detected during inspection of such mask increased drastically and differentiation of critical and non-critical defects are more challenging, complex and time consuming. Because of significant defectivity of EUVL masks and non-availability of actinic inspection, it is important and also challenging to predict the criticality of defects for printability on wafer. This is one of the significant barriers for the adoption of EUVL for semiconductor manufacturing. Techniques to decide criticality of defects from images captured using non actinic inspection images is desired till actinic inspection is not available. High resolution inspection of photomask images detects many defects which are used for process and mask qualification. Repairing all defects is not practical and probably not required, however it's imperative to know which defects are severe enough to impact wafer before repair. Additionally, wafer printability check is always desired after repairing a defect. AIMSTM review is the industry standard for this, however doing AIMSTM review for all defects is expensive and very time consuming. Fast, accurate and an economical mechanism is desired which can predict defect printability on wafer accurately and quickly from images captured using high resolution inspection machine. Predicting defect printability from such images is challenging due to the fact that the high resolution images do not correlate with actual mask contours. The challenge is increased due to use of different optical condition during inspection other than actual scanner condition, and defects found in such images do not have correlation with actual impact on wafer. Our automated defect simulation tool predicts

  14. Differential contribution of visual and auditory information to accurately predict the direction and rotational motion of a visual stimulus.

    Science.gov (United States)

    Park, Seoung Hoon; Kim, Seonjin; Kwon, MinHyuk; Christou, Evangelos A

    2016-03-01

    Vision and auditory information are critical for perception and to enhance the ability of an individual to respond accurately to a stimulus. However, it is unknown whether visual and auditory information contribute differentially to identify the direction and rotational motion of the stimulus. The purpose of this study was to determine the ability of an individual to accurately predict the direction and rotational motion of the stimulus based on visual and auditory information. In this study, we recruited 9 expert table-tennis players and used table-tennis service as our experimental model. Participants watched recorded services with different levels of visual and auditory information. The goal was to anticipate the direction of the service (left or right) and the rotational motion of service (topspin, sidespin, or cut). We recorded their responses and quantified the following outcomes: (i) directional accuracy and (ii) rotational motion accuracy. The response accuracy was the accurate predictions relative to the total number of trials. The ability of the participants to predict the direction of the service accurately increased with additional visual information but not with auditory information. In contrast, the ability of the participants to predict the rotational motion of the service accurately increased with the addition of auditory information to visual information but not with additional visual information alone. In conclusion, this finding demonstrates that visual information enhances the ability of an individual to accurately predict the direction of the stimulus, whereas additional auditory information enhances the ability of an individual to accurately predict the rotational motion of stimulus.

  15. Improvement of a land surface model for accurate prediction of surface energy and water balances

    International Nuclear Information System (INIS)

    Katata, Genki

    2009-02-01

    In order to predict energy and water balances between the biosphere and atmosphere accurately, sophisticated schemes to calculate evaporation and adsorption processes in the soil and cloud (fog) water deposition on vegetation were implemented in the one-dimensional atmosphere-soil-vegetation model including CO 2 exchange process (SOLVEG2). Performance tests in arid areas showed that the above schemes have a significant effect on surface energy and water balances. The framework of the above schemes incorporated in the SOLVEG2 and instruction for running the model are documented. With further modifications of the model to implement the carbon exchanges between the vegetation and soil, deposition processes of materials on the land surface, vegetation stress-growth-dynamics etc., the model is suited to evaluate an effect of environmental loads to ecosystems by atmospheric pollutants and radioactive substances under climate changes such as global warming and drought. (author)

  16. Crystal Graph Convolutional Neural Networks for an Accurate and Interpretable Prediction of Material Properties

    Science.gov (United States)

    Xie, Tian; Grossman, Jeffrey C.

    2018-04-01

    The use of machine learning methods for accelerating the design of crystalline materials usually requires manually constructed feature vectors or complex transformation of atom coordinates to input the crystal structure, which either constrains the model to certain crystal types or makes it difficult to provide chemical insights. Here, we develop a crystal graph convolutional neural networks framework to directly learn material properties from the connection of atoms in the crystal, providing a universal and interpretable representation of crystalline materials. Our method provides a highly accurate prediction of density functional theory calculated properties for eight different properties of crystals with various structure types and compositions after being trained with 1 04 data points. Further, our framework is interpretable because one can extract the contributions from local chemical environments to global properties. Using an example of perovskites, we show how this information can be utilized to discover empirical rules for materials design.

  17. Watershed area ratio accurately predicts daily streamflow in nested catchments in the Catskills, New York

    Directory of Open Access Journals (Sweden)

    Chris C. Gianfagna

    2015-09-01

    New hydrological insights for the region: Watershed area ratio was the most important basin parameter for estimating flow at upstream sites based on downstream flow. The area ratio alone explained 93% of the variance in the slopes of relationships between upstream and downstream flows. Regression analysis indicated that flow at any upstream point can be estimated by multiplying the flow at a downstream reference gage by the watershed area ratio. This method accurately predicted upstream flows at area ratios as low as 0.005. We also observed a very strong relationship (R2 = 0.79 between area ratio and flow–flow slopes in non-nested catchments. Our results indicate that a simple flow estimation method based on watershed area ratios is justifiable, and indeed preferred, for the estimation of daily streamflow in ungaged watersheds in the Catskills region.

  18. In vitro transcription accurately predicts lac repressor phenotype in vivo in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Matthew Almond Sochor

    2014-07-01

    Full Text Available A multitude of studies have looked at the in vivo and in vitro behavior of the lac repressor binding to DNA and effector molecules in order to study transcriptional repression, however these studies are not always reconcilable. Here we use in vitro transcription to directly mimic the in vivo system in order to build a self consistent set of experiments to directly compare in vivo and in vitro genetic repression. A thermodynamic model of the lac repressor binding to operator DNA and effector is used to link DNA occupancy to either normalized in vitro mRNA product or normalized in vivo fluorescence of a regulated gene, YFP. An accurate measurement of repressor, DNA and effector concentrations were made both in vivo and in vitro allowing for direct modeling of the entire thermodynamic equilibrium. In vivo repression profiles are accurately predicted from the given in vitro parameters when molecular crowding is considered. Interestingly, our measured repressor–operator DNA affinity differs significantly from previous in vitro measurements. The literature values are unable to replicate in vivo binding data. We therefore conclude that the repressor-DNA affinity is much weaker than previously thought. This finding would suggest that in vitro techniques that are specifically designed to mimic the in vivo process may be necessary to replicate the native system.

  19. Measuring solar reflectance - Part I: Defining a metric that accurately predicts solar heat gain

    Energy Technology Data Exchange (ETDEWEB)

    Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul [Heat Island Group, Environmental Energy Technologies Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)

    2010-09-15

    Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective ''cool colored'' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland US latitudes, this metric R{sub E891BN} can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {<=} 5:12 [23 ]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool roof net energy savings by as much as 23%. We define clear sky air mass one global horizontal (''AM1GH'') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer. (author)

  20. A Machine Learned Classifier That Uses Gene Expression Data to Accurately Predict Estrogen Receptor Status

    Science.gov (United States)

    Bastani, Meysam; Vos, Larissa; Asgarian, Nasimeh; Deschenes, Jean; Graham, Kathryn; Mackey, John; Greiner, Russell

    2013-01-01

    Background Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER) status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. Methods To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. Results This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. Conclusions Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions. PMID:24312637

  1. Measuring solar reflectance Part I: Defining a metric that accurately predicts solar heat gain

    Energy Technology Data Exchange (ETDEWEB)

    Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul

    2010-05-14

    Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective 'cool colored' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland U.S. latitudes, this metric RE891BN can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {le} 5:12 [23{sup o}]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool-roof net energy savings by as much as 23%. We define clear-sky air mass one global horizontal ('AM1GH') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer.

  2. A machine learned classifier that uses gene expression data to accurately predict estrogen receptor status.

    Directory of Open Access Journals (Sweden)

    Meysam Bastani

    Full Text Available BACKGROUND: Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. METHODS: To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. RESULTS: This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. CONCLUSIONS: Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions.

  3. Highly accurate prediction of food challenge outcome using routinely available clinical data.

    Science.gov (United States)

    DunnGalvin, Audrey; Daly, Deirdre; Cullinane, Claire; Stenke, Emily; Keeton, Diane; Erlewyn-Lajeunesse, Mich; Roberts, Graham C; Lucas, Jane; Hourihane, Jonathan O'B

    2011-03-01

    Serum specific IgE or skin prick tests are less useful at levels below accepted decision points. We sought to develop and validate a model to predict food challenge outcome by using routinely collected data in a diverse sample of children considered suitable for food challenge. The proto-algorithm was generated by using a limited data set from 1 service (phase 1). We retrospectively applied, evaluated, and modified the initial model by using an extended data set in another center (phase 2). Finally, we prospectively validated the model in a blind study in a further group of children undergoing food challenge for peanut, milk, or egg in the second center (phase 3). Allergen-specific models were developed for peanut, egg, and milk. Phase 1 (N = 429) identified 5 clinical factors associated with diagnosis of food allergy by food challenge. In phase 2 (N = 289), we examined the predictive ability of 6 clinical factors: skin prick test, serum specific IgE, total IgE minus serum specific IgE, symptoms, sex, and age. In phase 3 (N = 70), 97% of cases were accurately predicted as positive and 94% as negative. Our model showed an advantage in clinical prediction compared with serum specific IgE only, skin prick test only, and serum specific IgE and skin prick test (92% accuracy vs 57%, and 81%, respectively). Our findings have implications for the improved delivery of food allergy-related health care, enhanced food allergy-related quality of life, and economized use of health service resources by decreasing the number of food challenges performed. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  4. ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers

    Energy Technology Data Exchange (ETDEWEB)

    Visel, Axel; Blow, Matthew J.; Li, Zirong; Zhang, Tao; Akiyama, Jennifer A.; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Wright, Crystal; Chen, Feng; Afzal, Veena; Ren, Bing; Rubin, Edward M.; Pennacchio, Len A.

    2009-02-01

    A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. We tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.

  5. Accurate and Reliable Prediction of the Binding Affinities of Macrocycles to Their Protein Targets.

    Science.gov (United States)

    Yu, Haoyu S; Deng, Yuqing; Wu, Yujie; Sindhikara, Dan; Rask, Amy R; Kimura, Takayuki; Abel, Robert; Wang, Lingle

    2017-12-12

    Macrocycles have been emerging as a very important drug class in the past few decades largely due to their expanded chemical diversity benefiting from advances in synthetic methods. Macrocyclization has been recognized as an effective way to restrict the conformational space of acyclic small molecule inhibitors with the hope of improving potency, selectivity, and metabolic stability. Because of their relatively larger size as compared to typical small molecule drugs and the complexity of the structures, efficient sampling of the accessible macrocycle conformational space and accurate prediction of their binding affinities to their target protein receptors poses a great challenge of central importance in computational macrocycle drug design. In this article, we present a novel method for relative binding free energy calculations between macrocycles with different ring sizes and between the macrocycles and their corresponding acyclic counterparts. We have applied the method to seven pharmaceutically interesting data sets taken from recent drug discovery projects including 33 macrocyclic ligands covering a diverse chemical space. The predicted binding free energies are in good agreement with experimental data with an overall root-mean-square error (RMSE) of 0.94 kcal/mol. This is to our knowledge the first time where the free energy of the macrocyclization of linear molecules has been directly calculated with rigorous physics-based free energy calculation methods, and we anticipate the outstanding accuracy demonstrated here across a broad range of target classes may have significant implications for macrocycle drug discovery.

  6. Do Dual-Route Models Accurately Predict Reading and Spelling Performance in Individuals with Acquired Alexia and Agraphia?

    OpenAIRE

    Rapcsak, Steven Z.; Henry, Maya L.; Teague, Sommer L.; Carnahan, Susan D.; Beeson, Pélagie M.

    2007-01-01

    Coltheart and colleagues (Coltheart, Rastle, Perry, Langdon, & Ziegler, 2001; Castles, Bates, & Coltheart, 2006) have demonstrated that an equation derived from dual-route theory accurately predicts reading performance in young normal readers and in children with reading impairment due to developmental dyslexia or stroke. In this paper we present evidence that the dual-route equation and a related multiple regression model also accurately predict both reading and spelling performance in adult...

  7. Accurate First-Principles Spectra Predictions for Planetological and Astrophysical Applications at Various T-Conditions

    Science.gov (United States)

    Rey, M.; Nikitin, A. V.; Tyuterev, V.

    2014-06-01

    Knowledge of near infrared intensities of rovibrational transitions of polyatomic molecules is essential for the modeling of various planetary atmospheres, brown dwarfs and for other astrophysical applications 1,2,3. For example, to analyze exoplanets, atmospheric models have been developed, thus making the need to provide accurate spectroscopic data. Consequently, the spectral characterization of such planetary objects relies on the necessity of having adequate and reliable molecular data in extreme conditions (temperature, optical path length, pressure). On the other hand, in the modeling of astrophysical opacities, millions of lines are generally involved and the line-by-line extraction is clearly not feasible in laboratory measurements. It is thus suggested that this large amount of data could be interpreted only by reliable theoretical predictions. There exists essentially two theoretical approaches for the computation and prediction of spectra. The first one is based on empirically-fitted effective spectroscopic models. Another way for computing energies, line positions and intensities is based on global variational calculations using ab initio surfaces. They do not yet reach the spectroscopic accuracy stricto sensu but implicitly account for all intramolecular interactions including resonance couplings in a wide spectral range. The final aim of this work is to provide reliable predictions which could be quantitatively accurate with respect to the precision of available observations and as complete as possible. All this thus requires extensive first-principles quantum mechanical calculations essentially based on three necessary ingredients which are (i) accurate intramolecular potential energy surface and dipole moment surface components well-defined in a large range of vibrational displacements and (ii) efficient computational methods combined with suitable choices of coordinates to account for molecular symmetry properties and to achieve a good numerical

  8. Does the emergency surgery score accurately predict outcomes in emergent laparotomies?

    Science.gov (United States)

    Peponis, Thomas; Bohnen, Jordan D; Sangji, Naveen F; Nandan, Anirudh R; Han, Kelsey; Lee, Jarone; Yeh, D Dante; de Moya, Marc A; Velmahos, George C; Chang, David C; Kaafarani, Haytham M A

    2017-08-01

    The emergency surgery score is a mortality-risk calculator for emergency general operation patients. We sought to examine whether the emergency surgery score predicts 30-day morbidity and mortality in a high-risk group of patients undergoing emergent laparotomy. Using the 2011-2012 American College of Surgeons National Surgical Quality Improvement Program database, we identified all patients who underwent emergent laparotomy using (1) the American College of Surgeons National Surgical Quality Improvement Program definition of "emergent," and (2) all Current Procedural Terminology codes denoting a laparotomy, excluding aortic aneurysm rupture. Multivariable logistic regression analyses were performed to measure the correlation (c-statistic) between the emergency surgery score and (1) 30-day mortality, and (2) 30-day morbidity after emergent laparotomy. As sensitivity analyses, the correlation between the emergency surgery score and 30-day mortality was also evaluated in prespecified subgroups based on Current Procedural Terminology codes. A total of 26,410 emergent laparotomy patients were included. Thirty-day mortality and morbidity were 10.2% and 43.8%, respectively. The emergency surgery score correlated well with mortality (c-statistic = 0.84); scores of 1, 11, and 22 correlated with mortalities of 0.4%, 39%, and 100%, respectively. Similarly, the emergency surgery score correlated well with morbidity (c-statistic = 0.74); scores of 0, 7, and 11 correlated with complication rates of 13%, 58%, and 79%, respectively. The morbidity rates plateaued for scores higher than 11. Sensitivity analyses demonstrated that the emergency surgery score effectively predicts mortality in patients undergoing emergent (1) splenic, (2) gastroduodenal, (3) intestinal, (4) hepatobiliary, or (5) incarcerated ventral hernia operation. The emergency surgery score accurately predicts outcomes in all types of emergent laparotomy patients and may prove valuable as a bedside decision

  9. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  10. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  11. Can radiation therapy treatment planning system accurately predict surface doses in postmastectomy radiation therapy patients?

    International Nuclear Information System (INIS)

    Wong, Sharon; Back, Michael; Tan, Poh Wee; Lee, Khai Mun; Baggarley, Shaun; Lu, Jaide Jay

    2012-01-01

    Skin doses have been an important factor in the dose prescription for breast radiotherapy. Recent advances in radiotherapy treatment techniques, such as intensity-modulated radiation therapy (IMRT) and new treatment schemes such as hypofractionated breast therapy have made the precise determination of the surface dose necessary. Detailed information of the dose at various depths of the skin is also critical in designing new treatment strategies. The purpose of this work was to assess the accuracy of surface dose calculation by a clinically used treatment planning system and those measured by thermoluminescence dosimeters (TLDs) in a customized chest wall phantom. This study involved the construction of a chest wall phantom for skin dose assessment. Seven TLDs were distributed throughout each right chest wall phantom to give adequate representation of measured radiation doses. Point doses from the CMS Xio® treatment planning system (TPS) were calculated for each relevant TLD positions and results correlated. There were no significant difference between measured absorbed dose by TLD and calculated doses by the TPS (p > 0.05 (1-tailed). Dose accuracy of up to 2.21% was found. The deviations from the calculated absorbed doses were overall larger (3.4%) when wedges and bolus were used. 3D radiotherapy TPS is a useful and accurate tool to assess the accuracy of surface dose. Our studies have shown that radiation treatment accuracy expressed as a comparison between calculated doses (by TPS) and measured doses (by TLD dosimetry) can be accurately predicted for tangential treatment of the chest wall after mastectomy.

  12. How accurate is anatomic limb alignment in predicting mechanical limb alignment after total knee arthroplasty?

    Science.gov (United States)

    Lee, Seung Ah; Choi, Sang-Hee; Chang, Moon Jong

    2015-10-27

    Anatomic limb alignment often differs from mechanical limb alignment after total knee arthroplasty (TKA). We sought to assess the accuracy, specificity, and sensitivity for each of three commonly used ranges for anatomic limb alignment (3-9°, 5-10° and 2-10°) in predicting an acceptable range (neutral ± 3°) for mechanical limb alignment after TKA. We also assessed whether the accuracy of anatomic limb alignment was affected by anatomic variation. This retrospective study included 314 primary TKAs. The alignment of the limb was measured with both anatomic and mechanical methods of measurement. We also measured anatomic variation, including the femoral bowing angle, tibial bowing angle, and neck-shaft angle of the femur. All angles were measured on the same full-length standing anteroposterior radiographs. The accuracy, specificity, and sensitivity for each range of anatomic limb alignment were calculated and compared using mechanical limb alignment as the reference standard. The associations between the accuracy of anatomic limb alignment and anatomic variation were also determined. The range of 2-10° for anatomic limb alignment showed the highest accuracy, but it was only 73 % (3-9°, 65 %; 5-10°, 67 %). The specificity of the 2-10° range was 81 %, which was higher than that of the other ranges (3-9°, 69 %; 5-10°, 67 %). However, the sensitivity of the 2-10° range to predict varus malalignment was only 16 % (3-9°, 35 %; 5-10°, 68 %). In addition, the sensitivity of the 2-10° range to predict valgus malalignment was only 43 % (3-9°, 71 %; 5-10°, 43 %). The accuracy of anatomical limb alignment was lower for knees with greater femoral (odds ratio = 1.2) and tibial (odds ratio = 1.2) bowing. Anatomic limb alignment did not accurately predict mechanical limb alignment after TKA, and its accuracy was affected by anatomic variation. Thus, alignment after TKA should be assessed by measuring mechanical alignment rather than anatomic

  13. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  14. A Novel Fibrosis Index Comprising a Non-Cholesterol Sterol Accurately Predicts HCV-Related Liver Cirrhosis

    DEFF Research Database (Denmark)

    Ydreborg, Magdalena; Lisovskaja, Vera; Lagging, Martin

    2014-01-01

    of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive...

  15. Cluster abundance in chameleon f ( R ) gravity I: toward an accurate halo mass function prediction

    Energy Technology Data Exchange (ETDEWEB)

    Cataneo, Matteo; Rapetti, David [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, 2100 Copenhagen (Denmark); Lombriser, Lucas [Institute for Astronomy, University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom); Li, Baojiu, E-mail: matteoc@dark-cosmology.dk, E-mail: drapetti@dark-cosmology.dk, E-mail: llo@roe.ac.uk, E-mail: baojiu.li@durham.ac.uk [Institute for Computational Cosmology, Department of Physics, Durham University, South Road, Durham DH1 3LE (United Kingdom)

    2016-12-01

    We refine the mass and environment dependent spherical collapse model of chameleon f ( R ) gravity by calibrating a phenomenological correction inspired by the parameterized post-Friedmann framework against high-resolution N -body simulations. We employ our method to predict the corresponding modified halo mass function, and provide fitting formulas to calculate the enhancement of the f ( R ) halo abundance with respect to that of General Relativity (GR) within a precision of ∼< 5% from the results obtained in the simulations. Similar accuracy can be achieved for the full f ( R ) mass function on the condition that the modeling of the reference GR abundance of halos is accurate at the percent level. We use our fits to forecast constraints on the additional scalar degree of freedom of the theory, finding that upper bounds competitive with current Solar System tests are within reach of cluster number count analyses from ongoing and upcoming surveys at much larger scales. Importantly, the flexibility of our method allows also for this to be applied to other scalar-tensor theories characterized by a mass and environment dependent spherical collapse.

  16. ROCK I Has More Accurate Prognostic Value than MET in Predicting Patient Survival in Colorectal Cancer.

    Science.gov (United States)

    Li, Jian; Bharadwaj, Shruthi S; Guzman, Grace; Vishnubhotla, Ramana; Glover, Sarah C

    2015-06-01

    Colorectal cancer remains the second leading cause of death in the United States despite improvements in incidence rates and advancements in screening. The present study evaluated the prognostic value of two tumor markers, MET and ROCK I, which have been noted in other cancers to provide more accurate prognoses of patient outcomes than tumor staging alone. We constructed a tissue microarray from surgical specimens of adenocarcinomas from 108 colorectal cancer patients. Using immunohistochemistry, we examined the expression levels of tumor markers MET and ROCK I, with a pathologist blinded to patient identities and clinical outcomes providing the scoring of MET and ROCK I expression. We then used retrospective analysis of patients' survival data to provide correlations with expression levels of MET and ROCK I. Both MET and ROCK I were significantly over-expressed in colorectal cancer tissues, relative to the unaffected adjacent mucosa. Kaplan-Meier survival analysis revealed that patients' 5-year survival was inversely correlated with levels of expression of ROCK I. In contrast, MET was less strongly correlated with five-year survival. ROCK I provides better efficacy in predicting patient outcomes, compared to either tumor staging or MET expression. As a result, ROCK I may provide a less invasive method of assessing patient prognoses and directing therapeutic interventions. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Fast and Accurate Prediction of Numerical Relativity Waveforms from Binary Black Hole Coalescences Using Surrogate Models.

    Science.gov (United States)

    Blackman, Jonathan; Field, Scott E; Galley, Chad R; Szilágyi, Béla; Scheel, Mark A; Tiglio, Manuel; Hemberger, Daniel A

    2015-09-18

    Simulating a binary black hole coalescence by solving Einstein's equations is computationally expensive, requiring days to months of supercomputing time. Using reduced order modeling techniques, we construct an accurate surrogate model, which is evaluated in a millisecond to a second, for numerical relativity (NR) waveforms from nonspinning binary black hole coalescences with mass ratios in [1, 10] and durations corresponding to about 15 orbits before merger. We assess the model's uncertainty and show that our modeling strategy predicts NR waveforms not used for the surrogate's training with errors nearly as small as the numerical error of the NR code. Our model includes all spherical-harmonic _{-2}Y_{ℓm} waveform modes resolved by the NR code up to ℓ=8. We compare our surrogate model to effective one body waveforms from 50M_{⊙} to 300M_{⊙} for advanced LIGO detectors and find that the surrogate is always more faithful (by at least an order of magnitude in most cases).

  18. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  19. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  20. Absolute Hounsfield unit measurement on noncontrast computed tomography cannot accurately predict struvite stone composition.

    Science.gov (United States)

    Marchini, Giovanni Scala; Gebreselassie, Surafel; Liu, Xiaobo; Pynadath, Cindy; Snyder, Grace; Monga, Manoj

    2013-02-01

    The purpose of our study was to determine, in vivo, whether single-energy noncontrast computed tomography (NCCT) can accurately predict the presence/percentage of struvite stone composition. We retrospectively searched for all patients with struvite components on stone composition analysis between January 2008 and March 2012. Inclusion criteria were NCCT prior to stone analysis and stone size ≥4 mm. A single urologist, blinded to stone composition, reviewed all NCCT to acquire stone location, dimensions, and Hounsfield unit (HU). HU density (HUD) was calculated by dividing mean HU by the stone's largest transverse diameter. Stone analysis was performed via Fourier transform infrared spectrometry. Independent sample Student's t-test and analysis of variance (ANOVA) were used to compare HU/HUD among groups. Spearman's correlation test was used to determine the correlation between HU and stone size and also HU/HUD to % of each component within the stone. Significance was considered if pR=0.017; p=0.912) and negative with HUD (R=-0.20; p=0.898). Overall, 3 (6.8%) had stones (n=5) with other miscellaneous stones (n=39), no difference was found for HU (p=0.09) but HUD was significantly lower for pure stones (27.9±23.6 v 72.5±55.9, respectively; p=0.006). Again, significant overlaps were seen. Pure struvite stones have significantly lower HUD than mixed struvite stones, but overlap exists. A low HUD may increase the suspicion for a pure struvite calculus.

  1. Unilateral Prostate Cancer Cannot be Accurately Predicted in Low-Risk Patients

    International Nuclear Information System (INIS)

    Isbarn, Hendrik; Karakiewicz, Pierre I.; Vogel, Susanne

    2010-01-01

    Purpose: Hemiablative therapy (HAT) is increasing in popularity for treatment of patients with low-risk prostate cancer (PCa). The validity of this therapeutic modality, which exclusively treats PCa within a single prostate lobe, rests on accurate staging. We tested the accuracy of unilaterally unremarkable biopsy findings in cases of low-risk PCa patients who are potential candidates for HAT. Methods and Materials: The study population consisted of 243 men with clinical stage ≤T2a, a prostate-specific antigen (PSA) concentration of <10 ng/ml, a biopsy-proven Gleason sum of ≤6, and a maximum of 2 ipsilateral positive biopsy results out of 10 or more cores. All men underwent a radical prostatectomy, and pathology stage was used as the gold standard. Univariable and multivariable logistic regression models were tested for significant predictors of unilateral, organ-confined PCa. These predictors consisted of PSA, %fPSA (defined as the quotient of free [uncomplexed] PSA divided by the total PSA), clinical stage (T2a vs. T1c), gland volume, and number of positive biopsy cores (2 vs. 1). Results: Despite unilateral stage at biopsy, bilateral or even non-organ-confined PCa was reported in 64% of all patients. In multivariable analyses, no variable could clearly and independently predict the presence of unilateral PCa. This was reflected in an overall accuracy of 58% (95% confidence interval, 50.6-65.8%). Conclusions: Two-thirds of patients with unilateral low-risk PCa, confirmed by clinical stage and biopsy findings, have bilateral or non-organ-confined PCa at radical prostatectomy. This alarming finding questions the safety and validity of HAT.

  2. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  3. Large arterial occlusive strokes as a medical emergency: need to accurately predict clot location.

    Science.gov (United States)

    Vanacker, Peter; Faouzi, Mohamed; Eskandari, Ashraf; Maeder, Philippe; Meuli, Reto; Michel, Patrik

    2017-10-01

    Endovascular treatment for acute ischemic stroke with a large intracranial occlusion was recently shown to be effective. Timely knowledge of the presence, site, and extent of arterial occlusions in the ischemic territory has the potential to influence patient selection for endovascular treatment. We aimed to find predictors of large vessel occlusive strokes, on the basis of available demographic, clinical, radiological, and laboratory data in the emergency setting. Patients enrolled in ASTRAL registry with acute ischemic stroke and computed tomography (CT)-angiography within 12 h of stroke onset were selected and categorized according to occlusion site. Easily accessible variables were used in a multivariate analysis. Of 1645 patients enrolled, a significant proportion (46.2%) had a large vessel occlusion in the ischemic territory. The main clinical predictors of any arterial occlusion were in-hospital stroke [odd ratios (OR) 2.1, 95% confidence interval 1.4-3.1], higher initial National Institute of Health Stroke Scale (OR 1.1, 1.1-1.2), presence of visual field defects (OR 1.9, 1.3-2.6), dysarthria (OR 1.4, 1.0-1.9), or hemineglect (OR 2.0, 1.4-2.8) at admission and atrial fibrillation (OR 1.7, 1.2-2.3). Further, the following radiological predictors were identified: time-to-imaging (OR 0.9, 0.9-1.0), early ischemic changes (OR 2.3, 1.7-3.2), and silent lesions on CT (OR 0.7, 0.5-1.0). The area under curve for this analysis was 0.85. Looking at different occlusion sites, National Institute of Health Stroke Scale and early ischemic changes on CT were independent predictors in all subgroups. Neurological deficits, stroke risk factors, and CT findings accurately identify acute ischemic stroke patients at risk of symptomatic vessel occlusion. Predicting the presence of these occlusions may impact emergency stroke care in regions with limited access to noninvasive vascular imaging.

  4. Combining structural modeling with ensemble machine learning to accurately predict protein fold stability and binding affinity effects upon mutation.

    Directory of Open Access Journals (Sweden)

    Niklas Berliner

    Full Text Available Advances in sequencing have led to a rapid accumulation of mutations, some of which are associated with diseases. However, to draw mechanistic conclusions, a biochemical understanding of these mutations is necessary. For coding mutations, accurate prediction of significant changes in either the stability of proteins or their affinity to their binding partners is required. Traditional methods have used semi-empirical force fields, while newer methods employ machine learning of sequence and structural features. Here, we show how combining both of these approaches leads to a marked boost in accuracy. We introduce ELASPIC, a novel ensemble machine learning approach that is able to predict stability effects upon mutation in both, domain cores and domain-domain interfaces. We combine semi-empirical energy terms, sequence conservation, and a wide variety of molecular details with a Stochastic Gradient Boosting of Decision Trees (SGB-DT algorithm. The accuracy of our predictions surpasses existing methods by a considerable margin, achieving correlation coefficients of 0.77 for stability, and 0.75 for affinity predictions. Notably, we integrated homology modeling to enable proteome-wide prediction and show that accurate prediction on modeled structures is possible. Lastly, ELASPIC showed significant differences between various types of disease-associated mutations, as well as between disease and common neutral mutations. Unlike pure sequence-based prediction methods that try to predict phenotypic effects of mutations, our predictions unravel the molecular details governing the protein instability, and help us better understand the molecular causes of diseases.

  5. Towards Accurate Prediction of Unbalance Response, Oil Whirl and Oil Whip of Flexible Rotors Supported by Hydrodynamic Bearings

    Directory of Open Access Journals (Sweden)

    Rob Eling

    2016-09-01

    Full Text Available Journal bearings are used to support rotors in a wide range of applications. In order to ensure reliable operation, accurate analyses of these rotor-bearing systems are crucial. Coupled analysis of the rotor and the journal bearing is essential in the case that the rotor is flexible. The accuracy of prediction of the model at hand depends on its comprehensiveness. In this study, we construct three bearing models of increasing modeling comprehensiveness and use these to predict the response of two different rotor-bearing systems. The main goal is to evaluate the correlation with measurement data as a function of modeling comprehensiveness: 1D versus 2D pressure prediction, distributed versus lumped thermal model, Newtonian versus non-Newtonian fluid description and non-mass-conservative versus mass-conservative cavitation description. We conclude that all three models predict the existence of critical speeds and whirl for both rotor-bearing systems. However, the two more comprehensive models in general show better correlation with measurement data in terms of frequency and amplitude. Furthermore, we conclude that a thermal network model comprising temperature predictions of the bearing surroundings is essential to obtain accurate predictions. The results of this study aid in developing accurate and computationally-efficient models of flexible rotors supported by plain journal bearings.

  6. Accurate diffraction data integration by the EVAL15 profile prediction method : Application in chemical and biological crystallography

    NARCIS (Netherlands)

    Xian, X.

    2009-01-01

    Accurate integration of reflection intensities plays an essential role in structure determination of the crystallized compound. A new diffraction data integration method, EVAL15, is presented in this thesis. This method uses the principle of general impacts to predict ab inito three-dimensional

  7. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Science.gov (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill

    2017-01-01

    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding. PMID:28729875

  8. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2017-07-01

    Full Text Available Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  9. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding.

    Science.gov (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill

    2017-01-01

    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  10. Towards more accurate wind and solar power prediction by improving NWP model physics

    Science.gov (United States)

    Steiner, Andrea; Köhler, Carmen; von Schumann, Jonas; Ritter, Bodo

    2014-05-01

    The growing importance and successive expansion of renewable energies raise new challenges for decision makers, economists, transmission system operators, scientists and many more. In this interdisciplinary field, the role of Numerical Weather Prediction (NWP) is to reduce the errors and provide an a priori estimate of remaining uncertainties associated with the large share of weather-dependent power sources. For this purpose it is essential to optimize NWP model forecasts with respect to those prognostic variables which are relevant for wind and solar power plants. An improved weather forecast serves as the basis for a sophisticated power forecasts. Consequently, a well-timed energy trading on the stock market, and electrical grid stability can be maintained. The German Weather Service (DWD) currently is involved with two projects concerning research in the field of renewable energy, namely ORKA*) and EWeLiNE**). Whereas the latter is in collaboration with the Fraunhofer Institute (IWES), the project ORKA is led by energy & meteo systems (emsys). Both cooperate with German transmission system operators. The goal of the projects is to improve wind and photovoltaic (PV) power forecasts by combining optimized NWP and enhanced power forecast models. In this context, the German Weather Service aims to improve its model system, including the ensemble forecasting system, by working on data assimilation, model physics and statistical post processing. This presentation is focused on the identification of critical weather situations and the associated errors in the German regional NWP model COSMO-DE. First steps leading to improved physical parameterization schemes within the NWP-model are presented. Wind mast measurements reaching up to 200 m height above ground are used for the estimation of the (NWP) wind forecast error at heights relevant for wind energy plants. One particular problem is the daily cycle in wind speed. The transition from stable stratification during

  11. A machine learning approach to the accurate prediction of multi-leaf collimator positional errors

    Science.gov (United States)

    Carlson, Joel N. K.; Park, Jong Min; Park, So-Yeon; In Park, Jong; Choi, Yunseok; Ye, Sung-Joon

    2016-03-01

    Discrepancies between planned and delivered movements of multi-leaf collimators (MLCs) are an important source of errors in dose distributions during radiotherapy. In this work we used machine learning techniques to train models to predict these discrepancies, assessed the accuracy of the model predictions, and examined the impact these errors have on quality assurance (QA) procedures and dosimetry. Predictive leaf motion parameters for the models were calculated from the plan files, such as leaf position and velocity, whether the leaf was moving towards or away from the isocenter of the MLC, and many others. Differences in positions between synchronized DICOM-RT planning files and DynaLog files reported during QA delivery were used as a target response for training of the models. The final model is capable of predicting MLC positions during delivery to a high degree of accuracy. For moving MLC leaves, predicted positions were shown to be significantly closer to delivered positions than were planned positions. By incorporating predicted positions into dose calculations in the TPS, increases were shown in gamma passing rates against measured dose distributions recorded during QA delivery. For instance, head and neck plans with 1%/2 mm gamma criteria had an average increase in passing rate of 4.17% (SD  =  1.54%). This indicates that the inclusion of predictions during dose calculation leads to a more realistic representation of plan delivery. To assess impact on the patient, dose volumetric histograms (DVH) using delivered positions were calculated for comparison with planned and predicted DVHs. In all cases, predicted dose volumetric parameters were in closer agreement to the delivered parameters than were the planned parameters, particularly for organs at risk on the periphery of the treatment area. By incorporating the predicted positions into the TPS, the treatment planner is given a more realistic view of the dose distribution as it will truly be

  12. Dynamics of Flexible MLI-type Debris for Accurate Orbit Prediction

    Science.gov (United States)

    2014-09-01

    debris for accurate propagation under perturbations”, in Proceedings of 65th International Astronautical Congress (IAC 2014), Toronto, Canada , 2014...Surveillance Network ( SSN ) was able to detect more than 900 pieces of debris that were at risk to damage operational spacecraft. In February 10, 2009...created two large debris clouds and the SSN reported that 382 pieces of debris from Iridium 33 and 893 pieces from Cosmos 2251 were created, and

  13. Accurate microRNA target prediction correlates with protein repression levels

    Directory of Open Access Journals (Sweden)

    Simossis Victor A

    2009-09-01

    Full Text Available Abstract Background MicroRNAs are small endogenously expressed non-coding RNA molecules that regulate target gene expression through translation repression or messenger RNA degradation. MicroRNA regulation is performed through pairing of the microRNA to sites in the messenger RNA of protein coding genes. Since experimental identification of miRNA target genes poses difficulties, computational microRNA target prediction is one of the key means in deciphering the role of microRNAs in development and disease. Results DIANA-microT 3.0 is an algorithm for microRNA target prediction which is based on several parameters calculated individually for each microRNA and combines conserved and non-conserved microRNA recognition elements into a final prediction score, which correlates with protein production fold change. Specifically, for each predicted interaction the program reports a signal to noise ratio and a precision score which can be used as an indication of the false positive rate of the prediction. Conclusion Recently, several computational target prediction programs were benchmarked based on a set of microRNA target genes identified by the pSILAC method. In this assessment DIANA-microT 3.0 was found to achieve the highest precision among the most widely used microRNA target prediction programs reaching approximately 66%. The DIANA-microT 3.0 prediction results are available online in a user friendly web server at http://www.microrna.gr/microT

  14. Sensor Data Fusion for Accurate Cloud Presence Prediction Using Dempster-Shafer Evidence Theory

    Directory of Open Access Journals (Sweden)

    Jesse S. Jin

    2010-10-01

    Full Text Available Sensor data fusion technology can be used to best extract useful information from multiple sensor observations. It has been widely applied in various applications such as target tracking, surveillance, robot navigation, signal and image processing. This paper introduces a novel data fusion approach in a multiple radiation sensor environment using Dempster-Shafer evidence theory. The methodology is used to predict cloud presence based on the inputs of radiation sensors. Different radiation data have been used for the cloud prediction. The potential application areas of the algorithm include renewable power for virtual power station where the prediction of cloud presence is the most challenging issue for its photovoltaic output. The algorithm is validated by comparing the predicted cloud presence with the corresponding sunshine occurrence data that were recorded as the benchmark. Our experiments have indicated that comparing to the approaches using individual sensors, the proposed data fusion approach can increase correct rate of cloud prediction by ten percent, and decrease unknown rate of cloud prediction by twenty three percent.

  15. Do dual-route models accurately predict reading and spelling performance in individuals with acquired alexia and agraphia?

    Science.gov (United States)

    Rapcsak, Steven Z; Henry, Maya L; Teague, Sommer L; Carnahan, Susan D; Beeson, Pélagie M

    2007-06-18

    Coltheart and co-workers [Castles, A., Bates, T. C., & Coltheart, M. (2006). John Marshall and the developmental dyslexias. Aphasiology, 20, 871-892; Coltheart, M., Rastle, K., Perry, C., Langdon, R., & Ziegler, J. (2001). DRC: A dual route cascaded model of visual word recognition and reading aloud. Psychological Review, 108, 204-256] have demonstrated that an equation derived from dual-route theory accurately predicts reading performance in young normal readers and in children with reading impairment due to developmental dyslexia or stroke. In this paper, we present evidence that the dual-route equation and a related multiple regression model also accurately predict both reading and spelling performance in adult neurological patients with acquired alexia and agraphia. These findings provide empirical support for dual-route theories of written language processing.

  16. NESmapper: accurate prediction of leucine-rich nuclear export signals using activity-based profiles.

    Directory of Open Access Journals (Sweden)

    Shunichi Kosugi

    2014-09-01

    Full Text Available The nuclear export of proteins is regulated largely through the exportin/CRM1 pathway, which involves the specific recognition of leucine-rich nuclear export signals (NESs in the cargo proteins, and modulates nuclear-cytoplasmic protein shuttling by antagonizing the nuclear import activity mediated by importins and the nuclear import signal (NLS. Although the prediction of NESs can help to define proteins that undergo regulated nuclear export, current methods of predicting NESs, including computational tools and consensus-sequence-based searches, have limited accuracy, especially in terms of their specificity. We found that each residue within an NES largely contributes independently and additively to the entire nuclear export activity. We created activity-based profiles of all classes of NESs with a comprehensive mutational analysis in mammalian cells. The profiles highlight a number of specific activity-affecting residues not only at the conserved hydrophobic positions but also in the linker and flanking regions. We then developed a computational tool, NESmapper, to predict NESs by using profiles that had been further optimized by training and combining the amino acid properties of the NES-flanking regions. This tool successfully reduced the considerable number of false positives, and the overall prediction accuracy was higher than that of other methods, including NESsential and Wregex. This profile-based prediction strategy is a reliable way to identify functional protein motifs. NESmapper is available at http://sourceforge.net/projects/nesmapper.

  17. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  18. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  19. Accurate prediction of the ammonia probes of a variable proton-to-electron mass ratio

    Science.gov (United States)

    Owens, A.; Yurchenko, S. N.; Thiel, W.; Špirko, V.

    2015-07-01

    A comprehensive study of the mass sensitivity of the vibration-rotation-inversion transitions of 14NH3, 15NH3, 14ND3 and 15ND3 is carried out variationally using the TROVE approach. Variational calculations are robust and accurate, offering a new way to compute sensitivity coefficients. Particular attention is paid to the Δk = ±3 transitions between the accidentally coinciding rotation-inversion energy levels of the ν2 = 0+, 0-, 1+ and 1- states, and the inversion transitions in the ν4 = 1 state affected by the `giant' l-type doubling effect. These transitions exhibit highly anomalous sensitivities, thus appearing as promising probes of a possible cosmological variation of the proton-to-electron mass ratio μ. Moreover, a simultaneous comparison of the calculated sensitivities reveals a sizeable isotopic dependence which could aid an exclusive ammonia detection.

  20. Are predictive equations for estimating resting energy expenditure accurate in Asian Indian male weightlifters?

    Directory of Open Access Journals (Sweden)

    Mini Joseph

    2017-01-01

    Full Text Available Background: The accuracy of existing predictive equations to determine the resting energy expenditure (REE of professional weightlifters remains scarcely studied. Our study aimed at assessing the REE of male Asian Indian weightlifters with indirect calorimetry and to compare the measured REE (mREE with published equations. A new equation using potential anthropometric variables to predict REE was also evaluated. Materials and Methods: REE was measured on 30 male professional weightlifters aged between 17 and 28 years using indirect calorimetry and compared with the eight formulas predicted by Harris–Benedicts, Mifflin-St. Jeor, FAO/WHO/UNU, ICMR, Cunninghams, Owen, Katch-McArdle, and Nelson. Pearson correlation coefficient, intraclass correlation coefficient, and multiple linear regression analysis were carried out to study the agreement between the different methods, association with anthropometric variables, and to formulate a new prediction equation for this population. Results: Pearson correlation coefficients between mREE and the anthropometric variables showed positive significance with suprailiac skinfold thickness, lean body mass (LBM, waist circumference, hip circumference, bone mineral mass, and body mass. All eight predictive equations underestimated the REE of the weightlifters when compared with the mREE. The highest mean difference was 636 kcal/day (Owen, 1986 and the lowest difference was 375 kcal/day (Cunninghams, 1980. Multiple linear regression done stepwise showed that LBM was the only significant determinant of REE in this group of sportspersons. A new equation using LBM as the independent variable for calculating REE was computed. REE for weightlifters = −164.065 + 0.039 (LBM (confidence interval −1122.984, 794.854]. This new equation reduced the mean difference with mREE by 2.36 + 369.15 kcal/day (standard error = 67.40. Conclusion: The significant finding of this study was that all the prediction equations

  1. A machine learning approach to the accurate prediction of monitor units for a compact proton machine.

    Science.gov (United States)

    Sun, Baozhou; Lam, Dao; Yang, Deshan; Grantham, Kevin; Zhang, Tiezhi; Mutic, Sasa; Zhao, Tianyu

    2018-05-01

    Clinical treatment planning systems for proton therapy currently do not calculate monitor units (MUs) in passive scatter proton therapy due to the complexity of the beam delivery systems. Physical phantom measurements are commonly employed to determine the field-specific output factors (OFs) but are often subject to limited machine time, measurement uncertainties and intensive labor. In this study, a machine learning-based approach was developed to predict output (cGy/MU) and derive MUs, incorporating the dependencies on gantry angle and field size for a single-room proton therapy system. The goal of this study was to develop a secondary check tool for OF measurements and eventually eliminate patient-specific OF measurements. The OFs of 1754 fields previously measured in a water phantom with calibrated ionization chambers and electrometers for patient-specific fields with various range and modulation width combinations for 23 options were included in this study. The training data sets for machine learning models in three different methods (Random Forest, XGBoost and Cubist) included 1431 (~81%) OFs. Ten-fold cross-validation was used to prevent "overfitting" and to validate each model. The remaining 323 (~19%) OFs were used to test the trained models. The difference between the measured and predicted values from machine learning models was analyzed. Model prediction accuracy was also compared with that of the semi-empirical model developed by Kooy (Phys. Med. Biol. 50, 2005). Additionally, gantry angle dependence of OFs was measured for three groups of options categorized on the selection of the second scatters. Field size dependence of OFs was investigated for the measurements with and without patient-specific apertures. All three machine learning methods showed higher accuracy than the semi-empirical model which shows considerably large discrepancy of up to 7.7% for the treatment fields with full range and full modulation width. The Cubist-based solution

  2. Safe surgery: how accurate are we at predicting intra-operative blood loss?

    LENUS (Irish Health Repository)

    2012-02-01

    Introduction Preoperative estimation of intra-operative blood loss by both anaesthetist and operating surgeon is a criterion of the World Health Organization\\'s surgical safety checklist. The checklist requires specific preoperative planning when anticipated blood loss is greater than 500 mL. The aim of this study was to assess the accuracy of surgeons and anaesthetists at predicting intra-operative blood loss. Methods A 6-week prospective study of intermediate and major operations in an academic medical centre was performed. An independent observer interviewed surgical and anaesthetic consultants and registrars, preoperatively asking each to predict expected blood loss in millilitre. Intra-operative blood loss was measured and compared with these predictions. Parameters including the use of anticoagulation and anti-platelet therapy as well as intra-operative hypothermia and hypotension were recorded. Results One hundred sixty-eight operations were included in the study, including 142 elective and 26 emergency operations. Blood loss was predicted to within 500 mL of measured blood loss in 89% of cases. Consultant surgeons tended to underestimate blood loss, doing so in 43% of all cases, while consultant anaesthetists were more likely to overestimate (60% of all operations). Twelve patients (7%) had underestimation of blood loss of more than 500 mL by both surgeon and anaesthetist. Thirty per cent (n = 6\\/20) of patients requiring transfusion of a blood product within 24 hours of surgery had blood loss underestimated by more than 500 mL by both surgeon and anaesthetist. There was no significant difference in prediction between patients on anti-platelet or anticoagulation therapy preoperatively and those not on the said therapies. Conclusion Predicted intra-operative blood loss was within 500 mL of measured blood loss in 89% of operations. In 30% of patients who ultimately receive a blood transfusion, both the surgeon and anaesthetist significantly underestimate

  3. Fast and accurate covalent bond predictions using perturbation theory in chemical space

    Science.gov (United States)

    Chang, Kuang-Yu; von Lilienfeld, Anatole

    I will discuss the predictive accuracy of perturbation theory based estimates of changes in covalent bonding due to linear alchemical interpolations among systems of different chemical composition. We have investigated single, double, and triple bonds occurring in small sets of iso-valence-electronic molecular species with elements drawn from second to fourth rows in the p-block of the periodic table. Numerical evidence suggests that first order estimates of covalent bonding potentials can achieve chemical accuracy (within 1 kcal/mol) if the alchemical interpolation is vertical (fixed geometry) among chemical elements from third and fourth row of the periodic table. When applied to nonbonded systems of molecular dimers or solids such as III-V semiconductors, alanates, alkali halides, and transition metals, similar observations hold, enabling rapid predictions of van der Waals energies, defect energies, band-structures, crystal structures, and lattice constants.

  4. Beating Heart Motion Accurate Prediction Method Based on Interactive Multiple Model: An Information Fusion Approach

    Science.gov (United States)

    Xie, Weihong; Yu, Yang

    2017-01-01

    Robot-assisted motion compensated beating heart surgery has the advantage over the conventional Coronary Artery Bypass Graft (CABG) in terms of reduced trauma to the surrounding structures that leads to shortened recovery time. The severe nonlinear and diverse nature of irregular heart rhythm causes enormous difficulty for the robot to realize the clinic requirements, especially under arrhythmias. In this paper, we propose a fusion prediction framework based on Interactive Multiple Model (IMM) estimator, allowing each model to cover a distinguishing feature of the heart motion in underlying dynamics. We find that, at normal state, the nonlinearity of the heart motion with slow time-variant changing dominates the beating process. When an arrhythmia occurs, the irregularity mode, the fast uncertainties with random patterns become the leading factor of the heart motion. We deal with prediction problem in the case of arrhythmias by estimating the state with two behavior modes which can adaptively “switch” from one to the other. Also, we employed the signal quality index to adaptively determine the switch transition probability in the framework of IMM. We conduct comparative experiments to evaluate the proposed approach with four distinguished datasets. The test results indicate that the new proposed approach reduces prediction errors significantly. PMID:29124062

  5. Beating Heart Motion Accurate Prediction Method Based on Interactive Multiple Model: An Information Fusion Approach

    Directory of Open Access Journals (Sweden)

    Fan Liang

    2017-01-01

    Full Text Available Robot-assisted motion compensated beating heart surgery has the advantage over the conventional Coronary Artery Bypass Graft (CABG in terms of reduced trauma to the surrounding structures that leads to shortened recovery time. The severe nonlinear and diverse nature of irregular heart rhythm causes enormous difficulty for the robot to realize the clinic requirements, especially under arrhythmias. In this paper, we propose a fusion prediction framework based on Interactive Multiple Model (IMM estimator, allowing each model to cover a distinguishing feature of the heart motion in underlying dynamics. We find that, at normal state, the nonlinearity of the heart motion with slow time-variant changing dominates the beating process. When an arrhythmia occurs, the irregularity mode, the fast uncertainties with random patterns become the leading factor of the heart motion. We deal with prediction problem in the case of arrhythmias by estimating the state with two behavior modes which can adaptively “switch” from one to the other. Also, we employed the signal quality index to adaptively determine the switch transition probability in the framework of IMM. We conduct comparative experiments to evaluate the proposed approach with four distinguished datasets. The test results indicate that the new proposed approach reduces prediction errors significantly.

  6. Meta-analytic approach to the accurate prediction of secreted virulence effectors in gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Sato Yoshiharu

    2011-11-01

    Full Text Available Abstract Background Many pathogens use a type III secretion system to translocate virulence proteins (called effectors in order to adapt to the host environment. To date, many prediction tools for effector identification have been developed. However, these tools are insufficiently accurate for producing a list of putative effectors that can be applied directly for labor-intensive experimental verification. This also suggests that important features of effectors have yet to be fully characterized. Results In this study, we have constructed an accurate approach to predicting secreted virulence effectors from Gram-negative bacteria. This consists of a support vector machine-based discriminant analysis followed by a simple criteria-based filtering. The accuracy was assessed by estimating the average number of true positives in the top-20 ranking in the genome-wide screening. In the validation, 10 sets of 20 training and 20 testing examples were randomly selected from 40 known effectors of Salmonella enterica serovar Typhimurium LT2. On average, the SVM portion of our system predicted 9.7 true positives from 20 testing examples in the top-20 of the prediction. Removal of the N-terminal instability, codon adaptation index and ProtParam indices decreased the score to 7.6, 8.9 and 7.9, respectively. These discrimination features suggested that the following characteristics of effectors had been uncovered: unstable N-terminus, non-optimal codon usage, hydrophilic, and less aliphathic. The secondary filtering process represented by coexpression analysis and domain distribution analysis further refined the average true positive counts to 12.3. We further confirmed that our system can correctly predict known effectors of P. syringae DC3000, strongly indicating its feasibility. Conclusions We have successfully developed an accurate prediction system for screening effectors on a genome-wide scale. We confirmed the accuracy of our system by external validation

  7. Predictive performance of universal termination of resuscitation rules in an Asian community: are they accurate enough?

    Science.gov (United States)

    Chiang, Wen-Chu; Ko, Patrick Chow-In; Chang, Anna Marie; Liu, Sot Shih-Hung; Wang, Hui-Chih; Yang, Chih-Wei; Hsieh, Ming-Ju; Chen, Shey-Ying; Lai, Mei-Shu; Ma, Matthew Huei-Ming

    2015-04-01

    Prehospital termination of resuscitation (TOR) rules have not been widely validated outside of Western countries. This study evaluated the performance of TOR rules in an Asian metropolitan with a mixed-tier emergency medical service (EMS). We analysed the Utstein registry of adult, non-traumatic out-of-hospital cardiac arrests (OHCAs) in Taipei to test the performance of TOR rules for advanced life support (ALS) or basic life support (BLS) providers. ALS and BLS-TOR rules were tested in OHCAs among three subgroups: (1) resuscitated by ALS, (2) by BLS and (3) by mixed ALS and BLS. Outcome definition was in-hospital death. Sensitivity, specificity, positive predictive value (PPV), negative predictive value and decreased transport rate (DTR) among various provider combinations were calculated. Of the 3489 OHCAs included, 240 were resuscitated by ALS, 1727 by BLS and 1522 by ALS and BLS. Overall survival to hospital discharge was 197 patients (5.6%). Specificity and PPV of ALS-TOR and BLS-TOR for identifying death ranged from 70.7% to 81.8% and 95.1% to 98.1%, respectively. Applying the TOR rules would have a DTR of 34.2-63.9%. BLS rules had better predictive accuracy and DTR than ALS rules among all subgroups. Application of the ALS and BLS TOR rules would have decreased OHCA transported to the hospital, and BLS rules are reasonable as the universal criteria in a mixed-tier EMS. However, 1.9-4.9% of those who survived would be misclassified as non-survivors, raising concern of compromising patient safety for the implementation of the rules. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. Can magnetic resonance imaging accurately predict concordant pain provocation during provocative disc injection?

    International Nuclear Information System (INIS)

    Kang, Chang Ho; Kim, Yun Hwan; Kim, Jung Hyuk; Chung, Kyoo Byung; Sung, Deuk Jae; Lee, Sang-Heon; Derby, Richard

    2009-01-01

    To correlate magnetic resonance (MR) image findings with pain response by provocation discography in patients with discogenic low back pain, with an emphasis on the combination analysis of a high intensity zone (HIZ) and disc contour abnormalities. Sixty-two patients (aged 17-68 years) with axial low back pain that was likely to be disc related underwent lumbar discography (178 discs tested). The MR images were evaluated for disc degeneration, disc contour abnormalities, HIZ, and endplate abnormalities. Based on the combination of an HIZ and disc contour abnormalities, four classes were determined: (1) normal or bulging disc without HIZ; (2) normal or bulging disc with HIZ; (3) disc protrusion without HIZ; (4) disc protrusion with HIZ. These MR image findings and a new combined MR classification were analyzed in the base of concordant pain determined by discography. Disc protrusion with HIZ [sensitivity 45.5%; specificity 97.8%; positive predictive value (PPV), 87.0%] correlated significantly with concordant pain provocation (P < 0.01). A normal or bulging disc with HIZ was not associated with reproduction of pain. Disc degeneration (sensitivity 95.4%; specificity 38.8%; PPV 33.9%), disc protrusion (sensitivity 68.2%; specificity 80.6%; PPV 53.6%), and HIZ (sensitivity 56.8%; specificity 83.6%; PPV 53.2%) were not helpful in the identification of a disc with concordant pain. The proposed MR classification is useful to predict a disc with concordant pain. Disc protrusion with HIZ on MR imaging predicted positive discography in patients with discogenic low back pain. (orig.)

  9. Does resident ranking during recruitment accurately predict subsequent performance as a surgical resident?

    Science.gov (United States)

    Fryer, Jonathan P; Corcoran, Noreen; George, Brian; Wang, Ed; Darosa, Debra

    2012-01-01

    While the primary goal of ranking applicants for surgical residency training positions is to identify the candidates who will subsequently perform best as surgical residents, the effectiveness of the ranking process has not been adequately studied. We evaluated our general surgery resident recruitment process between 2001 and 2011 inclusive, to determine if our recruitment ranking parameters effectively predicted subsequent resident performance. We identified 3 candidate ranking parameters (United States Medical Licensing Examination [USMLE] Step 1 score, unadjusted ranking score [URS], and final adjusted ranking [FAR]), and 4 resident performance parameters (American Board of Surgery In-Training Examination [ABSITE] score, PGY1 resident evaluation grade [REG], overall REG, and independent faculty rating ranking [IFRR]), and assessed whether the former were predictive of the latter. Analyses utilized Spearman correlation coefficient. We found that the URS, which is based on objective and criterion based parameters, was a better predictor of subsequent performance than the FAR, which is a modification of the URS based on subsequent determinations of the resident selection committee. USMLE score was a reliable predictor of ABSITE scores only. However, when we compared our worst residence performances with the performances of the other residents in this evaluation, the data did not produce convincing evidence that poor resident performances could be reliably predicted by any of the recruitment ranking parameters. Finally, stratifying candidates based on their rank range did not effectively define a ranking cut-off beyond which resident performance would drop off. Based on these findings, we recommend surgery programs may be better served by utilizing a more structured resident ranking process and that subsequent adjustments to the rank list generated by this process should be undertaken with caution. Copyright © 2012 Association of Program Directors in Surgery

  10. Microvascular remodelling in preeclampsia: quantifying capillary rarefaction accurately and independently predicts preeclampsia.

    Science.gov (United States)

    Antonios, Tarek F T; Nama, Vivek; Wang, Duolao; Manyonda, Isaac T

    2013-09-01

    Preeclampsia is a major cause of maternal and neonatal mortality and morbidity. The incidence of preeclampsia seems to be rising because of increased prevalence of predisposing disorders, such as essential hypertension, diabetes, and obesity, and there is increasing evidence to suggest widespread microcirculatory abnormalities before the onset of preeclampsia. We hypothesized that quantifying capillary rarefaction could be helpful in the clinical prediction of preeclampsia. We measured skin capillary density according to a well-validated protocol at 5 consecutive predetermined visits in 322 consecutive white women, of whom 16 subjects developed preeclampsia. We found that structural capillary rarefaction at 20-24 weeks of gestation yielded a sensitivity of 0.87 with a specificity of 0.50 at the cutoff of 2 capillaries/field with the area under the curve of the receiver operating characteristic value of 0.70, whereas capillary rarefaction at 27-32 weeks of gestation yielded a sensitivity of 0.75 and a higher specificity of 0.77 at the cutoff of 8 capillaries/field with area under the curve of the receiver operating characteristic value of 0.82. Combining capillary rarefaction with uterine artery Doppler pulsatility index increased the sensitivity and specificity of the prediction. Multivariable analysis shows that the odds of preeclampsia are increased in women with previous history of preeclampsia or chronic hypertension and in those with increased uterine artery Doppler pulsatility index, but the most powerful and independent predictor of preeclampsia was capillary rarefaction at 27-32 weeks. Quantifying structural rarefaction of skin capillaries in pregnancy is a potentially useful clinical marker for the prediction of preeclampsia.

  11. Accurate prediction of the dew points of acidic combustion gases by using an artificial neural network model

    International Nuclear Information System (INIS)

    ZareNezhad, Bahman; Aminian, Ali

    2011-01-01

    This paper presents a new approach based on using an artificial neural network (ANN) model for predicting the acid dew points of the combustion gases in process and power plants. The most important acidic combustion gases namely, SO 3 , SO 2 , NO 2 , HCl and HBr are considered in this investigation. Proposed Network is trained using the Levenberg-Marquardt back propagation algorithm and the hyperbolic tangent sigmoid activation function is applied to calculate the output values of the neurons of the hidden layer. According to the network's training, validation and testing results, a three layer neural network with nine neurons in the hidden layer is selected as the best architecture for accurate prediction of the acidic combustion gases dew points over wide ranges of acid and moisture concentrations. The proposed neural network model can have significant application in predicting the condensation temperatures of different acid gases to mitigate the corrosion problems in stacks, pollution control devices and energy recovery systems.

  12. Can tritiated water-dilution space accurately predict total body water in chukar partridges

    International Nuclear Information System (INIS)

    Crum, B.G.; Williams, J.B.; Nagy, K.A.

    1985-01-01

    Total body water (TBW) volumes determined from the dilution space of injected tritiated water have consistently overestimated actual water volumes (determined by desiccation to constant mass) in reptiles and mammals, but results for birds are controversial. We investigated potential errors in both the dilution method and the desiccation method in an attempt to resolve this controversy. Tritiated water dilution yielded an accurate measurement of water mass in vitro. However, in vivo, this method yielded a 4.6% overestimate of the amount of water (3.1% of live body mass) in chukar partridges, apparently largely because of loss of tritium from body water to sites of dissociable hydrogens on body solids. An additional source of overestimation (approximately 2% of body mass) was loss of tritium to the solids in blood samples during distillation of blood to obtain pure water for tritium analysis. Measuring tritium activity in plasma samples avoided this problem but required measurement of, and correction for, the dry matter content in plasma. Desiccation to constant mass by lyophilization or oven-drying also overestimated the amount of water actually in the bodies of chukar partridges by 1.4% of body mass, because these values included water adsorbed onto the outside of feathers. When desiccating defeathered carcasses, oven-drying at 70 degrees C yielded TBW values identical to those obtained from lyophilization, but TBW was overestimated (0.5% of body mass) by drying at 100 degrees C due to loss of organic substances as well as water

  13. Surface temperatures in New York City: Geospatial data enables the accurate prediction of radiative heat transfer.

    Science.gov (United States)

    Ghandehari, Masoud; Emig, Thorsten; Aghamohamadnia, Milad

    2018-02-02

    Despite decades of research seeking to derive the urban energy budget, the dynamics of thermal exchange in the densely constructed environment is not yet well understood. Using New York City as a study site, we present a novel hybrid experimental-computational approach for a better understanding of the radiative heat transfer in complex urban environments. The aim of this work is to contribute to the calculation of the urban energy budget, particularly the stored energy. We will focus our attention on surface thermal radiation. Improved understanding of urban thermodynamics incorporating the interaction of various bodies, particularly in high rise cities, will have implications on energy conservation at the building scale, and for human health and comfort at the urban scale. The platform presented is based on longwave hyperspectral imaging of nearly 100 blocks of Manhattan, in addition to a geospatial radiosity model that describes the collective radiative heat exchange between multiple buildings. Despite assumptions in surface emissivity and thermal conductivity of buildings walls, the close comparison of temperatures derived from measurements and computations is promising. Results imply that the presented geospatial thermodynamic model of urban structures can enable accurate and high resolution analysis of instantaneous urban surface temperatures.

  14. Improving the description of sunglint for accurate prediction of remotely sensed radiances

    Energy Technology Data Exchange (ETDEWEB)

    Ottaviani, Matteo [Light and Life Laboratory, Department of Physics and Engineering Physics, Stevens Institute of Technology, Castle Point on Hudson, Hoboken, NJ 07030 (United States)], E-mail: mottavia@stevens.edu; Spurr, Robert [RT Solutions Inc., 9 Channing Street, Cambridge, MA 02138 (United States); Stamnes, Knut; Li Wei [Light and Life Laboratory, Department of Physics and Engineering Physics, Stevens Institute of Technology, Castle Point on Hudson, Hoboken, NJ 07030 (United States); Su Wenying [Science Systems and Applications Inc., 1 Enterprise Parkway, Hampton, VA 23666 (United States); Wiscombe, Warren [NASA GSFC, Greenbelt, MD 20771 (United States)

    2008-09-15

    The bidirectional reflection distribution function (BRDF) of the ocean is a critical boundary condition for radiative transfer calculations in the coupled atmosphere-ocean system. Existing models express the extent of the glint-contaminated region and its contribution to the radiance essentially as a function of the wind speed. An accurate treatment of the glint contribution and its propagation in the atmosphere would improve current correction schemes and hence rescue a significant portion of data presently discarded as 'glint contaminated'. In current satellite imagery, a correction to the sensor-measured radiances is limited to the region at the edge of the glint, where the contribution is below a certain threshold. This correction assumes the sunglint radiance to be directly transmitted through the atmosphere. To quantify the error introduced by this approximation we employ a radiative transfer code that allows for a user-specified BRDF at the atmosphere-ocean interface and rigorously accounts for multiple scattering. We show that the errors incurred by ignoring multiple scattering are very significant and typically lie in the range 10-90%. Multiple reflections and shadowing at the surface can also be accounted for, and we illustrate the importance of such processes at grazing geometries.

  15. High-order accurate numerical algorithm for three-dimensional transport prediction

    Energy Technology Data Exchange (ETDEWEB)

    Pepper, D W [Savannah River Lab., Aiken, SC; Baker, A J

    1980-01-01

    The numerical solution of the three-dimensional pollutant transport equation is obtained with the method of fractional steps; advection is solved by the method of moments and diffusion by cubic splines. Topography and variable mesh spacing are accounted for with coordinate transformations. First estimate wind fields are obtained by interpolation to grid points surrounding specific data locations. Numerical results agree with results obtained from analytical Gaussian plume relations for ideal conditions. The numerical model is used to simulate the transport of tritium released from the Savannah River Plant on 2 May 1974. Predicted ground level air concentration 56 km from the release point is within 38% of the experimentally measured value.

  16. Developing Metamodels for Fast and Accurate Prediction of the Draping of Physical Surfaces

    DEFF Research Database (Denmark)

    Christensen, Esben Toke; Forrester, AIJ.; Lund, Erik

    2018-01-01

    In this paper, the use of methods from the meta- or surrogate modeling literature, for building models predicting the draping of physical surfaces, is examined. An example application concerning modeling of the behavior of a variable shape mold is treated. Four different methods are considered...... and local variants, are compared in terms of accuracy and numerical efficiency on data sets of different sizes for the treated application. It is shown that the POD-based methods are vastly superior to models based on kriging alone, and that the use of a difference model structure is advantageous...

  17. Accurate cut-offs for predicting endoscopic activity and mucosal healing in Crohn's disease with fecal calprotectin

    Directory of Open Access Journals (Sweden)

    Juan María Vázquez-Morón

    Full Text Available Background: Fecal biomarkers, especially fecal calprotectin, are useful for predicting endoscopic activity in Crohn's disease; however, the cut-off point remains unclear. The aim of this paper was to analyze whether faecal calprotectin and M2 pyruvate kinase are good tools for generating highly accurate scores for the prediction of the state of endoscopic activity and mucosal healing. Methods: The simple endoscopic score for Crohn's disease and the Crohn's disease activity index was calculated for 71 patients diagnosed with Crohn's. Fecal calprotectin and M2-PK were measured by the enzyme-linked immunosorbent assay test. Results: A fecal calprotectin cut-off concentration of ≥ 170 µg/g (sensitivity 77.6%, specificity 95.5% and likelihood ratio +17.06 predicts a high probability of endoscopic activity, and a fecal calprotectin cut-off of ≤ 71 µg/g (sensitivity 95.9%, specificity 52.3% and likelihood ratio -0.08 predicts a high probability of mucosal healing. Three clinical groups were identified according to the data obtained: endoscopic activity (calprotectin ≥ 170, mucosal healing (calprotectin ≤ 71 and uncertainty (71 > calprotectin < 170, with significant differences in endoscopic values (F = 26.407, p < 0.01. Clinical activity or remission modified the probabilities of presenting endoscopic activity (100% vs 89% or mucosal healing (75% vs 87% in the diagnostic scores generated. M2-PK was insufficiently accurate to determine scores. Conclusions: The highly accurate scores for fecal calprotectin provide a useful tool for interpreting the probabilities of presenting endoscopic activity or mucosal healing, and are valuable in the specific clinical context.

  18. DisoMCS: Accurately Predicting Protein Intrinsically Disordered Regions Using a Multi-Class Conservative Score Approach.

    Directory of Open Access Journals (Sweden)

    Zhiheng Wang

    Full Text Available The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database.The DisoMCS is available at http://cal.tongji.edu.cn/disorder/.

  19. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    KAUST Repository

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  20. Neural network and SVM classifiers accurately predict lipid binding proteins, irrespective of sequence homology.

    Science.gov (United States)

    Bakhtiarizadeh, Mohammad Reza; Moradi-Shahrbabak, Mohammad; Ebrahimi, Mansour; Ebrahimie, Esmaeil

    2014-09-07

    Due to the central roles of lipid binding proteins (LBPs) in many biological processes, sequence based identification of LBPs is of great interest. The major challenge is that LBPs are diverse in sequence, structure, and function which results in low accuracy of sequence homology based methods. Therefore, there is a need for developing alternative functional prediction methods irrespective of sequence similarity. To identify LBPs from non-LBPs, the performances of support vector machine (SVM) and neural network were compared in this study. Comprehensive protein features and various techniques were employed to create datasets. Five-fold cross-validation (CV) and independent evaluation (IE) tests were used to assess the validity of the two methods. The results indicated that SVM outperforms neural network. SVM achieved 89.28% (CV) and 89.55% (IE) overall accuracy in identification of LBPs from non-LBPs and 92.06% (CV) and 92.90% (IE) (in average) for classification of different LBPs classes. Increasing the number and the range of extracted protein features as well as optimization of the SVM parameters significantly increased the efficiency of LBPs class prediction in comparison to the only previous report in this field. Altogether, the results showed that the SVM algorithm can be run on broad, computationally calculated protein features and offers a promising tool in detection of LBPs classes. The proposed approach has the potential to integrate and improve the common sequence alignment based methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    KAUST Repository

    Chen, Peng; Li, Jinyan; Limsoon, Wong; Kuwahara, Hiroyuki; Huang, Jianhua Z.; Gao, Xin

    2013-01-01

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  2. Deep Learning Accurately Predicts Estrogen Receptor Status in Breast Cancer Metabolomics Data.

    Science.gov (United States)

    Alakwaa, Fadhl M; Chaudhary, Kumardeep; Garmire, Lana X

    2018-01-05

    Metabolomics holds the promise as a new technology to diagnose highly heterogeneous diseases. Conventionally, metabolomics data analysis for diagnosis is done using various statistical and machine learning based classification methods. However, it remains unknown if deep neural network, a class of increasingly popular machine learning methods, is suitable to classify metabolomics data. Here we use a cohort of 271 breast cancer tissues, 204 positive estrogen receptor (ER+), and 67 negative estrogen receptor (ER-) to test the accuracies of feed-forward networks, a deep learning (DL) framework, as well as six widely used machine learning models, namely random forest (RF), support vector machines (SVM), recursive partitioning and regression trees (RPART), linear discriminant analysis (LDA), prediction analysis for microarrays (PAM), and generalized boosted models (GBM). DL framework has the highest area under the curve (AUC) of 0.93 in classifying ER+/ER- patients, compared to the other six machine learning algorithms. Furthermore, the biological interpretation of the first hidden layer reveals eight commonly enriched significant metabolomics pathways (adjusted P-value learning methods. Among them, protein digestion and absorption and ATP-binding cassette (ABC) transporters pathways are also confirmed in integrated analysis between metabolomics and gene expression data in these samples. In summary, deep learning method shows advantages for metabolomics based breast cancer ER status classification, with both the highest prediction accuracy (AUC = 0.93) and better revelation of disease biology. We encourage the adoption of feed-forward networks based deep learning method in the metabolomics research community for classification.

  3. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences.

    Science.gov (United States)

    Chen, Peng; Li, Jinyan; Wong, Limsoon; Kuwahara, Hiroyuki; Huang, Jianhua Z; Gao, Xin

    2013-08-01

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. Copyright © 2013 Wiley Periodicals, Inc.

  4. Size matters. The width and location of a ureteral stone accurately predict the chance of spontaneous passage

    Energy Technology Data Exchange (ETDEWEB)

    Jendeberg, Johan; Geijer, Haakan; Alshamari, Muhammed; Liden, Mats [Oerebro University Hospital, Department of Radiology, Faculty of Medicine and Health, Oerebro (Sweden); Cierzniak, Bartosz [Oerebro University, Department of Surgery, Faculty of Medicine and Health, Oerebro (Sweden)

    2017-11-15

    To determine how to most accurately predict the chance of spontaneous passage of a ureteral stone using information in the diagnostic non-enhanced computed tomography (NECT) and to create predictive models with smaller stone size intervals than previously possible. Retrospectively 392 consecutive patients with ureteric stone on NECT were included. Three radiologists independently measured the stone size. Stone location, side, hydronephrosis, CRP, medical expulsion therapy (MET) and all follow-up radiology until stone expulsion or 26 weeks were recorded. Logistic regressions were performed with spontaneous stone passage in 4 weeks and 20 weeks as the dependent variable. The spontaneous passage rate in 20 weeks was 312 out of 392 stones, 98% in 0-2 mm, 98% in 3 mm, 81% in 4 mm, 65% in 5 mm, 33% in 6 mm and 9% in ≥6.5 mm wide stones. The stone size and location predicted spontaneous ureteric stone passage. The side and the grade of hydronephrosis only predicted stone passage in specific subgroups. Spontaneous passage of a ureteral stone can be predicted with high accuracy with the information available in the NECT. We present a prediction method based on stone size and location. (orig.)

  5. ABC/2 Method Does not Accurately Predict Cerebral Arteriovenous Malformation Volume.

    Science.gov (United States)

    Roark, Christopher; Vadlamudi, Venu; Chaudhary, Neeraj; Gemmete, Joseph J; Seinfeld, Joshua; Thompson, B Gregory; Pandey, Aditya S

    2018-02-01

    Stereotactic radiosurgery (SRS) is a treatment option for cerebral arteriovenous malformations (AVMs) to prevent intracranial hemorrhage. The decision to proceed with SRS is usually based on calculated nidal volume. Physicians commonly use the ABC/2 formula, based on digital subtraction angiography (DSA), when counseling patients for SRS. To determine whether AVM volume calculated using the ABC/2 method on DSA is accurate when compared to the exact volume calculated from thin-cut axial sections used for SRS planning. Retrospective search of neurovascular database to identify AVMs treated with SRS from 1995 to 2015. Maximum nidal diameters in orthogonal planes on DSA images were recorded to determine volume using ABC/2 formula. Nidal target volume was extracted from operative reports of SRS. Volumes were then compared using descriptive statistics and paired t-tests. Ninety intracranial AVMs were identified. Median volume was 4.96 cm3 [interquartile range (IQR) 1.79-8.85] with SRS planning methods and 6.07 cm3 (IQR 1.3-13.6) with ABC/2 methodology. Moderate correlation was seen between SRS and ABC/2 (r = 0.662; P ABC/2 (t = -3.2; P = .002). When AVMs were dichotomized based on ABC/2 volume, significant differences remained (t = 3.1, P = .003 for ABC/2 volume ABC/2 volume > 7 cm3). The ABC/2 method overestimates cerebral AVM volume when compared to volumetric analysis from SRS planning software. For AVMs > 7 cm3, the overestimation is even greater. SRS planning techniques were also significantly different than values derived from equations for cones and cylinders. Copyright © 2017 by the Congress of Neurological Surgeons

  6. Prognostic breast cancer signature identified from 3D culture model accurately predicts clinical outcome across independent datasets

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Katherine J.; Patrick, Denis R.; Bissell, Mina J.; Fournier, Marcia V.

    2008-10-20

    One of the major tenets in breast cancer research is that early detection is vital for patient survival by increasing treatment options. To that end, we have previously used a novel unsupervised approach to identify a set of genes whose expression predicts prognosis of breast cancer patients. The predictive genes were selected in a well-defined three dimensional (3D) cell culture model of non-malignant human mammary epithelial cell morphogenesis as down-regulated during breast epithelial cell acinar formation and cell cycle arrest. Here we examine the ability of this gene signature (3D-signature) to predict prognosis in three independent breast cancer microarray datasets having 295, 286, and 118 samples, respectively. Our results show that the 3D-signature accurately predicts prognosis in three unrelated patient datasets. At 10 years, the probability of positive outcome was 52, 51, and 47 percent in the group with a poor-prognosis signature and 91, 75, and 71 percent in the group with a good-prognosis signature for the three datasets, respectively (Kaplan-Meier survival analysis, p<0.05). Hazard ratios for poor outcome were 5.5 (95% CI 3.0 to 12.2, p<0.0001), 2.4 (95% CI 1.6 to 3.6, p<0.0001) and 1.9 (95% CI 1.1 to 3.2, p = 0.016) and remained significant for the two larger datasets when corrected for estrogen receptor (ER) status. Hence the 3D-signature accurately predicts breast cancer outcome in both ER-positive and ER-negative tumors, though individual genes differed in their prognostic ability in the two subtypes. Genes that were prognostic in ER+ patients are AURKA, CEP55, RRM2, EPHA2, FGFBP1, and VRK1, while genes prognostic in ER patients include ACTB, FOXM1 and SERPINE2 (Kaplan-Meier p<0.05). Multivariable Cox regression analysis in the largest dataset showed that the 3D-signature was a strong independent factor in predicting breast cancer outcome. The 3D-signature accurately predicts breast cancer outcome across multiple datasets and holds prognostic

  7. Combining multiple regression and principal component analysis for accurate predictions for column ozone in Peninsular Malaysia

    Science.gov (United States)

    Rajab, Jasim M.; MatJafri, M. Z.; Lim, H. S.

    2013-06-01

    This study encompasses columnar ozone modelling in the peninsular Malaysia. Data of eight atmospheric parameters [air surface temperature (AST), carbon monoxide (CO), methane (CH4), water vapour (H2Ovapour), skin surface temperature (SSKT), atmosphere temperature (AT), relative humidity (RH), and mean surface pressure (MSP)] data set, retrieved from NASA's Atmospheric Infrared Sounder (AIRS), for the entire period (2003-2008) was employed to develop models to predict the value of columnar ozone (O3) in study area. The combined method, which is based on using both multiple regressions combined with principal component analysis (PCA) modelling, was used to predict columnar ozone. This combined approach was utilized to improve the prediction accuracy of columnar ozone. Separate analysis was carried out for north east monsoon (NEM) and south west monsoon (SWM) seasons. The O3 was negatively correlated with CH4, H2Ovapour, RH, and MSP, whereas it was positively correlated with CO, AST, SSKT, and AT during both the NEM and SWM season periods. Multiple regression analysis was used to fit the columnar ozone data using the atmospheric parameter's variables as predictors. A variable selection method based on high loading of varimax rotated principal components was used to acquire subsets of the predictor variables to be comprised in the linear regression model of the atmospheric parameter's variables. It was found that the increase in columnar O3 value is associated with an increase in the values of AST, SSKT, AT, and CO and with a drop in the levels of CH4, H2Ovapour, RH, and MSP. The result of fitting the best models for the columnar O3 value using eight of the independent variables gave about the same values of the R (≈0.93) and R2 (≈0.86) for both the NEM and SWM seasons. The common variables that appeared in both regression equations were SSKT, CH4 and RH, and the principal precursor of the columnar O3 value in both the NEM and SWM seasons was SSKT.

  8. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  9. Disturbance observer based model predictive control for accurate atmospheric entry of spacecraft

    Science.gov (United States)

    Wu, Chao; Yang, Jun; Li, Shihua; Li, Qi; Guo, Lei

    2018-05-01

    Facing the complex aerodynamic environment of Mars atmosphere, a composite atmospheric entry trajectory tracking strategy is investigated in this paper. External disturbances, initial states uncertainties and aerodynamic parameters uncertainties are the main problems. The composite strategy is designed to solve these problems and improve the accuracy of Mars atmospheric entry. This strategy includes a model predictive control for optimized trajectory tracking performance, as well as a disturbance observer based feedforward compensation for external disturbances and uncertainties attenuation. 500-run Monte Carlo simulations show that the proposed composite control scheme achieves more precise Mars atmospheric entry (3.8 km parachute deployment point distribution error) than the baseline control scheme (8.4 km) and integral control scheme (5.8 km).

  10. nuMap: a web platform for accurate prediction of nucleosome positioning.

    Science.gov (United States)

    Alharbi, Bader A; Alshammari, Thamir H; Felton, Nathan L; Zhurkin, Victor B; Cui, Feng

    2014-10-01

    Nucleosome positioning is critical for gene expression and of major biological interest. The high cost of experimentally mapping nucleosomal arrangement signifies the need for computational approaches to predict nucleosome positions at high resolution. Here, we present a web-based application to fulfill this need by implementing two models, YR and W/S schemes, for the translational and rotational positioning of nucleosomes, respectively. Our methods are based on sequence-dependent anisotropic bending that dictates how DNA is wrapped around a histone octamer. This application allows users to specify a number of options such as schemes and parameters for threading calculation and provides multiple layout formats. The nuMap is implemented in Java/Perl/MySQL and is freely available for public use at http://numap.rit.edu. The user manual, implementation notes, description of the methodology and examples are available at the site. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  11. nuMap: A Web Platform for Accurate Prediction of Nucleosome Positioning

    Directory of Open Access Journals (Sweden)

    Bader A. Alharbi

    2014-10-01

    Full Text Available Nucleosome positioning is critical for gene expression and of major biological interest. The high cost of experimentally mapping nucleosomal arrangement signifies the need for computational approaches to predict nucleosome positions at high resolution. Here, we present a web-based application to fulfill this need by implementing two models, YR and W/S schemes, for the translational and rotational positioning of nucleosomes, respectively. Our methods are based on sequence-dependent anisotropic bending that dictates how DNA is wrapped around a histone octamer. This application allows users to specify a number of options such as schemes and parameters for threading calculation and provides multiple layout formats. The nuMap is implemented in Java/Perl/MySQL and is freely available for public use at http://numap.rit.edu. The user manual, implementation notes, description of the methodology and examples are available at the site.

  12. How Accurately Do Consecutive Cohort Audits Predict Phase III Multisite Clinical Trial Recruitment in Palliative Care?

    Science.gov (United States)

    McCaffrey, Nikki; Fazekas, Belinda; Cutri, Natalie; Currow, David C

    2016-04-01

    Audits have been proposed for estimating possible recruitment rates to randomized controlled trials (RCTs), but few studies have compared audit data with subsequent recruitment rates. To compare the accuracy of estimates of potential recruitment from a retrospective consecutive cohort audit of actual participating sites and recruitment to four Phase III multisite clinical RCTs. The proportion of potentially eligible study participants estimated from an inpatient chart review of people with life-limiting illnesses referred to six Australian specialist palliative care services was compared with recruitment data extracted from study prescreening information from three sites that participated fully in four Palliative Care Clinical Studies Collaborative RCTs. The predominant reasons for ineligibility in the audit and RCTs were analyzed. The audit overestimated the proportion of people referred to the palliative care services who could participate in the RCTs (pain 17.7% vs. 1.2%, delirium 5.8% vs. 0.6%, anorexia 5.1% vs. 0.8%, and bowel obstruction 2.8% vs. 0.5%). Approximately 2% of the referral base was potentially eligible for these effectiveness studies. Ineligibility for general criteria (language, cognition, and geographic proximity) varied between studies, whereas the reasons for exclusion were similar between the audit and pain and anorexia studies but not for delirium or bowel obstruction. The retrospective consecutive case note audit in participating sites did not predict realistic recruitment rates, mostly underestimating the impact of study-specific inclusion criteria. These findings have implications for the applicability of the results of RCTs. Prospective pilot studies are more likely to predict actual recruitment. Copyright © 2016 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  13. Simplified versus geometrically accurate models of forefoot anatomy to predict plantar pressures: A finite element study.

    Science.gov (United States)

    Telfer, Scott; Erdemir, Ahmet; Woodburn, James; Cavanagh, Peter R

    2016-01-25

    Integration of patient-specific biomechanical measurements into the design of therapeutic footwear has been shown to improve clinical outcomes in patients with diabetic foot disease. The addition of numerical simulations intended to optimise intervention design may help to build on these advances, however at present the time and labour required to generate and run personalised models of foot anatomy restrict their routine clinical utility. In this study we developed second-generation personalised simple finite element (FE) models of the forefoot with varying geometric fidelities. Plantar pressure predictions from barefoot, shod, and shod with insole simulations using simplified models were compared to those obtained from CT-based FE models incorporating more detailed representations of bone and tissue geometry. A simplified model including representations of metatarsals based on simple geometric shapes, embedded within a contoured soft tissue block with outer geometry acquired from a 3D surface scan was found to provide pressure predictions closest to the more complex model, with mean differences of 13.3kPa (SD 13.4), 12.52kPa (SD 11.9) and 9.6kPa (SD 9.3) for barefoot, shod, and insole conditions respectively. The simplified model design could be produced in 3h in the case of the more detailed model, and solved on average 24% faster. FE models of the forefoot based on simplified geometric representations of the metatarsal bones and soft tissue surface geometry from 3D surface scans may potentially provide a simulation approach with improved clinical utility, however further validity testing around a range of therapeutic footwear types is required. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. A New Approach for Accurate Prediction of Liquid Loading of Directional Gas Wells in Transition Flow or Turbulent Flow

    Directory of Open Access Journals (Sweden)

    Ruiqing Ming

    2017-01-01

    Full Text Available Current common models for calculating continuous liquid-carrying critical gas velocity are established based on vertical wells and laminar flow without considering the influence of deviation angle and Reynolds number on liquid-carrying. With the increase of the directional well in transition flow or turbulent flow, the current common models cannot accurately predict the critical gas velocity of these wells. So we built a new model to predict continuous liquid-carrying critical gas velocity for directional well in transition flow or turbulent flow. It is shown from sensitivity analysis that the correction coefficient is mainly influenced by Reynolds number and deviation angle. With the increase of Reynolds number, the critical liquid-carrying gas velocity increases first and then decreases. And with the increase of deviation angle, the critical liquid-carrying gas velocity gradually decreases. It is indicated from the case calculation analysis that the calculation error of this new model is less than 10%, where accuracy is much higher than those of current common models. It is demonstrated that the continuous liquid-carrying critical gas velocity of directional well in transition flow or turbulent flow can be predicted accurately by using this new model.

  15. Using Bronson Equation to Accurately Predict the Dog Brain Weight Based on Body Weight Parameter

    Directory of Open Access Journals (Sweden)

    L. Miguel Carreira

    2016-12-01

    Full Text Available The study used 69 brains (n = 69 from adult dog cadavers, divided by their skull type into three groups, brachi (B, dolicho (D and mesaticephalic (M (n = 23 each, and aimed: (1 to determine whether the Bronson equation may be applied, without reservation, to estimate brain weight (BW in brachy (B, dolicho (D, and mesaticephalic (M dog breeds; and (2 to evaluate which breeds are more closely related to each other in an evolutionary scenario. All subjects were identified by sex, age, breed, and body weight (bw. An oscillating saw was used for a circumferential craniotomy to open the skulls; the brains were removed and weighed using a digital scale. For statistical analysis, p-values < 0.05 were considered significant. The work demonstrated a strong relationship between the observed and predicted BW by using the Bronson equation. It was possible to hypothesize that groups B and D present a greater encephalization level than M breeds, that B and D dog breeds are more closely related to each other than to M, and from the three groups, the D individuals presented the highest brain mass mean.

  16. The human skin/chick chorioallantoic membrane model accurately predicts the potency of cosmetic allergens.

    Science.gov (United States)

    Slodownik, Dan; Grinberg, Igor; Spira, Ram M; Skornik, Yehuda; Goldstein, Ronald S

    2009-04-01

    The current standard method for predicting contact allergenicity is the murine local lymph node assay (LLNA). Public objection to the use of animals in testing of cosmetics makes the development of a system that does not use sentient animals highly desirable. The chorioallantoic membrane (CAM) of the chick egg has been extensively used for the growth of normal and transformed mammalian tissues. The CAM is not innervated, and embryos are sacrificed before the development of pain perception. The aim of this study was to determine whether the sensitization phase of contact dermatitis to known cosmetic allergens can be quantified using CAM-engrafted human skin and how these results compare with published EC3 data obtained with the LLNA. We studied six common molecules used in allergen testing and quantified migration of epidermal Langerhans cells (LC) as a measure of their allergic potency. All agents with known allergic potential induced statistically significant migration of LC. The data obtained correlated well with published data for these allergens generated using the LLNA test. The human-skin CAM model therefore has great potential as an inexpensive, non-radioactive, in vivo alternative to the LLNA, which does not require the use of sentient animals. In addition, this system has the advantage of testing the allergic response of human, rather than animal skin.

  17. Towards Relaxing the Spherical Solar Radiation Pressure Model for Accurate Orbit Predictions

    Science.gov (United States)

    Lachut, M.; Bennett, J.

    2016-09-01

    The well-known cannonball model has been used ubiquitously to capture the effects of atmospheric drag and solar radiation pressure on satellites and/or space debris for decades. While it lends itself naturally to spherical objects, its validity in the case of non-spherical objects has been debated heavily for years throughout the space situational awareness community. One of the leading motivations to improve orbit predictions by relaxing the spherical assumption, is the ongoing demand for more robust and reliable conjunction assessments. In this study, we explore the orbit propagation of a flat plate in a near-GEO orbit under the influence of solar radiation pressure, using a Lambertian BRDF model. Consequently, this approach will account for the spin rate and orientation of the object, which is typically determined in practice using a light curve analysis. Here, simulations will be performed which systematically reduces the spin rate to demonstrate the point at which the spherical model no longer describes the orbital elements of the spinning plate. Further understanding of this threshold would provide insight into when a higher fidelity model should be used, thus resulting in improved orbit propagations. Therefore, the work presented here is of particular interest to organizations and researchers that maintain their own catalog, and/or perform conjunction analyses.

  18. Quasi-closed phase forward-backward linear prediction analysis of speech for accurate formant detection and estimation.

    Science.gov (United States)

    Gowda, Dhananjaya; Airaksinen, Manu; Alku, Paavo

    2017-09-01

    Recently, a quasi-closed phase (QCP) analysis of speech signals for accurate glottal inverse filtering was proposed. However, the QCP analysis which belongs to the family of temporally weighted linear prediction (WLP) methods uses the conventional forward type of sample prediction. This may not be the best choice especially in computing WLP models with a hard-limiting weighting function. A sample selective minimization of the prediction error in WLP reduces the effective number of samples available within a given window frame. To counter this problem, a modified quasi-closed phase forward-backward (QCP-FB) analysis is proposed, wherein each sample is predicted based on its past as well as future samples thereby utilizing the available number of samples more effectively. Formant detection and estimation experiments on synthetic vowels generated using a physical modeling approach as well as natural speech utterances show that the proposed QCP-FB method yields statistically significant improvements over the conventional linear prediction and QCP methods.

  19. The development and verification of a highly accurate collision prediction model for automated noncoplanar plan delivery

    International Nuclear Information System (INIS)

    Yu, Victoria Y.; Tran, Angelia; Nguyen, Dan; Cao, Minsong; Ruan, Dan; Low, Daniel A.; Sheng, Ke

    2015-01-01

    attributed to phantom setup errors due to the slightly deformable and flexible phantom extremities. The estimated site-specific safety buffer distance with 0.001% probability of collision for (gantry-to-couch, gantry-to-phantom) was (1.23 cm, 3.35 cm), (1.01 cm, 3.99 cm), and (2.19 cm, 5.73 cm) for treatment to the head, lung, and prostate, respectively. Automated delivery to all three treatment sites was completed in 15 min and collision free using a digital Linac. Conclusions: An individualized collision prediction model for the purpose of noncoplanar beam delivery was developed and verified. With the model, the study has demonstrated the feasibility of predicting deliverable beams for an individual patient and then guiding fully automated noncoplanar treatment delivery. This work motivates development of clinical workflows and quality assurance procedures to allow more extensive use and automation of noncoplanar beam geometries

  20. The development and verification of a highly accurate collision prediction model for automated noncoplanar plan delivery

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Victoria Y.; Tran, Angelia; Nguyen, Dan; Cao, Minsong; Ruan, Dan; Low, Daniel A.; Sheng, Ke, E-mail: ksheng@mednet.ucla.edu [Department of Radiation Oncology, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, California 90024 (United States)

    2015-11-15

    attributed to phantom setup errors due to the slightly deformable and flexible phantom extremities. The estimated site-specific safety buffer distance with 0.001% probability of collision for (gantry-to-couch, gantry-to-phantom) was (1.23 cm, 3.35 cm), (1.01 cm, 3.99 cm), and (2.19 cm, 5.73 cm) for treatment to the head, lung, and prostate, respectively. Automated delivery to all three treatment sites was completed in 15 min and collision free using a digital Linac. Conclusions: An individualized collision prediction model for the purpose of noncoplanar beam delivery was developed and verified. With the model, the study has demonstrated the feasibility of predicting deliverable beams for an individual patient and then guiding fully automated noncoplanar treatment delivery. This work motivates development of clinical workflows and quality assurance procedures to allow more extensive use and automation of noncoplanar beam geometries.

  1. The development and verification of a highly accurate collision prediction model for automated noncoplanar plan delivery.

    Science.gov (United States)

    Yu, Victoria Y; Tran, Angelia; Nguyen, Dan; Cao, Minsong; Ruan, Dan; Low, Daniel A; Sheng, Ke

    2015-11-01

    errors due to the slightly deformable and flexible phantom extremities. The estimated site-specific safety buffer distance with 0.001% probability of collision for (gantry-to-couch, gantry-to-phantom) was (1.23 cm, 3.35 cm), (1.01 cm, 3.99 cm), and (2.19 cm, 5.73 cm) for treatment to the head, lung, and prostate, respectively. Automated delivery to all three treatment sites was completed in 15 min and collision free using a digital Linac. An individualized collision prediction model for the purpose of noncoplanar beam delivery was developed and verified. With the model, the study has demonstrated the feasibility of predicting deliverable beams for an individual patient and then guiding fully automated noncoplanar treatment delivery. This work motivates development of clinical workflows and quality assurance procedures to allow more extensive use and automation of noncoplanar beam geometries.

  2. Industrial Compositional Streamline Simulation for Efficient and Accurate Prediction of Gas Injection and WAG Processes

    Energy Technology Data Exchange (ETDEWEB)

    Margot Gerritsen

    2008-10-31

    Gas-injection processes are widely and increasingly used for enhanced oil recovery (EOR). In the United States, for example, EOR production by gas injection accounts for approximately 45% of total EOR production and has tripled since 1986. The understanding of the multiphase, multicomponent flow taking place in any displacement process is essential for successful design of gas-injection projects. Due to complex reservoir geometry, reservoir fluid properties and phase behavior, the design of accurate and efficient numerical simulations for the multiphase, multicomponent flow governing these processes is nontrivial. In this work, we developed, implemented and tested a streamline based solver for gas injection processes that is computationally very attractive: as compared to traditional Eulerian solvers in use by industry it computes solutions with a computational speed orders of magnitude higher and a comparable accuracy provided that cross-flow effects do not dominate. We contributed to the development of compositional streamline solvers in three significant ways: improvement of the overall framework allowing improved streamline coverage and partial streamline tracing, amongst others; parallelization of the streamline code, which significantly improves wall clock time; and development of new compositional solvers that can be implemented along streamlines as well as in existing Eulerian codes used by industry. We designed several novel ideas in the streamline framework. First, we developed an adaptive streamline coverage algorithm. Adding streamlines locally can reduce computational costs by concentrating computational efforts where needed, and reduce mapping errors. Adapting streamline coverage effectively controls mass balance errors that mostly result from the mapping from streamlines to pressure grid. We also introduced the concept of partial streamlines: streamlines that do not necessarily start and/or end at wells. This allows more efficient coverage and avoids

  3. Mini-Mental Status Examination: a short form of MMSE was as accurate as the original MMSE in predicting dementia

    DEFF Research Database (Denmark)

    Schultz-Larsen, Kirsten; Lomholt, Rikke Kirstine; Kreiner, Svend

    2006-01-01

    .4%), and positive predictive value (71.0%) but equal area under the receiver operating characteristic curve. Cross-validation on follow-up data confirmed the results. CONCLUSION: A short, valid MMSE, which is as sensitive and specific as the original MMSE for the screening of cognitive impairments and dementia......OBJECTIVES: This study assesses the properties of the Mini-Mental State Examination (MMSE) with the purpose of improving the efficiencies of the methods of screening for cognitive impairment and dementia. A specific purpose was to determine whether an abbreviated version would be as accurate...... is attractive for research and clinical practice, particularly if predictive power can be enhanced by combining the short MMSE with neuropsychological tests or informant reports....

  4. Deformation, Failure, and Fatigue Life of SiC/Ti-15-3 Laminates Accurately Predicted by MAC/GMC

    Science.gov (United States)

    Bednarcyk, Brett A.; Arnold, Steven M.

    2002-01-01

    NASA Glenn Research Center's Micromechanics Analysis Code with Generalized Method of Cells (MAC/GMC) (ref.1) has been extended to enable fully coupled macro-micro deformation, failure, and fatigue life predictions for advanced metal matrix, ceramic matrix, and polymer matrix composites. Because of the multiaxial nature of the code's underlying micromechanics model, GMC--which allows the incorporation of complex local inelastic constitutive models--MAC/GMC finds its most important application in metal matrix composites, like the SiC/Ti-15-3 composite examined here. Furthermore, since GMC predicts the microscale fields within each constituent of the composite material, submodels for local effects such as fiber breakage, interfacial debonding, and matrix fatigue damage can and have been built into MAC/GMC. The present application of MAC/GMC highlights the combination of these features, which has enabled the accurate modeling of the deformation, failure, and life of titanium matrix composites.

  5. A Weibull statistics-based lignocellulose saccharification model and a built-in parameter accurately predict lignocellulose hydrolysis performance.

    Science.gov (United States)

    Wang, Mingyu; Han, Lijuan; Liu, Shasha; Zhao, Xuebing; Yang, Jinghua; Loh, Soh Kheang; Sun, Xiaomin; Zhang, Chenxi; Fang, Xu

    2015-09-01

    Renewable energy from lignocellulosic biomass has been deemed an alternative to depleting fossil fuels. In order to improve this technology, we aim to develop robust mathematical models for the enzymatic lignocellulose degradation process. By analyzing 96 groups of previously published and newly obtained lignocellulose saccharification results and fitting them to Weibull distribution, we discovered Weibull statistics can accurately predict lignocellulose saccharification data, regardless of the type of substrates, enzymes and saccharification conditions. A mathematical model for enzymatic lignocellulose degradation was subsequently constructed based on Weibull statistics. Further analysis of the mathematical structure of the model and experimental saccharification data showed the significance of the two parameters in this model. In particular, the λ value, defined the characteristic time, represents the overall performance of the saccharification system. This suggestion was further supported by statistical analysis of experimental saccharification data and analysis of the glucose production levels when λ and n values change. In conclusion, the constructed Weibull statistics-based model can accurately predict lignocellulose hydrolysis behavior and we can use the λ parameter to assess the overall performance of enzymatic lignocellulose degradation. Advantages and potential applications of the model and the λ value in saccharification performance assessment were discussed. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Predicted osteotomy planes are accurate when using patient-specific instrumentation for total knee arthroplasty in cadavers: a descriptive analysis.

    Science.gov (United States)

    Kievit, A J; Dobbe, J G G; Streekstra, G J; Blankevoort, L; Schafroth, M U

    2018-06-01

    Malalignment of implants is a major source of failure during total knee arthroplasty. To achieve more accurate 3D planning and execution of the osteotomy cuts during surgery, the Signature (Biomet, Warsaw) patient-specific instrumentation (PSI) was used to produce pin guides for the positioning of the osteotomy blocks by means of computer-aided manufacture based on CT scan images. The research question of this study is: what is the transfer accuracy of osteotomy planes predicted by the Signature PSI system for preoperative 3D planning and intraoperative block-guided pin placement to perform total knee arthroplasty procedures? The transfer accuracy achieved by using the Signature PSI system was evaluated by comparing the osteotomy planes predicted preoperatively with the osteotomy planes seen intraoperatively in human cadaveric legs. Outcomes were measured in terms of translational and rotational errors (varus, valgus, flexion, extension and axial rotation) for both tibia and femur osteotomies. Average translational errors between the osteotomy planes predicted using the Signature system and the actual osteotomy planes achieved was 0.8 mm (± 0.5 mm) for the tibia and 0.7 mm (± 4.0 mm) for the femur. Average rotational errors in relation to predicted and achieved osteotomy planes were 0.1° (± 1.2°) of varus and 0.4° (± 1.7°) of anterior slope (extension) for the tibia, and 2.8° (± 2.0°) of varus and 0.9° (± 2.7°) of flexion and 1.4° (± 2.2°) of external rotation for the femur. The similarity between osteotomy planes predicted using the Signature system and osteotomy planes actually achieved was excellent for the tibia although some discrepancies were seen for the femur. The use of 3D system techniques in TKA surgery can provide accurate intraoperative guidance, especially for patients with deformed bone, tailored to individual patients and ensure better placement of the implant.

  7. New and Accurate Predictive Model for the Efficacy of Extracorporeal Shock Wave Therapy in Managing Patients With Chronic Plantar Fasciitis.

    Science.gov (United States)

    Yin, Mengchen; Chen, Ni; Huang, Quan; Marla, Anastasia Sulindro; Ma, Junming; Ye, Jie; Mo, Wen

    2017-12-01

    Youden index was .4243, .3003, and .7189, respectively. The Hosmer-Lemeshow test showed a good fitting of the predictive model, with an overall accuracy of 89.6%. This study establishes a new and accurate predictive model for the efficacy of ESWT in managing patients with chronic plantar fasciitis. The use of these parameters, in the form of a predictive model for ESWT efficacy, has the potential to improve decision-making in the application of ESWT. Copyright © 2017 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  8. Limited Sampling Strategy for Accurate Prediction of Pharmacokinetics of Saroglitazar: A 3-point Linear Regression Model Development and Successful Prediction of Human Exposure.

    Science.gov (United States)

    Joshi, Shuchi N; Srinivas, Nuggehally R; Parmar, Deven V

    2018-03-01

    Our aim was to develop and validate the extrapolative performance of a regression model using a limited sampling strategy for accurate estimation of the area under the plasma concentration versus time curve for saroglitazar. Healthy subject pharmacokinetic data from a well-powered food-effect study (fasted vs fed treatments; n = 50) was used in this work. The first 25 subjects' serial plasma concentration data up to 72 hours and corresponding AUC 0-t (ie, 72 hours) from the fasting group comprised a training dataset to develop the limited sampling model. The internal datasets for prediction included the remaining 25 subjects from the fasting group and all 50 subjects from the fed condition of the same study. The external datasets included pharmacokinetic data for saroglitazar from previous single-dose clinical studies. Limited sampling models were composed of 1-, 2-, and 3-concentration-time points' correlation with AUC 0-t of saroglitazar. Only models with regression coefficients (R 2 ) >0.90 were screened for further evaluation. The best R 2 model was validated for its utility based on mean prediction error, mean absolute prediction error, and root mean square error. Both correlations between predicted and observed AUC 0-t of saroglitazar and verification of precision and bias using Bland-Altman plot were carried out. None of the evaluated 1- and 2-concentration-time points models achieved R 2 > 0.90. Among the various 3-concentration-time points models, only 4 equations passed the predefined criterion of R 2 > 0.90. Limited sampling models with time points 0.5, 2, and 8 hours (R 2 = 0.9323) and 0.75, 2, and 8 hours (R 2 = 0.9375) were validated. Mean prediction error, mean absolute prediction error, and root mean square error were prediction of saroglitazar. The same models, when applied to the AUC 0-t prediction of saroglitazar sulfoxide, showed mean prediction error, mean absolute prediction error, and root mean square error model predicts the exposure of

  9. Accurate prediction of stability changes in protein mutants by combining machine learning with structure based computational mutagenesis.

    Science.gov (United States)

    Masso, Majid; Vaisman, Iosif I

    2008-09-15

    Accurate predictive models for the impact of single amino acid substitutions on protein stability provide insight into protein structure and function. Such models are also valuable for the design and engineering of new proteins. Previously described methods have utilized properties of protein sequence or structure to predict the free energy change of mutants due to thermal (DeltaDeltaG) and denaturant (DeltaDeltaG(H2O)) denaturations, as well as mutant thermal stability (DeltaT(m)), through the application of either computational energy-based approaches or machine learning techniques. However, accuracy associated with applying these methods separately is frequently far from optimal. We detail a computational mutagenesis technique based on a four-body, knowledge-based, statistical contact potential. For any mutation due to a single amino acid replacement in a protein, the method provides an empirical normalized measure of the ensuing environmental perturbation occurring at every residue position. A feature vector is generated for the mutant by considering perturbations at the mutated position and it's ordered six nearest neighbors in the 3-dimensional (3D) protein structure. These predictors of stability change are evaluated by applying machine learning tools to large training sets of mutants derived from diverse proteins that have been experimentally studied and described. Predictive models based on our combined approach are either comparable to, or in many cases significantly outperform, previously published results. A web server with supporting documentation is available at http://proteins.gmu.edu/automute.

  10. A NEW CLINICAL PREDICTION CRITERION ACCURATELY DETERMINES A SUBSET OF PATIENTS WITH BILATERAL PRIMARY ALDOSTERONISM BEFORE ADRENAL VENOUS SAMPLING.

    Science.gov (United States)

    Kocjan, Tomaz; Janez, Andrej; Stankovic, Milenko; Vidmar, Gaj; Jensterle, Mojca

    2016-05-01

    Adrenal venous sampling (AVS) is the only available method to distinguish bilateral from unilateral primary aldosteronism (PA). AVS has several drawbacks, so it is reasonable to avoid this procedure when the results would not affect clinical management. Our objective was to identify a clinical criterion that can reliably predict nonlateralized AVS as a surrogate for bilateral PA that is not treated surgically. A retrospective diagnostic cross-sectional study conducted at Slovenian national endocrine referral center included 69 consecutive patients (mean age 56 ± 8 years, 21 females) with PA who underwent AVS. PA was confirmed with the saline infusion test (SIT). AVS was performed sequentially during continuous adrenocorticotrophic hormone (ACTH) infusion. The main outcome measures were variables associated with nonlateralized AVS to derive a clinical prediction rule. Sixty-seven (97%) patients had a successful AVS and were included in the statistical analysis. A total of 39 (58%) patients had nonlateralized AVS. The combined criterion of serum potassium ≥3.5 mmol/L, post-SIT aldosterone AVS. The best overall classification accuracy (50/67 = 75%) was achieved using the post-SIT aldosterone level AVS. Our clinical prediction criterion appears to accurately determine a subset of patients with bilateral PA who could avoid unnecessary AVS and immediately commence with medical treatment.

  11. Non-isothermal kinetics model to predict accurate phase transformation and hardness of 22MnB5 boron steel

    Energy Technology Data Exchange (ETDEWEB)

    Bok, H.-H.; Kim, S.N.; Suh, D.W. [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Barlat, F., E-mail: f.barlat@postech.ac.kr [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Lee, M.-G., E-mail: myounglee@korea.ac.kr [Department of Materials Science and Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul (Korea, Republic of)

    2015-02-25

    A non-isothermal phase transformation kinetics model obtained by modifying the well-known JMAK approach is proposed for application to a low carbon boron steel (22MnB5) sheet. In the modified kinetics model, the parameters are functions of both temperature and cooling rate, and can be identified by a numerical optimization method. Moreover, in this approach the transformation start and finish temperatures are variable instead of the constants that depend on chemical composition. These variable reference temperatures are determined from the measured CCT diagram using dilatation experiments. The kinetics model developed in this work captures the complex transformation behavior of the boron steel sheet sample accurately. In particular, the predicted hardness and phase fractions in the specimens subjected to a wide range of cooling rates were validated by experiments.

  12. Accurate density functional prediction of molecular electron affinity with the scaling corrected Kohn–Sham frontier orbital energies

    Science.gov (United States)

    Zhang, DaDi; Yang, Xiaolong; Zheng, Xiao; Yang, Weitao

    2018-04-01

    Electron affinity (EA) is the energy released when an additional electron is attached to an atom or a molecule. EA is a fundamental thermochemical property, and it is closely pertinent to other important properties such as electronegativity and hardness. However, accurate prediction of EA is difficult with density functional theory methods. The somewhat large error of the calculated EAs originates mainly from the intrinsic delocalisation error associated with the approximate exchange-correlation functional. In this work, we employ a previously developed non-empirical global scaling correction approach, which explicitly imposes the Perdew-Parr-Levy-Balduz condition to the approximate functional, and achieve a substantially improved accuracy for the calculated EAs. In our approach, the EA is given by the scaling corrected Kohn-Sham lowest unoccupied molecular orbital energy of the neutral molecule, without the need to carry out the self-consistent-field calculation for the anion.

  13. Effect of computational grid on accurate prediction of a wind turbine rotor using delayed detached-eddy simulations

    Energy Technology Data Exchange (ETDEWEB)

    Bangga, Galih; Weihing, Pascal; Lutz, Thorsten; Krämer, Ewald [University of Stuttgart, Stuttgart (Germany)

    2017-05-15

    The present study focuses on the impact of grid for accurate prediction of the MEXICO rotor under stalled conditions. Two different blade mesh topologies, O and C-H meshes, and two different grid resolutions are tested for several time step sizes. The simulations are carried out using Delayed detached-eddy simulation (DDES) with two eddy viscosity RANS turbulence models, namely Spalart- Allmaras (SA) and Menter Shear stress transport (SST) k-ω. A high order spatial discretization, WENO (Weighted essentially non- oscillatory) scheme, is used in these computations. The results are validated against measurement data with regards to the sectional loads and the chordwise pressure distributions. The C-H mesh topology is observed to give the best results employing the SST k-ω turbulence model, but the computational cost is more expensive as the grid contains a wake block that increases the number of cells.

  14. Development of a method to accurately calculate the Dpb and quickly predict the strength of a chemical bond

    International Nuclear Information System (INIS)

    Du, Xia; Zhao, Dong-Xia; Yang, Zhong-Zhi

    2013-01-01

    Highlights: ► A method from new respect to characterize and measure the bond strength is proposed. ► We calculate the D pb of a series of various bonds to justify our approach. ► A quite good linear relationship of the D pb with the bond lengths for series of various bonds is shown. ► Take the prediction of strengths of C–H and N–H bonds for base pairs in DNA as a practical application of our method. - Abstract: A new approach to characterize and measure bond strength has been developed. First, we propose a method to accurately calculate the potential acting on an electron in a molecule (PAEM) at the saddle point along a chemical bond in situ, denoted by D pb . Then, a direct method to quickly evaluate bond strength is established. We choose some familiar molecules as models for benchmarking this method. As a practical application, the D pb of base pairs in DNA along C–H and N–H bonds are obtained for the first time. All results show that C 7 –H of A–T and C 8 –H of G–C are the relatively weak bonds that are the injured positions in DNA damage. The significance of this work is twofold: (i) A method is developed to calculate D pb of various sizable molecules in situ quickly and accurately; (ii) This work demonstrates the feasibility to quickly predict the bond strength in macromolecules

  15. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  16. A novel fibrosis index comprising a non-cholesterol sterol accurately predicts HCV-related liver cirrhosis.

    Directory of Open Access Journals (Sweden)

    Magdalena Ydreborg

    Full Text Available Diagnosis of liver cirrhosis is essential in the management of chronic hepatitis C virus (HCV infection. Liver biopsy is invasive and thus entails a risk of complications as well as a potential risk of sampling error. Therefore, non-invasive diagnostic tools are preferential. The aim of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive significance for liver fibrosis in 278 patients originally included in a multicenter phase III treatment trial for chronic HCV infection. A stepwise multivariate logistic model selection was performed with liver cirrhosis, defined as Ishak fibrosis stage 5-6, as the outcome variable. A new index, referred to as Nordic Liver Index (NoLI in the paper, was based on the model: Log-odds (predicting cirrhosis = -12.17+ (age × 0.11 + (BMI (kg/m(2 × 0.23 + (D7-lathosterol (μg/100 mg cholesterol×(-0.013 + (Platelet count (x10(9/L × (-0.018 + (Prothrombin-INR × 3.69. The area under the ROC curve (AUROC for prediction of cirrhosis was 0.91 (95% CI 0.86-0.96. The index was validated in a separate cohort of 83 patients and the AUROC for this cohort was similar (0.90; 95% CI: 0.82-0.98. In conclusion, the new index may complement other methods in diagnosing cirrhosis in patients with chronic HCV infection.

  17. A Deep Learning Framework for Robust and Accurate Prediction of ncRNA-Protein Interactions Using Evolutionary Information.

    Science.gov (United States)

    Yi, Hai-Cheng; You, Zhu-Hong; Huang, De-Shuang; Li, Xiao; Jiang, Tong-Hai; Li, Li-Ping

    2018-06-01

    The interactions between non-coding RNAs (ncRNAs) and proteins play an important role in many biological processes, and their biological functions are primarily achieved by binding with a variety of proteins. High-throughput biological techniques are used to identify protein molecules bound with specific ncRNA, but they are usually expensive and time consuming. Deep learning provides a powerful solution to computationally predict RNA-protein interactions. In this work, we propose the RPI-SAN model by using the deep-learning stacked auto-encoder network to mine the hidden high-level features from RNA and protein sequences and feed them into a random forest (RF) model to predict ncRNA binding proteins. Stacked assembling is further used to improve the accuracy of the proposed method. Four benchmark datasets, including RPI2241, RPI488, RPI1807, and NPInter v2.0, were employed for the unbiased evaluation of five established prediction tools: RPI-Pred, IPMiner, RPISeq-RF, lncPro, and RPI-SAN. The experimental results show that our RPI-SAN model achieves much better performance than other methods, with accuracies of 90.77%, 89.7%, 96.1%, and 99.33%, respectively. It is anticipated that RPI-SAN can be used as an effective computational tool for future biomedical researches and can accurately predict the potential ncRNA-protein interacted pairs, which provides reliable guidance for biological research. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Combining first-principles and data modeling for the accurate prediction of the refractive index of organic polymers

    Science.gov (United States)

    Afzal, Mohammad Atif Faiz; Cheng, Chong; Hachmann, Johannes

    2018-06-01

    Organic materials with a high index of refraction (RI) are attracting considerable interest due to their potential application in optic and optoelectronic devices. However, most of these applications require an RI value of 1.7 or larger, while typical carbon-based polymers only exhibit values in the range of 1.3-1.5. This paper introduces an efficient computational protocol for the accurate prediction of RI values in polymers to facilitate in silico studies that can guide the discovery and design of next-generation high-RI materials. Our protocol is based on the Lorentz-Lorenz equation and is parametrized by the polarizability and number density values of a given candidate compound. In the proposed scheme, we compute the former using first-principles electronic structure theory and the latter using an approximation based on van der Waals volumes. The critical parameter in the number density approximation is the packing fraction of the bulk polymer, for which we have devised a machine learning model. We demonstrate the performance of the proposed RI protocol by testing its predictions against the experimentally known RI values of 112 optical polymers. Our approach to combine first-principles and data modeling emerges as both a successful and a highly economical path to determining the RI values for a wide range of organic polymers.

  19. Predicting suitable optoelectronic properties of monoclinic VON semiconductor crystals for photovoltaics using accurate first-principles computations

    KAUST Repository

    Harb, Moussab

    2015-01-01

    Using accurate first-principles quantum calculations based on DFT (including the perturbation theory DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we predict essential fundamental properties (such as bandgap, optical absorption coefficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit relatively high absorption efficiencies in the visible range, high dielectric constants, high charge carrier mobilities and much lower exciton binding energies than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties are found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices like Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.

  20. Predicting suitable optoelectronic properties of monoclinic VON semiconductor crystals for photovoltaics using accurate first-principles computations

    KAUST Repository

    Harb, Moussab

    2015-08-26

    Using accurate first-principles quantum calculations based on DFT (including the perturbation theory DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we predict essential fundamental properties (such as bandgap, optical absorption coefficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit relatively high absorption efficiencies in the visible range, high dielectric constants, high charge carrier mobilities and much lower exciton binding energies than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties are found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices like Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.

  1. Accurate X-Ray Spectral Predictions: An Advanced Self-Consistent-Field Approach Inspired by Many-Body Perturbation Theory.

    Science.gov (United States)

    Liang, Yufeng; Vinson, John; Pemmaraju, Sri; Drisdell, Walter S; Shirley, Eric L; Prendergast, David

    2017-03-03

    Constrained-occupancy delta-self-consistent-field (ΔSCF) methods and many-body perturbation theories (MBPT) are two strategies for obtaining electronic excitations from first principles. Using the two distinct approaches, we study the O 1s core excitations that have become increasingly important for characterizing transition-metal oxides and understanding strong electronic correlation. The ΔSCF approach, in its current single-particle form, systematically underestimates the pre-edge intensity for chosen oxides, despite its success in weakly correlated systems. By contrast, the Bethe-Salpeter equation within MBPT predicts much better line shapes. This motivates one to reexamine the many-electron dynamics of x-ray excitations. We find that the single-particle ΔSCF approach can be rectified by explicitly calculating many-electron transition amplitudes, producing x-ray spectra in excellent agreement with experiments. This study paves the way to accurately predict x-ray near-edge spectral fingerprints for physics and materials science beyond the Bethe-Salpether equation.

  2. Estimating the state of a geophysical system with sparse observations: time delay methods to achieve accurate initial states for prediction

    Science.gov (United States)

    An, Zhe; Rey, Daniel; Ye, Jingxin; Abarbanel, Henry D. I.

    2017-01-01

    The problem of forecasting the behavior of a complex dynamical system through analysis of observational time-series data becomes difficult when the system expresses chaotic behavior and the measurements are sparse, in both space and/or time. Despite the fact that this situation is quite typical across many fields, including numerical weather prediction, the issue of whether the available observations are "sufficient" for generating successful forecasts is still not well understood. An analysis by Whartenby et al. (2013) found that in the context of the nonlinear shallow water equations on a β plane, standard nudging techniques require observing approximately 70 % of the full set of state variables. Here we examine the same system using a method introduced by Rey et al. (2014a), which generalizes standard nudging methods to utilize time delayed measurements. We show that in certain circumstances, it provides a sizable reduction in the number of observations required to construct accurate estimates and high-quality predictions. In particular, we find that this estimate of 70 % can be reduced to about 33 % using time delays, and even further if Lagrangian drifter locations are also used as measurements.

  3. Accurate prediction of complex free surface flow around a high speed craft using a single-phase level set method

    Science.gov (United States)

    Broglia, Riccardo; Durante, Danilo

    2017-11-01

    This paper focuses on the analysis of a challenging free surface flow problem involving a surface vessel moving at high speeds, or planing. The investigation is performed using a general purpose high Reynolds free surface solver developed at CNR-INSEAN. The methodology is based on a second order finite volume discretization of the unsteady Reynolds-averaged Navier-Stokes equations (Di Mascio et al. in A second order Godunov—type scheme for naval hydrodynamics, Kluwer Academic/Plenum Publishers, Dordrecht, pp 253-261, 2001; Proceedings of 16th international offshore and polar engineering conference, San Francisco, CA, USA, 2006; J Mar Sci Technol 14:19-29, 2009); air/water interface dynamics is accurately modeled by a non standard level set approach (Di Mascio et al. in Comput Fluids 36(5):868-886, 2007a), known as the single-phase level set method. In this algorithm the governing equations are solved only in the water phase, whereas the numerical domain in the air phase is used for a suitable extension of the fluid dynamic variables. The level set function is used to track the free surface evolution; dynamic boundary conditions are enforced directly on the interface. This approach allows to accurately predict the evolution of the free surface even in the presence of violent breaking waves phenomena, maintaining the interface sharp, without any need to smear out the fluid properties across the two phases. This paper is aimed at the prediction of the complex free-surface flow field generated by a deep-V planing boat at medium and high Froude numbers (from 0.6 up to 1.2). In the present work, the planing hull is treated as a two-degree-of-freedom rigid object. Flow field is characterized by the presence of thin water sheets, several energetic breaking waves and plungings. The computational results include convergence of the trim angle, sinkage and resistance under grid refinement; high-quality experimental data are used for the purposes of validation, allowing to

  4. A Real-Time Accurate Model and Its Predictive Fuzzy PID Controller for Pumped Storage Unit via Error Compensation

    Directory of Open Access Journals (Sweden)

    Jianzhong Zhou

    2017-12-01

    Full Text Available Model simulation and control of pumped storage unit (PSU are essential to improve the dynamic quality of power station. Only under the premise of the PSU models reflecting the actual transient process, the novel control method can be properly applied in the engineering. The contributions of this paper are that (1 a real-time accurate equivalent circuit model (RAECM of PSU via error compensation is proposed to reconcile the conflict between real-time online simulation and accuracy under various operating conditions, and (2 an adaptive predicted fuzzy PID controller (APFPID based on RAECM is put forward to overcome the instability of conventional control under no-load conditions with low water head. Respectively, all hydraulic factors in pipeline system are fully considered based on equivalent lumped-circuits theorem. The pretreatment, which consists of improved Suter-transformation and BP neural network, and online simulation method featured by two iterative loops are synthetically proposed to improve the solving accuracy of the pump-turbine. Moreover, the modified formulas for compensating error are derived with variable-spatial discretization to improve the accuracy of the real-time simulation further. The implicit RadauIIA method is verified to be more suitable for PSUGS owing to wider stable domain. Then, APFPID controller is constructed based on the integration of fuzzy PID and the model predictive control. Rolling prediction by RAECM is proposed to replace rolling optimization with its computational speed guaranteed. Finally, the simulation and on-site measurements are compared to prove trustworthy of RAECM under various running conditions. Comparative experiments also indicate that APFPID controller outperforms other controllers in most cases, especially low water head conditions. Satisfying results of RAECM have been achieved in engineering and it provides a novel model reference for PSUGS.

  5. Respiratory variation in peak aortic velocity accurately predicts fluid responsiveness in children undergoing neurosurgery under general anesthesia.

    Science.gov (United States)

    Morparia, Kavita G; Reddy, Srijaya K; Olivieri, Laura J; Spaeder, Michael C; Schuette, Jennifer J

    2018-04-01

    The determination of fluid responsiveness in the critically ill child is of vital importance, more so as fluid overload becomes increasingly associated with worse outcomes. Dynamic markers of volume responsiveness have shown some promise in the pediatric population, but more research is needed before they can be adopted for widespread use. Our aim was to investigate effectiveness of respiratory variation in peak aortic velocity and pulse pressure variation to predict fluid responsiveness, and determine their optimal cutoff values. We performed a prospective, observational study at a single tertiary care pediatric center. Twenty-one children with normal cardiorespiratory status undergoing general anesthesia for neurosurgery were enrolled. Respiratory variation in peak aortic velocity (ΔVpeak ao) was measured both before and after volume expansion using a bedside ultrasound device. Pulse pressure variation (PPV) value was obtained from the bedside monitor. All patients received a 10 ml/kg fluid bolus as volume expansion, and were qualified as responders if stroke volume increased >15% as a result. Utility of ΔVpeak ao and PPV and to predict responsiveness to volume expansion was investigated. A baseline ΔVpeak ao value of greater than or equal to 12.3% best predicted a positive response to volume expansion, with a sensitivity of 77%, specificity of 89% and area under receiver operating characteristic curve of 0.90. PPV failed to demonstrate utility in this patient population. Respiratory variation in peak aortic velocity is a promising marker for optimization of perioperative fluid therapy in the pediatric population and can be accurately measured using bedside ultrasonography. More research is needed to evaluate the lack of effectiveness of pulse pressure variation for this purpose.

  6. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  7. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  8. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  9. A rapid and accurate approach for prediction of interactomes from co-elution data (PrInCE).

    Science.gov (United States)

    Stacey, R Greg; Skinnider, Michael A; Scott, Nichollas E; Foster, Leonard J

    2017-10-23

    An organism's protein interactome, or complete network of protein-protein interactions, defines the protein complexes that drive cellular processes. Techniques for studying protein complexes have traditionally applied targeted strategies such as yeast two-hybrid or affinity purification-mass spectrometry to assess protein interactions. However, given the vast number of protein complexes, more scalable methods are necessary to accelerate interaction discovery and to construct whole interactomes. We recently developed a complementary technique based on the use of protein correlation profiling (PCP) and stable isotope labeling in amino acids in cell culture (SILAC) to assess chromatographic co-elution as evidence of interacting proteins. Importantly, PCP-SILAC is also capable of measuring protein interactions simultaneously under multiple biological conditions, allowing the detection of treatment-specific changes to an interactome. Given the uniqueness and high dimensionality of co-elution data, new tools are needed to compare protein elution profiles, control false discovery rates, and construct an accurate interactome. Here we describe a freely available bioinformatics pipeline, PrInCE, for the analysis of co-elution data. PrInCE is a modular, open-source library that is computationally inexpensive, able to use label and label-free data, and capable of detecting tens of thousands of protein-protein interactions. Using a machine learning approach, PrInCE offers greatly reduced run time, more predicted interactions at the same stringency, prediction of protein complexes, and greater ease of use over previous bioinformatics tools for co-elution data. PrInCE is implemented in Matlab (version R2017a). Source code and standalone executable programs for Windows and Mac OSX are available at https://github.com/fosterlab/PrInCE , where usage instructions can be found. An example dataset and output are also provided for testing purposes. PrInCE is the first fast and easy

  10. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  11. Accurate prediction of retention in hydrophilic interaction chromatography by back calculation of high pressure liquid chromatography gradient profiles.

    Science.gov (United States)

    Wang, Nu; Boswell, Paul G

    2017-10-20

    Gradient retention times are difficult to project from the underlying retention factor (k) vs. solvent composition (φ) relationships. A major reason for this difficulty is that gradients produced by HPLC pumps are imperfect - gradient delay, gradient dispersion, and solvent mis-proportioning are all difficult to account for in calculations. However, we recently showed that a gradient "back-calculation" methodology can measure these imperfections and take them into account. In RPLC, when the back-calculation methodology was used, error in projected gradient retention times is as low as could be expected based on repeatability in the k vs. φ relationships. HILIC, however, presents a new challenge: the selectivity of HILIC columns drift strongly over time. Retention is repeatable in short time, but selectivity frequently drifts over the course of weeks. In this study, we set out to understand if the issue of selectivity drift can be avoid by doing our experiments quickly, and if there any other factors that make it difficult to predict gradient retention times from isocratic k vs. φ relationships when gradient imperfections are taken into account with the back-calculation methodology. While in past reports, the accuracy of retention projections was >5%, the back-calculation methodology brought our error down to ∼1%. This result was 6-43 times more accurate than projections made using ideal gradients and 3-5 times more accurate than the same retention projections made using offset gradients (i.e., gradients that only took gradient delay into account). Still, the error remained higher in our HILIC projections than in RPLC. Based on the shape of the back-calculated gradients, we suspect the higher error is a result of prominent gradient distortion caused by strong, preferential water uptake from the mobile phase into the stationary phase during the gradient - a factor our model did not properly take into account. It appears that, at least with the stationary phase

  12. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  13. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  14. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  15. Do Skilled Elementary Teachers Hold Scientific Conceptions and Can They Accurately Predict the Type and Source of Students' Preconceptions of Electric Circuits?

    Science.gov (United States)

    Lin, Jing-Wen

    2016-01-01

    Holding scientific conceptions and having the ability to accurately predict students' preconceptions are a prerequisite for science teachers to design appropriate constructivist-oriented learning experiences. This study explored the types and sources of students' preconceptions of electric circuits. First, 438 grade 3 (9 years old) students were…

  16. Prediction of collision cross section and retention time for broad scope screening in gradient reversed-phase liquid chromatography-ion mobility-high resolution accurate mass spectrometry

    DEFF Research Database (Denmark)

    Mollerup, Christian Brinch; Mardal, Marie; Dalsgaard, Petur Weihe

    2018-01-01

    artificial neural networks (ANNs). Prediction was based on molecular descriptors, 827 RTs, and 357 CCS values from pharmaceuticals, drugs of abuse, and their metabolites. ANN models for the prediction of RT or CCS separately were examined, and the potential to predict both from a single model......Exact mass, retention time (RT), and collision cross section (CCS) are used as identification parameters in liquid chromatography coupled to ion mobility high resolution accurate mass spectrometry (LC-IM-HRMS). Targeted screening analyses are now more flexible and can be expanded for suspect...

  17. Towards accurate prediction of unbalance response, oil whirl and oil whip of flexible rotors supported by hydrodynamic bearings

    NARCIS (Netherlands)

    Eling, R.P.T.; te Wierik, M.; van Ostayen, R.A.J.; Rixen, D.J.

    2016-01-01

    Journal bearings are used to support rotors in a wide range of applications. In order to ensure reliable operation, accurate analyses of these rotor-bearing systems are crucial. Coupled analysis of the rotor and the journal bearing is essential in the case that the rotor is flexible. The accuracy of

  18. Total reference air kerma can accurately predict isodose surface volumes in cervix cancer brachytherapy. A multicenter study

    DEFF Research Database (Denmark)

    Nkiwane, Karen S; Andersen, Else; Champoudry, Jerome

    2017-01-01

    PURPOSE: To demonstrate that V60 Gy, V75 Gy, and V85 Gy isodose surface volumes can be accurately estimated from total reference air kerma (TRAK) in cervix cancer MRI-guided brachytherapy (BT). METHODS AND MATERIALS: 60 Gy, 75 Gy, and 85 Gy isodose surface volumes levels were obtained from treatm...

  19. Accurate particle speed prediction by improved particle speed measurement and 3-dimensional particle size and shape characterization technique

    DEFF Research Database (Denmark)

    Cernuschi, Federico; Rothleitner, Christian; Clausen, Sønnik

    2017-01-01

    Accurate particle mass and velocity measurement is needed for interpreting test results in erosion tests of materials and coatings. The impact and damage of a surface is influenced by the kinetic energy of a particle, i.e. particle mass and velocity. Particle mass is usually determined with optic...

  20. Accurate pan-specific prediction of peptide-MHC class II binding affinity with improved binding core identification

    DEFF Research Database (Denmark)

    Andreatta, Massimo; Karosiene, Edita; Rasmussen, Michael

    2015-01-01

    with known binding registers, the new method NetMHCIIpan-3.1 significantly outperformed the earlier 3.0 version. We illustrate the impact of accurate binding core identification for the interpretation of T cell cross-reactivity using tetramer double staining with a CMV epitope and its variants mapped...

  1. Accurate and computationally efficient prediction of thermochemical properties of biomolecules using the generalized connectivity-based hierarchy.

    Science.gov (United States)

    Sengupta, Arkajyoti; Ramabhadran, Raghunath O; Raghavachari, Krishnan

    2014-08-14

    In this study we have used the connectivity-based hierarchy (CBH) method to derive accurate heats of formation of a range of biomolecules, 18 amino acids and 10 barbituric acid/uracil derivatives. The hierarchy is based on the connectivity of the different atoms in a large molecule. It results in error-cancellation reaction schemes that are automated, general, and can be readily used for a broad range of organic molecules and biomolecules. Herein, we first locate stable conformational and tautomeric forms of these biomolecules using an accurate level of theory (viz. CCSD(T)/6-311++G(3df,2p)). Subsequently, the heats of formation of the amino acids are evaluated using the CBH-1 and CBH-2 schemes and routinely employed density functionals or wave function-based methods. The calculated heats of formation obtained herein using modest levels of theory and are in very good agreement with those obtained using more expensive W1-F12 and W2-F12 methods on amino acids and G3 results on barbituric acid derivatives. Overall, the present study (a) highlights the small effect of including multiple conformers in determining the heats of formation of biomolecules and (b) in concurrence with previous CBH studies, proves that use of the more effective error-cancelling isoatomic scheme (CBH-2) results in more accurate heats of formation with modestly sized basis sets along with common density functionals or wave function-based methods.

  2. Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.

    Directory of Open Access Journals (Sweden)

    Liam R Brunham

    2005-12-01

    Full Text Available The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008. These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

  3. A hybrid solution using computational prediction and measured data to accurately determine process corrections with reduced overlay sampling

    Science.gov (United States)

    Noyes, Ben F.; Mokaberi, Babak; Mandoy, Ram; Pate, Alex; Huijgen, Ralph; McBurney, Mike; Chen, Owen

    2017-03-01

    Reducing overlay error via an accurate APC feedback system is one of the main challenges in high volume production of the current and future nodes in the semiconductor industry. The overlay feedback system directly affects the number of dies meeting overlay specification and the number of layers requiring dedicated exposure tools through the fabrication flow. Increasing the former number and reducing the latter number is beneficial for the overall efficiency and yield of the fabrication process. An overlay feedback system requires accurate determination of the overlay error, or fingerprint, on exposed wafers in order to determine corrections to be automatically and dynamically applied to the exposure of future wafers. Since current and future nodes require correction per exposure (CPE), the resolution of the overlay fingerprint must be high enough to accommodate CPE in the overlay feedback system, or overlay control module (OCM). Determining a high resolution fingerprint from measured data requires extremely dense overlay sampling that takes a significant amount of measurement time. For static corrections this is acceptable, but in an automated dynamic correction system this method creates extreme bottlenecks for the throughput of said system as new lots have to wait until the previous lot is measured. One solution is using a less dense overlay sampling scheme and employing computationally up-sampled data to a dense fingerprint. That method uses a global fingerprint model over the entire wafer; measured localized overlay errors are therefore not always represented in its up-sampled output. This paper will discuss a hybrid system shown in Fig. 1 that combines a computationally up-sampled fingerprint with the measured data to more accurately capture the actual fingerprint, including local overlay errors. Such a hybrid system is shown to result in reduced modelled residuals while determining the fingerprint, and better on-product overlay performance.

  4. An evolutionary model-based algorithm for accurate phylogenetic breakpoint mapping and subtype prediction in HIV-1.

    Directory of Open Access Journals (Sweden)

    Sergei L Kosakovsky Pond

    2009-11-01

    Full Text Available Genetically diverse pathogens (such as Human Immunodeficiency virus type 1, HIV-1 are frequently stratified into phylogenetically or immunologically defined subtypes for classification purposes. Computational identification of such subtypes is helpful in surveillance, epidemiological analysis and detection of novel variants, e.g., circulating recombinant forms in HIV-1. A number of conceptually and technically different techniques have been proposed for determining the subtype of a query sequence, but there is not a universally optimal approach. We present a model-based phylogenetic method for automatically subtyping an HIV-1 (or other viral or bacterial sequence, mapping the location of breakpoints and assigning parental sequences in recombinant strains as well as computing confidence levels for the inferred quantities. Our Subtype Classification Using Evolutionary ALgorithms (SCUEAL procedure is shown to perform very well in a variety of simulation scenarios, runs in parallel when multiple sequences are being screened, and matches or exceeds the performance of existing approaches on typical empirical cases. We applied SCUEAL to all available polymerase (pol sequences from two large databases, the Stanford Drug Resistance database and the UK HIV Drug Resistance Database. Comparing with subtypes which had previously been assigned revealed that a minor but substantial (approximately 5% fraction of pure subtype sequences may in fact be within- or inter-subtype recombinants. A free implementation of SCUEAL is provided as a module for the HyPhy package and the Datamonkey web server. Our method is especially useful when an accurate automatic classification of an unknown strain is desired, and is positioned to complement and extend faster but less accurate methods. Given the increasingly frequent use of HIV subtype information in studies focusing on the effect of subtype on treatment, clinical outcome, pathogenicity and vaccine design, the importance

  5. MFPred: Rapid and accurate prediction of protein-peptide recognition multispecificity using self-consistent mean field theory.

    Directory of Open Access Journals (Sweden)

    Aliza B Rubenstein

    2017-06-01

    Full Text Available Multispecificity-the ability of a single receptor protein molecule to interact with multiple substrates-is a hallmark of molecular recognition at protein-protein and protein-peptide interfaces, including enzyme-substrate complexes. The ability to perform structure-based prediction of multispecificity would aid in the identification of novel enzyme substrates, protein interaction partners, and enable design of novel enzymes targeted towards alternative substrates. The relatively slow speed of current biophysical, structure-based methods limits their use for prediction and, especially, design of multispecificity. Here, we develop a rapid, flexible-backbone self-consistent mean field theory-based technique, MFPred, for multispecificity modeling at protein-peptide interfaces. We benchmark our method by predicting experimentally determined peptide specificity profiles for a range of receptors: protease and kinase enzymes, and protein recognition modules including SH2, SH3, MHC Class I and PDZ domains. We observe robust recapitulation of known specificities for all receptor-peptide complexes, and comparison with other methods shows that MFPred results in equivalent or better prediction accuracy with a ~10-1000-fold decrease in computational expense. We find that modeling bound peptide backbone flexibility is key to the observed accuracy of the method. We used MFPred for predicting with high accuracy the impact of receptor-side mutations on experimentally determined multispecificity of a protease enzyme. Our approach should enable the design of a wide range of altered receptor proteins with programmed multispecificities.

  6. Accurate Traffic Flow Prediction in Heterogeneous Vehicular Networks in an Intelligent Transport System Using a Supervised Non-Parametric Classifier

    Directory of Open Access Journals (Sweden)

    Hesham El-Sayed

    2018-05-01

    Full Text Available Heterogeneous vehicular networks (HETVNETs evolve from vehicular ad hoc networks (VANETs, which allow vehicles to always be connected so as to obtain safety services within intelligent transportation systems (ITSs. The services and data provided by HETVNETs should be neither interrupted nor delayed. Therefore, Quality of Service (QoS improvement of HETVNETs is one of the topics attracting the attention of researchers and the manufacturing community. Several methodologies and frameworks have been devised by researchers to address QoS-prediction service issues. In this paper, to improve QoS, we evaluate various traffic characteristics of HETVNETs and propose a new supervised learning model to capture knowledge on all possible traffic patterns. This model is a refinement of support vector machine (SVM kernels with a radial basis function (RBF. The proposed model produces better results than SVMs, and outperforms other prediction methods used in a traffic context, as it has lower computational complexity and higher prediction accuracy.

  7. Is demography destiny? Application of machine learning techniques to accurately predict population health outcomes from a minimal demographic dataset.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available For years, we have relied on population surveys to keep track of regional public health statistics, including the prevalence of non-communicable diseases. Because of the cost and limitations of such surveys, we often do not have the up-to-date data on health outcomes of a region. In this paper, we examined the feasibility of inferring regional health outcomes from socio-demographic data that are widely available and timely updated through national censuses and community surveys. Using data for 50 American states (excluding Washington DC from 2007 to 2012, we constructed a machine-learning model to predict the prevalence of six non-communicable disease (NCD outcomes (four NCDs and two major clinical risk factors, based on population socio-demographic characteristics from the American Community Survey. We found that regional prevalence estimates for non-communicable diseases can be reasonably predicted. The predictions were highly correlated with the observed data, in both the states included in the derivation model (median correlation 0.88 and those excluded from the development for use as a completely separated validation sample (median correlation 0.85, demonstrating that the model had sufficient external validity to make good predictions, based on demographics alone, for areas not included in the model development. This highlights both the utility of this sophisticated approach to model development, and the vital importance of simple socio-demographic characteristics as both indicators and determinants of chronic disease.

  8. Is demography destiny? Application of machine learning techniques to accurately predict population health outcomes from a minimal demographic dataset.

    Science.gov (United States)

    Luo, Wei; Nguyen, Thin; Nichols, Melanie; Tran, Truyen; Rana, Santu; Gupta, Sunil; Phung, Dinh; Venkatesh, Svetha; Allender, Steve

    2015-01-01

    For years, we have relied on population surveys to keep track of regional public health statistics, including the prevalence of non-communicable diseases. Because of the cost and limitations of such surveys, we often do not have the up-to-date data on health outcomes of a region. In this paper, we examined the feasibility of inferring regional health outcomes from socio-demographic data that are widely available and timely updated through national censuses and community surveys. Using data for 50 American states (excluding Washington DC) from 2007 to 2012, we constructed a machine-learning model to predict the prevalence of six non-communicable disease (NCD) outcomes (four NCDs and two major clinical risk factors), based on population socio-demographic characteristics from the American Community Survey. We found that regional prevalence estimates for non-communicable diseases can be reasonably predicted. The predictions were highly correlated with the observed data, in both the states included in the derivation model (median correlation 0.88) and those excluded from the development for use as a completely separated validation sample (median correlation 0.85), demonstrating that the model had sufficient external validity to make good predictions, based on demographics alone, for areas not included in the model development. This highlights both the utility of this sophisticated approach to model development, and the vital importance of simple socio-demographic characteristics as both indicators and determinants of chronic disease.

  9. Microdosing of a Carbon-14 Labeled Protein in Healthy Volunteers Accurately Predicts Its Pharmacokinetics at Therapeutic Dosages

    NARCIS (Netherlands)

    Vlaming, M.L.; Duijn, E. van; Dillingh, M.R.; Brands, R.; Windhorst, A.D.; Hendrikse, N.H.; Bosgra, S.; Burggraaf, J.; Koning, M.C. de; Fidder, A.; Mocking, J.A.; Sandman, H.; Ligt, R.A. de; Fabriek, B.O.; Pasman, W.J.; Seinen, W.; Alves, T.; Carrondo, M.; Peixoto, C.; Peeters, P.A.; Vaes, W.H.

    2015-01-01

    Preclinical development of new biological entities (NBEs), such as human protein therapeutics, requires considerable expenditure of time and costs. Poor prediction of pharmacokinetics in humans further reduces net efficiency. In this study, we show for the first time that pharmacokinetic data of

  10. Accurate prediction of the toxicity of benzoic acid compounds in mice via oral without using any computer codes

    International Nuclear Information System (INIS)

    Keshavarz, Mohammad Hossein; Gharagheizi, Farhad; Shokrolahi, Arash; Zakinejad, Sajjad

    2012-01-01

    Highlights: ► A novel method is introduced for desk calculation of toxicity of benzoic acid derivatives. ► There is no need to use QSAR and QSTR methods, which are based on computer codes. ► The predicted results of 58 compounds are more reliable than those predicted by QSTR method. ► The present method gives good predictions for further 324 benzoic acid compounds. - Abstract: Most of benzoic acid derivatives are toxic, which may cause serious public health and environmental problems. Two novel simple and reliable models are introduced for desk calculations of the toxicity of benzoic acid compounds in mice via oral LD 50 with more reliance on their answers as one could attach to the more complex outputs. They require only elemental composition and molecular fragments without using any computer codes. The first model is based on only the number of carbon and hydrogen atoms, which can be improved by several molecular fragments in the second model. For 57 benzoic compounds, where the computed results of quantitative structure–toxicity relationship (QSTR) were recently reported, the predicted results of two simple models of present method are more reliable than QSTR computations. The present simple method is also tested with further 324 benzoic acid compounds including complex molecular structures, which confirm good forecasting ability of the second model.

  11. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  12. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  13. Exchange-Hole Dipole Dispersion Model for Accurate Energy Ranking in Molecular Crystal Structure Prediction II: Nonplanar Molecules.

    Science.gov (United States)

    Whittleton, Sarah R; Otero-de-la-Roza, A; Johnson, Erin R

    2017-11-14

    The crystal structure prediction (CSP) of a given compound from its molecular diagram is a fundamental challenge in computational chemistry with implications in relevant technological fields. A key component of CSP is the method to calculate the lattice energy of a crystal, which allows the ranking of candidate structures. This work is the second part of our investigation to assess the potential of the exchange-hole dipole moment (XDM) dispersion model for crystal structure prediction. In this article, we study the relatively large, nonplanar, mostly flexible molecules in the first five blind tests held by the Cambridge Crystallographic Data Centre. Four of the seven experimental structures are predicted as the energy minimum, and thermal effects are demonstrated to have a large impact on the ranking of at least another compound. As in the first part of this series, delocalization error affects the results for a single crystal (compound X), in this case by detrimentally overstabilizing the π-conjugated conformation of the monomer. Overall, B86bPBE-XDM correctly predicts 16 of the 21 compounds in the five blind tests, a result similar to the one obtained using the best CSP method available to date (dispersion-corrected PW91 by Neumann et al.). Perhaps more importantly, the systems for which B86bPBE-XDM fails to predict the experimental structure as the energy minimum are mostly the same as with Neumann's method, which suggests that similar difficulties (absence of vibrational free energy corrections, delocalization error,...) are not limited to B86bPBE-XDM but affect GGA-based DFT-methods in general. Our work confirms B86bPBE-XDM as an excellent option for crystal energy ranking in CSP and offers a guide to identify crystals (organic salts, conjugated flexible systems) where difficulties may appear.

  14. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  15. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Science.gov (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  16. Can Vrancea earthquakes be accurately predicted from unusual bio-system behavior and seismic-electromagnetic records?

    International Nuclear Information System (INIS)

    Enescu, D.; Chitaru, C.; Enescu, B.D.

    1999-01-01

    The relevance of bio-seismic research for the short-term prediction of strong Vrancea earthquakes is underscored. An unusual animal behavior before and during Vrancea earthquakes is described and illustrated in the individual case of the major earthquake of March 4, 1977. Several hypotheses to account for the uncommon behavior of bio-systems in relation to earthquakes in general and strong Vrancea earthquakes in particular are discussed in the second section. It is reminded that promising preliminary results concerning the identification of seismic-electromagnetic precursor signals have been obtained in the Vrancea seismogenic area using special, highly sensitive equipment. The need to correlate bio-seismic and seismic-electromagnetic researches is evident. Further investigations are suggested and urgent steps are proposed in order to achieve a successful short-term prediction of strong Vrancea earthquakes. (authors)

  17. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Science.gov (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  18. Unsteady Reynolds averaged Navier-Stokes: toward accurate predictions in fuel-bundles and T-junctions

    International Nuclear Information System (INIS)

    Merzari, E.; Ninokata, H.; Baglietto, E.

    2008-01-01

    Traditional steady-state simulation and turbulence modelling are not always reliable. Even in simple flows, the results can be not accurate when particular conditions occur. Examples are buoyancy, flow oscillations, and turbulent mixing. Often, unsteady simulations are necessary, but they tend to be computationally not affordable. The Unsteady Reynolds Averaged Navier-Stokes (URANS) approach holds promise to be less computational expensive than Large Eddy Simulation (LES) or Direct Numerical Simulation (DNS), reaching a considerable degree of accuracy. Moreover, URANS methodologies do not need complex boundary formulations for the inlet and the outlet like LES or DNS. The Test cases for this methodology will be Fuel Bundles and T-junctions. Tight-Fuel Rod-Bundles present large scale coherent structures than cannot be taken into account by a simple steady-state simulation. T-junctions where a hot fluid and a cold fluid mix present temperature fluctuations and therefore thermal fatigue. For both cases the capacity of the methodology to reproduce the flow field are assessed and it is evaluated that URANS holds promise to be the industrial standard in nuclear engineering applications that do not involve buoyancy. The codes employed are STAR-CD 3.26 and 4.06. (author)

  19. Accuration of Time Series and Spatial Interpolation Method for Prediction of Precipitation Distribution on the Geographical Information System

    Science.gov (United States)

    Prasetyo, S. Y. J.; Hartomo, K. D.

    2018-01-01

    The Spatial Plan of the Province of Central Java 2009-2029 identifies that most regencies or cities in Central Java Province are very vulnerable to landslide disaster. The data are also supported by other data from Indonesian Disaster Risk Index (In Indonesia called Indeks Risiko Bencana Indonesia) 2013 that suggest that some areas in Central Java Province exhibit a high risk of natural disasters. This research aims to develop an application architecture and analysis methodology in GIS to predict and to map rainfall distribution. We propose our GIS architectural application of “Multiplatform Architectural Spatiotemporal” and data analysis methods of “Triple Exponential Smoothing” and “Spatial Interpolation” as our significant scientific contribution. This research consists of 2 (two) parts, namely attribute data prediction using TES method and spatial data prediction using Inverse Distance Weight (IDW) method. We conduct our research in 19 subdistricts in the Boyolali Regency, Central Java Province, Indonesia. Our main research data is the biweekly rainfall data in 2000-2016 Climatology, Meteorology, and Geophysics Agency (In Indonesia called Badan Meteorologi, Klimatologi, dan Geofisika) of Central Java Province and Laboratory of Plant Disease Observations Region V Surakarta, Central Java. The application architecture and analytical methodology of “Multiplatform Architectural Spatiotemporal” and spatial data analysis methodology of “Triple Exponential Smoothing” and “Spatial Interpolation” can be developed as a GIS application framework of rainfall distribution for various applied fields. The comparison between the TES and IDW methods show that relative to time series prediction, spatial interpolation exhibit values that are approaching actual. Spatial interpolation is closer to actual data because computed values are the rainfall data of the nearest location or the neighbour of sample values. However, the IDW’s main weakness is that some

  20. A Simple PB/LIE Free Energy Function Accurately Predicts the Peptide Binding Specificity of the Tiam1 PDZ Domain.

    Science.gov (United States)

    Panel, Nicolas; Sun, Young Joo; Fuentes, Ernesto J; Simonson, Thomas

    2017-01-01

    PDZ domains generally bind short amino acid sequences at the C-terminus of target proteins, and short peptides can be used as inhibitors or model ligands. Here, we used experimental binding assays and molecular dynamics simulations to characterize 51 complexes involving the Tiam1 PDZ domain and to test the performance of a semi-empirical free energy function. The free energy function combined a Poisson-Boltzmann (PB) continuum electrostatic term, a van der Waals interaction energy, and a surface area term. Each term was empirically weighted, giving a Linear Interaction Energy or "PB/LIE" free energy. The model yielded a mean unsigned deviation of 0.43 kcal/mol and a Pearson correlation of 0.64 between experimental and computed free energies, which was superior to a Null model that assumes all complexes have the same affinity. Analyses of the models support several experimental observations that indicate the orientation of the α 2 helix is a critical determinant for peptide specificity. The models were also used to predict binding free energies for nine new variants, corresponding to point mutants of the Syndecan1 and Caspr4 peptides. The predictions did not reveal improved binding; however, they suggest that an unnatural amino acid could be used to increase protease resistance and peptide lifetimes in vivo . The overall performance of the model should allow its use in the design of new PDZ ligands in the future.

  1. An application of a relational database system for high-throughput prediction of elemental compositions from accurate mass values.

    Science.gov (United States)

    Sakurai, Nozomu; Ara, Takeshi; Kanaya, Shigehiko; Nakamura, Yukiko; Iijima, Yoko; Enomoto, Mitsuo; Motegi, Takeshi; Aoki, Koh; Suzuki, Hideyuki; Shibata, Daisuke

    2013-01-15

    High-accuracy mass values detected by high-resolution mass spectrometry analysis enable prediction of elemental compositions, and thus are used for metabolite annotations in metabolomic studies. Here, we report an application of a relational database to significantly improve the rate of elemental composition predictions. By searching a database of pre-calculated elemental compositions with fixed kinds and numbers of atoms, the approach eliminates redundant evaluations of the same formula that occur in repeated calculations with other tools. When our approach is compared with HR2, which is one of the fastest tools available, our database search times were at least 109 times shorter than those of HR2. When a solid-state drive (SSD) was applied, the search time was 488 times shorter at 5 ppm mass tolerance and 1833 times at 0.1 ppm. Even if the search by HR2 was performed with 8 threads in a high-spec Windows 7 PC, the database search times were at least 26 and 115 times shorter without and with the SSD. These improvements were enhanced in a low spec Windows XP PC. We constructed a web service 'MFSearcher' to query the database in a RESTful manner. Available for free at http://webs2.kazusa.or.jp/mfsearcher. The web service is implemented in Java, MySQL, Apache and Tomcat, with all major browsers supported. sakurai@kazusa.or.jp Supplementary data are available at Bioinformatics online.

  2. A Simple PB/LIE Free Energy Function Accurately Predicts the Peptide Binding Specificity of the Tiam1 PDZ Domain

    Directory of Open Access Journals (Sweden)

    Nicolas Panel

    2017-09-01

    Full Text Available PDZ domains generally bind short amino acid sequences at the C-terminus of target proteins, and short peptides can be used as inhibitors or model ligands. Here, we used experimental binding assays and molecular dynamics simulations to characterize 51 complexes involving the Tiam1 PDZ domain and to test the performance of a semi-empirical free energy function. The free energy function combined a Poisson-Boltzmann (PB continuum electrostatic term, a van der Waals interaction energy, and a surface area term. Each term was empirically weighted, giving a Linear Interaction Energy or “PB/LIE” free energy. The model yielded a mean unsigned deviation of 0.43 kcal/mol and a Pearson correlation of 0.64 between experimental and computed free energies, which was superior to a Null model that assumes all complexes have the same affinity. Analyses of the models support several experimental observations that indicate the orientation of the α2 helix is a critical determinant for peptide specificity. The models were also used to predict binding free energies for nine new variants, corresponding to point mutants of the Syndecan1 and Caspr4 peptides. The predictions did not reveal improved binding; however, they suggest that an unnatural amino acid could be used to increase protease resistance and peptide lifetimes in vivo. The overall performance of the model should allow its use in the design of new PDZ ligands in the future.

  3. A 3D-CFD code for accurate prediction of fluid flows and fluid forces in seals

    Science.gov (United States)

    Athavale, M. M.; Przekwas, A. J.; Hendricks, R. C.

    1994-01-01

    Current and future turbomachinery requires advanced seal configurations to control leakage, inhibit mixing of incompatible fluids and to control the rotodynamic response. In recognition of a deficiency in the existing predictive methodology for seals, a seven year effort was established in 1990 by NASA's Office of Aeronautics Exploration and Technology, under the Earth-to-Orbit Propulsion program, to develop validated Computational Fluid Dynamics (CFD) concepts, codes and analyses for seals. The effort will provide NASA and the U.S. Aerospace Industry with advanced CFD scientific codes and industrial codes for analyzing and designing turbomachinery seals. An advanced 3D CFD cylindrical seal code has been developed, incorporating state-of-the-art computational methodology for flow analysis in straight, tapered and stepped seals. Relevant computational features of the code include: stationary/rotating coordinates, cylindrical and general Body Fitted Coordinates (BFC) systems, high order differencing schemes, colocated variable arrangement, advanced turbulence models, incompressible/compressible flows, and moving grids. This paper presents the current status of code development, code demonstration for predicting rotordynamic coefficients, numerical parametric study of entrance loss coefficients for generic annular seals, and plans for code extensions to labyrinth, damping, and other seal configurations.

  4. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  5. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  6. Genomic inference accurately predicts the timing and severity of a recent bottleneck in a non-model insect population

    Science.gov (United States)

    McCoy, Rajiv C.; Garud, Nandita R.; Kelley, Joanna L.; Boggs, Carol L.; Petrov, Dmitri A.

    2015-01-01

    The analysis of molecular data from natural populations has allowed researchers to answer diverse ecological questions that were previously intractable. In particular, ecologists are often interested in the demographic history of populations, information that is rarely available from historical records. Methods have been developed to infer demographic parameters from genomic data, but it is not well understood how inferred parameters compare to true population history or depend on aspects of experimental design. Here we present and evaluate a method of SNP discovery using RNA-sequencing and demographic inference using the program δaδi, which uses a diffusion approximation to the allele frequency spectrum to fit demographic models. We test these methods in a population of the checkerspot butterfly Euphydryas gillettii. This population was intentionally introduced to Gothic, Colorado in 1977 and has since experienced extreme fluctuations including bottlenecks of fewer than 25 adults, as documented by nearly annual field surveys. Using RNA-sequencing of eight individuals from Colorado and eight individuals from a native population in Wyoming, we generate the first genomic resources for this system. While demographic inference is commonly used to examine ancient demography, our study demonstrates that our inexpensive, all-in-one approach to marker discovery and genotyping provides sufficient data to accurately infer the timing of a recent bottleneck. This demographic scenario is relevant for many species of conservation concern, few of which have sequenced genomes. Our results are remarkably insensitive to sample size or number of genomic markers, which has important implications for applying this method to other non-model systems. PMID:24237665

  7. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  8. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Number of bodily symptoms predicts outcome more accurately than health anxiety in patients attending neurology, cardiology, and gastroenterology clinics.

    Science.gov (United States)

    Jackson, Judy; Fiddler, Maggie; Kapur, Navneet; Wells, Adrian; Tomenson, Barbara; Creed, Francis

    2006-04-01

    In consecutive new outpatients, we aimed to assess whether somatization and health anxiety predicted health care use and quality of life 6 months later in all patients or in those without demonstrable abnormalities. On the first clinic visit, participants completed the Illness Perception Questionnaire (IPQ), the Health Anxiety Questionnaire (HAQ), and the Hospital Anxiety and Depression Scale (HADS). Outcome was assessed as: (a) the number of medical consultations over the subsequent 6 months, extracted from medical records, and (b) Short-Form Health Survey 36 (SF36) physical component score 6 months after index clinic visit. A total of 295 patients were recruited (77% response rate), and medical consultation data were available for 275. The number of bodily symptoms was associated with both outcomes in linear fashion (Psomatization and hypochondriasis.

  10. Automatic Earthquake Shear Stress Measurement Method Developed for Accurate Time- Prediction Analysis of Forthcoming Major Earthquakes Along Shallow Active Faults

    Science.gov (United States)

    Serata, S.

    2006-12-01

    The Serata Stressmeter has been developed to measure and monitor earthquake shear stress build-up along shallow active faults. The development work made in the past 25 years has established the Stressmeter as an automatic stress measurement system to study timing of forthcoming major earthquakes in support of the current earthquake prediction studies based on statistical analysis of seismological observations. In early 1982, a series of major Man-made earthquakes (magnitude 4.5-5.0) suddenly occurred in an area over deep underground potash mine in Saskatchewan, Canada. By measuring underground stress condition of the mine, the direct cause of the earthquake was disclosed. The cause was successfully eliminated by controlling the stress condition of the mine. The Japanese government was interested in this development and the Stressmeter was introduced to the Japanese government research program for earthquake stress studies. In Japan the Stressmeter was first utilized for direct measurement of the intrinsic lateral tectonic stress gradient G. The measurement, conducted at the Mt. Fuji Underground Research Center of the Japanese government, disclosed the constant natural gradients of maximum and minimum lateral stresses in an excellent agreement with the theoretical value, i.e., G = 0.25. All the conventional methods of overcoring, hydrofracturing and deformation, which were introduced to compete with the Serata method, failed demonstrating the fundamental difficulties of the conventional methods. The intrinsic lateral stress gradient determined by the Stressmeter for the Japanese government was found to be the same with all the other measurements made by the Stressmeter in Japan. The stress measurement results obtained by the major international stress measurement work in the Hot Dry Rock Projects conducted in USA, England and Germany are found to be in good agreement with the Stressmeter results obtained in Japan. Based on this broad agreement, a solid geomechanical

  11. Does 99mTc MAA study accurately predict the Hepatopulmonary shunt fraction of 90Y theraspheres?

    International Nuclear Information System (INIS)

    Jha, Ashish; Zade, A.; Monteiro, P.; Shah, S.; Purandare, N.C.; Rangarajan, V.; Kulkarni, S.; Kulkarni, A.; Shetty, Nitin

    2010-01-01

    Full text: Transarterial-radioembolisation (TARE) is FDA approved therapeutic option for primary and metastatic liver malignancy when patient is inoperable; which in addition to the embolic effect (as seen with Transarterial- chemoembolisation-TACE) also gives the benefit of selectively irradiation to the target lesions with minimal toxicity to adjacent normal hepatocytes. However there is a risk of shunting of radioactive spheres to pulmonary circulation and subsequent pulmonary toxicity if the hepatopulmonary shunt fraction is high. The estimated lung dose becomes the limiting factor for the dose that can be delivered trans-arterially for radioembolisation of hepatic neoplasms.This is achieved by a pretreatment 99m Tc MAA study. Aim: The accuracy of 99m Tc-MAA Scintigraphy to predict the hepatopulmonary shunt fraction of 90 Y Theraspheres was evaluated by comparing it with that obtained by post therapeutic Bremsstrahlung imaging. Materials and Methods: Patients: 13 patients who underwent 90 Y Theraspheres radioembolisation of hepatic malignancies (both primary and secondary) underwent pre therapeutic 99m Tc- MAA Scintigraphy and post therapeutic 90 Y Bremsstrahlung Scintigraphy. 10-12 mCi of freshly prepared 99m Tc MAA was administered by selective hepatic artery cauterization. Planar and tomographic images were acquired within 1hr of radiopharmaceutical administration. IMAGE ACQUISITION 99m Tc MAA static images were acquired in 256 x 256 matrix (1000 KCnts) and SPECT were a 128 x 128 matrix with 64 frames (20 s/frame). The scan parameters for CT were 140 kV, 2.5 mAs, and 1-cm slices. SPECT images were corrected for attenuation and scatter. Post therapeutic 90 Y Bremsstrahlung imaging was done with HEGP collimator with photo peak centered at 140 KeV - 64.29% and +56% window width. SPECT/CT images were obtained using a dual-detector gamma-camera with a mounted 1-row CT scanner (Infinia Hawkeye; GE medical systems) to evaluate hepatic and extra hepatic tracer

  12. Combining Mean and Standard Deviation of Hounsfield Unit Measurements from Preoperative CT Allows More Accurate Prediction of Urinary Stone Composition Than Mean Hounsfield Units Alone.

    Science.gov (United States)

    Tailly, Thomas; Larish, Yaniv; Nadeau, Brandon; Violette, Philippe; Glickman, Leonard; Olvera-Posada, Daniel; Alenezi, Husain; Amann, Justin; Denstedt, John; Razvi, Hassan

    2016-04-01

    The mineral composition of a urinary stone may influence its surgical and medical treatment. Previous attempts at identifying stone composition based on mean Hounsfield Units (HUm) have had varied success. We aimed to evaluate the additional use of standard deviation of HU (HUsd) to more accurately predict stone composition. We identified patients from two centers who had undergone urinary stone treatment between 2006 and 2013 and had mineral stone analysis and a computed tomography (CT) available. HUm and HUsd of the stones were compared with ANOVA. Receiver operative characteristic analysis with area under the curve (AUC), Youden index, and likelihood ratio calculations were performed. Data were available for 466 patients. The major components were calcium oxalate monohydrate (COM), uric acid, hydroxyapatite, struvite, brushite, cystine, and CO dihydrate (COD) in 41.4%, 19.3%, 12.4%, 7.5%, 5.8%, 5.4%, and 4.7% of patients, respectively. The HUm of UA and Br was significantly lower and higher than the HUm of any other stone type, respectively. HUm and HUsd were most accurate in predicting uric acid with an AUC of 0.969 and 0.851, respectively. The combined use of HUm and HUsd resulted in increased positive predictive value and higher likelihood ratios for identifying a stone's mineral composition for all stone types but COM. To the best of our knowledge, this is the first report of CT data aiding in the prediction of brushite stone composition. Both HUm and HUsd can help predict stone composition and their combined use results in higher likelihood ratios influencing probability.

  13. Integrating metabolic performance, thermal tolerance, and plasticity enables for more accurate predictions on species vulnerability to acute and chronic effects of global warming.

    Science.gov (United States)

    Magozzi, Sarah; Calosi, Piero

    2015-01-01

    Predicting species vulnerability to global warming requires a comprehensive, mechanistic understanding of sublethal and lethal thermal tolerances. To date, however, most studies investigating species physiological responses to increasing temperature have focused on the underlying physiological traits of either acute or chronic tolerance in isolation. Here we propose an integrative, synthetic approach including the investigation of multiple physiological traits (metabolic performance and thermal tolerance), and their plasticity, to provide more accurate and balanced predictions on species and assemblage vulnerability to both acute and chronic effects of global warming. We applied this approach to more accurately elucidate relative species vulnerability to warming within an assemblage of six caridean prawns occurring in the same geographic, hence macroclimatic, region, but living in different thermal habitats. Prawns were exposed to four incubation temperatures (10, 15, 20 and 25 °C) for 7 days, their metabolic rates and upper thermal limits were measured, and plasticity was calculated according to the concept of Reaction Norms, as well as Q10 for metabolism. Compared to species occupying narrower/more stable thermal niches, species inhabiting broader/more variable thermal environments (including the invasive Palaemon macrodactylus) are likely to be less vulnerable to extreme acute thermal events as a result of their higher upper thermal limits. Nevertheless, they may be at greater risk from chronic exposure to warming due to the greater metabolic costs they incur. Indeed, a trade-off between acute and chronic tolerance was apparent in the assemblage investigated. However, the invasive species P. macrodactylus represents an exception to this pattern, showing elevated thermal limits and plasticity of these limits, as well as a high metabolic control. In general, integrating multiple proxies for species physiological acute and chronic responses to increasing

  14. Accurate Predictions of Mean Geomagnetic Dipole Excursion and Reversal Frequencies, Mean Paleomagnetic Field Intensity, and the Radius of Earth's Core Using McLeod's Rule

    Science.gov (United States)

    Voorhies, Coerte V.; Conrad, Joy

    1996-01-01

    The geomagnetic spatial power spectrum R(sub n)(r) is the mean square magnetic induction represented by degree n spherical harmonic coefficients of the internal scalar potential averaged over the geocentric sphere of radius r. McLeod's Rule for the magnetic field generated by Earth's core geodynamo says that the expected core surface power spectrum (R(sub nc)(c)) is inversely proportional to (2n + 1) for 1 less than n less than or equal to N(sub E). McLeod's Rule is verified by locating Earth's core with main field models of Magsat data; the estimated core radius of 3485 kn is close to the seismologic value for c of 3480 km. McLeod's Rule and similar forms are then calibrated with the model values of R(sub n) for 3 less than or = n less than or = 12. Extrapolation to the degree 1 dipole predicts the expectation value of Earth's dipole moment to be about 5.89 x 10(exp 22) Am(exp 2)rms (74.5% of the 1980 value) and the expected geomagnetic intensity to be about 35.6 (mu)T rms at Earth's surface. Archeo- and paleomagnetic field intensity data show these and related predictions to be reasonably accurate. The probability distribution chi(exp 2) with 2n+1 degrees of freedom is assigned to (2n + 1)R(sub nc)/(R(sub nc). Extending this to the dipole implies that an exceptionally weak absolute dipole moment (less than or = 20% of the 1980 value) will exist during 2.5% of geologic time. The mean duration for such major geomagnetic dipole power excursions, one quarter of which feature durable axial dipole reversal, is estimated from the modern dipole power time-scale and the statistical model of excursions. The resulting mean excursion duration of 2767 years forces us to predict an average of 9.04 excursions per million years, 2.26 axial dipole reversals per million years, and a mean reversal duration of 5533 years. Paleomagnetic data show these predictions to be quite accurate. McLeod's Rule led to accurate predictions of Earth's core radius, mean paleomagnetic field

  15. Prediction of collision cross section and retention time for broad scope screening in gradient reversed-phase liquid chromatography-ion mobility-high resolution accurate mass spectrometry.

    Science.gov (United States)

    Mollerup, Christian Brinch; Mardal, Marie; Dalsgaard, Petur Weihe; Linnet, Kristian; Barron, Leon Patrick

    2018-03-23

    Exact mass, retention time (RT), and collision cross section (CCS) are used as identification parameters in liquid chromatography coupled to ion mobility high resolution accurate mass spectrometry (LC-IM-HRMS). Targeted screening analyses are now more flexible and can be expanded for suspect and non-targeted screening. These allow for tentative identification of new compounds, and in-silico predicted reference values are used for improving confidence and filtering false-positive identifications. In this work, predictions of both RT and CCS values are performed with machine learning using artificial neural networks (ANNs). Prediction was based on molecular descriptors, 827 RTs, and 357 CCS values from pharmaceuticals, drugs of abuse, and their metabolites. ANN models for the prediction of RT or CCS separately were examined, and the potential to predict both from a single model was investigated for the first time. The optimized combined RT-CCS model was a four-layered multi-layer perceptron ANN, and the 95th prediction error percentiles were within 2 min RT error and 5% relative CCS error for the external validation set (n = 36) and the full RT-CCS dataset (n = 357). 88.6% (n = 733) of predicted RTs were within 2 min error for the full dataset. Overall, when using 2 min RT error and 5% relative CCS error, 91.9% (n = 328) of compounds were retained, while 99.4% (n = 355) were retained when using at least one of these thresholds. This combined prediction approach can therefore be useful for rapid suspect/non-targeted screening involving HRMS, and will support current workflows. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Reliable and accurate point-based prediction of cumulative infiltration using soil readily available characteristics: A comparison between GMDH, ANN, and MLR

    Science.gov (United States)

    Rahmati, Mehdi

    2017-08-01

    Developing accurate and reliable pedo-transfer functions (PTFs) to predict soil non-readily available characteristics is one of the most concerned topic in soil science and selecting more appropriate predictors is a crucial factor in PTFs' development. Group method of data handling (GMDH), which finds an approximate relationship between a set of input and output variables, not only provide an explicit procedure to select the most essential PTF input variables, but also results in more accurate and reliable estimates than other mostly applied methodologies. Therefore, the current research was aimed to apply GMDH in comparison with multivariate linear regression (MLR) and artificial neural network (ANN) to develop several PTFs to predict soil cumulative infiltration point-basely at specific time intervals (0.5-45 min) using soil readily available characteristics (RACs). In this regard, soil infiltration curves as well as several soil RACs including soil primary particles (clay (CC), silt (Si), and sand (Sa)), saturated hydraulic conductivity (Ks), bulk (Db) and particle (Dp) densities, organic carbon (OC), wet-aggregate stability (WAS), electrical conductivity (EC), and soil antecedent (θi) and field saturated (θfs) water contents were measured at 134 different points in Lighvan watershed, northwest of Iran. Then, applying GMDH, MLR, and ANN methodologies, several PTFs have been developed to predict cumulative infiltrations using two sets of selected soil RACs including and excluding Ks. According to the test data, results showed that developed PTFs by GMDH and MLR procedures using all soil RACs including Ks resulted in more accurate (with E values of 0.673-0.963) and reliable (with CV values lower than 11 percent) predictions of cumulative infiltrations at different specific time steps. In contrast, ANN procedure had lower accuracy (with E values of 0.356-0.890) and reliability (with CV values up to 50 percent) compared to GMDH and MLR. The results also revealed

  17. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  18. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  19. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  20. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  1. Predicting College Students' First Year Success: Should Soft Skills Be Taken into Consideration to More Accurately Predict the Academic Achievement of College Freshmen?

    Science.gov (United States)

    Powell, Erica Dion

    2013-01-01

    This study presents a survey developed to measure the skills of entering college freshmen in the areas of responsibility, motivation, study habits, literacy, and stress management, and explores the predictive power of this survey as a measure of academic performance during the first semester of college. The survey was completed by 334 incoming…

  2. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  3. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  4. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  5. Noncontrast computed tomography can predict the outcome of shockwave lithotripsy via accurate stone measurement and abdominal fat distribution determination

    Directory of Open Access Journals (Sweden)

    Jiun-Hung Geng

    2015-01-01

    Full Text Available Urolithiasis is a common disease of the urinary system. Extracorporeal shockwave lithotripsy (SWL has become one of the standard treatments for renal and ureteral stones; however, the success rates range widely and failure of stone disintegration may cause additional outlay, alternative procedures, and even complications. We used the data available from noncontrast abdominal computed tomography (NCCT to evaluate the impact of stone parameters and abdominal fat distribution on calculus-free rates following SWL. We retrospectively reviewed 328 patients who had urinary stones and had undergone SWL from August 2012 to August 2013. All of them received pre-SWL NCCT; 1 month after SWL, radiography was arranged to evaluate the condition of the fragments. These patients were classified into stone-free group and residual stone group. Unenhanced computed tomography variables, including stone attenuation, abdominal fat area, and skin-to-stone distance (SSD were analyzed. In all, 197 (60% were classified as stone-free and 132 (40% as having residual stone. The mean ages were 49.35 ± 13.22 years and 55.32 ± 13.52 years, respectively. On univariate analysis, age, stone size, stone surface area, stone attenuation, SSD, total fat area (TFA, abdominal circumference, serum creatinine, and the severity of hydronephrosis revealed statistical significance between these two groups. From multivariate logistic regression analysis, the independent parameters impacting SWL outcomes were stone size, stone attenuation, TFA, and serum creatinine. [Adjusted odds ratios and (95% confidence intervals: 9.49 (3.72–24.20, 2.25 (1.22–4.14, 2.20 (1.10–4.40, and 2.89 (1.35–6.21 respectively, all p < 0.05]. In the present study, stone size, stone attenuation, TFA and serum creatinine were four independent predictors for stone-free rates after SWL. These findings suggest that pretreatment NCCT may predict the outcomes after SWL. Consequently, we can use these

  6. Noncontrast computed tomography can predict the outcome of shockwave lithotripsy via accurate stone measurement and abdominal fat distribution determination.

    Science.gov (United States)

    Geng, Jiun-Hung; Tu, Hung-Pin; Shih, Paul Ming-Chen; Shen, Jung-Tsung; Jang, Mei-Yu; Wu, Wen-Jen; Li, Ching-Chia; Chou, Yii-Her; Juan, Yung-Shun

    2015-01-01

    Urolithiasis is a common disease of the urinary system. Extracorporeal shockwave lithotripsy (SWL) has become one of the standard treatments for renal and ureteral stones; however, the success rates range widely and failure of stone disintegration may cause additional outlay, alternative procedures, and even complications. We used the data available from noncontrast abdominal computed tomography (NCCT) to evaluate the impact of stone parameters and abdominal fat distribution on calculus-free rates following SWL. We retrospectively reviewed 328 patients who had urinary stones and had undergone SWL from August 2012 to August 2013. All of them received pre-SWL NCCT; 1 month after SWL, radiography was arranged to evaluate the condition of the fragments. These patients were classified into stone-free group and residual stone group. Unenhanced computed tomography variables, including stone attenuation, abdominal fat area, and skin-to-stone distance (SSD) were analyzed. In all, 197 (60%) were classified as stone-free and 132 (40%) as having residual stone. The mean ages were 49.35 ± 13.22 years and 55.32 ± 13.52 years, respectively. On univariate analysis, age, stone size, stone surface area, stone attenuation, SSD, total fat area (TFA), abdominal circumference, serum creatinine, and the severity of hydronephrosis revealed statistical significance between these two groups. From multivariate logistic regression analysis, the independent parameters impacting SWL outcomes were stone size, stone attenuation, TFA, and serum creatinine. [Adjusted odds ratios and (95% confidence intervals): 9.49 (3.72-24.20), 2.25 (1.22-4.14), 2.20 (1.10-4.40), and 2.89 (1.35-6.21) respectively, all p < 0.05]. In the present study, stone size, stone attenuation, TFA and serum creatinine were four independent predictors for stone-free rates after SWL. These findings suggest that pretreatment NCCT may predict the outcomes after SWL. Consequently, we can use these predictors for selecting

  7. In 'big bang' major incidents do triage tools accurately predict clinical priority?: a systematic review of the literature.

    Science.gov (United States)

    Kilner, T M; Brace, S J; Cooke, M W; Stallard, N; Bleetman, A; Perkins, G D

    2011-05-01

    The term "big bang" major incidents is used to describe sudden, usually traumatic,catastrophic events, involving relatively large numbers of injured individuals, where demands on clinical services rapidly outstrip the available resources. Triage tools support the pre-hospital provider to prioritise which patients to treat and/or transport first based upon clinical need. The aim of this review is to identify existing triage tools and to determine the extent to which their reliability and validity have been assessed. A systematic review of the literature was conducted to identify and evaluate published data validating the efficacy of the triage tools. Studies using data from trauma patients that report on the derivation, validation and/or reliability of the specific pre-hospital triage tools were eligible for inclusion.Purely descriptive studies, reviews, exercises or reports (without supporting data) were excluded. The search yielded 1982 papers. After initial scrutiny of title and abstract, 181 papers were deemed potentially applicable and from these 11 were identified as relevant to this review (in first figure). There were two level of evidence one studies, three level of evidence two studies and six level of evidence three studies. The two level of evidence one studies were prospective validations of Clinical Decision Rules (CDR's) in children in South Africa, all the other studies were retrospective CDR derivation, validation or cohort studies. The quality of the papers was rated as good (n=3), fair (n=7), poor (n=1). There is limited evidence for the validity of existing triage tools in big bang major incidents.Where evidence does exist it focuses on sensitivity and specificity in relation to prediction of trauma death or severity of injury based on data from single or small number patient incidents. The Sacco system is unique in combining survivability modelling with the degree by which the system is overwhelmed in the triage decision system. The

  8. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  9. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  10. Perceived Physician-informed Weight Status Predicts Accurate Weight Self-Perception and Weight Self-Regulation in Low-income, African American Women.

    Science.gov (United States)

    Harris, Charlie L; Strayhorn, Gregory; Moore, Sandra; Goldman, Brian; Martin, Michelle Y

    2016-01-01

    Obese African American women under-appraise their body mass index (BMI) classification and report fewer weight loss attempts than women who accurately appraise their weight status. This cross-sectional study examined whether physician-informed weight status could predict weight self-perception and weight self-regulation strategies in obese women. A convenience sample of 118 low-income women completed a survey assessing demographic characteristics, comorbidities, weight self-perception, and weight self-regulation strategies. BMI was calculated during nurse triage. Binary logistic regression models were performed to test hypotheses. The odds of obese accurate appraisers having been informed about their weight status were six times greater than those of under-appraisers. The odds of those using an "approach" self-regulation strategy having been physician-informed were four times greater compared with those using an "avoidance" strategy. Physicians are uniquely positioned to influence accurate weight self-perception and adaptive weight self-regulation strategies in underserved women, reducing their risk for obesity-related morbidity.

  11. An Accurate GPS-IMU/DR Data Fusion Method for Driverless Car Based on a Set of Predictive Models and Grid Constraints.

    Science.gov (United States)

    Wang, Shiyao; Deng, Zhidong; Yin, Gang

    2016-02-24

    A high-performance differential global positioning system (GPS)  receiver with real time kinematics provides absolute localization for driverless cars. However, it is not only susceptible to multipath effect but also unable to effectively fulfill precise error correction in a wide range of driving areas. This paper proposes an accurate GPS-inertial measurement unit (IMU)/dead reckoning (DR) data fusion method based on a set of predictive models and occupancy grid constraints. First, we employ a set of autoregressive and moving average (ARMA) equations that have different structural parameters to build maximum likelihood models of raw navigation. Second, both grid constraints and spatial consensus checks on all predictive results and current measurements are required to have removal of outliers. Navigation data that satisfy stationary stochastic process are further fused to achieve accurate localization results. Third, the standard deviation of multimodal data fusion can be pre-specified by grid size. Finally, we perform a lot of field tests on a diversity of real urban scenarios. The experimental results demonstrate that the method can significantly smooth small jumps in bias and considerably reduce accumulated position errors due to DR. With low computational complexity, the position accuracy of our method surpasses existing state-of-the-arts on the same dataset and the new data fusion method is practically applied in our driverless car.

  12. An Accurate GPS-IMU/DR Data Fusion Method for Driverless Car Based on a Set of Predictive Models and Grid Constraints

    Directory of Open Access Journals (Sweden)

    Shiyao Wang

    2016-02-01

    Full Text Available A high-performance differential global positioning system (GPS  receiver with real time kinematics provides absolute localization for driverless cars. However, it is not only susceptible to multipath effect but also unable to effectively fulfill precise error correction in a wide range of driving areas. This paper proposes an accurate GPS–inertial measurement unit (IMU/dead reckoning (DR data fusion method based on a set of predictive models and occupancy grid constraints. First, we employ a set of autoregressive and moving average (ARMA equations that have different structural parameters to build maximum likelihood models of raw navigation. Second, both grid constraints and spatial consensus checks on all predictive results and current measurements are required to have removal of outliers. Navigation data that satisfy stationary stochastic process are further fused to achieve accurate localization results. Third, the standard deviation of multimodal data fusion can be pre-specified by grid size. Finally, we perform a lot of field tests on a diversity of real urban scenarios. The experimental results demonstrate that the method can significantly smooth small jumps in bias and considerably reduce accumulated position errors due to DR. With low computational complexity, the position accuracy of our method surpasses existing state-of-the-arts on the same dataset and the new data fusion method is practically applied in our driverless car.

  13. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  14. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  15. Enhancement of a Turbulence Sub-Model for More Accurate Predictions of Vertical Stratifications in 3D Coastal and Estuarine Modeling

    Directory of Open Access Journals (Sweden)

    Wenrui Huang

    2010-03-01

    Full Text Available This paper presents an improvement of the Mellor and Yamada's 2nd order turbulence model in the Princeton Ocean Model (POM for better predictions of vertical stratifications of salinity in estuaries. The model was evaluated in the strongly stratified estuary, Apalachicola River, Florida, USA. The three-dimensional hydrodynamic model was applied to study the stratified flow and salinity intrusion in the estuary in response to tide, wind, and buoyancy forces. Model tests indicate that model predictions over estimate the stratification when using the default turbulent parameters. Analytic studies of density-induced and wind-induced flows indicate that accurate estimation of vertical eddy viscosity plays an important role in describing vertical profiles. Initial model revision experiments show that the traditional approach of modifying empirical constants in the turbulence model leads to numerical instability. In order to improve the performance of the turbulence model while maintaining numerical stability, a stratification factor was introduced to allow adjustment of the vertical turbulent eddy viscosity and diffusivity. Sensitivity studies indicate that the stratification factor, ranging from 1.0 to 1.2, does not cause numerical instability in Apalachicola River. Model simulations show that increasing the turbulent eddy viscosity by a stratification factor of 1.12 results in an optimal agreement between model predictions and observations in the case study presented in this study. Using the proposed stratification factor provides a useful way for coastal modelers to improve the turbulence model performance in predicting vertical turbulent mixing in stratified estuaries and coastal waters.

  16. Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

    Directory of Open Access Journals (Sweden)

    Sheila M Reynolds

    2010-07-01

    Full Text Available DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the

  17. Learning a weighted sequence model of the nucleosome core and linker yields more accurate predictions in Saccharomyces cerevisiae and Homo sapiens.

    Science.gov (United States)

    Reynolds, Sheila M; Bilmes, Jeff A; Noble, William Stafford

    2010-07-08

    DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

  18. Learning a Weighted Sequence Model of the Nucleosome Core and Linker Yields More Accurate Predictions in Saccharomyces cerevisiae and Homo sapiens

    Science.gov (United States)

    Reynolds, Sheila M.; Bilmes, Jeff A.; Noble, William Stafford

    2010-01-01

    DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence—301 base pairs, centered at the position to be scored—with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the

  19. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  20. Metabolite signal identification in accurate mass metabolomics data with MZedDB, an interactive m/z annotation tool utilising predicted ionisation behaviour 'rules'

    Directory of Open Access Journals (Sweden)

    Snowdon Stuart

    2009-07-01

    Full Text Available Abstract Background Metabolomics experiments using Mass Spectrometry (MS technology measure the mass to charge ratio (m/z and intensity of ionised molecules in crude extracts of complex biological samples to generate high dimensional metabolite 'fingerprint' or metabolite 'profile' data. High resolution MS instruments perform routinely with a mass accuracy of Results Metabolite 'structures' harvested from publicly accessible databases were converted into a common format to generate a comprehensive archive in MZedDB. 'Rules' were derived from chemical information that allowed MZedDB to generate a list of adducts and neutral loss fragments putatively able to form for each structure and calculate, on the fly, the exact molecular weight of every potential ionisation product to provide targets for annotation searches based on accurate mass. We demonstrate that data matrices representing populations of ionisation products generated from different biological matrices contain a large proportion (sometimes > 50% of molecular isotopes, salt adducts and neutral loss fragments. Correlation analysis of ESI-MS data features confirmed the predicted relationships of m/z signals. An integrated isotope enumerator in MZedDB allowed verification of exact isotopic pattern distributions to corroborate experimental data. Conclusion We conclude that although ultra-high accurate mass instruments provide major insight into the chemical diversity of biological extracts, the facile annotation of a large proportion of signals is not possible by simple, automated query of current databases using computed molecular formulae. Parameterising MZedDB to take into account predicted ionisation behaviour and the biological source of any sample improves greatly both the frequency and accuracy of potential annotation 'hits' in ESI-MS data.

  1. PredictSNP2: A Unified Platform for Accurately Evaluating SNP Effects by Exploiting the Different Characteristics of Variants in Distinct Genomic Regions.

    Science.gov (United States)

    Bendl, Jaroslav; Musil, Miloš; Štourač, Jan; Zendulka, Jaroslav; Damborský, Jiří; Brezovský, Jan

    2016-05-01

    An important message taken from human genome sequencing projects is that the human population exhibits approximately 99.9% genetic similarity. Variations in the remaining parts of the genome determine our identity, trace our history and reveal our heritage. The precise delineation of phenotypically causal variants plays a key role in providing accurate personalized diagnosis, prognosis, and treatment of inherited diseases. Several computational methods for achieving such delineation have been reported recently. However, their ability to pinpoint potentially deleterious variants is limited by the fact that their mechanisms of prediction do not account for the existence of different categories of variants. Consequently, their output is biased towards the variant categories that are most strongly represented in the variant databases. Moreover, most such methods provide numeric scores but not binary predictions of the deleteriousness of variants or confidence scores that would be more easily understood by users. We have constructed three datasets covering different types of disease-related variants, which were divided across five categories: (i) regulatory, (ii) splicing, (iii) missense, (iv) synonymous, and (v) nonsense variants. These datasets were used to develop category-optimal decision thresholds and to evaluate six tools for variant prioritization: CADD, DANN, FATHMM, FitCons, FunSeq2 and GWAVA. This evaluation revealed some important advantages of the category-based approach. The results obtained with the five best-performing tools were then combined into a consensus score. Additional comparative analyses showed that in the case of missense variations, protein-based predictors perform better than DNA sequence-based predictors. A user-friendly web interface was developed that provides easy access to the five tools' predictions, and their consensus scores, in a user-understandable format tailored to the specific features of different categories of variations. To

  2. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  3. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  4. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  5. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  6. Discovery of a general method of solving the Schrödinger and dirac equations that opens a way to accurately predictive quantum chemistry.

    Science.gov (United States)

    Nakatsuji, Hiroshi

    2012-09-18

    Just as Newtonian law governs classical physics, the Schrödinger equation (SE) and the relativistic Dirac equation (DE) rule the world of chemistry. So, if we can solve these equations accurately, we can use computation to predict chemistry precisely. However, for approximately 80 years after the discovery of these equations, chemists believed that they could not solve SE and DE for atoms and molecules that included many electrons. This Account reviews ideas developed over the past decade to further the goal of predictive quantum chemistry. Between 2000 and 2005, I discovered a general method of solving the SE and DE accurately. As a first inspiration, I formulated the structure of the exact wave function of the SE in a compact mathematical form. The explicit inclusion of the exact wave function's structure within the variational space allows for the calculation of the exact wave function as a solution of the variational method. Although this process sounds almost impossible, it is indeed possible, and I have published several formulations and applied them to solve the full configuration interaction (CI) with a very small number of variables. However, when I examined analytical solutions for atoms and molecules, the Hamiltonian integrals in their secular equations diverged. This singularity problem occurred in all atoms and molecules because it originates from the singularity of the Coulomb potential in their Hamiltonians. To overcome this problem, I first introduced the inverse SE and then the scaled SE. The latter simpler idea led to immediate and surprisingly accurate solution for the SEs of the hydrogen atom, helium atom, and hydrogen molecule. The free complement (FC) method, also called the free iterative CI (free ICI) method, was efficient for solving the SEs. In the FC method, the basis functions that span the exact wave function are produced by the Hamiltonian of the system and the zeroth-order wave function. These basis functions are called complement

  7. Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions.

    Science.gov (United States)

    Zuñiga, Cristal; Li, Chien-Ting; Huelsman, Tyler; Levering, Jennifer; Zielinski, Daniel C; McConnell, Brian O; Long, Christopher P; Knoshaug, Eric P; Guarnieri, Michael T; Antoniewicz, Maciek R; Betenbaugh, Michael J; Zengler, Karsten

    2016-09-01

    The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. © 2016 American Society of Plant Biologists. All rights reserved.

  8. Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions1

    Science.gov (United States)

    Zuñiga, Cristal; Li, Chien-Ting; Zielinski, Daniel C.; Guarnieri, Michael T.; Antoniewicz, Maciek R.; Zengler, Karsten

    2016-01-01

    The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. PMID:27372244

  9. Albumin-Bilirubin and Platelet-Albumin-Bilirubin Grades Accurately Predict Overall Survival in High-Risk Patients Undergoing Conventional Transarterial Chemoembolization for Hepatocellular Carcinoma.

    Science.gov (United States)

    Hansmann, Jan; Evers, Maximilian J; Bui, James T; Lokken, R Peter; Lipnik, Andrew J; Gaba, Ron C; Ray, Charles E

    2017-09-01

    To evaluate albumin-bilirubin (ALBI) and platelet-albumin-bilirubin (PALBI) grades in predicting overall survival in high-risk patients undergoing conventional transarterial chemoembolization for hepatocellular carcinoma (HCC). This single-center retrospective study included 180 high-risk patients (142 men, 59 y ± 9) between April 2007 and January 2015. Patients were considered high-risk based on laboratory abnormalities before the procedure (bilirubin > 2.0 mg/dL, albumin 1.2 mg/dL); presence of ascites, encephalopathy, portal vein thrombus, or transjugular intrahepatic portosystemic shunt; or Model for End-Stage Liver Disease score > 15. Serum albumin, bilirubin, and platelet values were used to determine ALBI and PALBI grades. Overall survival was stratified by ALBI and PALBI grades with substratification by Child-Pugh class (CPC) and Barcelona Liver Clinic Cancer (BCLC) stage using Kaplan-Meier analysis. C-index was used to determine discriminatory ability and survival prediction accuracy. Median survival for 79 ALBI grade 2 patients and 101 ALBI grade 3 patients was 20.3 and 10.7 months, respectively (P  .05). ALBI and PALBI grades are accurate survival metrics in high-risk patients undergoing conventional transarterial chemoembolization for HCC. Use of these scores allows for more refined survival stratification within CPC and BCLC stage. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  10. Improved predictive modeling of white LEDs with accurate luminescence simulation and practical inputs with TracePro opto-mechanical design software

    Science.gov (United States)

    Tsao, Chao-hsi; Freniere, Edward R.; Smith, Linda

    2009-02-01

    The use of white LEDs for solid-state lighting to address applications in the automotive, architectural and general illumination markets is just emerging. LEDs promise greater energy efficiency and lower maintenance costs. However, there is a significant amount of design and cost optimization to be done while companies continue to improve semiconductor manufacturing processes and begin to apply more efficient and better color rendering luminescent materials such as phosphor and quantum dot nanomaterials. In the last decade, accurate and predictive opto-mechanical software modeling has enabled adherence to performance, consistency, cost, and aesthetic criteria without the cost and time associated with iterative hardware prototyping. More sophisticated models that include simulation of optical phenomenon, such as luminescence, promise to yield designs that are more predictive - giving design engineers and materials scientists more control over the design process to quickly reach optimum performance, manufacturability, and cost criteria. A design case study is presented where first, a phosphor formulation and excitation source are optimized for a white light. The phosphor formulation, the excitation source and other LED components are optically and mechanically modeled and ray traced. Finally, its performance is analyzed. A blue LED source is characterized by its relative spectral power distribution and angular intensity distribution. YAG:Ce phosphor is characterized by relative absorption, excitation and emission spectra, quantum efficiency and bulk absorption coefficient. Bulk scatter properties are characterized by wavelength dependent scatter coefficients, anisotropy and bulk absorption coefficient.

  11. Accurate electrostatic and van der Waals pull-in prediction for fully clamped nano/micro-beams using linear universal graphs of pull-in instability

    Science.gov (United States)

    Tahani, Masoud; Askari, Amir R.

    2014-09-01

    In spite of the fact that pull-in instability of electrically actuated nano/micro-beams has been investigated by many researchers to date, no explicit formula has been presented yet which can predict pull-in voltage based on a geometrically non-linear and distributed parameter model. The objective of present paper is to introduce a simple and accurate formula to predict this value for a fully clamped electrostatically actuated nano/micro-beam. To this end, a non-linear Euler-Bernoulli beam model is employed, which accounts for the axial residual stress, geometric non-linearity of mid-plane stretching, distributed electrostatic force and the van der Waals (vdW) attraction. The non-linear boundary value governing equation of equilibrium is non-dimensionalized and solved iteratively through single-term Galerkin based reduced order model (ROM). The solutions are validated thorough direct comparison with experimental and other existing results reported in previous studies. Pull-in instability under electrical and vdW loads are also investigated using universal graphs. Based on the results of these graphs, non-dimensional pull-in and vdW parameters, which are defined in the text, vary linearly versus the other dimensionless parameters of the problem. Using this fact, some linear equations are presented to predict pull-in voltage, the maximum allowable length, the so-called detachment length, and the minimum allowable gap for a nano/micro-system. These linear equations are also reduced to a couple of universal pull-in formulas for systems with small initial gap. The accuracy of the universal pull-in formulas are also validated by comparing its results with available experimental and some previous geometric linear and closed-form findings published in the literature.

  12. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  13. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    Science.gov (United States)

    Tadmor, Arbel

    2009-03-01

    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  14. A simple, fast, and accurate thermodynamic-based approach for transfer and prediction of gas chromatography retention times between columns and instruments Part III: Retention time prediction on target column.

    Science.gov (United States)

    Hou, Siyuan; Stevenson, Keisean A J M; Harynuk, James J

    2018-03-27

    This is the third part of a three-part series of papers. In Part I, we presented a method for determining the actual effective geometry of a reference column as well as the thermodynamic-based parameters of a set of probe compounds in an in-house mixture. Part II introduced an approach for estimating the actual effective geometry of a target column by collecting retention data of the same mixture of probe compounds on the target column and using their thermodynamic parameters, acquired on the reference column, as a bridge between both systems. Part III, presented here, demonstrates the retention time transfer and prediction from the reference column to the target column using experimental data for a separate mixture of compounds. To predict the retention time of a new compound, we first estimate its thermodynamic-based parameters on the reference column (using geometric parameters determined previously). The compound's retention time on a second column (of previously determined geometry) is then predicted. The models and the associated optimization algorithms were tested using simulated and experimental data. The accuracy of predicted retention times shows that the proposed approach is simple, fast, and accurate for retention time transfer and prediction between gas chromatography columns. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  16. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  17. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  18. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  19. Cosmological constraints from the CFHTLenS shear measurements using a new, accurate, and flexible way of predicting non-linear mass clustering

    Science.gov (United States)

    Angulo, Raul E.; Hilbert, Stefan

    2015-03-01

    We explore the cosmological constraints from cosmic shear using a new way of modelling the non-linear matter correlation functions. The new formalism extends the method of Angulo & White, which manipulates outputs of N-body simulations to represent the 3D non-linear mass distribution in different cosmological scenarios. We show that predictions from our approach for shear two-point correlations at 1-300 arcmin separations are accurate at the ˜10 per cent level, even for extreme changes in cosmology. For moderate changes, with target cosmologies similar to that preferred by analyses of recent Planck data, the accuracy is close to ˜5 per cent. We combine this approach with a Monte Carlo Markov chain sampler to explore constraints on a Λ cold dark matter model from the shear correlation functions measured in the Canada-France-Hawaii Telescope Lensing Survey (CFHTLenS). We obtain constraints on the parameter combination σ8(Ωm/0.27)0.6 = 0.801 ± 0.028. Combined with results from cosmic microwave background data, we obtain marginalized constraints on σ8 = 0.81 ± 0.01 and Ωm = 0.29 ± 0.01. These results are statistically compatible with previous analyses, which supports the validity of our approach. We discuss the advantages of our method and the potential it offers, including a path to model in detail (i) the effects of baryons, (ii) high-order shear correlation functions, and (iii) galaxy-galaxy lensing, among others, in future high-precision cosmological analyses.

  20. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  1. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  2. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  3. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  4. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  5. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  6. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Science.gov (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  7. To help, or not to help, that is not the only question: An investigation of the interplay of different factors to predict helping behavior in an accurate and effective way.

    OpenAIRE

    Urschler, David F.

    2016-01-01

    Previous research has shown that people’s willingness to help those in need is influenced by a multitude of factors (e.g., perceived dangerousness of a situation, cost-benefit analysis, attributions of responsibility, kinship, status, and culture). However, past research has often focused on single factors to predict helping intentions. Therefore, the present thesis examines the interplay of different factors in order to predict helping intentions in the most accurate and effective way. Th...

  8. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  9. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

    Science.gov (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

    2016-10-01

    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  10. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  11. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  14. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  15. Rapid identification of sequences for orphan enzymes to power accurate protein annotation.

    Directory of Open Access Journals (Sweden)

    Kevin R Ramkissoon

    Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.

  16. Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation

    Science.gov (United States)

    Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.

    2013-01-01

    The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392

  17. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Johanna Rintahaka

    Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

  18. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Science.gov (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  19. NetMHC-3.0: accurate web accessible predictions of human, mouse and monkey MHC class I affinities for peptides of length 8-11.

    Science.gov (United States)

    Lundegaard, Claus; Lamberth, Kasper; Harndahl, Mikkel; Buus, Søren; Lund, Ole; Nielsen, Morten

    2008-07-01

    NetMHC-3.0 is trained on a large number of quantitative peptide data using both affinity data from the Immune Epitope Database and Analysis Resource (IEDB) and elution data from SYFPEITHI. The method generates high-accuracy predictions of major histocompatibility complex (MHC): peptide binding. The predictions are based on artificial neural networks trained on data from 55 MHC alleles (43 Human and 12 non-human), and position-specific scoring matrices (PSSMs) for additional 67 HLA alleles. As only the MHC class I prediction server is available, predictions are possible for peptides of length 8-11 for all 122 alleles. artificial neural network predictions are given as actual IC(50) values whereas PSSM predictions are given as a log-odds likelihood scores. The output is optionally available as download for easy post-processing. The training method underlying the server is the best available, and has been used to predict possible MHC-binding peptides in a series of pathogen viral proteomes including SARS, Influenza and HIV, resulting in an average of 75-80% confirmed MHC binders. Here, the performance is further validated and benchmarked using a large set of newly published affinity data, non-redundant to the training set. The server is free of use and available at: http://www.cbs.dtu.dk/services/NetMHC.

  20. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  1. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  2. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  3. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  4. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  5. Accurate prediction of subcellular location of apoptosis proteins combining Chou’s PseAAC and PsePSSM based on wavelet denoising

    Science.gov (United States)

    Chen, Cheng; Chen, Rui-Xin; Wang, Lei; Wang, Ming-Hui; Zhang, Yan

    2017-01-01

    Apoptosis proteins subcellular localization information are very important for understanding the mechanism of programmed cell death and the development of drugs. The prediction of subcellular localization of an apoptosis protein is still a challenging task because the prediction of apoptosis proteins subcellular localization can help to understand their function and the role of metabolic processes. In this paper, we propose a novel method for protein subcellular localization prediction. Firstly, the features of the protein sequence are extracted by combining Chou's pseudo amino acid composition (PseAAC) and pseudo-position specific scoring matrix (PsePSSM), then the feature information of the extracted is denoised by two-dimensional (2-D) wavelet denoising. Finally, the optimal feature vectors are input to the SVM classifier to predict subcellular location of apoptosis proteins. Quite promising predictions are obtained using the jackknife test on three widely used datasets and compared with other state-of-the-art methods. The results indicate that the method proposed in this paper can remarkably improve the prediction accuracy of apoptosis protein subcellular localization, which will be a supplementary tool for future proteomics research. PMID:29296195

  6. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  7. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  8. The accurate definition of metabolic volumes on 18F-FDG-PET before treatment allows the response to chemoradiotherapy to be predicted in the case of oesophagus cancers

    International Nuclear Information System (INIS)

    Hatt, M.; Cheze-Le Rest, C.; Visvikis, D.; Pradier, O.

    2011-01-01

    This study aims at assessing the possibility of prediction of the response of locally advanced oesophagus cancers, even before the beginning of treatment, by using metabolic volume measurements performed on 18 F-FDG PET images made before the treatment. Medical files of 50 patients have been analyzed. According to the observed responses, and to metabolic volume and Total Lesion Glycosis (TLG) values, it appears that the images allow the extraction of parameters, such as the TLG, which are criteria for the prediction of the therapeutic response. Short communication

  9. Human glycemic response curves after intake of carbohydrate foods are accurately predicted by combining in vitro gastrointestinal digestion with in silico kinetic modeling

    Directory of Open Access Journals (Sweden)

    Susann Bellmann

    2018-02-01

    Conclusion: Based on the demonstrated accuracy and predictive quality, this in vitro–in silico technology can be used for the testing of food products on their glycemic response under standardized conditions and may stimulate the production of (slow carbs for the prevention of metabolic diseases.

  10. NetMHC-3.0: accurate web accessible predictions of human, mouse and monkey MHC class I affinities for peptides of length 8-11

    DEFF Research Database (Denmark)

    Lundegaard, Claus; Lamberth, K; Harndahl, M

    2008-01-01

    NetMHC-3.0 is trained on a large number of quantitative peptide data using both affinity data from the Immune Epitope Database and Analysis Resource (IEDB) and elution data from SYFPEITHI. The method generates high-accuracy predictions of major histocompatibility complex (MHC): peptide binding...

  11. Fecal Calprotectin is an Accurate Tool and Correlated to Seo Index in Prediction of Relapse in Iranian Patients With Ulcerative Colitis.

    Science.gov (United States)

    Hosseini, Seyed Vahid; Jafari, Peyman; Taghavi, Seyed Alireza; Safarpour, Ali Reza; Rezaianzadeh, Abbas; Moini, Maryam; Mehrabi, Manoosh

    2015-02-01

    The natural clinical course of Ulcerative Colitis (UC) is characterized by episodes of relapse and remission. Fecal Calprotectin (FC) is a relatively new marker of intestinal inflammation and is an available, non-expensive tool for predicting relapse of quiescent UC. The Seo colitis activity index is a clinical index for assessment of the severity of UC. The present study aimed to evaluate the accuracy of FC and the Seo colitis activity index and their correlation in prediction of UC exacerbation. In this prospective cohort study, 157 patients with clinical and endoscopic diagnosis of UC selected randomly from 1273 registered patients in Fars province's IBD registry center in Shiraz, Iran, were followed from October 2012 to October 2013 for 12 months or shorter, if they had a relapse. Two patients left the study before completion and one patient had relapse because of discontinuation of drugs. The participants' clinical and serum factors were evaluated every three months. Furthermore, stool samples were collected at the beginning of study and every three months and FC concentration (commercially available enzyme linked immunoassay) and the Seo Index were assessed. Then univariate analysis, multiple variable logistic regression, Receiver Operating Characteristics (ROC) curve analysis, and Pearson's correlation test (r) were used for statistical analysis of data. According to the results, 74 patients (48.1%) relapsed during the follow-up (33 men and 41 women). Mean ± SD of FC was 862.82 ± 655.97 μg/g and 163.19 ± 215.85 μg/g in relapsing and non-relapsing patients, respectively (P Seo index were significant predictors of relapse. ROC curve analysis of FC level and Seo activity index for prediction of relapse demonstrated area under the curve of 0.882 (P Seo index was significant in prediction of relapse (r = 0.63, P Seo activity index in prediction of relapse in the course of quiescent UC in Iranian patients.

  12. Efficient and accurate two-scale FE-FFT-based prediction of the effective material behavior of elasto-viscoplastic polycrystals

    Science.gov (United States)

    Kochmann, Julian; Wulfinghoff, Stephan; Ehle, Lisa; Mayer, Joachim; Svendsen, Bob; Reese, Stefanie

    2017-09-01

    Recently, two-scale FE-FFT-based methods (e.g., Spahn et al. in Comput Methods Appl Mech Eng 268:871-883, 2014; Kochmann et al. in Comput Methods Appl Mech Eng 305:89-110, 2016) have been proposed to predict the microscopic and overall mechanical behavior of heterogeneous materials. The purpose of this work is the extension to elasto-viscoplastic polycrystals, efficient and robust Fourier solvers and the prediction of micromechanical fields during macroscopic deformation processes. Assuming scale separation, the macroscopic problem is solved using the finite element method. The solution of the microscopic problem, which is embedded as a periodic unit cell (UC) in each macroscopic integration point, is found by employing fast Fourier transforms, fixed-point and Newton-Krylov methods. The overall material behavior is defined by the mean UC response. In order to ensure spatially converged micromechanical fields as well as feasible overall CPU times, an efficient but simple solution strategy for two-scale simulations is proposed. As an example, the constitutive behavior of 42CrMo4 steel is predicted during macroscopic three-point bending tests.

  13. PredPPCrys: accurate prediction of sequence cloning, protein production, purification and crystallization propensity from protein sequences using multi-step heterogeneous feature fusion and selection.

    Directory of Open Access Journals (Sweden)

    Huilin Wang

    Full Text Available X-ray crystallography is the primary approach to solve the three-dimensional structure of a protein. However, a major bottleneck of this method is the failure of multi-step experimental procedures to yield diffraction-quality crystals, including sequence cloning, protein material production, purification, crystallization and ultimately, structural determination. Accordingly, prediction of the propensity of a protein to successfully undergo these experimental procedures based on the protein sequence may help narrow down laborious experimental efforts and facilitate target selection. A number of bioinformatics methods based on protein sequence information have been developed for this purpose. However, our knowledge on the important determinants of propensity for a protein sequence to produce high diffraction-quality crystals remains largely incomplete. In practice, most of the existing methods display poorer performance when evaluated on larger and updated datasets. To address this problem, we constructed an up-to-date dataset as the benchmark, and subsequently developed a new approach termed 'PredPPCrys' using the support vector machine (SVM. Using a comprehensive set of multifaceted sequence-derived features in combination with a novel multi-step feature selection strategy, we identified and characterized the relative importance and contribution of each feature type to the prediction performance of five individual experimental steps required for successful crystallization. The resulting optimal candidate features were used as inputs to build the first-level SVM predictor (PredPPCrys I. Next, prediction outputs of PredPPCrys I were used as the input to build second-level SVM classifiers (PredPPCrys II, which led to significantly enhanced prediction performance. Benchmarking experiments indicated that our PredPPCrys method outperforms most existing procedures on both up-to-date and previous datasets. In addition, the predicted crystallization

  14. Normal Tissue Complication Probability Estimation by the Lyman-Kutcher-Burman Method Does Not Accurately Predict Spinal Cord Tolerance to Stereotactic Radiosurgery

    International Nuclear Information System (INIS)

    Daly, Megan E.; Luxton, Gary; Choi, Clara Y.H.; Gibbs, Iris C.; Chang, Steven D.; Adler, John R.; Soltys, Scott G.

    2012-01-01

    Purpose: To determine whether normal tissue complication probability (NTCP) analyses of the human spinal cord by use of the Lyman-Kutcher-Burman (LKB) model, supplemented by linear–quadratic modeling to account for the effect of fractionation, predict the risk of myelopathy from stereotactic radiosurgery (SRS). Methods and Materials: From November 2001 to July 2008, 24 spinal hemangioblastomas in 17 patients were treated with SRS. Of the tumors, 17 received 1 fraction with a median dose of 20 Gy (range, 18–30 Gy) and 7 received 20 to 25 Gy in 2 or 3 sessions, with cord maximum doses of 22.7 Gy (range, 17.8–30.9 Gy) and 22.0 Gy (range, 20.2–26.6 Gy), respectively. By use of conventional values for α/β, volume parameter n, 50% complication probability dose TD 50 , and inverse slope parameter m, a computationally simplified implementation of the LKB model was used to calculate the biologically equivalent uniform dose and NTCP for each treatment. Exploratory calculations were performed with alternate values of α/β and n. Results: In this study 1 case (4%) of myelopathy occurred. The LKB model using radiobiological parameters from Emami and the logistic model with parameters from Schultheiss overestimated complication rates, predicting 13 complications (54%) and 18 complications (75%), respectively. An increase in the volume parameter (n), to assume greater parallel organization, improved the predictive value of the models. Maximum-likelihood LKB fitting of α/β and n yielded better predictions (0.7 complications), with n = 0.023 and α/β = 17.8 Gy. Conclusions: The spinal cord tolerance to the dosimetry of SRS is higher than predicted by the LKB model using any set of accepted parameters. Only a high α/β value in the LKB model and only a large volume effect in the logistic model with Schultheiss data could explain the low number of complications observed. This finding emphasizes that radiobiological models traditionally used to estimate spinal cord NTCP

  15. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  16. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  17. A random forest based risk model for reliable and accurate prediction of receipt of transfusion in patients undergoing percutaneous coronary intervention.

    Directory of Open Access Journals (Sweden)

    Hitinder S Gurm

    Full Text Available BACKGROUND: Transfusion is a common complication of Percutaneous Coronary Intervention (PCI and is associated with adverse short and long term outcomes. There is no risk model for identifying patients most likely to receive transfusion after PCI. The objective of our study was to develop and validate a tool for predicting receipt of blood transfusion in patients undergoing contemporary PCI. METHODS: Random forest models were developed utilizing 45 pre-procedural clinical and laboratory variables to estimate the receipt of transfusion in patients undergoing PCI. The most influential variables were selected for inclusion in an abbreviated model. Model performance estimating transfusion was evaluated in an independent validation dataset using area under the ROC curve (AUC, with net reclassification improvement (NRI used to compare full and reduced model prediction after grouping in low, intermediate, and high risk categories. The impact of procedural anticoagulation on observed versus predicted transfusion rates were assessed for the different risk categories. RESULTS: Our study cohort was comprised of 103,294 PCI procedures performed at 46 hospitals between July 2009 through December 2012 in Michigan of which 72,328 (70% were randomly selected for training the models, and 30,966 (30% for validation. The models demonstrated excellent calibration and discrimination (AUC: full model  = 0.888 (95% CI 0.877-0.899, reduced model AUC = 0.880 (95% CI, 0.868-0.892, p for difference 0.003, NRI = 2.77%, p = 0.007. Procedural anticoagulation and radial access significantly influenced transfusion rates in the intermediate and high risk patients but no clinically relevant impact was noted in low risk patients, who made up 70% of the total cohort. CONCLUSIONS: The risk of transfusion among patients undergoing PCI can be reliably calculated using a novel easy to use computational tool (https://bmc2.org/calculators/transfusion. This risk prediction

  18. Benchmarking of density functionals for a soft but accurate prediction and assignment of (1) H and (13)C NMR chemical shifts in organic and biological molecules.

    Science.gov (United States)

    Benassi, Enrico

    2017-01-15

    A number of programs and tools that simulate 1 H and 13 C nuclear magnetic resonance (NMR) chemical shifts using empirical approaches are available. These tools are user-friendly, but they provide a very rough (and sometimes misleading) estimation of the NMR properties, especially for complex systems. Rigorous and reliable ways to predict and interpret NMR properties of simple and complex systems are available in many popular computational program packages. Nevertheless, experimentalists keep relying on these "unreliable" tools in their daily work because, to have a sufficiently high accuracy, these rigorous quantum mechanical methods need high levels of theory. An alternative, efficient, semi-empirical approach has been proposed by Bally, Rablen, Tantillo, and coworkers. This idea consists of creating linear calibrations models, on the basis of the application of different combinations of functionals and basis sets. Following this approach, the predictive capability of a wider range of popular functionals was systematically investigated and tested. The NMR chemical shifts were computed in solvated phase at density functional theory level, using 30 different functionals coupled with three different triple-ζ basis sets. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Accurate quantum chemical calculations

    Science.gov (United States)

    Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Taylor, Peter R.

    1989-01-01

    An important goal of quantum chemical calculations is to provide an understanding of chemical bonding and molecular electronic structure. A second goal, the prediction of energy differences to chemical accuracy, has been much harder to attain. First, the computational resources required to achieve such accuracy are very large, and second, it is not straightforward to demonstrate that an apparently accurate result, in terms of agreement with experiment, does not result from a cancellation of errors. Recent advances in electronic structure methodology, coupled with the power of vector supercomputers, have made it possible to solve a number of electronic structure problems exactly using the full configuration interaction (FCI) method within a subspace of the complete Hilbert space. These exact results can be used to benchmark approximate techniques that are applicable to a wider range of chemical and physical problems. The methodology of many-electron quantum chemistry is reviewed. Methods are considered in detail for performing FCI calculations. The application of FCI methods to several three-electron problems in molecular physics are discussed. A number of benchmark applications of FCI wave functions are described. Atomic basis sets and the development of improved methods for handling very large basis sets are discussed: these are then applied to a number of chemical and spectroscopic problems; to transition metals; and to problems involving potential energy surfaces. Although the experiences described give considerable grounds for optimism about the general ability to perform accurate calculations, there are several problems that have proved less tractable, at least with current computer resources, and these and possible solutions are discussed.

  20. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  1. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  2. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  3. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  4. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  5. Alcohol levels do not accurately predict physical or mental impairment in ethanol-tolerant subjects: relevance to emergency medicine and dram shop laws.

    Science.gov (United States)

    Roberts, James R; Dollard, Denis

    2010-12-01

    The human body and the central nervous system can develop tremendous tolerance to ethanol. Mental and physical dysfunctions from ethanol, in an alcohol-tolerant individual, do not consistently correlate with ethanol levels traditionally used to define intoxication, or even lethality, in a nontolerant subject. Attempting to relate observed signs of alcohol intoxication or impairment, or to evaluate sobriety, by quantifying blood alcohol levels can be misleading, if not impossible. We report a case demonstrating the disconnect between alcohol levels and generally assigned parameters of intoxication and impairment. In this case, an alcohol-tolerant man, with a serum ethanol level of 515 mg/dl, appeared neurologically intact and cognitively normal. This individual was without objective signs of impairment or intoxication by repeated evaluations by experienced emergency physicians. In alcohol-tolerant individuals, blood alcohol levels cannot always be predicted by and do not necessarily correlate with outward appearance, overt signs of intoxication, or physical examination. This phenomenon must be acknowledged when analyzing medical decision making in the emergency department or when evaluating the ability of bartenders and party hosts to identify intoxication in dram shop cases.

  6. N0/N1, PNL, or LNR? The effect of lymph node number on accurate survival prediction in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Valsangkar, Nakul P; Bush, Devon M; Michaelson, James S; Ferrone, Cristina R; Wargo, Jennifer A; Lillemoe, Keith D; Fernández-del Castillo, Carlos; Warshaw, Andrew L; Thayer, Sarah P

    2013-02-01

    We evaluated the prognostic accuracy of LN variables (N0/N1), numbers of positive lymph nodes (PLN), and lymph node ratio (LNR) in the context of the total number of examined lymph nodes (ELN). Patients from SEER and a single institution (MGH) were reviewed and survival analyses performed in subgroups based on numbers of ELN to calculate excess risk of death (hazard ratio, HR). In SEER and MGH, higher numbers of ELN improved the overall survival for N0 patients. The prognostic significance (N0/N1) and PLN were too variable as the importance of a single PLN depended on the total number of LN dissected. LNR consistently correlated with survival once a certain number of lymph nodes were dissected (≥13 in SEER and ≥17 in the MGH dataset). Better survival for N0 patients with increasing ELN likely represents improved staging. PLN have some predictive value but the ELN strongly influence their impact on survival, suggesting the need for a ratio-based classification. LNR strongly correlates with outcome provided that a certain number of lymph nodes is evaluated, suggesting that the prognostic accuracy of any LN variable depends on the total number of ELN.

  7. Accurate predictions of spectroscopic and molecular properties of 27 Λ-S and 73 Ω states of AsS radical

    Science.gov (United States)

    Shi, Deheng; Song, Ziyue; Niu, Xianghong; Sun, Jinfeng; Zhu, Zunlue

    2016-01-01

    The PECs are calculated for the 27 Λ-S states and their corresponding 73 Ω states of AsS radical. Of these Λ-S states, only the 22Δ and 54Π states are replulsive. The 12Σ+, 22Σ+, 42Π, 34Δ, 34Σ+, and 44Π states possess double wells. The 32Σ+ state possesses three wells. The A2Π, 32Π, 12Φ, 24Π, 34Π, 24Δ, 34Δ, 16Σ+, and 16Π states are inverted with the SO coupling effect included. The 14Σ+, 24Σ+, 24Σ-, 24Δ, 14Φ, 16Σ+, and 16Π states, the second wells of 12Σ+, 34Σ+, 42Π, 44Π, and 34Δ states, and the third well of 32Σ+ state are very weakly-bound states. The PECs are extrapolated to the CBS limit. The effect of SO coupling on the PECs is discussed. The spectroscopic parameters are evaluated, and compared with available measurements and other theoretical ones. The vibrational properties of several weakly-bound states are determined. The spectroscopic properties reported here can be expected to be reliably predicted ones.

  8. Accurate predictions of spectroscopic and molecular properties of 27 Λ-S and 73 Ω states of AsS radical.

    Science.gov (United States)

    Shi, Deheng; Song, Ziyue; Niu, Xianghong; Sun, Jinfeng; Zhu, Zunlue

    2016-01-15

    The PECs are calculated for the 27 Λ-S states and their corresponding 73 Ω states of AsS radical. Of these Λ-S states, only the 2(2)Δ and 5(4)Π states are replulsive. The 1(2)Σ(+), 2(2)Σ(+), 4(2)Π, 3(4)Δ, 3(4)Σ(+), and 4(4)Π states possess double wells. The 3(2)Σ(+) state possesses three wells. The A(2)Π, 3(2)Π, 1(2)Φ, 2(4)Π, 3(4)Π, 2(4)Δ, 3(4)Δ, 1(6)Σ(+), and 1(6)Π states are inverted with the SO coupling effect included. The 1(4)Σ(+), 2(4)Σ(+), 2(4)Σ(-), 2(4)Δ, 1(4)Φ, 1(6)Σ(+), and 1(6)Π states, the second wells of 1(2)Σ(+), 3(4)Σ(+), 4(2)Π, 4(4)Π, and 3(4)Δ states, and the third well of 3(2)Σ(+) state are very weakly-bound states. The PECs are extrapolated to the CBS limit. The effect of SO coupling on the PECs is discussed. The spectroscopic parameters are evaluated, and compared with available measurements and other theoretical ones. The vibrational properties of several weakly-bound states are determined. The spectroscopic properties reported here can be expected to be reliably predicted ones. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The M. D. Anderson Symptom Inventory-Head and Neck Module, a Patient-Reported Outcome Instrument, Accurately Predicts the Severity of Radiation-Induced Mucositis

    International Nuclear Information System (INIS)

    Rosenthal, David I.; Mendoza, Tito R.; Chambers, Mark; Burkett, V. Shannon; Garden, Adam S.; Hessell, Amy C.; Lewin, Jan S.; Ang, K. Kian; Kies, Merrill S.; Gning, Ibrahima; Wang, Xin S.; Cleeland, Charles S.

    2008-01-01

    Purpose: To compare the M. D. Anderson Symptom Inventory-Head and Neck (MDASI-HN) module, a symptom burden instrument, with the Functional Assessment of Cancer Therapy-Head and Neck (FACT-HN) module, a quality-of-life instrument, for the assessment of mucositis in patients with head-and-neck cancer treated with radiotherapy and to identify the most distressing symptoms from the patient's perspective. Methods and Materials: Consecutive patients with head-and-neck cancer (n = 134) completed the MDASI-HN and FACT-HN before radiotherapy (time 1) and after 6 weeks of radiotherapy or chemoradiotherapy (time 2). The mean global and subscale scores for each instrument were compared with the objective mucositis scores determined from the National Cancer Institute Common Terminology Criteria for Adverse Events, version 3.0. Results: The global and subscale scores for each instrument showed highly significant changes from time 1 to time 2 and a significant correlation with the objective mucositis scores at time 2. Only the MDASI scores, however, were significant predictors of objective Common Terminology Criteria for Adverse Events mucositis scores on multivariate regression analysis (standardized regression coefficient, 0.355 for the global score and 0.310 for the head-and-neck cancer-specific score). Most of the moderate and severe symptoms associated with mucositis as identified on the MDASI-HN are not present on the FACT-HN. Conclusion: Both the MDASI-HN and FACT-HN modules can predict the mucositis scores. However, the MDASI-HN, a symptom burden instrument, was more closely associated with the severity of radiation-induced mucositis than the FACT-HN on multivariate regression analysis. This greater association was most likely related to the inclusion of a greater number of face-valid mucositis-related items in the MDASI-HN compared with the FACT-HN

  10. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  11. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  12. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  13. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  14. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Science.gov (United States)

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  15. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  17. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  18. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  19. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  1. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  3. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  4. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  5. Can Selforganizing Maps Accurately Predict Photometric Redshifts?

    Science.gov (United States)

    Way, Michael J.; Klose, Christian

    2012-01-01

    We present an unsupervised machine-learning approach that can be employed for estimating photometric redshifts. The proposed method is based on a vector quantization called the self-organizing-map (SOM) approach. A variety of photometrically derived input values were utilized from the Sloan Digital Sky Survey's main galaxy sample, luminous red galaxy, and quasar samples, along with the PHAT0 data set from the Photo-z Accuracy Testing project. Regression results obtained with this new approach were evaluated in terms of root-mean-square error (RMSE) to estimate the accuracy of the photometric redshift estimates. The results demonstrate competitive RMSE and outlier percentages when compared with several other popular approaches, such as artificial neural networks and Gaussian process regression. SOM RMSE results (using delta(z) = z(sub phot) - z(sub spec)) are 0.023 for the main galaxy sample, 0.027 for the luminous red galaxy sample, 0.418 for quasars, and 0.022 for PHAT0 synthetic data. The results demonstrate that there are nonunique solutions for estimating SOM RMSEs. Further research is needed in order to find more robust estimation techniques using SOMs, but the results herein are a positive indication of their capabilities when compared with other well-known methods

  6. Statistical analysis of accurate prediction of local atmospheric optical attenuation with a new model according to weather together with beam wandering compensation system: a season-wise experimental investigation

    Science.gov (United States)

    Arockia Bazil Raj, A.; Padmavathi, S.

    2016-07-01

    Atmospheric parameters strongly affect the performance of Free Space Optical Communication (FSOC) system when the optical wave is propagating through the inhomogeneous turbulent medium. Developing a model to get an accurate prediction of optical attenuation according to meteorological parameters becomes significant to understand the behaviour of FSOC channel during different seasons. A dedicated free space optical link experimental set-up is developed for the range of 0.5 km at an altitude of 15.25 m. The diurnal profile of received power and corresponding meteorological parameters are continuously measured using the developed optoelectronic assembly and weather station, respectively, and stored in a data logging computer. Measured meteorological parameters (as input factors) and optical attenuation (as response factor) of size [177147 × 4] are used for linear regression analysis and to design the mathematical model that is more suitable to predict the atmospheric optical attenuation at our test field. A model that exhibits the R2 value of 98.76% and average percentage deviation of 1.59% is considered for practical implementation. The prediction accuracy of the proposed model is investigated along with the comparative results obtained from some of the existing models in terms of Root Mean Square Error (RMSE) during different local seasons in one-year period. The average RMSE value of 0.043-dB/km is obtained in the longer range dynamic of meteorological parameters variations.

  7. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  8. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  9. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  10. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

    Science.gov (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

    2015-08-18

    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  12. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  13. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  14. Spectrally accurate contour dynamics

    International Nuclear Information System (INIS)

    Van Buskirk, R.D.; Marcus, P.S.

    1994-01-01

    We present an exponentially accurate boundary integral method for calculation the equilibria and dynamics of piece-wise constant distributions of potential vorticity. The method represents contours of potential vorticity as a spectral sum and solves the Biot-Savart equation for the velocity by spectrally evaluating a desingularized contour integral. We use the technique in both an initial-value code and a newton continuation method. Our methods are tested by comparing the numerical solutions with known analytic results, and it is shown that for the same amount of computational work our spectral methods are more accurate than other contour dynamics methods currently in use

  15. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  16. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  17. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  18. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  19. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  20. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  1. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  2. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  3. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  4. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  5. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  6. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  7. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  8. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  10. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  11. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  12. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  13. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  14. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  15. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  16. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  17. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  18. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  19. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  20. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  1. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  2. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  3. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  4. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  5. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  6. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  7. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  8. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  9. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  10. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

    Science.gov (United States)

    Varmanen, P; Rantanen, T; Palva, A

    1996-12-01

    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  11. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  12. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  13. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  14. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  15. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  16. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  17. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  18. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  19. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  20. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  1. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  2. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Science.gov (United States)

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  4. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  5. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Science.gov (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  6. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  7. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  8. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  9. An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

    Science.gov (United States)

    Branny, P; de la Torre, F; Garel, J R

    1998-04-01

    The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

  10. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  11. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  12. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  13. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  14. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  15. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  16. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  17. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  18. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  19. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  20. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  1. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Science.gov (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  2. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Science.gov (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  3. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  4. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  5. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  7. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  8. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  9. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  11. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  12. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  13. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  14. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  15. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  16. Accurate Evaluation of Quantum Integrals

    Science.gov (United States)

    Galant, D. C.; Goorvitch, D.; Witteborn, Fred C. (Technical Monitor)

    1995-01-01

    Combining an appropriate finite difference method with Richardson's extrapolation results in a simple, highly accurate numerical method for solving a Schrodinger's equation. Important results are that error estimates are provided, and that one can extrapolate expectation values rather than the wavefunctions to obtain highly accurate expectation values. We discuss the eigenvalues, the error growth in repeated Richardson's extrapolation, and show that the expectation values calculated on a crude mesh can be extrapolated to obtain expectation values of high accuracy.

  17. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  18. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  19. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  20. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  1. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Science.gov (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  4. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  5. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  7. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  8. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  9. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Science.gov (United States)

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  10. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Science.gov (United States)

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  11. Systemic inflammatory response syndrome and model for end-stage liver disease score accurately predict the in-hospital mortality of black African patients with decompensated cirrhosis at initial hospitalization: a retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Mahassadi AK

    2018-04-01

    Full Text Available Alassan Kouamé Mahassadi,1 Justine Laure Konang Nguieguia,1 Henriette Ya Kissi,1 Anthony Afum-Adjei Awuah,2 Aboubacar Demba Bangoura,1 Stanislas Adjeka Doffou,1 Alain Koffi Attia1 1Medicine and Hepatogastroenterology Unit, Centre Hospitalier et Universitaire de Yopougon, Abidjan, Côte d’Ivoire; 2Kumasi Centre for Collaborative Research in Tropical Medicine, Kumasi, Ghana Background: Systemic inflammatory response syndrome (SIRS and model for end-stage liver disease (MELD predict short-term mortality in patients with cirrhosis. Prediction of mortality at initial hospitalization is unknown in black African patients with decompensated cirrhosis.Aim: This study aimed to look at the role of MELD score and SIRS as the predictors of morbidity and mortality at initial hospitalization.Patients and methods: In this retrospective cohort study, we enrolled 159 patients with cirrhosis (median age: 49 years, 70.4% males. The role of Child–Pugh–Turcotte (CPT score, MELD score, and SIRS on mortality was determined by the Kaplan–Meier method, and the prognosis factors were assessed with Cox regression model.Results: At initial hospitalization, 74.2%, 20.1%, and 37.7% of the patients with cirrhosis showed the presence of ascites, hepatorenal syndrome, and esophageal varices, respectively. During the in-hospital follow-up, 40 (25.2% patients died. The overall incidence of mortality was found to be 3.1 [95% confidence interval (CI: 2.2–4.1] per 100 person-days. Survival probabilities were found to be high in case of patients who were SIRS negative (log-rank test= 4.51, p=0.03 and in case of patients with MELD score ≤16 (log-rank test=7.26, p=0.01 compared to the patients who were SIRS positive and those with MELD score >16. Only SIRS (hazard ratio (HR=3.02, [95% CI: 1.4–7.4], p=0.01 and MELD score >16 (HR=2.2, [95% CI: 1.1–4.3], p=0.02 were independent predictors of mortality in multivariate analysis except CPT, which was not relevant in our study

  12. Does the Spectrum model accurately predict trends in adult mortality? Evaluation of model estimates using empirical data from a rural HIV community cohort study in north-western Tanzania

    Directory of Open Access Journals (Sweden)

    Denna Michael

    2014-01-01

    Full Text Available Introduction: Spectrum epidemiological models are used by UNAIDS to provide global, regional and national HIV estimates and projections, which are then used for evidence-based health planning for HIV services. However, there are no validations of the Spectrum model against empirical serological and mortality data from populations in sub-Saharan Africa. Methods: Serologic, demographic and verbal autopsy data have been regularly collected among over 30,000 residents in north-western Tanzania since 1994. Five-year age-specific mortality rates (ASMRs per 1,000 person years and the probability of dying between 15 and 60 years of age (45Q15, were calculated and compared with the Spectrum model outputs. Mortality trends by HIV status are shown for periods before the introduction of antiretroviral therapy (1994–1999, 2000–2005 and the first 5 years afterwards (2005–2009. Results: Among 30–34 year olds of both sexes, observed ASMRs per 1,000 person years were 13.33 (95% CI: 10.75–16.52 in the period 1994–1999, 11.03 (95% CI: 8.84–13.77 in 2000–2004, and 6.22 (95% CI; 4.75–8.15 in 2005–2009. Among the same age group, the ASMRs estimated by the Spectrum model were 10.55, 11.13 and 8.15 for the periods 1994–1999, 2000–2004 and 2005–2009, respectively. The cohort data, for both sexes combined, showed that the 45Q15 declined from 39% (95% CI: 27–55% in 1994 to 22% (95% CI: 17–29% in 2009, whereas the Spectrum model predicted a decline from 43% in 1994 to 37% in 2009. Conclusion: From 1994 to 2009, the observed decrease in ASMRs was steeper in younger age groups than that predicted by the Spectrum model, perhaps because the Spectrum model under-estimated the ASMRs in 30–34 year olds in 1994–99. However, the Spectrum model predicted a greater decrease in 45Q15 mortality than observed in the cohort, although the reasons for this over-estimate are unclear.

  13. Nonsurgical giant cell tumour of the tendon sheath or of the diffuse type: Are MRI or 18F-FDG PET/CT able to provide an accurate prediction of long-term outcome?

    International Nuclear Information System (INIS)

    Dercle, Laurent; Chisin, Roland; Ammari, Samy; Gillebert, Quentin; Ouali, Monia; Jaudet, Cyril; Dierickx, Lawrence; Zerdoud, Slimane; Courbon, Frederic; Delord, Jean-Pierre; Schlumberger, Martin

    2015-01-01

    To investigate whether MRI (RECIST 1.1, WHO criteria and the volumetric approach) or 18 F-FDG PET/CT (PERCIST 1.0) are able to predict long-term outcome in nonsurgical patients with giant cell tumour of the tendon sheath or of the diffuse type (GCT-TS/DT). Fifteen ''nonsurgical'' patients with a histological diagnosis of GCT-TS/DT were divided into two groups: symptomatic patients receiving targeted therapy and asymptomatic untreated patients. All 15 patients were evaluated by MRI of whom 10 were treated, and a subgroup of 7 patients were evaluated by PET/CT of whom 4 were treated. Early evolution was assessed according to MRI and PET/CT scans at baseline and during follow-up. Cohen's kappa coefficient was used to evaluate the degree of agreement between PERCIST 1.0, RECIST 1.1, WHO criteria, volumetric approaches and the reference standard (long-term outcome, delay 505 ± 457 days). The response rate in symptomatic patients with GCT-TS/DT receiving targeted therapy was also assessed in a larger population that included additional patients obtained from a review of the literature. The kappa coefficients for agreement between RECIST/WHO/volumetric criteria and outcome (15 patients) were respectively: 0.35 (p = 0.06), 0.26 (p = 0.17) and 0.26 (p = 0.17). In the PET/CT subgroup (7 patients), PERCIST was in perfect agreement with the late symptomatic evolution (kappa = 1, p 18 F-FDG PET/CT with PERCIST is a promising approach to the prediction of the long-term outcome in GCT-TS/DT and may avoid unnecessary treatments, toxicity and costs. On MRI, WHO and volumetric approaches are not more effective than RECIST using the current thresholds. (orig.)

  14. Towards accurate emergency response behavior

    International Nuclear Information System (INIS)

    Sargent, T.O.

    1981-01-01

    Nuclear reactor operator emergency response behavior has persisted as a training problem through lack of information. The industry needs an accurate definition of operator behavior in adverse stress conditions, and training methods which will produce the desired behavior. Newly assembled information from fifty years of research into human behavior in both high and low stress provides a more accurate definition of appropriate operator response, and supports training methods which will produce the needed control room behavior. The research indicates that operator response in emergencies is divided into two modes, conditioned behavior and knowledge based behavior. Methods which assure accurate conditioned behavior, and provide for the recovery of knowledge based behavior, are described in detail

  15. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  16. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  17. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  18. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  20. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  1. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  2. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  3. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  4. When Is Network Lasso Accurate?

    Directory of Open Access Journals (Sweden)

    Alexander Jung

    2018-01-01

    Full Text Available The “least absolute shrinkage and selection operator” (Lasso method has been adapted recently for network-structured datasets. In particular, this network Lasso method allows to learn graph signals from a small number of noisy signal samples by using the total variation of a graph signal for regularization. While efficient and scalable implementations of the network Lasso are available, only little is known about the conditions on the underlying network structure which ensure network Lasso to be accurate. By leveraging concepts of compressed sensing, we address this gap and derive precise conditions on the underlying network topology and sampling set which guarantee the network Lasso for a particular loss function to deliver an accurate estimate of the entire underlying graph signal. We also quantify the error incurred by network Lasso in terms of two constants which reflect the connectivity of the sampled nodes.

  5. The Accurate Particle Tracer Code

    OpenAIRE

    Wang, Yulei; Liu, Jian; Qin, Hong; Yu, Zhi

    2016-01-01

    The Accurate Particle Tracer (APT) code is designed for large-scale particle simulations on dynamical systems. Based on a large variety of advanced geometric algorithms, APT possesses long-term numerical accuracy and stability, which are critical for solving multi-scale and non-linear problems. Under the well-designed integrated and modularized framework, APT serves as a universal platform for researchers from different fields, such as plasma physics, accelerator physics, space science, fusio...

  6. Accurate x-ray spectroscopy

    International Nuclear Information System (INIS)

    Deslattes, R.D.

    1987-01-01

    Heavy ion accelerators are the most flexible and readily accessible sources of highly charged ions. These having only one or two remaining electrons have spectra whose accurate measurement is of considerable theoretical significance. Certain features of ion production by accelerators tend to limit the accuracy which can be realized in measurement of these spectra. This report aims to provide background about spectroscopic limitations and discuss how accelerator operations may be selected to permit attaining intrinsically limited data

  7. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro