Transcriptome dynamics-based operon prediction in prokaryotes.
Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario
2014-05-16
Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.
The relative value of operon predictions
Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.
For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,
REMap: Operon Map of M. tuberculosis
Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu
2016-01-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008
ProOpDB: Prokaryotic Operon DataBase.
Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique
2012-01-01
The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.
REMap: Operon map of M. tuberculosis based on RNA sequence data.
Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu
2016-07-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
CONDOP: an R package for CONdition-Dependent Operon Predictions.
Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario
2016-10-15
The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Teaching the Big Ideas of Biology with Operon Models
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Evolution and Biophysics of the Escherichia coli lac Operon
Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor
2011-03-01
To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2005-11-18
Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2007-03-15
Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
Directory of Open Access Journals (Sweden)
Silvia Dossena
2013-12-01
Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
International Nuclear Information System (INIS)
Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.
1993-01-01
Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Ancient origin of the tryptophan operon and the dynamics of evolutionary change.
Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A
2003-09-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Problem-Solving Test: Tryptophan Operon Mutants
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
Narang, Atul; Oehler, Stefan
2017-05-01
The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.
Stochastic simulations of the tetracycline operon
2011-01-01
Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular
Stochastic simulations of the tetracycline operon
Directory of Open Access Journals (Sweden)
Kaznessis Yiannis N
2011-01-01
Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the
Mental models accurately predict emotion transitions.
Thornton, Mark A; Tamir, Diana I
2017-06-06
Successful social interactions depend on people's ability to predict others' future actions and emotions. People possess many mechanisms for perceiving others' current emotional states, but how might they use this information to predict others' future states? We hypothesized that people might capitalize on an overlooked aspect of affective experience: current emotions predict future emotions. By attending to regularities in emotion transitions, perceivers might develop accurate mental models of others' emotional dynamics. People could then use these mental models of emotion transitions to predict others' future emotions from currently observable emotions. To test this hypothesis, studies 1-3 used data from three extant experience-sampling datasets to establish the actual rates of emotional transitions. We then collected three parallel datasets in which participants rated the transition likelihoods between the same set of emotions. Participants' ratings of emotion transitions predicted others' experienced transitional likelihoods with high accuracy. Study 4 demonstrated that four conceptual dimensions of mental state representation-valence, social impact, rationality, and human mind-inform participants' mental models. Study 5 used 2 million emotion reports on the Experience Project to replicate both of these findings: again people reported accurate models of emotion transitions, and these models were informed by the same four conceptual dimensions. Importantly, neither these conceptual dimensions nor holistic similarity could fully explain participants' accuracy, suggesting that their mental models contain accurate information about emotion dynamics above and beyond what might be predicted by static emotion knowledge alone.
Mental models accurately predict emotion transitions
Thornton, Mark A.; Tamir, Diana I.
2017-01-01
Successful social interactions depend on people’s ability to predict others’ future actions and emotions. People possess many mechanisms for perceiving others’ current emotional states, but how might they use this information to predict others’ future states? We hypothesized that people might capitalize on an overlooked aspect of affective experience: current emotions predict future emotions. By attending to regularities in emotion transitions, perceivers might develop accurate mental models of others’ emotional dynamics. People could then use these mental models of emotion transitions to predict others’ future emotions from currently observable emotions. To test this hypothesis, studies 1–3 used data from three extant experience-sampling datasets to establish the actual rates of emotional transitions. We then collected three parallel datasets in which participants rated the transition likelihoods between the same set of emotions. Participants’ ratings of emotion transitions predicted others’ experienced transitional likelihoods with high accuracy. Study 4 demonstrated that four conceptual dimensions of mental state representation—valence, social impact, rationality, and human mind—inform participants’ mental models. Study 5 used 2 million emotion reports on the Experience Project to replicate both of these findings: again people reported accurate models of emotion transitions, and these models were informed by the same four conceptual dimensions. Importantly, neither these conceptual dimensions nor holistic similarity could fully explain participants’ accuracy, suggesting that their mental models contain accurate information about emotion dynamics above and beyond what might be predicted by static emotion knowledge alone. PMID:28533373
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Metazoan operons accelerate recovery from growth arrested states
Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.
2011-01-01
Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799
Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.
Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale
2015-05-25
Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes
Directory of Open Access Journals (Sweden)
Jan Ewald
2015-04-01
Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.
A new, accurate predictive model for incident hypertension
DEFF Research Database (Denmark)
Völzke, Henry; Fung, Glenn; Ittermann, Till
2013-01-01
Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures.......Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures....
Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio
2016-01-01
The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
2015-01-01
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.
2005-04-12
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.
Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.
Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan
2017-01-01
Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius
Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena
2013-01-01
Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange
Accurate Multisteps Traffic Flow Prediction Based on SVM
Directory of Open Access Journals (Sweden)
Zhang Mingheng
2013-01-01
Full Text Available Accurate traffic flow prediction is prerequisite and important for realizing intelligent traffic control and guidance, and it is also the objective requirement for intelligent traffic management. Due to the strong nonlinear, stochastic, time-varying characteristics of urban transport system, artificial intelligence methods such as support vector machine (SVM are now receiving more and more attentions in this research field. Compared with the traditional single-step prediction method, the multisteps prediction has the ability that can predict the traffic state trends over a certain period in the future. From the perspective of dynamic decision, it is far important than the current traffic condition obtained. Thus, in this paper, an accurate multi-steps traffic flow prediction model based on SVM was proposed. In which, the input vectors were comprised of actual traffic volume and four different types of input vectors were compared to verify their prediction performance with each other. Finally, the model was verified with actual data in the empirical analysis phase and the test results showed that the proposed SVM model had a good ability for traffic flow prediction and the SVM-HPT model outperformed the other three models for prediction.
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong
2015-10-23
The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.
Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti
2017-01-01
The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.
Tadmor, Arbel
2009-03-01
In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.
Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.
Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong
2012-01-01
During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.
Solving a discrete model of the lac operon using Z3
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.
García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L
2017-09-01
Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Dynamics and bistability in a reduced model of the lac operon
Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.
2004-06-01
It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.
Rapid customised operon assembly by yeast recombinational cloning.
Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R
2017-06-01
We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.
Directory of Open Access Journals (Sweden)
Hasnain Seyed
2004-09-01
Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG
Directory of Open Access Journals (Sweden)
Orlando Díaz-Hernández
2010-07-01
Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Highly Accurate Prediction of Jobs Runtime Classes
Reiner-Benaim, Anat; Grabarnick, Anna; Shmueli, Edi
2016-01-01
Separating the short jobs from the long is a known technique to improve scheduling performance. In this paper we describe a method we developed for accurately predicting the runtimes classes of the jobs to enable this separation. Our method uses the fact that the runtimes can be represented as a mixture of overlapping Gaussian distributions, in order to train a CART classifier to provide the prediction. The threshold that separates the short jobs from the long jobs is determined during the ev...
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.
Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula
2013-07-01
The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport
Chopra, Paras; Bender, Andreas
The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].
Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha
2014-11-01
Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.
The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio
2012-01-01
Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.
The pyrimidine operon pyrRPB-carA from Lactococcus lactis
DEFF Research Database (Denmark)
Martinussen, Jan; Schallert, J.; Andersen, Birgit
2001-01-01
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito
2014-09-01
Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Influential Factors for Accurate Load Prediction in a Demand Response Context
DEFF Research Database (Denmark)
Wollsen, Morten Gill; Kjærgaard, Mikkel Baun; Jørgensen, Bo Nørregaard
2016-01-01
Accurate prediction of a buildings electricity load is crucial to respond to Demand Response events with an assessable load change. However, previous work on load prediction lacks to consider a wider set of possible data sources. In this paper we study different data scenarios to map the influence....... Next, the time of day that is being predicted greatly influence the prediction which is related to the weather pattern. By presenting these results we hope to improve the modeling of building loads and algorithms for Demand Response planning.......Accurate prediction of a buildings electricity load is crucial to respond to Demand Response events with an assessable load change. However, previous work on load prediction lacks to consider a wider set of possible data sources. In this paper we study different data scenarios to map the influence...
Accurate predictions for the LHC made easy
CERN. Geneva
2014-01-01
The data recorded by the LHC experiments is of a very high quality. To get the most out of the data, precise theory predictions, including uncertainty estimates, are needed to reduce as much as possible theoretical bias in the experimental analyses. Recently, significant progress has been made in computing Next-to-Leading Order (NLO) computations, including matching to the parton shower, that allow for these accurate, hadron-level predictions. I shall discuss one of these efforts, the MadGraph5_aMC@NLO program, that aims at the complete automation of predictions at the NLO accuracy within the SM as well as New Physics theories. I’ll illustrate some of the theoretical ideas behind this program, show some selected applications to LHC physics, as well as describe the future plans.
Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.
Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L
2016-01-01
Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase
The post-transcriptional operon
DEFF Research Database (Denmark)
Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik
2011-01-01
model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....
Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.
Stewart, V; Yanofsky, C
1986-01-01
We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Can phenological models predict tree phenology accurately under climate change conditions?
Chuine, Isabelle; Bonhomme, Marc; Legave, Jean Michel; García de Cortázar-Atauri, Inaki; Charrier, Guillaume; Lacointe, André; Améglio, Thierry
2014-05-01
The onset of the growing season of trees has been globally earlier by 2.3 days/decade during the last 50 years because of global warming and this trend is predicted to continue according to climate forecast. The effect of temperature on plant phenology is however not linear because temperature has a dual effect on bud development. On one hand, low temperatures are necessary to break bud dormancy, and on the other hand higher temperatures are necessary to promote bud cells growth afterwards. Increasing phenological changes in temperate woody species have strong impacts on forest trees distribution and productivity, as well as crops cultivation areas. Accurate predictions of trees phenology are therefore a prerequisite to understand and foresee the impacts of climate change on forests and agrosystems. Different process-based models have been developed in the last two decades to predict the date of budburst or flowering of woody species. They are two main families: (1) one-phase models which consider only the ecodormancy phase and make the assumption that endodormancy is always broken before adequate climatic conditions for cell growth occur; and (2) two-phase models which consider both the endodormancy and ecodormancy phases and predict a date of dormancy break which varies from year to year. So far, one-phase models have been able to predict accurately tree bud break and flowering under historical climate. However, because they do not consider what happens prior to ecodormancy, and especially the possible negative effect of winter temperature warming on dormancy break, it seems unlikely that they can provide accurate predictions in future climate conditions. It is indeed well known that a lack of low temperature results in abnormal pattern of bud break and development in temperate fruit trees. An accurate modelling of the dormancy break date has thus become a major issue in phenology modelling. Two-phases phenological models predict that global warming should delay
Prediction of Accurate Mixed Mode Fatigue Crack Growth Curves using the Paris' Law
Sajith, S.; Krishna Murthy, K. S. R.; Robi, P. S.
2017-12-01
Accurate information regarding crack growth times and structural strength as a function of the crack size is mandatory in damage tolerance analysis. Various equivalent stress intensity factor (SIF) models are available for prediction of mixed mode fatigue life using the Paris' law. In the present investigation these models have been compared to assess their efficacy in prediction of the life close to the experimental findings as there are no guidelines/suggestions available on selection of these models for accurate and/or conservative predictions of fatigue life. Within the limitations of availability of experimental data and currently available numerical simulation techniques, the results of present study attempts to outline models that would provide accurate and conservative life predictions.
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Directory of Open Access Journals (Sweden)
Catherine E Dana
Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.
da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A
2017-07-01
One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...
Stefanski, Katherine M.
A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
NNLOPS accurate predictions for $W^+W^-$ production arXiv
Re, Emanuele; Zanderighi, Giulia
We present novel predictions for the production of $W^+W^-$ pairs in hadron collisions that are next-to-next-to-leading order accurate and consistently matched to a parton shower (NNLOPS). All diagrams that lead to the process $pp\\to e^- \\bar \
ASTRAL, DRAGON and SEDAN scores predict stroke outcome more accurately than physicians.
Ntaios, G; Gioulekas, F; Papavasileiou, V; Strbian, D; Michel, P
2016-11-01
ASTRAL, SEDAN and DRAGON scores are three well-validated scores for stroke outcome prediction. Whether these scores predict stroke outcome more accurately compared with physicians interested in stroke was investigated. Physicians interested in stroke were invited to an online anonymous survey to provide outcome estimates in randomly allocated structured scenarios of recent real-life stroke patients. Their estimates were compared to scores' predictions in the same scenarios. An estimate was considered accurate if it was within 95% confidence intervals of actual outcome. In all, 244 participants from 32 different countries responded assessing 720 real scenarios and 2636 outcomes. The majority of physicians' estimates were inaccurate (1422/2636, 53.9%). 400 (56.8%) of physicians' estimates about the percentage probability of 3-month modified Rankin score (mRS) > 2 were accurate compared with 609 (86.5%) of ASTRAL score estimates (P DRAGON score estimates (P DRAGON score estimates (P DRAGON and SEDAN scores predict outcome of acute ischaemic stroke patients with higher accuracy compared to physicians interested in stroke. © 2016 EAN.
UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD
International Nuclear Information System (INIS)
Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.
1994-01-01
UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent
Cop-like operon: Structure and organization in species of the Lactobacillale order
Directory of Open Access Journals (Sweden)
ANGÉLICA REYES
2006-01-01
Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.
Elucidation of Operon Structures across Closely Related Bacterial Genomes
Li, Guojun
2014-01-01
About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722
Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin
2015-03-17
Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal
A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.
Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo
2014-01-01
The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
Dynamic model of gene regulation for the lac operon
International Nuclear Information System (INIS)
Angelova, Maia; Ben-Halim, Asma
2011-01-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Dynamic model of gene regulation for the lac operon
Energy Technology Data Exchange (ETDEWEB)
Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)
2011-03-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.
Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan
2017-10-01
One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple
Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.
Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula
2016-09-01
The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Towards cycle-accurate performance predictions for real-time embedded systems
Triantafyllidis, K.; Bondarev, E.; With, de P.H.N.; Arabnia, H.R.; Deligiannidis, L.; Jandieri, G.
2013-01-01
In this paper we present a model-based performance analysis method for component-based real-time systems, featuring cycle-accurate predictions of latencies and enhanced system robustness. The method incorporates the following phases: (a) instruction-level profiling of SW components, (b) modeling the
clpC operon regulates cell architecture and sporulation in Bacillus anthracis.
Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra
2015-03-01
The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Accurate Prediction of Motor Failures by Application of Multi CBM Tools: A Case Study
Dutta, Rana; Singh, Veerendra Pratap; Dwivedi, Jai Prakash
2018-02-01
Motor failures are very difficult to predict accurately with a single condition-monitoring tool as both electrical and the mechanical systems are closely related. Electrical problem, like phase unbalance, stator winding insulation failures can, at times, lead to vibration problem and at the same time mechanical failures like bearing failure, leads to rotor eccentricity. In this case study of a 550 kW blower motor it has been shown that a rotor bar crack was detected by current signature analysis and vibration monitoring confirmed the same. In later months in a similar motor vibration monitoring predicted bearing failure and current signature analysis confirmed the same. In both the cases, after dismantling the motor, the predictions were found to be accurate. In this paper we will be discussing the accurate predictions of motor failures through use of multi condition monitoring tools with two case studies.
Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073
CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Marasco Rosangela
2006-11-01
Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
Ghosh, Semanti; Bagchi, Angshuman
2015-12-01
Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio
DEFF Research Database (Denmark)
Danielsen, S; Kilstrup, M; Barilla, K
1992-01-01
. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...
Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao
2013-10-01
The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates
DEFF Research Database (Denmark)
Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria
2014-01-01
We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli
Directory of Open Access Journals (Sweden)
Sun Yuan
2006-02-01
Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.
DEFF Research Database (Denmark)
Lundegaard, Claus; Lund, Ole; Nielsen, Morten
2008-01-01
Several accurate prediction systems have been developed for prediction of class I major histocompatibility complex (MHC):peptide binding. Most of these are trained on binding affinity data of primarily 9mer peptides. Here, we show how prediction methods trained on 9mer data can be used for accurate...
Scribbans, T D; Berg, K; Narazaki, K; Janssen, I; Gurd, B J
2015-09-01
There is currently little information regarding the ability of metabolic prediction equations to accurately predict oxygen uptake and exercise intensity from heart rate (HR) during intermittent sport. The purpose of the present study was to develop and, cross-validate equations appropriate for accurately predicting oxygen cost (VO2) and energy expenditure from HR during intermittent sport participation. Eleven healthy adult males (19.9±1.1yrs) were recruited to establish the relationship between %VO2peak and %HRmax during low-intensity steady state endurance (END), moderate-intensity interval (MOD) and high intensity-interval exercise (HI), as performed on a cycle ergometer. Three equations (END, MOD, and HI) for predicting %VO2peak based on %HRmax were developed. HR and VO2 were directly measured during basketball games (6 male, 20.8±1.0 yrs; 6 female, 20.0±1.3yrs) and volleyball drills (12 female; 20.8±1.0yrs). Comparisons were made between measured and predicted VO2 and energy expenditure using the 3 equations developed and 2 previously published equations. The END and MOD equations accurately predicted VO2 and energy expenditure, while the HI equation underestimated, and the previously published equations systematically overestimated VO2 and energy expenditure. Intermittent sport VO2 and energy expenditure can be accurately predicted from heart rate data using either the END (%VO2peak=%HRmax x 1.008-17.17) or MOD (%VO2peak=%HRmax x 1.2-32) equations. These 2 simple equations provide an accessible and cost-effective method for accurate estimation of exercise intensity and energy expenditure during intermittent sport.
Decreases in average bacterial community rRNA operon copy number during succession.
Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R
2016-05-01
Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.
Directory of Open Access Journals (Sweden)
Johanna Rintahaka
Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
PredictSNP: robust and accurate consensus classifier for prediction of disease-related mutations.
Directory of Open Access Journals (Sweden)
Jaroslav Bendl
2014-01-01
Full Text Available Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp.
Riyanti, Eny Ida; Rogers, Peter L
2009-01-01
Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
Predicting metabolic pathways by sub-network extraction.
Faust, Karoline; van Helden, Jacques
2012-01-01
Various methods result in groups of functionally related genes obtained from genomes (operons, regulons, syntheny groups, and phylogenetic profiles), transcriptomes (co-expression groups) and proteomes (modules of interacting proteins). When such groups contain two or more enzyme-coding genes, graph analysis methods can be applied to extract a metabolic pathway that interconnects them. We describe here the way to use the Pathway extraction tool available on the NeAT Web server ( http://rsat.ulb.ac.be/neat/ ) to piece together the metabolic pathway from a group of associated, enzyme-coding genes. The tool identifies the reactions that can be catalyzed by the products of the query genes (seed reactions), and applies sub-graph extraction algorithms to extract from a metabolic network a sub-network that connects the seed reactions. This sub-network represents the predicted metabolic pathway. We describe here the pathway prediction process in a step-by-step way, give hints about the main parametric choices, and illustrate how this tool can be used to extract metabolic pathways from bacterial genomes, on the basis of two study cases: the isoleucine-valine operon in Escherichia coli and a predicted operon in Cupriavidus (Ralstonia) metallidurans.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
A new, accurate predictive model for incident hypertension.
Völzke, Henry; Fung, Glenn; Ittermann, Till; Yu, Shipeng; Baumeister, Sebastian E; Dörr, Marcus; Lieb, Wolfgang; Völker, Uwe; Linneberg, Allan; Jørgensen, Torben; Felix, Stephan B; Rettig, Rainer; Rao, Bharat; Kroemer, Heyo K
2013-11-01
Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures. The primary study population consisted of 1605 normotensive individuals aged 20-79 years with 5-year follow-up from the population-based study, that is the Study of Health in Pomerania (SHIP). The initial set was randomly split into a training and a testing set. We used a probabilistic graphical model applying a Bayesian network to create a predictive model for incident hypertension and compared the predictive performance with the established Framingham risk score for hypertension. Finally, the model was validated in 2887 participants from INTER99, a Danish community-based intervention study. In the training set of SHIP data, the Bayesian network used a small subset of relevant baseline features including age, mean arterial pressure, rs16998073, serum glucose and urinary albumin concentrations. Furthermore, we detected relevant interactions between age and serum glucose as well as between rs16998073 and urinary albumin concentrations [area under the receiver operating characteristic (AUC 0.76)]. The model was confirmed in the SHIP validation set (AUC 0.78) and externally replicated in INTER99 (AUC 0.77). Compared to the established Framingham risk score for hypertension, the predictive performance of the new model was similar in the SHIP validation set and moderately better in INTER99. Data mining procedures identified a predictive model for incident hypertension, which included innovative and easy-to-measure variables. The findings promise great applicability in screening settings and clinical practice.
Eucaryotic operon genes can define highly conserved syntenies
Czech Academy of Sciences Publication Activity Database
Trachtulec, Zdeněk
2004-01-01
Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004
Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús
2013-02-01
Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.
Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki
2013-08-01
Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.
Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O
2015-02-01
Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Qinna Cui
Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased
Deng, Xin; Gumm, Jordan; Karki, Suman; Eickholt, Jesse; Cheng, Jianlin
2015-07-07
Protein disordered regions are segments of a protein chain that do not adopt a stable structure. Thus far, a variety of protein disorder prediction methods have been developed and have been widely used, not only in traditional bioinformatics domains, including protein structure prediction, protein structure determination and function annotation, but also in many other biomedical fields. The relationship between intrinsically-disordered proteins and some human diseases has played a significant role in disorder prediction in disease identification and epidemiological investigations. Disordered proteins can also serve as potential targets for drug discovery with an emphasis on the disordered-to-ordered transition in the disordered binding regions, and this has led to substantial research in drug discovery or design based on protein disordered region prediction. Furthermore, protein disorder prediction has also been applied to healthcare by predicting the disease risk of mutations in patients and studying the mechanistic basis of diseases. As the applications of disorder prediction increase, so too does the need to make quick and accurate predictions. To fill this need, we also present a new approach to predict protein residue disorder using wide sequence windows that is applicable on the genomic scale.
Directory of Open Access Journals (Sweden)
Xin Deng
2015-07-01
Full Text Available Protein disordered regions are segments of a protein chain that do not adopt a stable structure. Thus far, a variety of protein disorder prediction methods have been developed and have been widely used, not only in traditional bioinformatics domains, including protein structure prediction, protein structure determination and function annotation, but also in many other biomedical fields. The relationship between intrinsically-disordered proteins and some human diseases has played a significant role in disorder prediction in disease identification and epidemiological investigations. Disordered proteins can also serve as potential targets for drug discovery with an emphasis on the disordered-to-ordered transition in the disordered binding regions, and this has led to substantial research in drug discovery or design based on protein disordered region prediction. Furthermore, protein disorder prediction has also been applied to healthcare by predicting the disease risk of mutations in patients and studying the mechanistic basis of diseases. As the applications of disorder prediction increase, so too does the need to make quick and accurate predictions. To fill this need, we also present a new approach to predict protein residue disorder using wide sequence windows that is applicable on the genomic scale.
Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C
2015-07-07
Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.
Kim, Moonjeong; Kim, Kwang-Sun
2017-07-06
The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Multi-fidelity machine learning models for accurate bandgap predictions of solids
International Nuclear Information System (INIS)
Pilania, Ghanshyam; Gubernatis, James E.; Lookman, Turab
2016-01-01
Here, we present a multi-fidelity co-kriging statistical learning framework that combines variable-fidelity quantum mechanical calculations of bandgaps to generate a machine-learned model that enables low-cost accurate predictions of the bandgaps at the highest fidelity level. Additionally, the adopted Gaussian process regression formulation allows us to predict the underlying uncertainties as a measure of our confidence in the predictions. In using a set of 600 elpasolite compounds as an example dataset and using semi-local and hybrid exchange correlation functionals within density functional theory as two levels of fidelities, we demonstrate the excellent learning performance of the method against actual high fidelity quantum mechanical calculations of the bandgaps. The presented statistical learning method is not restricted to bandgaps or electronic structure methods and extends the utility of high throughput property predictions in a significant way.
Rapid and accurate prediction and scoring of water molecules in protein binding sites.
Directory of Open Access Journals (Sweden)
Gregory A Ross
Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.
Chung, T; Resnik, E; Stueland, C; LaPorte, D C
1993-01-01
Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G
Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It
Park, Seoung Hoon; Kim, Seonjin; Kwon, MinHyuk; Christou, Evangelos A
2016-03-01
Vision and auditory information are critical for perception and to enhance the ability of an individual to respond accurately to a stimulus. However, it is unknown whether visual and auditory information contribute differentially to identify the direction and rotational motion of the stimulus. The purpose of this study was to determine the ability of an individual to accurately predict the direction and rotational motion of the stimulus based on visual and auditory information. In this study, we recruited 9 expert table-tennis players and used table-tennis service as our experimental model. Participants watched recorded services with different levels of visual and auditory information. The goal was to anticipate the direction of the service (left or right) and the rotational motion of service (topspin, sidespin, or cut). We recorded their responses and quantified the following outcomes: (i) directional accuracy and (ii) rotational motion accuracy. The response accuracy was the accurate predictions relative to the total number of trials. The ability of the participants to predict the direction of the service accurately increased with additional visual information but not with auditory information. In contrast, the ability of the participants to predict the rotational motion of the service accurately increased with the addition of auditory information to visual information but not with additional visual information alone. In conclusion, this finding demonstrates that visual information enhances the ability of an individual to accurately predict the direction of the stimulus, whereas additional auditory information enhances the ability of an individual to accurately predict the rotational motion of stimulus.
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Sequence analysis of the Legionella micdadei groELS operon
DEFF Research Database (Denmark)
Hindersson, P; Høiby, N; Bangsborg, Jette Marie
1991-01-01
shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...
Sahukhal, Gyan S; Elasri, Mohamed O
2014-06-11
Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.
Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill
2017-01-01
Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.
DEFF Research Database (Denmark)
Ydreborg, Magdalena; Lisovskaja, Vera; Lagging, Martin
2014-01-01
of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive...
LocARNA-P: Accurate boundary prediction and improved detection of structural RNAs
DEFF Research Database (Denmark)
Will, Sebastian; Joshi, Tejal; Hofacker, Ivo L.
2012-01-01
Current genomic screens for noncoding RNAs (ncRNAs) predict a large number of genomic regions containing potential structural ncRNAs. The analysis of these data requires highly accurate prediction of ncRNA boundaries and discrimination of promising candidate ncRNAs from weak predictions. Existing...... methods struggle with these goals because they rely on sequence-based multiple sequence alignments, which regularly misalign RNA structure and therefore do not support identification of structural similarities. To overcome this limitation, we compute columnwise and global reliabilities of alignments based...... on sequence and structure similarity; we refer to these structure-based alignment reliabilities as STARs. The columnwise STARs of alignments, or STAR profiles, provide a versatile tool for the manual and automatic analysis of ncRNAs. In particular, we improve the boundary prediction of the widely used nc...
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Unknown
[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.
Rapcsak, Steven Z.; Henry, Maya L.; Teague, Sommer L.; Carnahan, Susan D.; Beeson, Pélagie M.
2007-01-01
Coltheart and colleagues (Coltheart, Rastle, Perry, Langdon, & Ziegler, 2001; Castles, Bates, & Coltheart, 2006) have demonstrated that an equation derived from dual-route theory accurately predicts reading performance in young normal readers and in children with reading impairment due to developmental dyslexia or stroke. In this paper we present evidence that the dual-route equation and a related multiple regression model also accurately predict both reading and spelling performance in adult...
Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn
2016-10-01
Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.
Rezaeiha, A.; Kalkman, I.; Blocken, B.J.E.
2017-01-01
Accurate prediction of the performance of a vertical-axis wind turbine (VAWT) using CFD simulation requires the employment of a sufficiently fine azimuthal increment (dθ) combined with a mesh size at which essential flow characteristics can be accurately resolved. Furthermore, the domain size needs
Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.
Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M
2016-09-12
The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .
Bayesian calibration of power plant models for accurate performance prediction
International Nuclear Information System (INIS)
Boksteen, Sowande Z.; Buijtenen, Jos P. van; Pecnik, Rene; Vecht, Dick van der
2014-01-01
Highlights: • Bayesian calibration is applied to power plant performance prediction. • Measurements from a plant in operation are used for model calibration. • A gas turbine performance model and steam cycle model are calibrated. • An integrated plant model is derived. • Part load efficiency is accurately predicted as a function of ambient conditions. - Abstract: Gas turbine combined cycles are expected to play an increasingly important role in the balancing of supply and demand in future energy markets. Thermodynamic modeling of these energy systems is frequently applied to assist in decision making processes related to the management of plant operation and maintenance. In most cases, model inputs, parameters and outputs are treated as deterministic quantities and plant operators make decisions with limited or no regard of uncertainties. As the steady integration of wind and solar energy into the energy market induces extra uncertainties, part load operation and reliability are becoming increasingly important. In the current study, methods are proposed to not only quantify various types of uncertainties in measurements and plant model parameters using measured data, but to also assess their effect on various aspects of performance prediction. The authors aim to account for model parameter and measurement uncertainty, and for systematic discrepancy of models with respect to reality. For this purpose, the Bayesian calibration framework of Kennedy and O’Hagan is used, which is especially suitable for high-dimensional industrial problems. The article derives a calibrated model of the plant efficiency as a function of ambient conditions and operational parameters, which is also accurate in part load. The article shows that complete statistical modeling of power plants not only enhances process models, but can also increases confidence in operational decisions
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Accurate Holdup Calculations with Predictive Modeling & Data Integration
Energy Technology Data Exchange (ETDEWEB)
Azmy, Yousry [North Carolina State Univ., Raleigh, NC (United States). Dept. of Nuclear Engineering; Cacuci, Dan [Univ. of South Carolina, Columbia, SC (United States). Dept. of Mechanical Engineering
2017-04-03
In facilities that process special nuclear material (SNM) it is important to account accurately for the fissile material that enters and leaves the plant. Although there are many stages and processes through which materials must be traced and measured, the focus of this project is material that is “held-up” in equipment, pipes, and ducts during normal operation and that can accumulate over time into significant quantities. Accurately estimating the holdup is essential for proper SNM accounting (vis-à-vis nuclear non-proliferation), criticality and radiation safety, waste management, and efficient plant operation. Usually it is not possible to directly measure the holdup quantity and location, so these must be inferred from measured radiation fields, primarily gamma and less frequently neutrons. Current methods to quantify holdup, i.e. Generalized Geometry Holdup (GGH), primarily rely on simple source configurations and crude radiation transport models aided by ad hoc correction factors. This project seeks an alternate method of performing measurement-based holdup calculations using a predictive model that employs state-of-the-art radiation transport codes capable of accurately simulating such situations. Inverse and data assimilation methods use the forward transport model to search for a source configuration that best matches the measured data and simultaneously provide an estimate of the level of confidence in the correctness of such configuration. In this work the holdup problem is re-interpreted as an inverse problem that is under-determined, hence may permit multiple solutions. A probabilistic approach is applied to solving the resulting inverse problem. This approach rates possible solutions according to their plausibility given the measurements and initial information. This is accomplished through the use of Bayes’ Theorem that resolves the issue of multiple solutions by giving an estimate of the probability of observing each possible solution. To use
Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan
2014-01-01
Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory
Fast and Accurate Prediction of Stratified Steel Temperature During Holding Period of Ladle
Deodhar, Anirudh; Singh, Umesh; Shukla, Rishabh; Gautham, B. P.; Singh, Amarendra K.
2017-04-01
Thermal stratification of liquid steel in a ladle during the holding period and the teeming operation has a direct bearing on the superheat available at the caster and hence on the caster set points such as casting speed and cooling rates. The changes in the caster set points are typically carried out based on temperature measurements at the end of tundish outlet. Thermal prediction models provide advance knowledge of the influence of process and design parameters on the steel temperature at various stages. Therefore, they can be used in making accurate decisions about the caster set points in real time. However, this requires both fast and accurate thermal prediction models. In this work, we develop a surrogate model for the prediction of thermal stratification using data extracted from a set of computational fluid dynamics (CFD) simulations, pre-determined using design of experiments technique. Regression method is used for training the predictor. The model predicts the stratified temperature profile instantaneously, for a given set of process parameters such as initial steel temperature, refractory heat content, slag thickness, and holding time. More than 96 pct of the predicted values are within an error range of ±5 K (±5 °C), when compared against corresponding CFD results. Considering its accuracy and computational efficiency, the model can be extended for thermal control of casting operations. This work also sets a benchmark for developing similar thermal models for downstream processes such as tundish and caster.
Accurate prediction of the enthalpies of formation for xanthophylls.
Lii, Jenn-Huei; Liao, Fu-Xing; Hu, Ching-Han
2011-11-30
This study investigates the applications of computational approaches in the prediction of enthalpies of formation (ΔH(f)) for C-, H-, and O-containing compounds. Molecular mechanics (MM4) molecular mechanics method, density functional theory (DFT) combined with the atomic equivalent (AE) and group equivalent (GE) schemes, and DFT-based correlation corrected atomization (CCAZ) were used. We emphasized on the application to xanthophylls, C-, H-, and O-containing carotenoids which consist of ∼ 100 atoms and extended π-delocaization systems. Within the training set, MM4 predictions are more accurate than those obtained using AE and GE; however a systematic underestimation was observed in the extended systems. ΔH(f) for the training set molecules predicted by CCAZ combined with DFT are in very good agreement with the G3 results. The average absolute deviations (AADs) of CCAZ combined with B3LYP and MPWB1K are 0.38 and 0.53 kcal/mol compared with the G3 data, and are 0.74 and 0.69 kcal/mol compared with the available experimental data, respectively. Consistency of the CCAZ approach for the selected xanthophylls is revealed by the AAD of 2.68 kcal/mol between B3LYP-CCAZ and MPWB1K-CCAZ. Copyright © 2011 Wiley Periodicals, Inc.
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
Directory of Open Access Journals (Sweden)
Arkin Adam P
2006-01-01
Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.
Directory of Open Access Journals (Sweden)
Yong-Bi Fu
2017-07-01
Full Text Available Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.
Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill
2017-01-01
Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding. PMID:28729875
XenoSite: accurately predicting CYP-mediated sites of metabolism with neural networks.
Zaretzki, Jed; Matlock, Matthew; Swamidass, S Joshua
2013-12-23
Understanding how xenobiotic molecules are metabolized is important because it influences the safety, efficacy, and dose of medicines and how they can be modified to improve these properties. The cytochrome P450s (CYPs) are proteins responsible for metabolizing 90% of drugs on the market, and many computational methods can predict which atomic sites of a molecule--sites of metabolism (SOMs)--are modified during CYP-mediated metabolism. This study improves on prior methods of predicting CYP-mediated SOMs by using new descriptors and machine learning based on neural networks. The new method, XenoSite, is faster to train and more accurate by as much as 4% or 5% for some isozymes. Furthermore, some "incorrect" predictions made by XenoSite were subsequently validated as correct predictions by revaluation of the source literature. Moreover, XenoSite output is interpretable as a probability, which reflects both the confidence of the model that a particular atom is metabolized and the statistical likelihood that its prediction for that atom is correct.
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E
2016-01-01
An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.
Rapid identification of sequences for orphan enzymes to power accurate protein annotation.
Directory of Open Access Journals (Sweden)
Kevin R Ramkissoon
Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.
Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation
Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.
2013-01-01
The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392
Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon
2014-01-01
Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Ray, Sujay; Banerjee, Arundhati
2015-10-01
Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2006-06-01
Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.
International Nuclear Information System (INIS)
Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.
1988-01-01
The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis
Microbiome Data Accurately Predicts the Postmortem Interval Using Random Forest Regression Models
Directory of Open Access Journals (Sweden)
Aeriel Belk
2018-02-01
Full Text Available Death investigations often include an effort to establish the postmortem interval (PMI in cases in which the time of death is uncertain. The postmortem interval can lead to the identification of the deceased and the validation of witness statements and suspect alibis. Recent research has demonstrated that microbes provide an accurate clock that starts at death and relies on ecological change in the microbial communities that normally inhabit a body and its surrounding environment. Here, we explore how to build the most robust Random Forest regression models for prediction of PMI by testing models built on different sample types (gravesoil, skin of the torso, skin of the head, gene markers (16S ribosomal RNA (rRNA, 18S rRNA, internal transcribed spacer regions (ITS, and taxonomic levels (sequence variants, species, genus, etc.. We also tested whether particular suites of indicator microbes were informative across different datasets. Generally, results indicate that the most accurate models for predicting PMI were built using gravesoil and skin data using the 16S rRNA genetic marker at the taxonomic level of phyla. Additionally, several phyla consistently contributed highly to model accuracy and may be candidate indicators of PMI.
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.
Chowdhury, Nilkanta; Bagchi, Angshuman
2017-07-01
Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.
Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul
2015-08-18
Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato
2018-01-01
Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.
Directory of Open Access Journals (Sweden)
Rob Eling
2016-09-01
Full Text Available Journal bearings are used to support rotors in a wide range of applications. In order to ensure reliable operation, accurate analyses of these rotor-bearing systems are crucial. Coupled analysis of the rotor and the journal bearing is essential in the case that the rotor is flexible. The accuracy of prediction of the model at hand depends on its comprehensiveness. In this study, we construct three bearing models of increasing modeling comprehensiveness and use these to predict the response of two different rotor-bearing systems. The main goal is to evaluate the correlation with measurement data as a function of modeling comprehensiveness: 1D versus 2D pressure prediction, distributed versus lumped thermal model, Newtonian versus non-Newtonian fluid description and non-mass-conservative versus mass-conservative cavitation description. We conclude that all three models predict the existence of critical speeds and whirl for both rotor-bearing systems. However, the two more comprehensive models in general show better correlation with measurement data in terms of frequency and amplitude. Furthermore, we conclude that a thermal network model comprising temperature predictions of the bearing surroundings is essential to obtain accurate predictions. The results of this study aid in developing accurate and computationally-efficient models of flexible rotors supported by plain journal bearings.
Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo
2014-12-01
The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.
DEFF Research Database (Denmark)
Hermannsson, Pétur Gordon; Vannahme, Christoph; Smith, Cameron L. C.
2014-01-01
and superstrate materials. The importance of accounting for material dispersion in order to obtain accurate simulation results is highlighted, and a method for doing so using an iterative approach is demonstrated. Furthermore, an application for the model is demonstrated, in which the material dispersion......In the past decade, photonic crystal resonant reflectors have been increasingly used as the basis for label-free biochemical assays in lab-on-a-chip applications. In both designing and interpreting experimental results, an accurate model describing the optical behavior of such structures...... is essential. Here, an analytical method for precisely predicting the absolute positions of resonantly reflected wavelengths is presented. The model is experimentally verified to be highly accurate using nanoreplicated, polymer-based photonic crystal grating reflectors with varying grating periods...
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.
Rajagopalan, Ramya; Kroos, Lee
2017-05-15
Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent
Directory of Open Access Journals (Sweden)
Sato Yoshiharu
2011-11-01
Full Text Available Abstract Background Many pathogens use a type III secretion system to translocate virulence proteins (called effectors in order to adapt to the host environment. To date, many prediction tools for effector identification have been developed. However, these tools are insufficiently accurate for producing a list of putative effectors that can be applied directly for labor-intensive experimental verification. This also suggests that important features of effectors have yet to be fully characterized. Results In this study, we have constructed an accurate approach to predicting secreted virulence effectors from Gram-negative bacteria. This consists of a support vector machine-based discriminant analysis followed by a simple criteria-based filtering. The accuracy was assessed by estimating the average number of true positives in the top-20 ranking in the genome-wide screening. In the validation, 10 sets of 20 training and 20 testing examples were randomly selected from 40 known effectors of Salmonella enterica serovar Typhimurium LT2. On average, the SVM portion of our system predicted 9.7 true positives from 20 testing examples in the top-20 of the prediction. Removal of the N-terminal instability, codon adaptation index and ProtParam indices decreased the score to 7.6, 8.9 and 7.9, respectively. These discrimination features suggested that the following characteristics of effectors had been uncovered: unstable N-terminus, non-optimal codon usage, hydrophilic, and less aliphathic. The secondary filtering process represented by coexpression analysis and domain distribution analysis further refined the average true positive counts to 12.3. We further confirmed that our system can correctly predict known effectors of P. syringae DC3000, strongly indicating its feasibility. Conclusions We have successfully developed an accurate prediction system for screening effectors on a genome-wide scale. We confirmed the accuracy of our system by external validation
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.
2015-01-01
encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
International Nuclear Information System (INIS)
Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.
2007-01-01
The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent
2015-09-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers
Energy Technology Data Exchange (ETDEWEB)
Visel, Axel; Blow, Matthew J.; Li, Zirong; Zhang, Tao; Akiyama, Jennifer A.; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Wright, Crystal; Chen, Feng; Afzal, Veena; Ren, Bing; Rubin, Edward M.; Pennacchio, Len A.
2009-02-01
A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. We tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.
The effect of stochasticity on the lac operon: an evolutionary perspective.
Directory of Open Access Journals (Sweden)
Milan van Hoek
2007-06-01
Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
Directory of Open Access Journals (Sweden)
Juan María Vázquez-Morón
Full Text Available Background: Fecal biomarkers, especially fecal calprotectin, are useful for predicting endoscopic activity in Crohn's disease; however, the cut-off point remains unclear. The aim of this paper was to analyze whether faecal calprotectin and M2 pyruvate kinase are good tools for generating highly accurate scores for the prediction of the state of endoscopic activity and mucosal healing. Methods: The simple endoscopic score for Crohn's disease and the Crohn's disease activity index was calculated for 71 patients diagnosed with Crohn's. Fecal calprotectin and M2-PK were measured by the enzyme-linked immunosorbent assay test. Results: A fecal calprotectin cut-off concentration of ≥ 170 µg/g (sensitivity 77.6%, specificity 95.5% and likelihood ratio +17.06 predicts a high probability of endoscopic activity, and a fecal calprotectin cut-off of ≤ 71 µg/g (sensitivity 95.9%, specificity 52.3% and likelihood ratio -0.08 predicts a high probability of mucosal healing. Three clinical groups were identified according to the data obtained: endoscopic activity (calprotectin ≥ 170, mucosal healing (calprotectin ≤ 71 and uncertainty (71 > calprotectin < 170, with significant differences in endoscopic values (F = 26.407, p < 0.01. Clinical activity or remission modified the probabilities of presenting endoscopic activity (100% vs 89% or mucosal healing (75% vs 87% in the diagnostic scores generated. M2-PK was insufficiently accurate to determine scores. Conclusions: The highly accurate scores for fecal calprotectin provide a useful tool for interpreting the probabilities of presenting endoscopic activity or mucosal healing, and are valuable in the specific clinical context.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
International Nuclear Information System (INIS)
Hansen, Katja; Biegler, Franziska; Ramakrishnan, Raghunathan; Pronobis, Wiktor; Lilienfeld, O. Anatole von; Müller, Klaus-Robert; Tkatchenko, Alexandre
2015-01-01
Simultaneously accurate and efficient prediction of molecular properties throughout chemical compound space is a critical ingredient toward rational compound design in chemical and pharmaceutical industries. Aiming toward this goal, we develop and apply a systematic hierarchy of efficient empirical methods to estimate atomization and total energies of molecules. These methods range from a simple sum over atoms, to addition of bond energies, to pairwise interatomic force fields, reaching to the more sophisticated machine learning approaches that are capable of describing collective interactions between many atoms or bonds. In the case of equilibrium molecular geometries, even simple pairwise force fields demonstrate prediction accuracy comparable to benchmark energies calculated using density functional theory with hybrid exchange-correlation functionals; however, accounting for the collective many-body interactions proves to be essential for approaching the 'holy grail' of chemical accuracy of 1 kcal/mol for both equilibrium and out-of-equilibrium geometries. This remarkable accuracy is achieved by a vectorized representation of molecules (so-called Bag of Bonds model) that exhibits strong nonlocality in chemical space. The same representation allows us to predict accurate electronic properties of molecules, such as their polarizability and molecular frontier orbital energies
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
Directory of Open Access Journals (Sweden)
Zhiheng Wang
Full Text Available The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database.The DisoMCS is available at http://cal.tongji.edu.cn/disorder/.
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.
Directory of Open Access Journals (Sweden)
T Sabari Sankar
2009-03-01
Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.
Simple Mathematical Models Do Not Accurately Predict Early SIV Dynamics
Directory of Open Access Journals (Sweden)
Cecilia Noecker
2015-03-01
Full Text Available Upon infection of a new host, human immunodeficiency virus (HIV replicates in the mucosal tissues and is generally undetectable in circulation for 1–2 weeks post-infection. Several interventions against HIV including vaccines and antiretroviral prophylaxis target virus replication at this earliest stage of infection. Mathematical models have been used to understand how HIV spreads from mucosal tissues systemically and what impact vaccination and/or antiretroviral prophylaxis has on viral eradication. Because predictions of such models have been rarely compared to experimental data, it remains unclear which processes included in these models are critical for predicting early HIV dynamics. Here we modified the “standard” mathematical model of HIV infection to include two populations of infected cells: cells that are actively producing the virus and cells that are transitioning into virus production mode. We evaluated the effects of several poorly known parameters on infection outcomes in this model and compared model predictions to experimental data on infection of non-human primates with variable doses of simian immunodifficiency virus (SIV. First, we found that the mode of virus production by infected cells (budding vs. bursting has a minimal impact on the early virus dynamics for a wide range of model parameters, as long as the parameters are constrained to provide the observed rate of SIV load increase in the blood of infected animals. Interestingly and in contrast with previous results, we found that the bursting mode of virus production generally results in a higher probability of viral extinction than the budding mode of virus production. Second, this mathematical model was not able to accurately describe the change in experimentally determined probability of host infection with increasing viral doses. Third and finally, the model was also unable to accurately explain the decline in the time to virus detection with increasing viral
DEFF Research Database (Denmark)
Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin
1996-01-01
Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...
Kim, Scott Y H
2014-04-01
The Patient Preference Predictor (PPP) proposal places a high priority on the accuracy of predicting patients' preferences and finds the performance of surrogates inadequate. However, the quest to develop a highly accurate, individualized statistical model has significant obstacles. First, it will be impossible to validate the PPP beyond the limit imposed by 60%-80% reliability of people's preferences for future medical decisions--a figure no better than the known average accuracy of surrogates. Second, evidence supports the view that a sizable minority of persons may not even have preferences to predict. Third, many, perhaps most, people express their autonomy just as much by entrusting their loved ones to exercise their judgment than by desiring to specifically control future decisions. Surrogate decision making faces none of these issues and, in fact, it may be more efficient, accurate, and authoritative than is commonly assumed.
The MIDAS touch for Accurately Predicting the Stress-Strain Behavior of Tantalum
Energy Technology Data Exchange (ETDEWEB)
Jorgensen, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-03-02
Testing the behavior of metals in extreme environments is not always feasible, so material scientists use models to try and predict the behavior. To achieve accurate results it is necessary to use the appropriate model and material-specific parameters. This research evaluated the performance of six material models available in the MIDAS database [1] to determine at which temperatures and strain-rates they perform best, and to determine to which experimental data their parameters were optimized. Additionally, parameters were optimized for the Johnson-Cook model using experimental data from Lassila et al [2].
Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W
2015-11-01
Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Eberl, L; Christiansen, Gunna; Molin, S
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis
Czech Academy of Sciences Publication Activity Database
Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav
2007-01-01
Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.
de Oliveira, Rafael R; Nicholson, Wayne L
2016-01-01
To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
International Nuclear Information System (INIS)
Liu, Guangming; Ouyang, Minggao; Lu, Languang; Li, Jianqiu; Hua, Jianfeng
2015-01-01
Highlights: • An energy prediction (EP) method is introduced for battery E RDE determination. • EP determines E RDE through coupled prediction of future states, parameters, and output. • The PAEP combines parameter adaptation and prediction to update model parameters. • The PAEP provides improved E RDE accuracy compared with DC and other EP methods. - Abstract: In order to estimate the remaining driving range (RDR) in electric vehicles, the remaining discharge energy (E RDE ) of the applied battery system needs to be precisely predicted. Strongly affected by the load profiles, the available E RDE varies largely in real-world applications and requires specific determination. However, the commonly-used direct calculation (DC) method might result in certain energy prediction errors by relating the E RDE directly to the current state of charge (SOC). To enhance the E RDE accuracy, this paper presents a battery energy prediction (EP) method based on the predictive control theory, in which a coupled prediction of future battery state variation, battery model parameter change, and voltage response, is implemented on the E RDE prediction horizon, and the E RDE is subsequently accumulated and real-timely optimized. Three EP approaches with different model parameter updating routes are introduced, and the predictive-adaptive energy prediction (PAEP) method combining the real-time parameter identification and the future parameter prediction offers the best potential. Based on a large-format lithium-ion battery, the performance of different E RDE calculation methods is compared under various dynamic profiles. Results imply that the EP methods provide much better accuracy than the traditional DC method, and the PAEP could reduce the E RDE error by more than 90% and guarantee the relative energy prediction error under 2%, proving as a proper choice in online E RDE prediction. The correlation of SOC estimation and E RDE calculation is then discussed to illustrate the
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna
2010-05-26
RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at http://regpredict.lbl.gov.
Rapcsak, Steven Z; Henry, Maya L; Teague, Sommer L; Carnahan, Susan D; Beeson, Pélagie M
2007-06-18
Coltheart and co-workers [Castles, A., Bates, T. C., & Coltheart, M. (2006). John Marshall and the developmental dyslexias. Aphasiology, 20, 871-892; Coltheart, M., Rastle, K., Perry, C., Langdon, R., & Ziegler, J. (2001). DRC: A dual route cascaded model of visual word recognition and reading aloud. Psychological Review, 108, 204-256] have demonstrated that an equation derived from dual-route theory accurately predicts reading performance in young normal readers and in children with reading impairment due to developmental dyslexia or stroke. In this paper, we present evidence that the dual-route equation and a related multiple regression model also accurately predict both reading and spelling performance in adult neurological patients with acquired alexia and agraphia. These findings provide empirical support for dual-route theories of written language processing.
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando
2015-02-27
It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.
Deep, Prakash; Paninjath, Sankaranarayanan; Pereira, Mark; Buck, Peter
2016-05-01
At advanced technology nodes mask complexity has been increased because of large-scale use of resolution enhancement technologies (RET) which includes Optical Proximity Correction (OPC), Inverse Lithography Technology (ILT) and Source Mask Optimization (SMO). The number of defects detected during inspection of such mask increased drastically and differentiation of critical and non-critical defects are more challenging, complex and time consuming. Because of significant defectivity of EUVL masks and non-availability of actinic inspection, it is important and also challenging to predict the criticality of defects for printability on wafer. This is one of the significant barriers for the adoption of EUVL for semiconductor manufacturing. Techniques to decide criticality of defects from images captured using non actinic inspection images is desired till actinic inspection is not available. High resolution inspection of photomask images detects many defects which are used for process and mask qualification. Repairing all defects is not practical and probably not required, however it's imperative to know which defects are severe enough to impact wafer before repair. Additionally, wafer printability check is always desired after repairing a defect. AIMSTM review is the industry standard for this, however doing AIMSTM review for all defects is expensive and very time consuming. Fast, accurate and an economical mechanism is desired which can predict defect printability on wafer accurately and quickly from images captured using high resolution inspection machine. Predicting defect printability from such images is challenging due to the fact that the high resolution images do not correlate with actual mask contours. The challenge is increased due to use of different optical condition during inspection other than actual scanner condition, and defects found in such images do not have correlation with actual impact on wafer. Our automated defect simulation tool predicts
The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus
Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.
2006-01-01
The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and
Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine
2014-10-01
The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Martin, Katherine J.; Patrick, Denis R.; Bissell, Mina J.; Fournier, Marcia V.
2008-10-20
One of the major tenets in breast cancer research is that early detection is vital for patient survival by increasing treatment options. To that end, we have previously used a novel unsupervised approach to identify a set of genes whose expression predicts prognosis of breast cancer patients. The predictive genes were selected in a well-defined three dimensional (3D) cell culture model of non-malignant human mammary epithelial cell morphogenesis as down-regulated during breast epithelial cell acinar formation and cell cycle arrest. Here we examine the ability of this gene signature (3D-signature) to predict prognosis in three independent breast cancer microarray datasets having 295, 286, and 118 samples, respectively. Our results show that the 3D-signature accurately predicts prognosis in three unrelated patient datasets. At 10 years, the probability of positive outcome was 52, 51, and 47 percent in the group with a poor-prognosis signature and 91, 75, and 71 percent in the group with a good-prognosis signature for the three datasets, respectively (Kaplan-Meier survival analysis, p<0.05). Hazard ratios for poor outcome were 5.5 (95% CI 3.0 to 12.2, p<0.0001), 2.4 (95% CI 1.6 to 3.6, p<0.0001) and 1.9 (95% CI 1.1 to 3.2, p = 0.016) and remained significant for the two larger datasets when corrected for estrogen receptor (ER) status. Hence the 3D-signature accurately predicts breast cancer outcome in both ER-positive and ER-negative tumors, though individual genes differed in their prognostic ability in the two subtypes. Genes that were prognostic in ER+ patients are AURKA, CEP55, RRM2, EPHA2, FGFBP1, and VRK1, while genes prognostic in ER patients include ACTB, FOXM1 and SERPINE2 (Kaplan-Meier p<0.05). Multivariable Cox regression analysis in the largest dataset showed that the 3D-signature was a strong independent factor in predicting breast cancer outcome. The 3D-signature accurately predicts breast cancer outcome across multiple datasets and holds prognostic
Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T
2017-11-01
Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.
Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L
2017-01-01
Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Directory of Open Access Journals (Sweden)
Kathleen Jwanoswki
Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
Xian, X.
2009-01-01
Accurate integration of reflection intensities plays an essential role in structure determination of the crystallized compound. A new diffraction data integration method, EVAL15, is presented in this thesis. This method uses the principle of general impacts to predict ab inito three-dimensional
Directory of Open Access Journals (Sweden)
Niklas Berliner
Full Text Available Advances in sequencing have led to a rapid accumulation of mutations, some of which are associated with diseases. However, to draw mechanistic conclusions, a biochemical understanding of these mutations is necessary. For coding mutations, accurate prediction of significant changes in either the stability of proteins or their affinity to their binding partners is required. Traditional methods have used semi-empirical force fields, while newer methods employ machine learning of sequence and structural features. Here, we show how combining both of these approaches leads to a marked boost in accuracy. We introduce ELASPIC, a novel ensemble machine learning approach that is able to predict stability effects upon mutation in both, domain cores and domain-domain interfaces. We combine semi-empirical energy terms, sequence conservation, and a wide variety of molecular details with a Stochastic Gradient Boosting of Decision Trees (SGB-DT algorithm. The accuracy of our predictions surpasses existing methods by a considerable margin, achieving correlation coefficients of 0.77 for stability, and 0.75 for affinity predictions. Notably, we integrated homology modeling to enable proteome-wide prediction and show that accurate prediction on modeled structures is possible. Lastly, ELASPIC showed significant differences between various types of disease-associated mutations, as well as between disease and common neutral mutations. Unlike pure sequence-based prediction methods that try to predict phenotypic effects of mutations, our predictions unravel the molecular details governing the protein instability, and help us better understand the molecular causes of diseases.
Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon
Nouwen, N; Driessen, AJM
2005-01-01
Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
2012-01-01
Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433
Gowda, Dhananjaya; Airaksinen, Manu; Alku, Paavo
2017-09-01
Recently, a quasi-closed phase (QCP) analysis of speech signals for accurate glottal inverse filtering was proposed. However, the QCP analysis which belongs to the family of temporally weighted linear prediction (WLP) methods uses the conventional forward type of sample prediction. This may not be the best choice especially in computing WLP models with a hard-limiting weighting function. A sample selective minimization of the prediction error in WLP reduces the effective number of samples available within a given window frame. To counter this problem, a modified quasi-closed phase forward-backward (QCP-FB) analysis is proposed, wherein each sample is predicted based on its past as well as future samples thereby utilizing the available number of samples more effectively. Formant detection and estimation experiments on synthetic vowels generated using a physical modeling approach as well as natural speech utterances show that the proposed QCP-FB method yields statistically significant improvements over the conventional linear prediction and QCP methods.
Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.
The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises
Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M
2015-12-29
Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.
Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin
2016-03-18
In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Amini, Y; Emdad, H; Farid, M
2014-01-01
Piezoelectric energy harvesting (PEH) from ambient energy sources, particularly vibrations, has attracted considerable interest throughout the last decade. Since fluid flow has a high energy density, it is one of the best candidates for PEH. Indeed, a piezoelectric energy harvesting process from the fluid flow takes the form of natural three-way coupling of the turbulent fluid flow, the electromechanical effect of the piezoelectric material and the electrical circuit. There are some experimental and numerical studies about piezoelectric energy harvesting from fluid flow in literatures. Nevertheless, accurate modeling for predicting characteristics of this three-way coupling has not yet been developed. In the present study, accurate modeling for this triple coupling is developed and validated by experimental results. A new code based on this modeling in an openFOAM platform is developed. (paper)
Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon
2016-05-18
Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.
Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander
2015-02-01
Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène
2018-01-22
Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016
Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.
2005-01-01
Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons
Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng
2015-10-01
To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.
RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.
Lei, Mei G; Lee, Chia Y
2015-12-01
Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
Directory of Open Access Journals (Sweden)
Cataldi Angel A
2011-07-01
Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are
Directory of Open Access Journals (Sweden)
Enrico eMuhr
2016-01-01
Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.
Highly accurate prediction of food challenge outcome using routinely available clinical data.
DunnGalvin, Audrey; Daly, Deirdre; Cullinane, Claire; Stenke, Emily; Keeton, Diane; Erlewyn-Lajeunesse, Mich; Roberts, Graham C; Lucas, Jane; Hourihane, Jonathan O'B
2011-03-01
Serum specific IgE or skin prick tests are less useful at levels below accepted decision points. We sought to develop and validate a model to predict food challenge outcome by using routinely collected data in a diverse sample of children considered suitable for food challenge. The proto-algorithm was generated by using a limited data set from 1 service (phase 1). We retrospectively applied, evaluated, and modified the initial model by using an extended data set in another center (phase 2). Finally, we prospectively validated the model in a blind study in a further group of children undergoing food challenge for peanut, milk, or egg in the second center (phase 3). Allergen-specific models were developed for peanut, egg, and milk. Phase 1 (N = 429) identified 5 clinical factors associated with diagnosis of food allergy by food challenge. In phase 2 (N = 289), we examined the predictive ability of 6 clinical factors: skin prick test, serum specific IgE, total IgE minus serum specific IgE, symptoms, sex, and age. In phase 3 (N = 70), 97% of cases were accurately predicted as positive and 94% as negative. Our model showed an advantage in clinical prediction compared with serum specific IgE only, skin prick test only, and serum specific IgE and skin prick test (92% accuracy vs 57%, and 81%, respectively). Our findings have implications for the improved delivery of food allergy-related health care, enhanced food allergy-related quality of life, and economized use of health service resources by decreasing the number of food challenges performed. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban
2017-07-17
Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana
2018-04-16
Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for
Directory of Open Access Journals (Sweden)
Astha Agarwal
2013-01-01
Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
An Interpretable Machine Learning Model for Accurate Prediction of Sepsis in the ICU.
Nemati, Shamim; Holder, Andre; Razmi, Fereshteh; Stanley, Matthew D; Clifford, Gari D; Buchman, Timothy G
2018-04-01
Sepsis is among the leading causes of morbidity, mortality, and cost overruns in critically ill patients. Early intervention with antibiotics improves survival in septic patients. However, no clinically validated system exists for real-time prediction of sepsis onset. We aimed to develop and validate an Artificial Intelligence Sepsis Expert algorithm for early prediction of sepsis. Observational cohort study. Academic medical center from January 2013 to December 2015. Over 31,000 admissions to the ICUs at two Emory University hospitals (development cohort), in addition to over 52,000 ICU patients from the publicly available Medical Information Mart for Intensive Care-III ICU database (validation cohort). Patients who met the Third International Consensus Definitions for Sepsis (Sepsis-3) prior to or within 4 hours of their ICU admission were excluded, resulting in roughly 27,000 and 42,000 patients within our development and validation cohorts, respectively. None. High-resolution vital signs time series and electronic medical record data were extracted. A set of 65 features (variables) were calculated on hourly basis and passed to the Artificial Intelligence Sepsis Expert algorithm to predict onset of sepsis in the proceeding T hours (where T = 12, 8, 6, or 4). Artificial Intelligence Sepsis Expert was used to predict onset of sepsis in the proceeding T hours and to produce a list of the most significant contributing factors. For the 12-, 8-, 6-, and 4-hour ahead prediction of sepsis, Artificial Intelligence Sepsis Expert achieved area under the receiver operating characteristic in the range of 0.83-0.85. Performance of the Artificial Intelligence Sepsis Expert on the development and validation cohorts was indistinguishable. Using data available in the ICU in real-time, Artificial Intelligence Sepsis Expert can accurately predict the onset of sepsis in an ICU patient 4-12 hours prior to clinical recognition. A prospective study is necessary to determine the
Liu, Yi; Anusonti-Inthra, Phuriwat; Diskin, Boris
2011-01-01
A physics-based, systematically coupled, multidisciplinary prediction tool (MUTE) for rotorcraft noise was developed and validated with a wide range of flight configurations and conditions. MUTE is an aggregation of multidisciplinary computational tools that accurately and efficiently model the physics of the source of rotorcraft noise, and predict the noise at far-field observer locations. It uses systematic coupling approaches among multiple disciplines including Computational Fluid Dynamics (CFD), Computational Structural Dynamics (CSD), and high fidelity acoustics. Within MUTE, advanced high-order CFD tools are used around the rotor blade to predict the transonic flow (shock wave) effects, which generate the high-speed impulsive noise. Predictions of the blade-vortex interaction noise in low speed flight are also improved by using the Particle Vortex Transport Method (PVTM), which preserves the wake flow details required for blade/wake and fuselage/wake interactions. The accuracy of the source noise prediction is further improved by utilizing a coupling approach between CFD and CSD, so that the effects of key structural dynamics, elastic blade deformations, and trim solutions are correctly represented in the analysis. The blade loading information and/or the flow field parameters around the rotor blade predicted by the CFD/CSD coupling approach are used to predict the acoustic signatures at far-field observer locations with a high-fidelity noise propagation code (WOPWOP3). The predicted results from the MUTE tool for rotor blade aerodynamic loading and far-field acoustic signatures are compared and validated with a variation of experimental data sets, such as UH60-A data, DNW test data and HART II test data.
Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier
2014-01-01
The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari
2012-09-28
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari
2012-01-01
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963
Rey, M.; Nikitin, A. V.; Tyuterev, V.
2014-06-01
Knowledge of near infrared intensities of rovibrational transitions of polyatomic molecules is essential for the modeling of various planetary atmospheres, brown dwarfs and for other astrophysical applications 1,2,3. For example, to analyze exoplanets, atmospheric models have been developed, thus making the need to provide accurate spectroscopic data. Consequently, the spectral characterization of such planetary objects relies on the necessity of having adequate and reliable molecular data in extreme conditions (temperature, optical path length, pressure). On the other hand, in the modeling of astrophysical opacities, millions of lines are generally involved and the line-by-line extraction is clearly not feasible in laboratory measurements. It is thus suggested that this large amount of data could be interpreted only by reliable theoretical predictions. There exists essentially two theoretical approaches for the computation and prediction of spectra. The first one is based on empirically-fitted effective spectroscopic models. Another way for computing energies, line positions and intensities is based on global variational calculations using ab initio surfaces. They do not yet reach the spectroscopic accuracy stricto sensu but implicitly account for all intramolecular interactions including resonance couplings in a wide spectral range. The final aim of this work is to provide reliable predictions which could be quantitatively accurate with respect to the precision of available observations and as complete as possible. All this thus requires extensive first-principles quantum mechanical calculations essentially based on three necessary ingredients which are (i) accurate intramolecular potential energy surface and dipole moment surface components well-defined in a large range of vibrational displacements and (ii) efficient computational methods combined with suitable choices of coordinates to account for molecular symmetry properties and to achieve a good numerical
Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin
2013-01-01
The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Directory of Open Access Journals (Sweden)
Ruiqing Ming
2017-01-01
Full Text Available Current common models for calculating continuous liquid-carrying critical gas velocity are established based on vertical wells and laminar flow without considering the influence of deviation angle and Reynolds number on liquid-carrying. With the increase of the directional well in transition flow or turbulent flow, the current common models cannot accurately predict the critical gas velocity of these wells. So we built a new model to predict continuous liquid-carrying critical gas velocity for directional well in transition flow or turbulent flow. It is shown from sensitivity analysis that the correction coefficient is mainly influenced by Reynolds number and deviation angle. With the increase of Reynolds number, the critical liquid-carrying gas velocity increases first and then decreases. And with the increase of deviation angle, the critical liquid-carrying gas velocity gradually decreases. It is indicated from the case calculation analysis that the calculation error of this new model is less than 10%, where accuracy is much higher than those of current common models. It is demonstrated that the continuous liquid-carrying critical gas velocity of directional well in transition flow or turbulent flow can be predicted accurately by using this new model.
Accurate and dynamic predictive model for better prediction in medicine and healthcare.
Alanazi, H O; Abdullah, A H; Qureshi, K N; Ismail, A S
2018-05-01
Information and communication technologies (ICTs) have changed the trend into new integrated operations and methods in all fields of life. The health sector has also adopted new technologies to improve the systems and provide better services to customers. Predictive models in health care are also influenced from new technologies to predict the different disease outcomes. However, still, existing predictive models have suffered from some limitations in terms of predictive outcomes performance. In order to improve predictive model performance, this paper proposed a predictive model by classifying the disease predictions into different categories. To achieve this model performance, this paper uses traumatic brain injury (TBI) datasets. TBI is one of the serious diseases worldwide and needs more attention due to its seriousness and serious impacts on human life. The proposed predictive model improves the predictive performance of TBI. The TBI data set is developed and approved by neurologists to set its features. The experiment results show that the proposed model has achieved significant results including accuracy, sensitivity, and specificity.
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted
Notas, George; Bariotakis, Michail; Kalogrias, Vaios; Andrianaki, Maria; Azariadis, Kalliopi; Kampouri, Errika; Theodoropoulou, Katerina; Lavrentaki, Katerina; Kastrinakis, Stelios; Kampa, Marilena; Agouridakis, Panagiotis; Pirintsos, Stergios; Castanas, Elias
2015-01-01
Severe allergic reactions of unknown etiology,necessitating a hospital visit, have an important impact in the life of affected individuals and impose a major economic burden to societies. The prediction of clinically severe allergic reactions would be of great importance, but current attempts have been limited by the lack of a well-founded applicable methodology and the wide spatiotemporal distribution of allergic reactions. The valid prediction of severe allergies (and especially those needing hospital treatment) in a region, could alert health authorities and implicated individuals to take appropriate preemptive measures. In the present report we have collecterd visits for serious allergic reactions of unknown etiology from two major hospitals in the island of Crete, for two distinct time periods (validation and test sets). We have used the Normalized Difference Vegetation Index (NDVI), a satellite-based, freely available measurement, which is an indicator of live green vegetation at a given geographic area, and a set of meteorological data to develop a model capable of describing and predicting severe allergic reaction frequency. Our analysis has retained NDVI and temperature as accurate identifiers and predictors of increased hospital severe allergic reactions visits. Our approach may contribute towards the development of satellite-based modules, for the prediction of severe allergic reactions in specific, well-defined geographical areas. It could also probably be used for the prediction of other environment related diseases and conditions.
Bastani, Meysam; Vos, Larissa; Asgarian, Nasimeh; Deschenes, Jean; Graham, Kathryn; Mackey, John; Greiner, Russell
2013-01-01
Background Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER) status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. Methods To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. Results This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. Conclusions Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions. PMID:24312637
Ben Ali, Jaouher; Chebel-Morello, Brigitte; Saidi, Lotfi; Malinowski, Simon; Fnaiech, Farhat
2015-05-01
Accurate remaining useful life (RUL) prediction of critical assets is an important challenge in condition based maintenance to improve reliability and decrease machine's breakdown and maintenance's cost. Bearing is one of the most important components in industries which need to be monitored and the user should predict its RUL. The challenge of this study is to propose an original feature able to evaluate the health state of bearings and to estimate their RUL by Prognostics and Health Management (PHM) techniques. In this paper, the proposed method is based on the data-driven prognostic approach. The combination of Simplified Fuzzy Adaptive Resonance Theory Map (SFAM) neural network and Weibull distribution (WD) is explored. WD is used just in the training phase to fit measurement and to avoid areas of fluctuation in the time domain. SFAM training process is based on fitted measurements at present and previous inspection time points as input. However, the SFAM testing process is based on real measurements at present and previous inspections. Thanks to the fuzzy learning process, SFAM has an important ability and a good performance to learn nonlinear time series. As output, seven classes are defined; healthy bearing and six states for bearing degradation. In order to find the optimal RUL prediction, a smoothing phase is proposed in this paper. Experimental results show that the proposed method can reliably predict the RUL of rolling element bearings (REBs) based on vibration signals. The proposed prediction approach can be applied to prognostic other various mechanical assets.
DEFF Research Database (Denmark)
Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence
2005-01-01
Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...
Measuring solar reflectance - Part I: Defining a metric that accurately predicts solar heat gain
Energy Technology Data Exchange (ETDEWEB)
Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul [Heat Island Group, Environmental Energy Technologies Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)
2010-09-15
Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective ''cool colored'' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland US latitudes, this metric R{sub E891BN} can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {<=} 5:12 [23 ]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool roof net energy savings by as much as 23%. We define clear sky air mass one global horizontal (''AM1GH'') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer. (author)
Measuring solar reflectance Part I: Defining a metric that accurately predicts solar heat gain
Energy Technology Data Exchange (ETDEWEB)
Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul
2010-05-14
Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective 'cool colored' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland U.S. latitudes, this metric RE891BN can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {le} 5:12 [23{sup o}]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool-roof net energy savings by as much as 23%. We define clear-sky air mass one global horizontal ('AM1GH') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer.
Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent
2000-01-01
In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...
Energy Technology Data Exchange (ETDEWEB)
Jendeberg, Johan; Geijer, Haakan; Alshamari, Muhammed; Liden, Mats [Oerebro University Hospital, Department of Radiology, Faculty of Medicine and Health, Oerebro (Sweden); Cierzniak, Bartosz [Oerebro University, Department of Surgery, Faculty of Medicine and Health, Oerebro (Sweden)
2017-11-15
To determine how to most accurately predict the chance of spontaneous passage of a ureteral stone using information in the diagnostic non-enhanced computed tomography (NECT) and to create predictive models with smaller stone size intervals than previously possible. Retrospectively 392 consecutive patients with ureteric stone on NECT were included. Three radiologists independently measured the stone size. Stone location, side, hydronephrosis, CRP, medical expulsion therapy (MET) and all follow-up radiology until stone expulsion or 26 weeks were recorded. Logistic regressions were performed with spontaneous stone passage in 4 weeks and 20 weeks as the dependent variable. The spontaneous passage rate in 20 weeks was 312 out of 392 stones, 98% in 0-2 mm, 98% in 3 mm, 81% in 4 mm, 65% in 5 mm, 33% in 6 mm and 9% in ≥6.5 mm wide stones. The stone size and location predicted spontaneous ureteric stone passage. The side and the grade of hydronephrosis only predicted stone passage in specific subgroups. Spontaneous passage of a ureteral stone can be predicted with high accuracy with the information available in the NECT. We present a prediction method based on stone size and location. (orig.)
Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade
Czech Academy of Sciences Publication Activity Database
Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav
2015-01-01
Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015
Purification and crystallization of Phd, the antitoxin of the phd/doc operon
International Nuclear Information System (INIS)
Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy
2010-01-01
The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA
DEFF Research Database (Denmark)
Poulsen, Peter; Jensen, Kaj Frank
1992-01-01
We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...
Directory of Open Access Journals (Sweden)
Mariana Noelia Viale
2014-01-01
Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.
Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.
Marincola, Gabriella; Wolz, Christiane
2017-06-02
In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
De Vore, Karl W; Fatahi, Nadia M; Sass, John E
2016-08-01
Arrhenius modeling of analyte recovery at increased temperatures to predict long-term colder storage stability of biological raw materials, reagents, calibrators, and controls is standard practice in the diagnostics industry. Predicting subzero temperature stability using the same practice is frequently criticized but nevertheless heavily relied upon. We compared the ability to predict analyte recovery during frozen storage using 3 separate strategies: traditional accelerated studies with Arrhenius modeling, and extrapolation of recovery at 20% of shelf life using either ordinary least squares or a radical equation y = B1x(0.5) + B0. Computer simulations were performed to establish equivalence of statistical power to discern the expected changes during frozen storage or accelerated stress. This was followed by actual predictive and follow-up confirmatory testing of 12 chemistry and immunoassay analytes. Linear extrapolations tended to be the most conservative in the predicted percent recovery, reducing customer and patient risk. However, the majority of analytes followed a rate of change that slowed over time, which was fit best to a radical equation of the form y = B1x(0.5) + B0. Other evidence strongly suggested that the slowing of the rate was not due to higher-order kinetics, but to changes in the matrix during storage. Predicting shelf life of frozen products through extrapolation of early initial real-time storage analyte recovery should be considered the most accurate method. Although in this study the time required for a prediction was longer than a typical accelerated testing protocol, there are less potential sources of error, reduced costs, and a lower expenditure of resources. © 2016 American Association for Clinical Chemistry.
Does the emergency surgery score accurately predict outcomes in emergent laparotomies?
Peponis, Thomas; Bohnen, Jordan D; Sangji, Naveen F; Nandan, Anirudh R; Han, Kelsey; Lee, Jarone; Yeh, D Dante; de Moya, Marc A; Velmahos, George C; Chang, David C; Kaafarani, Haytham M A
2017-08-01
The emergency surgery score is a mortality-risk calculator for emergency general operation patients. We sought to examine whether the emergency surgery score predicts 30-day morbidity and mortality in a high-risk group of patients undergoing emergent laparotomy. Using the 2011-2012 American College of Surgeons National Surgical Quality Improvement Program database, we identified all patients who underwent emergent laparotomy using (1) the American College of Surgeons National Surgical Quality Improvement Program definition of "emergent," and (2) all Current Procedural Terminology codes denoting a laparotomy, excluding aortic aneurysm rupture. Multivariable logistic regression analyses were performed to measure the correlation (c-statistic) between the emergency surgery score and (1) 30-day mortality, and (2) 30-day morbidity after emergent laparotomy. As sensitivity analyses, the correlation between the emergency surgery score and 30-day mortality was also evaluated in prespecified subgroups based on Current Procedural Terminology codes. A total of 26,410 emergent laparotomy patients were included. Thirty-day mortality and morbidity were 10.2% and 43.8%, respectively. The emergency surgery score correlated well with mortality (c-statistic = 0.84); scores of 1, 11, and 22 correlated with mortalities of 0.4%, 39%, and 100%, respectively. Similarly, the emergency surgery score correlated well with morbidity (c-statistic = 0.74); scores of 0, 7, and 11 correlated with complication rates of 13%, 58%, and 79%, respectively. The morbidity rates plateaued for scores higher than 11. Sensitivity analyses demonstrated that the emergency surgery score effectively predicts mortality in patients undergoing emergent (1) splenic, (2) gastroduodenal, (3) intestinal, (4) hepatobiliary, or (5) incarcerated ventral hernia operation. The emergency surgery score accurately predicts outcomes in all types of emergent laparotomy patients and may prove valuable as a bedside decision
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Burbank, Lindsey P.; Van Horn, Christopher R.
2017-01-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...
Directory of Open Access Journals (Sweden)
Meysam Bastani
Full Text Available BACKGROUND: Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. METHODS: To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. RESULTS: This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. CONCLUSIONS: Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions.
In vitro transcription accurately predicts lac repressor phenotype in vivo in Escherichia coli
Directory of Open Access Journals (Sweden)
Matthew Almond Sochor
2014-07-01
Full Text Available A multitude of studies have looked at the in vivo and in vitro behavior of the lac repressor binding to DNA and effector molecules in order to study transcriptional repression, however these studies are not always reconcilable. Here we use in vitro transcription to directly mimic the in vivo system in order to build a self consistent set of experiments to directly compare in vivo and in vitro genetic repression. A thermodynamic model of the lac repressor binding to operator DNA and effector is used to link DNA occupancy to either normalized in vitro mRNA product or normalized in vivo fluorescence of a regulated gene, YFP. An accurate measurement of repressor, DNA and effector concentrations were made both in vivo and in vitro allowing for direct modeling of the entire thermodynamic equilibrium. In vivo repression profiles are accurately predicted from the given in vitro parameters when molecular crowding is considered. Interestingly, our measured repressor–operator DNA affinity differs significantly from previous in vitro measurements. The literature values are unable to replicate in vivo binding data. We therefore conclude that the repressor-DNA affinity is much weaker than previously thought. This finding would suggest that in vitro techniques that are specifically designed to mimic the in vivo process may be necessary to replicate the native system.
Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi
2016-06-01
To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Wang, Mingyu; Han, Lijuan; Liu, Shasha; Zhao, Xuebing; Yang, Jinghua; Loh, Soh Kheang; Sun, Xiaomin; Zhang, Chenxi; Fang, Xu
2015-09-01
Renewable energy from lignocellulosic biomass has been deemed an alternative to depleting fossil fuels. In order to improve this technology, we aim to develop robust mathematical models for the enzymatic lignocellulose degradation process. By analyzing 96 groups of previously published and newly obtained lignocellulose saccharification results and fitting them to Weibull distribution, we discovered Weibull statistics can accurately predict lignocellulose saccharification data, regardless of the type of substrates, enzymes and saccharification conditions. A mathematical model for enzymatic lignocellulose degradation was subsequently constructed based on Weibull statistics. Further analysis of the mathematical structure of the model and experimental saccharification data showed the significance of the two parameters in this model. In particular, the λ value, defined the characteristic time, represents the overall performance of the saccharification system. This suggestion was further supported by statistical analysis of experimental saccharification data and analysis of the glucose production levels when λ and n values change. In conclusion, the constructed Weibull statistics-based model can accurately predict lignocellulose hydrolysis behavior and we can use the λ parameter to assess the overall performance of enzymatic lignocellulose degradation. Advantages and potential applications of the model and the λ value in saccharification performance assessment were discussed. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G
2015-08-01
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop
International Nuclear Information System (INIS)
ZareNezhad, Bahman; Aminian, Ali
2011-01-01
This paper presents a new approach based on using an artificial neural network (ANN) model for predicting the acid dew points of the combustion gases in process and power plants. The most important acidic combustion gases namely, SO 3 , SO 2 , NO 2 , HCl and HBr are considered in this investigation. Proposed Network is trained using the Levenberg-Marquardt back propagation algorithm and the hyperbolic tangent sigmoid activation function is applied to calculate the output values of the neurons of the hidden layer. According to the network's training, validation and testing results, a three layer neural network with nine neurons in the hidden layer is selected as the best architecture for accurate prediction of the acidic combustion gases dew points over wide ranges of acid and moisture concentrations. The proposed neural network model can have significant application in predicting the condensation temperatures of different acid gases to mitigate the corrosion problems in stacks, pollution control devices and energy recovery systems.
Varmanen, P; Rantanen, T; Palva, A
1996-12-01
A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.
DEFF Research Database (Denmark)
Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.
2011-01-01
Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...
Directory of Open Access Journals (Sweden)
Michelle H. Cameron
2013-01-01
Full Text Available Background. Many people with MS fall, but the best method for identifying those at increased fall risk is not known. Objective. To compare how accurately fall history, questionnaires, and physical tests predict future falls and injurious falls in people with MS. Methods. 52 people with MS were asked if they had fallen in the past 2 months and the past year. Subjects were also assessed with the Activities-specific Balance Confidence, Falls Efficacy Scale-International, and Multiple Sclerosis Walking Scale-12 questionnaires, the Expanded Disability Status Scale, Timed 25-Foot Walk, and computerized dynamic posturography and recorded their falls daily for the following 6 months with calendars. The ability of baseline assessments to predict future falls was compared using receiver operator curves and logistic regression. Results. All tests individually provided similar fall prediction (area under the curve (AUC 0.60–0.75. A fall in the past year was the best predictor of falls (AUC 0.75, sensitivity 0.89, specificity 0.56 or injurious falls (AUC 0.69, sensitivity 0.96, specificity 0.41 in the following 6 months. Conclusion. Simply asking people with MS if they have fallen in the past year predicts future falls and injurious falls as well as more complex, expensive, or time-consuming approaches.
Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim
2014-01-01
The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432
Directory of Open Access Journals (Sweden)
Ziqing eDeng
2013-07-01
Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
DEFF Research Database (Denmark)
Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian
1994-01-01
specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...
Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model
Cao, Xin; Song, Yongli; Zhang, Tonghua
In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.
Harb, Moussab
2015-01-01
Using accurate first-principles quantum calculations based on DFT (including the perturbation theory DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we predict essential fundamental properties (such as bandgap, optical absorption coefficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit relatively high absorption efficiencies in the visible range, high dielectric constants, high charge carrier mobilities and much lower exciton binding energies than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties are found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices like Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.
Harb, Moussab
2015-08-26
Using accurate first-principles quantum calculations based on DFT (including the perturbation theory DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we predict essential fundamental properties (such as bandgap, optical absorption coefficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit relatively high absorption efficiencies in the visible range, high dielectric constants, high charge carrier mobilities and much lower exciton binding energies than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties are found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices like Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.
Directory of Open Access Journals (Sweden)
Magdalena Ydreborg
Full Text Available Diagnosis of liver cirrhosis is essential in the management of chronic hepatitis C virus (HCV infection. Liver biopsy is invasive and thus entails a risk of complications as well as a potential risk of sampling error. Therefore, non-invasive diagnostic tools are preferential. The aim of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive significance for liver fibrosis in 278 patients originally included in a multicenter phase III treatment trial for chronic HCV infection. A stepwise multivariate logistic model selection was performed with liver cirrhosis, defined as Ishak fibrosis stage 5-6, as the outcome variable. A new index, referred to as Nordic Liver Index (NoLI in the paper, was based on the model: Log-odds (predicting cirrhosis = -12.17+ (age × 0.11 + (BMI (kg/m(2 × 0.23 + (D7-lathosterol (μg/100 mg cholesterol×(-0.013 + (Platelet count (x10(9/L × (-0.018 + (Prothrombin-INR × 3.69. The area under the ROC curve (AUROC for prediction of cirrhosis was 0.91 (95% CI 0.86-0.96. The index was validated in a separate cohort of 83 patients and the AUROC for this cohort was similar (0.90; 95% CI: 0.82-0.98. In conclusion, the new index may complement other methods in diagnosing cirrhosis in patients with chronic HCV infection.
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon
International Nuclear Information System (INIS)
Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.
1988-01-01
Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs
Rahmati, Mehdi
2017-08-01
Developing accurate and reliable pedo-transfer functions (PTFs) to predict soil non-readily available characteristics is one of the most concerned topic in soil science and selecting more appropriate predictors is a crucial factor in PTFs' development. Group method of data handling (GMDH), which finds an approximate relationship between a set of input and output variables, not only provide an explicit procedure to select the most essential PTF input variables, but also results in more accurate and reliable estimates than other mostly applied methodologies. Therefore, the current research was aimed to apply GMDH in comparison with multivariate linear regression (MLR) and artificial neural network (ANN) to develop several PTFs to predict soil cumulative infiltration point-basely at specific time intervals (0.5-45 min) using soil readily available characteristics (RACs). In this regard, soil infiltration curves as well as several soil RACs including soil primary particles (clay (CC), silt (Si), and sand (Sa)), saturated hydraulic conductivity (Ks), bulk (Db) and particle (Dp) densities, organic carbon (OC), wet-aggregate stability (WAS), electrical conductivity (EC), and soil antecedent (θi) and field saturated (θfs) water contents were measured at 134 different points in Lighvan watershed, northwest of Iran. Then, applying GMDH, MLR, and ANN methodologies, several PTFs have been developed to predict cumulative infiltrations using two sets of selected soil RACs including and excluding Ks. According to the test data, results showed that developed PTFs by GMDH and MLR procedures using all soil RACs including Ks resulted in more accurate (with E values of 0.673-0.963) and reliable (with CV values lower than 11 percent) predictions of cumulative infiltrations at different specific time steps. In contrast, ANN procedure had lower accuracy (with E values of 0.356-0.890) and reliability (with CV values up to 50 percent) compared to GMDH and MLR. The results also revealed
Harris, Charlie L; Strayhorn, Gregory; Moore, Sandra; Goldman, Brian; Martin, Michelle Y
2016-01-01
Obese African American women under-appraise their body mass index (BMI) classification and report fewer weight loss attempts than women who accurately appraise their weight status. This cross-sectional study examined whether physician-informed weight status could predict weight self-perception and weight self-regulation strategies in obese women. A convenience sample of 118 low-income women completed a survey assessing demographic characteristics, comorbidities, weight self-perception, and weight self-regulation strategies. BMI was calculated during nurse triage. Binary logistic regression models were performed to test hypotheses. The odds of obese accurate appraisers having been informed about their weight status were six times greater than those of under-appraisers. The odds of those using an "approach" self-regulation strategy having been physician-informed were four times greater compared with those using an "avoidance" strategy. Physicians are uniquely positioned to influence accurate weight self-perception and adaptive weight self-regulation strategies in underserved women, reducing their risk for obesity-related morbidity.
Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.
Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo
Kievit, A J; Dobbe, J G G; Streekstra, G J; Blankevoort, L; Schafroth, M U
2018-06-01
Malalignment of implants is a major source of failure during total knee arthroplasty. To achieve more accurate 3D planning and execution of the osteotomy cuts during surgery, the Signature (Biomet, Warsaw) patient-specific instrumentation (PSI) was used to produce pin guides for the positioning of the osteotomy blocks by means of computer-aided manufacture based on CT scan images. The research question of this study is: what is the transfer accuracy of osteotomy planes predicted by the Signature PSI system for preoperative 3D planning and intraoperative block-guided pin placement to perform total knee arthroplasty procedures? The transfer accuracy achieved by using the Signature PSI system was evaluated by comparing the osteotomy planes predicted preoperatively with the osteotomy planes seen intraoperatively in human cadaveric legs. Outcomes were measured in terms of translational and rotational errors (varus, valgus, flexion, extension and axial rotation) for both tibia and femur osteotomies. Average translational errors between the osteotomy planes predicted using the Signature system and the actual osteotomy planes achieved was 0.8 mm (± 0.5 mm) for the tibia and 0.7 mm (± 4.0 mm) for the femur. Average rotational errors in relation to predicted and achieved osteotomy planes were 0.1° (± 1.2°) of varus and 0.4° (± 1.7°) of anterior slope (extension) for the tibia, and 2.8° (± 2.0°) of varus and 0.9° (± 2.7°) of flexion and 1.4° (± 2.2°) of external rotation for the femur. The similarity between osteotomy planes predicted using the Signature system and osteotomy planes actually achieved was excellent for the tibia although some discrepancies were seen for the femur. The use of 3D system techniques in TKA surgery can provide accurate intraoperative guidance, especially for patients with deformed bone, tailored to individual patients and ensure better placement of the implant.
DEFF Research Database (Denmark)
Schultz-Larsen, Kirsten; Lomholt, Rikke Kirstine; Kreiner, Svend
2006-01-01
.4%), and positive predictive value (71.0%) but equal area under the receiver operating characteristic curve. Cross-validation on follow-up data confirmed the results. CONCLUSION: A short, valid MMSE, which is as sensitive and specific as the original MMSE for the screening of cognitive impairments and dementia......OBJECTIVES: This study assesses the properties of the Mini-Mental State Examination (MMSE) with the purpose of improving the efficiencies of the methods of screening for cognitive impairment and dementia. A specific purpose was to determine whether an abbreviated version would be as accurate...... is attractive for research and clinical practice, particularly if predictive power can be enhanced by combining the short MMSE with neuropsychological tests or informant reports....
Deformation, Failure, and Fatigue Life of SiC/Ti-15-3 Laminates Accurately Predicted by MAC/GMC
Bednarcyk, Brett A.; Arnold, Steven M.
2002-01-01
NASA Glenn Research Center's Micromechanics Analysis Code with Generalized Method of Cells (MAC/GMC) (ref.1) has been extended to enable fully coupled macro-micro deformation, failure, and fatigue life predictions for advanced metal matrix, ceramic matrix, and polymer matrix composites. Because of the multiaxial nature of the code's underlying micromechanics model, GMC--which allows the incorporation of complex local inelastic constitutive models--MAC/GMC finds its most important application in metal matrix composites, like the SiC/Ti-15-3 composite examined here. Furthermore, since GMC predicts the microscale fields within each constituent of the composite material, submodels for local effects such as fiber breakage, interfacial debonding, and matrix fatigue damage can and have been built into MAC/GMC. The present application of MAC/GMC highlights the combination of these features, which has enabled the accurate modeling of the deformation, failure, and life of titanium matrix composites.
Role of the Escherichia coli glnALG operon in regulation of ammonium transport
International Nuclear Information System (INIS)
Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.
1986-01-01
Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt
Joshi, Shuchi N; Srinivas, Nuggehally R; Parmar, Deven V
2018-03-01
Our aim was to develop and validate the extrapolative performance of a regression model using a limited sampling strategy for accurate estimation of the area under the plasma concentration versus time curve for saroglitazar. Healthy subject pharmacokinetic data from a well-powered food-effect study (fasted vs fed treatments; n = 50) was used in this work. The first 25 subjects' serial plasma concentration data up to 72 hours and corresponding AUC 0-t (ie, 72 hours) from the fasting group comprised a training dataset to develop the limited sampling model. The internal datasets for prediction included the remaining 25 subjects from the fasting group and all 50 subjects from the fed condition of the same study. The external datasets included pharmacokinetic data for saroglitazar from previous single-dose clinical studies. Limited sampling models were composed of 1-, 2-, and 3-concentration-time points' correlation with AUC 0-t of saroglitazar. Only models with regression coefficients (R 2 ) >0.90 were screened for further evaluation. The best R 2 model was validated for its utility based on mean prediction error, mean absolute prediction error, and root mean square error. Both correlations between predicted and observed AUC 0-t of saroglitazar and verification of precision and bias using Bland-Altman plot were carried out. None of the evaluated 1- and 2-concentration-time points models achieved R 2 > 0.90. Among the various 3-concentration-time points models, only 4 equations passed the predefined criterion of R 2 > 0.90. Limited sampling models with time points 0.5, 2, and 8 hours (R 2 = 0.9323) and 0.75, 2, and 8 hours (R 2 = 0.9375) were validated. Mean prediction error, mean absolute prediction error, and root mean square error were prediction of saroglitazar. The same models, when applied to the AUC 0-t prediction of saroglitazar sulfoxide, showed mean prediction error, mean absolute prediction error, and root mean square error model predicts the exposure of
Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...
Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan
2014-11-01
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024
Directory of Open Access Journals (Sweden)
Kavita Yadav
Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.
Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari
2017-03-01
In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.
The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis
Ahn, Sang-Joon; Burne, Robert A.
2006-01-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...
Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro
2015-12-28
The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological
Lin, Jing-Wen
2016-01-01
Holding scientific conceptions and having the ability to accurately predict students' preconceptions are a prerequisite for science teachers to design appropriate constructivist-oriented learning experiences. This study explored the types and sources of students' preconceptions of electric circuits. First, 438 grade 3 (9 years old) students were…
Directory of Open Access Journals (Sweden)
Altenbuchner Josef
2011-10-01
Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on
Xie, Tian; Grossman, Jeffrey C.
2018-04-01
The use of machine learning methods for accelerating the design of crystalline materials usually requires manually constructed feature vectors or complex transformation of atom coordinates to input the crystal structure, which either constrains the model to certain crystal types or makes it difficult to provide chemical insights. Here, we develop a crystal graph convolutional neural networks framework to directly learn material properties from the connection of atoms in the crystal, providing a universal and interpretable representation of crystalline materials. Our method provides a highly accurate prediction of density functional theory calculated properties for eight different properties of crystals with various structure types and compositions after being trained with 1 04 data points. Further, our framework is interpretable because one can extract the contributions from local chemical environments to global properties. Using an example of perovskites, we show how this information can be utilized to discover empirical rules for materials design.
International Nuclear Information System (INIS)
Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.
2011-01-01
Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein
Liang, Yufeng; Vinson, John; Pemmaraju, Sri; Drisdell, Walter S; Shirley, Eric L; Prendergast, David
2017-03-03
Constrained-occupancy delta-self-consistent-field (ΔSCF) methods and many-body perturbation theories (MBPT) are two strategies for obtaining electronic excitations from first principles. Using the two distinct approaches, we study the O 1s core excitations that have become increasingly important for characterizing transition-metal oxides and understanding strong electronic correlation. The ΔSCF approach, in its current single-particle form, systematically underestimates the pre-edge intensity for chosen oxides, despite its success in weakly correlated systems. By contrast, the Bethe-Salpeter equation within MBPT predicts much better line shapes. This motivates one to reexamine the many-electron dynamics of x-ray excitations. We find that the single-particle ΔSCF approach can be rectified by explicitly calculating many-electron transition amplitudes, producing x-ray spectra in excellent agreement with experiments. This study paves the way to accurately predict x-ray near-edge spectral fingerprints for physics and materials science beyond the Bethe-Salpether equation.
International Nuclear Information System (INIS)
Du, Xia; Zhao, Dong-Xia; Yang, Zhong-Zhi
2013-01-01
Highlights: ► A method from new respect to characterize and measure the bond strength is proposed. ► We calculate the D pb of a series of various bonds to justify our approach. ► A quite good linear relationship of the D pb with the bond lengths for series of various bonds is shown. ► Take the prediction of strengths of C–H and N–H bonds for base pairs in DNA as a practical application of our method. - Abstract: A new approach to characterize and measure bond strength has been developed. First, we propose a method to accurately calculate the potential acting on an electron in a molecule (PAEM) at the saddle point along a chemical bond in situ, denoted by D pb . Then, a direct method to quickly evaluate bond strength is established. We choose some familiar molecules as models for benchmarking this method. As a practical application, the D pb of base pairs in DNA along C–H and N–H bonds are obtained for the first time. All results show that C 7 –H of A–T and C 8 –H of G–C are the relatively weak bonds that are the injured positions in DNA damage. The significance of this work is twofold: (i) A method is developed to calculate D pb of various sizable molecules in situ quickly and accurately; (ii) This work demonstrates the feasibility to quickly predict the bond strength in macromolecules
Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.
Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S
2006-03-01
Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.
Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka
2017-08-15
Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the
Directory of Open Access Journals (Sweden)
Keyhani Nemat O
2004-06-01
Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575
DEFF Research Database (Denmark)
Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø
1997-01-01
A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...
Directory of Open Access Journals (Sweden)
Bianca Schwartbeck
2016-11-01
Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.
Accurate Prediction of Coronary Artery Disease Using Bioinformatics Algorithms
Directory of Open Access Journals (Sweden)
Hajar Shafiee
2016-06-01
Full Text Available Background and Objectives: Cardiovascular disease is one of the main causes of death in developed and Third World countries. According to the statement of the World Health Organization, it is predicted that death due to heart disease will rise to 23 million by 2030. According to the latest statistics reported by Iran’s Minister of health, 3.39% of all deaths are attributed to cardiovascular diseases and 19.5% are related to myocardial infarction. The aim of this study was to predict coronary artery disease using data mining algorithms. Methods: In this study, various bioinformatics algorithms, such as decision trees, neural networks, support vector machines, clustering, etc., were used to predict coronary heart disease. The data used in this study was taken from several valid databases (including 14 data. Results: In this research, data mining techniques can be effectively used to diagnose different diseases, including coronary artery disease. Also, for the first time, a prediction system based on support vector machine with the best possible accuracy was introduced. Conclusion: The results showed that among the features, thallium scan variable is the most important feature in the diagnosis of heart disease. Designation of machine prediction models, such as support vector machine learning algorithm can differentiate between sick and healthy individuals with 100% accuracy.
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Yi, Hai-Cheng; You, Zhu-Hong; Huang, De-Shuang; Li, Xiao; Jiang, Tong-Hai; Li, Li-Ping
2018-06-01
The interactions between non-coding RNAs (ncRNAs) and proteins play an important role in many biological processes, and their biological functions are primarily achieved by binding with a variety of proteins. High-throughput biological techniques are used to identify protein molecules bound with specific ncRNA, but they are usually expensive and time consuming. Deep learning provides a powerful solution to computationally predict RNA-protein interactions. In this work, we propose the RPI-SAN model by using the deep-learning stacked auto-encoder network to mine the hidden high-level features from RNA and protein sequences and feed them into a random forest (RF) model to predict ncRNA binding proteins. Stacked assembling is further used to improve the accuracy of the proposed method. Four benchmark datasets, including RPI2241, RPI488, RPI1807, and NPInter v2.0, were employed for the unbiased evaluation of five established prediction tools: RPI-Pred, IPMiner, RPISeq-RF, lncPro, and RPI-SAN. The experimental results show that our RPI-SAN model achieves much better performance than other methods, with accuracies of 90.77%, 89.7%, 96.1%, and 99.33%, respectively. It is anticipated that RPI-SAN can be used as an effective computational tool for future biomedical researches and can accurately predict the potential ncRNA-protein interacted pairs, which provides reliable guidance for biological research. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...
Directory of Open Access Journals (Sweden)
Chris C. Gianfagna
2015-09-01
New hydrological insights for the region: Watershed area ratio was the most important basin parameter for estimating flow at upstream sites based on downstream flow. The area ratio alone explained 93% of the variance in the slopes of relationships between upstream and downstream flows. Regression analysis indicated that flow at any upstream point can be estimated by multiplying the flow at a downstream reference gage by the watershed area ratio. This method accurately predicted upstream flows at area ratios as low as 0.005. We also observed a very strong relationship (R2 = 0.79 between area ratio and flow–flow slopes in non-nested catchments. Our results indicate that a simple flow estimation method based on watershed area ratios is justifiable, and indeed preferred, for the estimation of daily streamflow in ungaged watersheds in the Catskills region.
Accurate and Reliable Prediction of the Binding Affinities of Macrocycles to Their Protein Targets.
Yu, Haoyu S; Deng, Yuqing; Wu, Yujie; Sindhikara, Dan; Rask, Amy R; Kimura, Takayuki; Abel, Robert; Wang, Lingle
2017-12-12
Macrocycles have been emerging as a very important drug class in the past few decades largely due to their expanded chemical diversity benefiting from advances in synthetic methods. Macrocyclization has been recognized as an effective way to restrict the conformational space of acyclic small molecule inhibitors with the hope of improving potency, selectivity, and metabolic stability. Because of their relatively larger size as compared to typical small molecule drugs and the complexity of the structures, efficient sampling of the accessible macrocycle conformational space and accurate prediction of their binding affinities to their target protein receptors poses a great challenge of central importance in computational macrocycle drug design. In this article, we present a novel method for relative binding free energy calculations between macrocycles with different ring sizes and between the macrocycles and their corresponding acyclic counterparts. We have applied the method to seven pharmaceutically interesting data sets taken from recent drug discovery projects including 33 macrocyclic ligands covering a diverse chemical space. The predicted binding free energies are in good agreement with experimental data with an overall root-mean-square error (RMSE) of 0.94 kcal/mol. This is to our knowledge the first time where the free energy of the macrocyclization of linear molecules has been directly calculated with rigorous physics-based free energy calculation methods, and we anticipate the outstanding accuracy demonstrated here across a broad range of target classes may have significant implications for macrocycle drug discovery.
International Nuclear Information System (INIS)
Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.
1988-01-01
We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation
Towards more accurate and reliable predictions for nuclear applications
International Nuclear Information System (INIS)
Goriely, S.
2015-01-01
The need for nuclear data far from the valley of stability, for applications such as nuclear astrophysics or future nuclear facilities, challenges the robustness as well as the predictive power of present nuclear models. Most of the nuclear data evaluation and prediction are still performed on the basis of phenomenological nuclear models. For the last decades, important progress has been achieved in fundamental nuclear physics, making it now feasible to use more reliable, but also more complex microscopic or semi-microscopic models in the evaluation and prediction of nuclear data for practical applications. In the present contribution, the reliability and accuracy of recent nuclear theories are discussed for most of the relevant quantities needed to estimate reaction cross sections and beta-decay rates, namely nuclear masses, nuclear level densities, gamma-ray strength, fission properties and beta-strength functions. It is shown that nowadays, mean-field models can be tuned at the same level of accuracy as the phenomenological models, renormalized on experimental data if needed, and therefore can replace the phenomenogical inputs in the prediction of nuclear data. While fundamental nuclear physicists keep on improving state-of-the-art models, e.g. within the shell model or ab initio models, nuclear applications could make use of their most recent results as quantitative constraints or guides to improve the predictions in energy or mass domain that will remain inaccessible experimentally. (orig.)
Feedforward signal prediction for accurate motion systems using digital filters
Butler, H.
2012-01-01
A positioning system that needs to accurately track a reference can benefit greatly from using feedforward. When using a force actuator, the feedforward needs to generate a force proportional to the reference acceleration, which can be measured by means of an accelerometer or can be created by
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
DEFF Research Database (Denmark)
Mollerup, Christian Brinch; Mardal, Marie; Dalsgaard, Petur Weihe
2018-01-01
artificial neural networks (ANNs). Prediction was based on molecular descriptors, 827 RTs, and 357 CCS values from pharmaceuticals, drugs of abuse, and their metabolites. ANN models for the prediction of RT or CCS separately were examined, and the potential to predict both from a single model......Exact mass, retention time (RT), and collision cross section (CCS) are used as identification parameters in liquid chromatography coupled to ion mobility high resolution accurate mass spectrometry (LC-IM-HRMS). Targeted screening analyses are now more flexible and can be expanded for suspect...
Accurate microRNA target prediction correlates with protein repression levels
Directory of Open Access Journals (Sweden)
Simossis Victor A
2009-09-01
Full Text Available Abstract Background MicroRNAs are small endogenously expressed non-coding RNA molecules that regulate target gene expression through translation repression or messenger RNA degradation. MicroRNA regulation is performed through pairing of the microRNA to sites in the messenger RNA of protein coding genes. Since experimental identification of miRNA target genes poses difficulties, computational microRNA target prediction is one of the key means in deciphering the role of microRNAs in development and disease. Results DIANA-microT 3.0 is an algorithm for microRNA target prediction which is based on several parameters calculated individually for each microRNA and combines conserved and non-conserved microRNA recognition elements into a final prediction score, which correlates with protein production fold change. Specifically, for each predicted interaction the program reports a signal to noise ratio and a precision score which can be used as an indication of the false positive rate of the prediction. Conclusion Recently, several computational target prediction programs were benchmarked based on a set of microRNA target genes identified by the pSILAC method. In this assessment DIANA-microT 3.0 was found to achieve the highest precision among the most widely used microRNA target prediction programs reaching approximately 66%. The DIANA-microT 3.0 prediction results are available online in a user friendly web server at http://www.microrna.gr/microT
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
MEIJER, WG
1994-01-01
During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic
Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia
2016-08-01
Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
Improvement of a land surface model for accurate prediction of surface energy and water balances
International Nuclear Information System (INIS)
Katata, Genki
2009-02-01
In order to predict energy and water balances between the biosphere and atmosphere accurately, sophisticated schemes to calculate evaporation and adsorption processes in the soil and cloud (fog) water deposition on vegetation were implemented in the one-dimensional atmosphere-soil-vegetation model including CO 2 exchange process (SOLVEG2). Performance tests in arid areas showed that the above schemes have a significant effect on surface energy and water balances. The framework of the above schemes incorporated in the SOLVEG2 and instruction for running the model are documented. With further modifications of the model to implement the carbon exchanges between the vegetation and soil, deposition processes of materials on the land surface, vegetation stress-growth-dynamics etc., the model is suited to evaluate an effect of environmental loads to ecosystems by atmospheric pollutants and radioactive substances under climate changes such as global warming and drought. (author)
Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W
2011-12-01
Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...
Magozzi, Sarah; Calosi, Piero
2015-01-01
Predicting species vulnerability to global warming requires a comprehensive, mechanistic understanding of sublethal and lethal thermal tolerances. To date, however, most studies investigating species physiological responses to increasing temperature have focused on the underlying physiological traits of either acute or chronic tolerance in isolation. Here we propose an integrative, synthetic approach including the investigation of multiple physiological traits (metabolic performance and thermal tolerance), and their plasticity, to provide more accurate and balanced predictions on species and assemblage vulnerability to both acute and chronic effects of global warming. We applied this approach to more accurately elucidate relative species vulnerability to warming within an assemblage of six caridean prawns occurring in the same geographic, hence macroclimatic, region, but living in different thermal habitats. Prawns were exposed to four incubation temperatures (10, 15, 20 and 25 °C) for 7 days, their metabolic rates and upper thermal limits were measured, and plasticity was calculated according to the concept of Reaction Norms, as well as Q10 for metabolism. Compared to species occupying narrower/more stable thermal niches, species inhabiting broader/more variable thermal environments (including the invasive Palaemon macrodactylus) are likely to be less vulnerable to extreme acute thermal events as a result of their higher upper thermal limits. Nevertheless, they may be at greater risk from chronic exposure to warming due to the greater metabolic costs they incur. Indeed, a trade-off between acute and chronic tolerance was apparent in the assemblage investigated. However, the invasive species P. macrodactylus represents an exception to this pattern, showing elevated thermal limits and plasticity of these limits, as well as a high metabolic control. In general, integrating multiple proxies for species physiological acute and chronic responses to increasing
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
International Nuclear Information System (INIS)
Wong, Sharon; Back, Michael; Tan, Poh Wee; Lee, Khai Mun; Baggarley, Shaun; Lu, Jaide Jay
2012-01-01
Skin doses have been an important factor in the dose prescription for breast radiotherapy. Recent advances in radiotherapy treatment techniques, such as intensity-modulated radiation therapy (IMRT) and new treatment schemes such as hypofractionated breast therapy have made the precise determination of the surface dose necessary. Detailed information of the dose at various depths of the skin is also critical in designing new treatment strategies. The purpose of this work was to assess the accuracy of surface dose calculation by a clinically used treatment planning system and those measured by thermoluminescence dosimeters (TLDs) in a customized chest wall phantom. This study involved the construction of a chest wall phantom for skin dose assessment. Seven TLDs were distributed throughout each right chest wall phantom to give adequate representation of measured radiation doses. Point doses from the CMS Xio® treatment planning system (TPS) were calculated for each relevant TLD positions and results correlated. There were no significant difference between measured absorbed dose by TLD and calculated doses by the TPS (p > 0.05 (1-tailed). Dose accuracy of up to 2.21% was found. The deviations from the calculated absorbed doses were overall larger (3.4%) when wedges and bolus were used. 3D radiotherapy TPS is a useful and accurate tool to assess the accuracy of surface dose. Our studies have shown that radiation treatment accuracy expressed as a comparison between calculated doses (by TPS) and measured doses (by TLD dosimetry) can be accurately predicted for tangential treatment of the chest wall after mastectomy.
Thieffry, D; Salgado, H; Huerta, A M; Collado-Vides, J
1998-06-01
As one of the best-characterized free-living organisms, Escherichia coli and its recently completed genomic sequence offer a special opportunity to exploit systematically the variety of regulatory data available in the literature in order to make a comprehensive set of regulatory predictions in the whole genome. The complete genome sequence of E.coli was analyzed for the binding of transcriptional regulators upstream of coding sequences. The biological information contained in RegulonDB (Huerta, A.M. et al., Nucleic Acids Res.,26,55-60, 1998) for 56 different transcriptional proteins was the support to implement a stringent strategy combining string search and weight matrices. We estimate that our search included representatives of 15-25% of the total number of regulatory binding proteins in E.coli. This search was performed on the set of 4288 putative regulatory regions, each 450 bp long. Within the regions with predicted sites, 89% are regulated by one protein and 81% involve only one site. These numbers are reasonably consistent with the distribution of experimental regulatory sites. Regulatory sites are found in 603 regions corresponding to 16% of operon regions and 10% of intra-operonic regions. Additional evidence gives stronger support to some of these predictions, including the position of the site, biological consistency with the function of the downstream gene, as well as genetic evidence for the regulatory interaction. The predictions described here were incorporated into the map presented in the paper describing the complete E.coli genome (Blattner,F.R. et al., Science, 277, 1453-1461, 1997). The complete set of predictions in GenBank format is available at the url: http://www. cifn.unam.mx/Computational_Biology/E.coli-predictions ecoli-reg@cifn.unam.mx, collado@cifn.unam.mx
DEFF Research Database (Denmark)
Revelles, O.; Espinosa-Urgel, M.; Molin, Søren
2004-01-01
-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...
Voorhies, Coerte V.; Conrad, Joy
1996-01-01
The geomagnetic spatial power spectrum R(sub n)(r) is the mean square magnetic induction represented by degree n spherical harmonic coefficients of the internal scalar potential averaged over the geocentric sphere of radius r. McLeod's Rule for the magnetic field generated by Earth's core geodynamo says that the expected core surface power spectrum (R(sub nc)(c)) is inversely proportional to (2n + 1) for 1 less than n less than or equal to N(sub E). McLeod's Rule is verified by locating Earth's core with main field models of Magsat data; the estimated core radius of 3485 kn is close to the seismologic value for c of 3480 km. McLeod's Rule and similar forms are then calibrated with the model values of R(sub n) for 3 less than or = n less than or = 12. Extrapolation to the degree 1 dipole predicts the expectation value of Earth's dipole moment to be about 5.89 x 10(exp 22) Am(exp 2)rms (74.5% of the 1980 value) and the expected geomagnetic intensity to be about 35.6 (mu)T rms at Earth's surface. Archeo- and paleomagnetic field intensity data show these and related predictions to be reasonably accurate. The probability distribution chi(exp 2) with 2n+1 degrees of freedom is assigned to (2n + 1)R(sub nc)/(R(sub nc). Extending this to the dipole implies that an exceptionally weak absolute dipole moment (less than or = 20% of the 1980 value) will exist during 2.5% of geologic time. The mean duration for such major geomagnetic dipole power excursions, one quarter of which feature durable axial dipole reversal, is estimated from the modern dipole power time-scale and the statistical model of excursions. The resulting mean excursion duration of 2767 years forces us to predict an average of 9.04 excursions per million years, 2.26 axial dipole reversals per million years, and a mean reversal duration of 5533 years. Paleomagnetic data show these predictions to be quite accurate. McLeod's Rule led to accurate predictions of Earth's core radius, mean paleomagnetic field
Directory of Open Access Journals (Sweden)
Uzma Qaisar
Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.
Hou, Siyuan; Stevenson, Keisean A J M; Harynuk, James J
2018-03-27
This is the third part of a three-part series of papers. In Part I, we presented a method for determining the actual effective geometry of a reference column as well as the thermodynamic-based parameters of a set of probe compounds in an in-house mixture. Part II introduced an approach for estimating the actual effective geometry of a target column by collecting retention data of the same mixture of probe compounds on the target column and using their thermodynamic parameters, acquired on the reference column, as a bridge between both systems. Part III, presented here, demonstrates the retention time transfer and prediction from the reference column to the target column using experimental data for a separate mixture of compounds. To predict the retention time of a new compound, we first estimate its thermodynamic-based parameters on the reference column (using geometric parameters determined previously). The compound's retention time on a second column (of previously determined geometry) is then predicted. The models and the associated optimization algorithms were tested using simulated and experimental data. The accuracy of predicted retention times shows that the proposed approach is simple, fast, and accurate for retention time transfer and prediction between gas chromatography columns. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Unilateral Prostate Cancer Cannot be Accurately Predicted in Low-Risk Patients
International Nuclear Information System (INIS)
Isbarn, Hendrik; Karakiewicz, Pierre I.; Vogel, Susanne
2010-01-01
Purpose: Hemiablative therapy (HAT) is increasing in popularity for treatment of patients with low-risk prostate cancer (PCa). The validity of this therapeutic modality, which exclusively treats PCa within a single prostate lobe, rests on accurate staging. We tested the accuracy of unilaterally unremarkable biopsy findings in cases of low-risk PCa patients who are potential candidates for HAT. Methods and Materials: The study population consisted of 243 men with clinical stage ≤T2a, a prostate-specific antigen (PSA) concentration of <10 ng/ml, a biopsy-proven Gleason sum of ≤6, and a maximum of 2 ipsilateral positive biopsy results out of 10 or more cores. All men underwent a radical prostatectomy, and pathology stage was used as the gold standard. Univariable and multivariable logistic regression models were tested for significant predictors of unilateral, organ-confined PCa. These predictors consisted of PSA, %fPSA (defined as the quotient of free [uncomplexed] PSA divided by the total PSA), clinical stage (T2a vs. T1c), gland volume, and number of positive biopsy cores (2 vs. 1). Results: Despite unilateral stage at biopsy, bilateral or even non-organ-confined PCa was reported in 64% of all patients. In multivariable analyses, no variable could clearly and independently predict the presence of unilateral PCa. This was reflected in an overall accuracy of 58% (95% confidence interval, 50.6-65.8%). Conclusions: Two-thirds of patients with unilateral low-risk PCa, confirmed by clinical stage and biopsy findings, have bilateral or non-organ-confined PCa at radical prostatectomy. This alarming finding questions the safety and validity of HAT.
Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M
2001-04-01
We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.
Masso, Majid; Vaisman, Iosif I
2008-09-15
Accurate predictive models for the impact of single amino acid substitutions on protein stability provide insight into protein structure and function. Such models are also valuable for the design and engineering of new proteins. Previously described methods have utilized properties of protein sequence or structure to predict the free energy change of mutants due to thermal (DeltaDeltaG) and denaturant (DeltaDeltaG(H2O)) denaturations, as well as mutant thermal stability (DeltaT(m)), through the application of either computational energy-based approaches or machine learning techniques. However, accuracy associated with applying these methods separately is frequently far from optimal. We detail a computational mutagenesis technique based on a four-body, knowledge-based, statistical contact potential. For any mutation due to a single amino acid replacement in a protein, the method provides an empirical normalized measure of the ensuing environmental perturbation occurring at every residue position. A feature vector is generated for the mutant by considering perturbations at the mutated position and it's ordered six nearest neighbors in the 3-dimensional (3D) protein structure. These predictors of stability change are evaluated by applying machine learning tools to large training sets of mutants derived from diverse proteins that have been experimentally studied and described. Predictive models based on our combined approach are either comparable to, or in many cases significantly outperform, previously published results. A web server with supporting documentation is available at http://proteins.gmu.edu/automute.
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
Tailly, Thomas; Larish, Yaniv; Nadeau, Brandon; Violette, Philippe; Glickman, Leonard; Olvera-Posada, Daniel; Alenezi, Husain; Amann, Justin; Denstedt, John; Razvi, Hassan
2016-04-01
The mineral composition of a urinary stone may influence its surgical and medical treatment. Previous attempts at identifying stone composition based on mean Hounsfield Units (HUm) have had varied success. We aimed to evaluate the additional use of standard deviation of HU (HUsd) to more accurately predict stone composition. We identified patients from two centers who had undergone urinary stone treatment between 2006 and 2013 and had mineral stone analysis and a computed tomography (CT) available. HUm and HUsd of the stones were compared with ANOVA. Receiver operative characteristic analysis with area under the curve (AUC), Youden index, and likelihood ratio calculations were performed. Data were available for 466 patients. The major components were calcium oxalate monohydrate (COM), uric acid, hydroxyapatite, struvite, brushite, cystine, and CO dihydrate (COD) in 41.4%, 19.3%, 12.4%, 7.5%, 5.8%, 5.4%, and 4.7% of patients, respectively. The HUm of UA and Br was significantly lower and higher than the HUm of any other stone type, respectively. HUm and HUsd were most accurate in predicting uric acid with an AUC of 0.969 and 0.851, respectively. The combined use of HUm and HUsd resulted in increased positive predictive value and higher likelihood ratios for identifying a stone's mineral composition for all stone types but COM. To the best of our knowledge, this is the first report of CT data aiding in the prediction of brushite stone composition. Both HUm and HUsd can help predict stone composition and their combined use results in higher likelihood ratios influencing probability.
Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V
2016-05-13
Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Dynamics of Flexible MLI-type Debris for Accurate Orbit Prediction
2014-09-01
debris for accurate propagation under perturbations”, in Proceedings of 65th International Astronautical Congress (IAC 2014), Toronto, Canada , 2014...Surveillance Network ( SSN ) was able to detect more than 900 pieces of debris that were at risk to damage operational spacecraft. In February 10, 2009...created two large debris clouds and the SSN reported that 382 pieces of debris from Iridium 33 and 893 pieces from Cosmos 2251 were created, and
Wang, Shiyao; Deng, Zhidong; Yin, Gang
2016-02-24
A high-performance differential global positioning system (GPS) receiver with real time kinematics provides absolute localization for driverless cars. However, it is not only susceptible to multipath effect but also unable to effectively fulfill precise error correction in a wide range of driving areas. This paper proposes an accurate GPS-inertial measurement unit (IMU)/dead reckoning (DR) data fusion method based on a set of predictive models and occupancy grid constraints. First, we employ a set of autoregressive and moving average (ARMA) equations that have different structural parameters to build maximum likelihood models of raw navigation. Second, both grid constraints and spatial consensus checks on all predictive results and current measurements are required to have removal of outliers. Navigation data that satisfy stationary stochastic process are further fused to achieve accurate localization results. Third, the standard deviation of multimodal data fusion can be pre-specified by grid size. Finally, we perform a lot of field tests on a diversity of real urban scenarios. The experimental results demonstrate that the method can significantly smooth small jumps in bias and considerably reduce accumulated position errors due to DR. With low computational complexity, the position accuracy of our method surpasses existing state-of-the-arts on the same dataset and the new data fusion method is practically applied in our driverless car.
Directory of Open Access Journals (Sweden)
Shiyao Wang
2016-02-01
Full Text Available A high-performance differential global positioning system (GPS receiver with real time kinematics provides absolute localization for driverless cars. However, it is not only susceptible to multipath effect but also unable to effectively fulfill precise error correction in a wide range of driving areas. This paper proposes an accurate GPS–inertial measurement unit (IMU/dead reckoning (DR data fusion method based on a set of predictive models and occupancy grid constraints. First, we employ a set of autoregressive and moving average (ARMA equations that have different structural parameters to build maximum likelihood models of raw navigation. Second, both grid constraints and spatial consensus checks on all predictive results and current measurements are required to have removal of outliers. Navigation data that satisfy stationary stochastic process are further fused to achieve accurate localization results. Third, the standard deviation of multimodal data fusion can be pre-specified by grid size. Finally, we perform a lot of field tests on a diversity of real urban scenarios. The experimental results demonstrate that the method can significantly smooth small jumps in bias and considerably reduce accumulated position errors due to DR. With low computational complexity, the position accuracy of our method surpasses existing state-of-the-arts on the same dataset and the new data fusion method is practically applied in our driverless car.
Lee, Seung Ah; Choi, Sang-Hee; Chang, Moon Jong
2015-10-27
Anatomic limb alignment often differs from mechanical limb alignment after total knee arthroplasty (TKA). We sought to assess the accuracy, specificity, and sensitivity for each of three commonly used ranges for anatomic limb alignment (3-9°, 5-10° and 2-10°) in predicting an acceptable range (neutral ± 3°) for mechanical limb alignment after TKA. We also assessed whether the accuracy of anatomic limb alignment was affected by anatomic variation. This retrospective study included 314 primary TKAs. The alignment of the limb was measured with both anatomic and mechanical methods of measurement. We also measured anatomic variation, including the femoral bowing angle, tibial bowing angle, and neck-shaft angle of the femur. All angles were measured on the same full-length standing anteroposterior radiographs. The accuracy, specificity, and sensitivity for each range of anatomic limb alignment were calculated and compared using mechanical limb alignment as the reference standard. The associations between the accuracy of anatomic limb alignment and anatomic variation were also determined. The range of 2-10° for anatomic limb alignment showed the highest accuracy, but it was only 73 % (3-9°, 65 %; 5-10°, 67 %). The specificity of the 2-10° range was 81 %, which was higher than that of the other ranges (3-9°, 69 %; 5-10°, 67 %). However, the sensitivity of the 2-10° range to predict varus malalignment was only 16 % (3-9°, 35 %; 5-10°, 68 %). In addition, the sensitivity of the 2-10° range to predict valgus malalignment was only 43 % (3-9°, 71 %; 5-10°, 43 %). The accuracy of anatomical limb alignment was lower for knees with greater femoral (odds ratio = 1.2) and tibial (odds ratio = 1.2) bowing. Anatomic limb alignment did not accurately predict mechanical limb alignment after TKA, and its accuracy was affected by anatomic variation. Thus, alignment after TKA should be assessed by measuring mechanical alignment rather than anatomic
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.
Ahn, Sang-Joon; Burne, Robert A
2006-10-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.
Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H
2014-02-01
A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Directory of Open Access Journals (Sweden)
Luke Czapla
Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier
2017-01-01
The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.
HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.
Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong
2016-01-01
Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
Accurate thermoelastic tensor and acoustic velocities of NaCl
Energy Technology Data Exchange (ETDEWEB)
Marcondes, Michel L., E-mail: michel@if.usp.br [Physics Institute, University of Sao Paulo, Sao Paulo, 05508-090 (Brazil); Chemical Engineering and Material Science, University of Minnesota, Minneapolis, 55455 (United States); Shukla, Gaurav, E-mail: shukla@physics.umn.edu [School of Physics and Astronomy, University of Minnesota, Minneapolis, 55455 (United States); Minnesota supercomputer Institute, University of Minnesota, Minneapolis, 55455 (United States); Silveira, Pedro da [Chemical Engineering and Material Science, University of Minnesota, Minneapolis, 55455 (United States); Wentzcovitch, Renata M., E-mail: wentz002@umn.edu [Chemical Engineering and Material Science, University of Minnesota, Minneapolis, 55455 (United States); Minnesota supercomputer Institute, University of Minnesota, Minneapolis, 55455 (United States)
2015-12-15
Despite the importance of thermoelastic properties of minerals in geology and geophysics, their measurement at high pressures and temperatures are still challenging. Thus, ab initio calculations are an essential tool for predicting these properties at extreme conditions. Owing to the approximate description of the exchange-correlation energy, approximations used in calculations of vibrational effects, and numerical/methodological approximations, these methods produce systematic deviations. Hybrid schemes combining experimental data and theoretical results have emerged as a way to reconcile available information and offer more reliable predictions at experimentally inaccessible thermodynamics conditions. Here we introduce a method to improve the calculated thermoelastic tensor by using highly accurate thermal equation of state (EoS). The corrective scheme is general, applicable to crystalline solids with any symmetry, and can produce accurate results at conditions where experimental data may not exist. We apply it to rock-salt-type NaCl, a material whose structural properties have been challenging to describe accurately by standard ab initio methods and whose acoustic/seismic properties are important for the gas and oil industry.
Kocjan, Tomaz; Janez, Andrej; Stankovic, Milenko; Vidmar, Gaj; Jensterle, Mojca
2016-05-01
Adrenal venous sampling (AVS) is the only available method to distinguish bilateral from unilateral primary aldosteronism (PA). AVS has several drawbacks, so it is reasonable to avoid this procedure when the results would not affect clinical management. Our objective was to identify a clinical criterion that can reliably predict nonlateralized AVS as a surrogate for bilateral PA that is not treated surgically. A retrospective diagnostic cross-sectional study conducted at Slovenian national endocrine referral center included 69 consecutive patients (mean age 56 ± 8 years, 21 females) with PA who underwent AVS. PA was confirmed with the saline infusion test (SIT). AVS was performed sequentially during continuous adrenocorticotrophic hormone (ACTH) infusion. The main outcome measures were variables associated with nonlateralized AVS to derive a clinical prediction rule. Sixty-seven (97%) patients had a successful AVS and were included in the statistical analysis. A total of 39 (58%) patients had nonlateralized AVS. The combined criterion of serum potassium ≥3.5 mmol/L, post-SIT aldosterone AVS. The best overall classification accuracy (50/67 = 75%) was achieved using the post-SIT aldosterone level AVS. Our clinical prediction criterion appears to accurately determine a subset of patients with bilateral PA who could avoid unnecessary AVS and immediately commence with medical treatment.
Directory of Open Access Journals (Sweden)
Opsata Mona
2010-08-01
Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.
Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar
2011-06-10
The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.
Reynolds, Sheila M.; Bilmes, Jeff A.; Noble, William Stafford
2010-01-01
DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence—301 base pairs, centered at the position to be scored—with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the
Directory of Open Access Journals (Sweden)
Sheila M Reynolds
2010-07-01
Full Text Available DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the
Reynolds, Sheila M; Bilmes, Jeff A; Noble, William Stafford
2010-07-08
DNA in eukaryotes is packaged into a chromatin complex, the most basic element of which is the nucleosome. The precise positioning of the nucleosome cores allows for selective access to the DNA, and the mechanisms that control this positioning are important pieces of the gene expression puzzle. We describe a large-scale nucleosome pattern that jointly characterizes the nucleosome core and the adjacent linkers and is predominantly characterized by long-range oscillations in the mono, di- and tri-nucleotide content of the DNA sequence, and we show that this pattern can be used to predict nucleosome positions in both Homo sapiens and Saccharomyces cerevisiae more accurately than previously published methods. Surprisingly, in both H. sapiens and S. cerevisiae, the most informative individual features are the mono-nucleotide patterns, although the inclusion of di- and tri-nucleotide features results in improved performance. Our approach combines a much longer pattern than has been previously used to predict nucleosome positioning from sequence-301 base pairs, centered at the position to be scored-with a novel discriminative classification approach that selectively weights the contributions from each of the input features. The resulting scores are relatively insensitive to local AT-content and can be used to accurately discriminate putative dyad positions from adjacent linker regions without requiring an additional dynamic programming step and without the attendant edge effects and assumptions about linker length modeling and overall nucleosome density. Our approach produces the best dyad-linker classification results published to date in H. sapiens, and outperforms two recently published models on a large set of S. cerevisiae nucleosome positions. Our results suggest that in both genomes, a comparable and relatively small fraction of nucleosomes are well-positioned and that these positions are predictable based on sequence alone. We believe that the bulk of the
Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon
DEFF Research Database (Denmark)
van Wezel, G P; Krab, I M; Douthwaite, S
1994-01-01
Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...
Cluster abundance in chameleon f ( R ) gravity I: toward an accurate halo mass function prediction
Energy Technology Data Exchange (ETDEWEB)
Cataneo, Matteo; Rapetti, David [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, 2100 Copenhagen (Denmark); Lombriser, Lucas [Institute for Astronomy, University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom); Li, Baojiu, E-mail: matteoc@dark-cosmology.dk, E-mail: drapetti@dark-cosmology.dk, E-mail: llo@roe.ac.uk, E-mail: baojiu.li@durham.ac.uk [Institute for Computational Cosmology, Department of Physics, Durham University, South Road, Durham DH1 3LE (United Kingdom)
2016-12-01
We refine the mass and environment dependent spherical collapse model of chameleon f ( R ) gravity by calibrating a phenomenological correction inspired by the parameterized post-Friedmann framework against high-resolution N -body simulations. We employ our method to predict the corresponding modified halo mass function, and provide fitting formulas to calculate the enhancement of the f ( R ) halo abundance with respect to that of General Relativity (GR) within a precision of ∼< 5% from the results obtained in the simulations. Similar accuracy can be achieved for the full f ( R ) mass function on the condition that the modeling of the reference GR abundance of halos is accurate at the percent level. We use our fits to forecast constraints on the additional scalar degree of freedom of the theory, finding that upper bounds competitive with current Solar System tests are within reach of cluster number count analyses from ongoing and upcoming surveys at much larger scales. Importantly, the flexibility of our method allows also for this to be applied to other scalar-tensor theories characterized by a mass and environment dependent spherical collapse.
Directory of Open Access Journals (Sweden)
April M Sapp
Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and
Blackman, Jonathan; Field, Scott E; Galley, Chad R; Szilágyi, Béla; Scheel, Mark A; Tiglio, Manuel; Hemberger, Daniel A
2015-09-18
Simulating a binary black hole coalescence by solving Einstein's equations is computationally expensive, requiring days to months of supercomputing time. Using reduced order modeling techniques, we construct an accurate surrogate model, which is evaluated in a millisecond to a second, for numerical relativity (NR) waveforms from nonspinning binary black hole coalescences with mass ratios in [1, 10] and durations corresponding to about 15 orbits before merger. We assess the model's uncertainty and show that our modeling strategy predicts NR waveforms not used for the surrogate's training with errors nearly as small as the numerical error of the NR code. Our model includes all spherical-harmonic _{-2}Y_{ℓm} waveform modes resolved by the NR code up to ℓ=8. We compare our surrogate model to effective one body waveforms from 50M_{⊙} to 300M_{⊙} for advanced LIGO detectors and find that the surrogate is always more faithful (by at least an order of magnitude in most cases).
Broglia, Riccardo; Durante, Danilo
2017-11-01
This paper focuses on the analysis of a challenging free surface flow problem involving a surface vessel moving at high speeds, or planing. The investigation is performed using a general purpose high Reynolds free surface solver developed at CNR-INSEAN. The methodology is based on a second order finite volume discretization of the unsteady Reynolds-averaged Navier-Stokes equations (Di Mascio et al. in A second order Godunov—type scheme for naval hydrodynamics, Kluwer Academic/Plenum Publishers, Dordrecht, pp 253-261, 2001; Proceedings of 16th international offshore and polar engineering conference, San Francisco, CA, USA, 2006; J Mar Sci Technol 14:19-29, 2009); air/water interface dynamics is accurately modeled by a non standard level set approach (Di Mascio et al. in Comput Fluids 36(5):868-886, 2007a), known as the single-phase level set method. In this algorithm the governing equations are solved only in the water phase, whereas the numerical domain in the air phase is used for a suitable extension of the fluid dynamic variables. The level set function is used to track the free surface evolution; dynamic boundary conditions are enforced directly on the interface. This approach allows to accurately predict the evolution of the free surface even in the presence of violent breaking waves phenomena, maintaining the interface sharp, without any need to smear out the fluid properties across the two phases. This paper is aimed at the prediction of the complex free-surface flow field generated by a deep-V planing boat at medium and high Froude numbers (from 0.6 up to 1.2). In the present work, the planing hull is treated as a two-degree-of-freedom rigid object. Flow field is characterized by the presence of thin water sheets, several energetic breaking waves and plungings. The computational results include convergence of the trim angle, sinkage and resistance under grid refinement; high-quality experimental data are used for the purposes of validation, allowing to
Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel
2014-01-01
Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.
Hounsfield unit density accurately predicts ESWL success.
Magnuson, William J; Tomera, Kevin M; Lance, Raymond S
2005-01-01
Extracorporeal shockwave lithotripsy (ESWL) is a commonly used non-invasive treatment for urolithiasis. Helical CT scans provide much better and detailed imaging of the patient with urolithiasis including the ability to measure density of urinary stones. In this study we tested the hypothesis that density of urinary calculi as measured by CT can predict successful ESWL treatment. 198 patients were treated at Alaska Urological Associates with ESWL between January 2002 and April 2004. Of these 101 met study inclusion with accessible CT scans and stones ranging from 5-15 mm. Follow-up imaging demonstrated stone freedom in 74.2%. The overall mean Houndsfield density value for stone-free compared to residual stone groups were significantly different ( 93.61 vs 122.80 p ESWL for upper tract calculi between 5-15mm.
Morparia, Kavita G; Reddy, Srijaya K; Olivieri, Laura J; Spaeder, Michael C; Schuette, Jennifer J
2018-04-01
The determination of fluid responsiveness in the critically ill child is of vital importance, more so as fluid overload becomes increasingly associated with worse outcomes. Dynamic markers of volume responsiveness have shown some promise in the pediatric population, but more research is needed before they can be adopted for widespread use. Our aim was to investigate effectiveness of respiratory variation in peak aortic velocity and pulse pressure variation to predict fluid responsiveness, and determine their optimal cutoff values. We performed a prospective, observational study at a single tertiary care pediatric center. Twenty-one children with normal cardiorespiratory status undergoing general anesthesia for neurosurgery were enrolled. Respiratory variation in peak aortic velocity (ΔVpeak ao) was measured both before and after volume expansion using a bedside ultrasound device. Pulse pressure variation (PPV) value was obtained from the bedside monitor. All patients received a 10 ml/kg fluid bolus as volume expansion, and were qualified as responders if stroke volume increased >15% as a result. Utility of ΔVpeak ao and PPV and to predict responsiveness to volume expansion was investigated. A baseline ΔVpeak ao value of greater than or equal to 12.3% best predicted a positive response to volume expansion, with a sensitivity of 77%, specificity of 89% and area under receiver operating characteristic curve of 0.90. PPV failed to demonstrate utility in this patient population. Respiratory variation in peak aortic velocity is a promising marker for optimization of perioperative fluid therapy in the pediatric population and can be accurately measured using bedside ultrasonography. More research is needed to evaluate the lack of effectiveness of pulse pressure variation for this purpose.
Energy Technology Data Exchange (ETDEWEB)
Bok, H.-H.; Kim, S.N.; Suh, D.W. [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Barlat, F., E-mail: f.barlat@postech.ac.kr [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Lee, M.-G., E-mail: myounglee@korea.ac.kr [Department of Materials Science and Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul (Korea, Republic of)
2015-02-25
A non-isothermal phase transformation kinetics model obtained by modifying the well-known JMAK approach is proposed for application to a low carbon boron steel (22MnB5) sheet. In the modified kinetics model, the parameters are functions of both temperature and cooling rate, and can be identified by a numerical optimization method. Moreover, in this approach the transformation start and finish temperatures are variable instead of the constants that depend on chemical composition. These variable reference temperatures are determined from the measured CCT diagram using dilatation experiments. The kinetics model developed in this work captures the complex transformation behavior of the boron steel sheet sample accurately. In particular, the predicted hardness and phase fractions in the specimens subjected to a wide range of cooling rates were validated by experiments.
Zhang, DaDi; Yang, Xiaolong; Zheng, Xiao; Yang, Weitao
2018-04-01
Electron affinity (EA) is the energy released when an additional electron is attached to an atom or a molecule. EA is a fundamental thermochemical property, and it is closely pertinent to other important properties such as electronegativity and hardness. However, accurate prediction of EA is difficult with density functional theory methods. The somewhat large error of the calculated EAs originates mainly from the intrinsic delocalisation error associated with the approximate exchange-correlation functional. In this work, we employ a previously developed non-empirical global scaling correction approach, which explicitly imposes the Perdew-Parr-Levy-Balduz condition to the approximate functional, and achieve a substantially improved accuracy for the calculated EAs. In our approach, the EA is given by the scaling corrected Kohn-Sham lowest unoccupied molecular orbital energy of the neutral molecule, without the need to carry out the self-consistent-field calculation for the anion.
Energy Technology Data Exchange (ETDEWEB)
Bangga, Galih; Weihing, Pascal; Lutz, Thorsten; Krämer, Ewald [University of Stuttgart, Stuttgart (Germany)
2017-05-15
The present study focuses on the impact of grid for accurate prediction of the MEXICO rotor under stalled conditions. Two different blade mesh topologies, O and C-H meshes, and two different grid resolutions are tested for several time step sizes. The simulations are carried out using Delayed detached-eddy simulation (DDES) with two eddy viscosity RANS turbulence models, namely Spalart- Allmaras (SA) and Menter Shear stress transport (SST) k-ω. A high order spatial discretization, WENO (Weighted essentially non- oscillatory) scheme, is used in these computations. The results are validated against measurement data with regards to the sectional loads and the chordwise pressure distributions. The C-H mesh topology is observed to give the best results employing the SST k-ω turbulence model, but the computational cost is more expensive as the grid contains a wake block that increases the number of cells.
International Nuclear Information System (INIS)
Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo
2005-01-01
The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory
Afzal, Mohammad Atif Faiz; Cheng, Chong; Hachmann, Johannes
2018-06-01
Organic materials with a high index of refraction (RI) are attracting considerable interest due to their potential application in optic and optoelectronic devices. However, most of these applications require an RI value of 1.7 or larger, while typical carbon-based polymers only exhibit values in the range of 1.3-1.5. This paper introduces an efficient computational protocol for the accurate prediction of RI values in polymers to facilitate in silico studies that can guide the discovery and design of next-generation high-RI materials. Our protocol is based on the Lorentz-Lorenz equation and is parametrized by the polarizability and number density values of a given candidate compound. In the proposed scheme, we compute the former using first-principles electronic structure theory and the latter using an approximation based on van der Waals volumes. The critical parameter in the number density approximation is the packing fraction of the bulk polymer, for which we have devised a machine learning model. We demonstrate the performance of the proposed RI protocol by testing its predictions against the experimentally known RI values of 112 optical polymers. Our approach to combine first-principles and data modeling emerges as both a successful and a highly economical path to determining the RI values for a wide range of organic polymers.
Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546
Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul
2017-07-15
The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory
Predicting accurate absolute binding energies in aqueous solution
DEFF Research Database (Denmark)
Jensen, Jan Halborg
2015-01-01
Recent predictions of absolute binding free energies of host-guest complexes in aqueous solution using electronic structure theory have been encouraging for some systems, while other systems remain problematic. In this paper I summarize some of the many factors that could easily contribute 1-3 kcal......-represented by continuum models. While I focus on binding free energies in aqueous solution the approach also applies (with minor adjustments) to any free energy difference such as conformational or reaction free energy differences or activation free energies in any solvent....
Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression
Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet
2015-01-01
Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450
Meijer, W.G; van den Bergh, E.R E; Smith, L.M
In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence
A rapid and accurate approach for prediction of interactomes from co-elution data (PrInCE).
Stacey, R Greg; Skinnider, Michael A; Scott, Nichollas E; Foster, Leonard J
2017-10-23
An organism's protein interactome, or complete network of protein-protein interactions, defines the protein complexes that drive cellular processes. Techniques for studying protein complexes have traditionally applied targeted strategies such as yeast two-hybrid or affinity purification-mass spectrometry to assess protein interactions. However, given the vast number of protein complexes, more scalable methods are necessary to accelerate interaction discovery and to construct whole interactomes. We recently developed a complementary technique based on the use of protein correlation profiling (PCP) and stable isotope labeling in amino acids in cell culture (SILAC) to assess chromatographic co-elution as evidence of interacting proteins. Importantly, PCP-SILAC is also capable of measuring protein interactions simultaneously under multiple biological conditions, allowing the detection of treatment-specific changes to an interactome. Given the uniqueness and high dimensionality of co-elution data, new tools are needed to compare protein elution profiles, control false discovery rates, and construct an accurate interactome. Here we describe a freely available bioinformatics pipeline, PrInCE, for the analysis of co-elution data. PrInCE is a modular, open-source library that is computationally inexpensive, able to use label and label-free data, and capable of detecting tens of thousands of protein-protein interactions. Using a machine learning approach, PrInCE offers greatly reduced run time, more predicted interactions at the same stringency, prediction of protein complexes, and greater ease of use over previous bioinformatics tools for co-elution data. PrInCE is implemented in Matlab (version R2017a). Source code and standalone executable programs for Windows and Mac OSX are available at https://github.com/fosterlab/PrInCE , where usage instructions can be found. An example dataset and output are also provided for testing purposes. PrInCE is the first fast and easy
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...
Can Measured Synergy Excitations Accurately Construct Unmeasured Muscle Excitations?
Bianco, Nicholas A; Patten, Carolynn; Fregly, Benjamin J
2018-01-01
Accurate prediction of muscle and joint contact forces during human movement could improve treatment planning for disorders such as osteoarthritis, stroke, Parkinson's disease, and cerebral palsy. Recent studies suggest that muscle synergies, a low-dimensional representation of a large set of muscle electromyographic (EMG) signals (henceforth called "muscle excitations"), may reduce the redundancy of muscle excitation solutions predicted by optimization methods. This study explores the feasibility of using muscle synergy information extracted from eight muscle EMG signals (henceforth called "included" muscle excitations) to accurately construct muscle excitations from up to 16 additional EMG signals (henceforth called "excluded" muscle excitations). Using treadmill walking data collected at multiple speeds from two subjects (one healthy, one poststroke), we performed muscle synergy analysis on all possible subsets of eight included muscle excitations and evaluated how well the calculated time-varying synergy excitations could construct the remaining excluded muscle excitations (henceforth called "synergy extrapolation"). We found that some, but not all, eight-muscle subsets yielded synergy excitations that achieved >90% extrapolation variance accounted for (VAF). Using the top 10% of subsets, we developed muscle selection heuristics to identify included muscle combinations whose synergy excitations achieved high extrapolation accuracy. For 3, 4, and 5 synergies, these heuristics yielded extrapolation VAF values approximately 5% lower than corresponding reconstruction VAF values for each associated eight-muscle subset. These results suggest that synergy excitations obtained from experimentally measured muscle excitations can accurately construct unmeasured muscle excitations, which could help limit muscle excitations predicted by muscle force optimizations.
Accurate anisotropic material modelling using only tensile tests for hot and cold forming
Abspoel, M.; Scholting, M. E.; Lansbergen, M.; Neelis, B. M.
2017-09-01
Accurate material data for simulations require a lot of effort. Advanced yield loci require many different kinds of tests and a Forming Limit Curve (FLC) needs a large amount of samples. Many people use simple material models to reduce the effort of testing, however some models are either not accurate enough (i.e. Hill’48), or do not describe new types of materials (i.e. Keeler). Advanced yield loci describe the anisotropic materials behaviour accurately, but are not widely adopted because of the specialized tests, and data post-processing is a hurdle for many. To overcome these issues, correlations between the advanced yield locus points (biaxial, plane strain and shear) and mechanical properties have been investigated. This resulted in accurate prediction of the advanced stress points using only Rm, Ag and r-values in three directions from which a Vegter yield locus can be constructed with low effort. FLC’s can be predicted with the equations of Abspoel & Scholting depending on total elongation A80, r-value and thickness. Both predictive methods are initially developed for steel, aluminium and stainless steel (BCC and FCC materials). The validity of the predicted Vegter yield locus is investigated with simulation and measurements on both hot and cold formed parts and compared with Hill’48. An adapted specimen geometry, to ensure a homogeneous temperature distribution in the Gleeble hot tensile test, was used to measure the mechanical properties needed to predict a hot Vegter yield locus. Since for hot material, testing of stress states other than uniaxial is really challenging, the prediction for the yield locus adds a lot of value. For the hot FLC an A80 sample with a homogeneous temperature distribution is needed which is due to size limitations not possible in the Gleeble tensile tester. Heating the sample in an industrial type furnace and tensile testing it in a dedicated device is a good alternative to determine the necessary parameters for the FLC
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Wenrui Huang
2010-03-01
Full Text Available This paper presents an improvement of the Mellor and Yamada's 2nd order turbulence model in the Princeton Ocean Model (POM for better predictions of vertical stratifications of salinity in estuaries. The model was evaluated in the strongly stratified estuary, Apalachicola River, Florida, USA. The three-dimensional hydrodynamic model was applied to study the stratified flow and salinity intrusion in the estuary in response to tide, wind, and buoyancy forces. Model tests indicate that model predictions over estimate the stratification when using the default turbulent parameters. Analytic studies of density-induced and wind-induced flows indicate that accurate estimation of vertical eddy viscosity plays an important role in describing vertical profiles. Initial model revision experiments show that the traditional approach of modifying empirical constants in the turbulence model leads to numerical instability. In order to improve the performance of the turbulence model while maintaining numerical stability, a stratification factor was introduced to allow adjustment of the vertical turbulent eddy viscosity and diffusivity. Sensitivity studies indicate that the stratification factor, ranging from 1.0 to 1.2, does not cause numerical instability in Apalachicola River. Model simulations show that increasing the turbulent eddy viscosity by a stratification factor of 1.12 results in an optimal agreement between model predictions and observations in the case study presented in this study. Using the proposed stratification factor provides a useful way for coastal modelers to improve the turbulence model performance in predicting vertical turbulent mixing in stratified estuaries and coastal waters.
Directory of Open Access Journals (Sweden)
Jing Lu
2014-11-01
Full Text Available We propose a weather prediction model in this article based on neural network and fuzzy inference system (NFIS-WPM, and then apply it to predict daily fuzzy precipitation given meteorological premises for testing. The model consists of two parts: the first part is the “fuzzy rule-based neural network”, which simulates sequential relations among fuzzy sets using artificial neural network; and the second part is the “neural fuzzy inference system”, which is based on the first part, but could learn new fuzzy rules from the previous ones according to the algorithm we proposed. NFIS-WPM (High Pro and NFIS-WPM (Ave are improved versions of this model. It is well known that the need for accurate weather prediction is apparent when considering the benefits. However, the excessive pursuit of accuracy in weather prediction makes some of the “accurate” prediction results meaningless and the numerical prediction model is often complex and time-consuming. By adapting this novel model to a precipitation prediction problem, we make the predicted outcomes of precipitation more accurate and the prediction methods simpler than by using the complex numerical forecasting model that would occupy large computation resources, be time-consuming and which has a low predictive accuracy rate. Accordingly, we achieve more accurate predictive precipitation results than by using traditional artificial neural networks that have low predictive accuracy.
Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk
2014-01-01
The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565
Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions
Römling, Ute; Galperin, Michael Y.
2015-01-01
Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867
Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...
Long Range Aircraft Trajectory Prediction
Magister, Tone
2009-01-01
The subject of the paper is the improvement of the aircraft future trajectory prediction accuracy for long-range airborne separation assurance. The strategic planning of safe aircraft flights and effective conflict avoidance tactics demand timely and accurate conflict detection based upon future four–dimensional airborne traffic situation prediction which is as accurate as each aircraft flight trajectory prediction. The improved kinematics model of aircraft relative flight considering flight ...
Urschler, David F.
2016-01-01
Previous research has shown that people’s willingness to help those in need is influenced by a multitude of factors (e.g., perceived dangerousness of a situation, cost-benefit analysis, attributions of responsibility, kinship, status, and culture). However, past research has often focused on single factors to predict helping intentions. Therefore, the present thesis examines the interplay of different factors in order to predict helping intentions in the most accurate and effective way. Th...
Marchini, Giovanni Scala; Gebreselassie, Surafel; Liu, Xiaobo; Pynadath, Cindy; Snyder, Grace; Monga, Manoj
2013-02-01
The purpose of our study was to determine, in vivo, whether single-energy noncontrast computed tomography (NCCT) can accurately predict the presence/percentage of struvite stone composition. We retrospectively searched for all patients with struvite components on stone composition analysis between January 2008 and March 2012. Inclusion criteria were NCCT prior to stone analysis and stone size ≥4 mm. A single urologist, blinded to stone composition, reviewed all NCCT to acquire stone location, dimensions, and Hounsfield unit (HU). HU density (HUD) was calculated by dividing mean HU by the stone's largest transverse diameter. Stone analysis was performed via Fourier transform infrared spectrometry. Independent sample Student's t-test and analysis of variance (ANOVA) were used to compare HU/HUD among groups. Spearman's correlation test was used to determine the correlation between HU and stone size and also HU/HUD to % of each component within the stone. Significance was considered if pR=0.017; p=0.912) and negative with HUD (R=-0.20; p=0.898). Overall, 3 (6.8%) had stones (n=5) with other miscellaneous stones (n=39), no difference was found for HU (p=0.09) but HUD was significantly lower for pure stones (27.9±23.6 v 72.5±55.9, respectively; p=0.006). Again, significant overlaps were seen. Pure struvite stones have significantly lower HUD than mixed struvite stones, but overlap exists. A low HUD may increase the suspicion for a pure struvite calculus.
An, Zhe; Rey, Daniel; Ye, Jingxin; Abarbanel, Henry D. I.
2017-01-01
The problem of forecasting the behavior of a complex dynamical system through analysis of observational time-series data becomes difficult when the system expresses chaotic behavior and the measurements are sparse, in both space and/or time. Despite the fact that this situation is quite typical across many fields, including numerical weather prediction, the issue of whether the available observations are "sufficient" for generating successful forecasts is still not well understood. An analysis by Whartenby et al. (2013) found that in the context of the nonlinear shallow water equations on a β plane, standard nudging techniques require observing approximately 70 % of the full set of state variables. Here we examine the same system using a method introduced by Rey et al. (2014a), which generalizes standard nudging methods to utilize time delayed measurements. We show that in certain circumstances, it provides a sizable reduction in the number of observations required to construct accurate estimates and high-quality predictions. In particular, we find that this estimate of 70 % can be reduced to about 33 % using time delays, and even further if Lagrangian drifter locations are also used as measurements.
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D
2011-04-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.
Directory of Open Access Journals (Sweden)
Jianzhong Zhou
2017-12-01
Full Text Available Model simulation and control of pumped storage unit (PSU are essential to improve the dynamic quality of power station. Only under the premise of the PSU models reflecting the actual transient process, the novel control method can be properly applied in the engineering. The contributions of this paper are that (1 a real-time accurate equivalent circuit model (RAECM of PSU via error compensation is proposed to reconcile the conflict between real-time online simulation and accuracy under various operating conditions, and (2 an adaptive predicted fuzzy PID controller (APFPID based on RAECM is put forward to overcome the instability of conventional control under no-load conditions with low water head. Respectively, all hydraulic factors in pipeline system are fully considered based on equivalent lumped-circuits theorem. The pretreatment, which consists of improved Suter-transformation and BP neural network, and online simulation method featured by two iterative loops are synthetically proposed to improve the solving accuracy of the pump-turbine. Moreover, the modified formulas for compensating error are derived with variable-spatial discretization to improve the accuracy of the real-time simulation further. The implicit RadauIIA method is verified to be more suitable for PSUGS owing to wider stable domain. Then, APFPID controller is constructed based on the integration of fuzzy PID and the model predictive control. Rolling prediction by RAECM is proposed to replace rolling optimization with its computational speed guaranteed. Finally, the simulation and on-site measurements are compared to prove trustworthy of RAECM under various running conditions. Comparative experiments also indicate that APFPID controller outperforms other controllers in most cases, especially low water head conditions. Satisfying results of RAECM have been achieved in engineering and it provides a novel model reference for PSUGS.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C
2018-06-01
Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Lewis, Jeffrey A; Boyd, Jeffrey M; Downs, Diana M; Escalante-Semerena, Jorge C
2009-04-01
In Salmonella enterica, tricarballylate (Tcb) catabolism requires function of TcuB, a membrane-bound protein that contains [4Fe-4S] clusters and heme. TcuB transfers electrons from reduced flavin adenine dinucleotide in the Tcb dehydrogenase (TcuA) to electron acceptors in the membrane. We recently showed that functions needed to assemble [Fe-S] clusters (i.e., the iscRSUA-hscBA-fdx operon) compensate for the lack of ApbC during growth of an apbC strain on Tcb. ApbC had been linked to [Fe-S] cluster metabolism, and we showed that an apbC strain had decreased TcuB activity. Here we report findings that expand our understanding of the regulation of expression of the iscRSUA genes in Salmonella enterica. We investigated why low levels of glucose or other saccharides restored growth of an apbC strain on Tcb. Here we report the following findings. (i) A Cra. (iv) Putative Cra binding sites are present in the regulatory region of the iscRSUA operon. (v) Cra protein binds to all three sites in the iscRSUA promoter region in a concentration-dependent fashion. To our knowledge, this is the first report of the involvement of Cra in [Fe-S] cluster assembly.
Directory of Open Access Journals (Sweden)
Snowdon Stuart
2009-07-01
Full Text Available Abstract Background Metabolomics experiments using Mass Spectrometry (MS technology measure the mass to charge ratio (m/z and intensity of ionised molecules in crude extracts of complex biological samples to generate high dimensional metabolite 'fingerprint' or metabolite 'profile' data. High resolution MS instruments perform routinely with a mass accuracy of Results Metabolite 'structures' harvested from publicly accessible databases were converted into a common format to generate a comprehensive archive in MZedDB. 'Rules' were derived from chemical information that allowed MZedDB to generate a list of adducts and neutral loss fragments putatively able to form for each structure and calculate, on the fly, the exact molecular weight of every potential ionisation product to provide targets for annotation searches based on accurate mass. We demonstrate that data matrices representing populations of ionisation products generated from different biological matrices contain a large proportion (sometimes > 50% of molecular isotopes, salt adducts and neutral loss fragments. Correlation analysis of ESI-MS data features confirmed the predicted relationships of m/z signals. An integrated isotope enumerator in MZedDB allowed verification of exact isotopic pattern distributions to corroborate experimental data. Conclusion We conclude that although ultra-high accurate mass instruments provide major insight into the chemical diversity of biological extracts, the facile annotation of a large proportion of signals is not possible by simple, automated query of current databases using computed molecular formulae. Parameterising MZedDB to take into account predicted ionisation behaviour and the biological source of any sample improves greatly both the frequency and accuracy of potential annotation 'hits' in ESI-MS data.
CFD-FEM coupling for accurate prediction of thermal fatigue
International Nuclear Information System (INIS)
Hannink, M.H.C.; Kuczaj, A.K.; Blom, F.J.; Church, J.M.; Komen, E.M.J.
2009-01-01
Thermal fatigue is a safety related issue in primary pipework systems of nuclear power plants. Life extension of current reactors and the design of a next generation of new reactors lead to growing importance of research in this direction. The thermal fatigue degradation mechanism is induced by temperature fluctuations in a fluid, which arise from mixing of hot and cold flows. Accompanied physical phenomena include thermal stratification, thermal striping, and turbulence [1]. Current plant instrumentation systems allow monitoring of possible causes as stratification and temperature gradients at fatigue susceptible locations [1]. However, high-cycle temperature fluctuations associated with turbulent mixing cannot be adequately detected by common thermocouple instrumentations. For a proper evaluation of thermal fatigue, therefore, numerical simulations are necessary that couple instantaneous fluid and solid interactions. In this work, a strategy for the numerical prediction of thermal fatigue is presented. The approach couples Computational Fluid Dynamics (CFD) and the Finite Element Method (FEM). For the development of the computational approach, a classical test case for the investigation of thermal fatigue problems is studied, i.e. mixing in a T-junction. Due to turbulent mixing of hot and cold fluids in two perpendicularly connected pipes, temperature fluctuations arise in the mixing zone downstream in the flow. Subsequently, these temperature fluctuations are also induced in the pipes. The stresses that arise due to the fluctuations may eventually lead to thermal fatigue. In the first step of the applied procedure, the temperature fluctuations in both fluid and structure are calculated using the CFD method. Subsequently, the temperature fluctuations in the structure are imposed as thermal loads in a FEM model of the pipes. A mechanical analysis is then performed to determine the thermal stresses, which are used to predict the fatigue lifetime of the structure
Sizemore, C; Geissdörfer, W; Hillen, W
1993-03-01
The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.
Sensor Data Fusion for Accurate Cloud Presence Prediction Using Dempster-Shafer Evidence Theory
Directory of Open Access Journals (Sweden)
Jesse S. Jin
2010-10-01
Full Text Available Sensor data fusion technology can be used to best extract useful information from multiple sensor observations. It has been widely applied in various applications such as target tracking, surveillance, robot navigation, signal and image processing. This paper introduces a novel data fusion approach in a multiple radiation sensor environment using Dempster-Shafer evidence theory. The methodology is used to predict cloud presence based on the inputs of radiation sensors. Different radiation data have been used for the cloud prediction. The potential application areas of the algorithm include renewable power for virtual power station where the prediction of cloud presence is the most challenging issue for its photovoltaic output. The algorithm is validated by comparing the predicted cloud presence with the corresponding sunshine occurrence data that were recorded as the benchmark. Our experiments have indicated that comparing to the approaches using individual sensors, the proposed data fusion approach can increase correct rate of cloud prediction by ten percent, and decrease unknown rate of cloud prediction by twenty three percent.
DEFF Research Database (Denmark)
Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne
1995-01-01
The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...
Directory of Open Access Journals (Sweden)
Tingting Xu
Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity
DEFF Research Database (Denmark)
Johansen, L.E.; Nygaard, P.; Lassen, C.
2003-01-01
In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...
Accurate lithography simulation model based on convolutional neural networks
Watanabe, Yuki; Kimura, Taiki; Matsunawa, Tetsuaki; Nojima, Shigeki
2017-07-01
Lithography simulation is an essential technique for today's semiconductor manufacturing process. In order to calculate an entire chip in realistic time, compact resist model is commonly used. The model is established for faster calculation. To have accurate compact resist model, it is necessary to fix a complicated non-linear model function. However, it is difficult to decide an appropriate function manually because there are many options. This paper proposes a new compact resist model using CNN (Convolutional Neural Networks) which is one of deep learning techniques. CNN model makes it possible to determine an appropriate model function and achieve accurate simulation. Experimental results show CNN model can reduce CD prediction errors by 70% compared with the conventional model.
Anatomically accurate, finite model eye for optical modeling.
Liou, H L; Brennan, N A
1997-08-01
There is a need for a schematic eye that models vision accurately under various conditions such as refractive surgical procedures, contact lens and spectacle wear, and near vision. Here we propose a new model eye close to anatomical, biometric, and optical realities. This is a finite model with four aspheric refracting surfaces and a gradient-index lens. It has an equivalent power of 60.35 D and an axial length of 23.95 mm. The new model eye provides spherical aberration values within the limits of empirical results and predicts chromatic aberration for wavelengths between 380 and 750 nm. It provides a model for calculating optical transfer functions and predicting optical performance of the eye.
Accurately Detecting Students' Lies regarding Relational Aggression by Correctional Instructions
Dickhauser, Oliver; Reinhard, Marc-Andre; Marksteiner, Tamara
2012-01-01
This study investigates the effect of correctional instructions when detecting lies about relational aggression. Based on models from the field of social psychology, we predict that correctional instruction will lead to a less pronounced lie bias and to more accurate lie detection. Seventy-five teachers received videotapes of students' true denial…
Yin, Mengchen; Chen, Ni; Huang, Quan; Marla, Anastasia Sulindro; Ma, Junming; Ye, Jie; Mo, Wen
2017-12-01
Youden index was .4243, .3003, and .7189, respectively. The Hosmer-Lemeshow test showed a good fitting of the predictive model, with an overall accuracy of 89.6%. This study establishes a new and accurate predictive model for the efficacy of ESWT in managing patients with chronic plantar fasciitis. The use of these parameters, in the form of a predictive model for ESWT efficacy, has the potential to improve decision-making in the application of ESWT. Copyright © 2017 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya
2015-01-01
Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.
Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis
DEFF Research Database (Denmark)
Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal
2005-01-01
control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...
Mollerup, Christian Brinch; Mardal, Marie; Dalsgaard, Petur Weihe; Linnet, Kristian; Barron, Leon Patrick
2018-03-23
Exact mass, retention time (RT), and collision cross section (CCS) are used as identification parameters in liquid chromatography coupled to ion mobility high resolution accurate mass spectrometry (LC-IM-HRMS). Targeted screening analyses are now more flexible and can be expanded for suspect and non-targeted screening. These allow for tentative identification of new compounds, and in-silico predicted reference values are used for improving confidence and filtering false-positive identifications. In this work, predictions of both RT and CCS values are performed with machine learning using artificial neural networks (ANNs). Prediction was based on molecular descriptors, 827 RTs, and 357 CCS values from pharmaceuticals, drugs of abuse, and their metabolites. ANN models for the prediction of RT or CCS separately were examined, and the potential to predict both from a single model was investigated for the first time. The optimized combined RT-CCS model was a four-layered multi-layer perceptron ANN, and the 95th prediction error percentiles were within 2 min RT error and 5% relative CCS error for the external validation set (n = 36) and the full RT-CCS dataset (n = 357). 88.6% (n = 733) of predicted RTs were within 2 min error for the full dataset. Overall, when using 2 min RT error and 5% relative CCS error, 91.9% (n = 328) of compounds were retained, while 99.4% (n = 355) were retained when using at least one of these thresholds. This combined prediction approach can therefore be useful for rapid suspect/non-targeted screening involving HRMS, and will support current workflows. Copyright © 2018 Elsevier B.V. All rights reserved.
Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J
2015-06-19
The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and
Deterministic prediction of surface wind speed variations
Directory of Open Access Journals (Sweden)
G. V. Drisya
2014-11-01
Full Text Available Accurate prediction of wind speed is an important aspect of various tasks related to wind energy management such as wind turbine predictive control and wind power scheduling. The most typical characteristic of wind speed data is its persistent temporal variations. Most of the techniques reported in the literature for prediction of wind speed and power are based on statistical methods or probabilistic distribution of wind speed data. In this paper we demonstrate that deterministic forecasting methods can make accurate short-term predictions of wind speed using past data, at locations where the wind dynamics exhibit chaotic behaviour. The predictions are remarkably accurate up to 1 h with a normalised RMSE (root mean square error of less than 0.02 and reasonably accurate up to 3 h with an error of less than 0.06. Repeated application of these methods at 234 different geographical locations for predicting wind speeds at 30-day intervals for 3 years reveals that the accuracy of prediction is more or less the same across all locations and time periods. Comparison of the results with f-ARIMA model predictions shows that the deterministic models with suitable parameters are capable of returning improved prediction accuracy and capturing the dynamical variations of the actual time series more faithfully. These methods are simple and computationally efficient and require only records of past data for making short-term wind speed forecasts within practically tolerable margin of errors.
Safe surgery: how accurate are we at predicting intra-operative blood loss?
LENUS (Irish Health Repository)
2012-02-01
Introduction Preoperative estimation of intra-operative blood loss by both anaesthetist and operating surgeon is a criterion of the World Health Organization\\'s surgical safety checklist. The checklist requires specific preoperative planning when anticipated blood loss is greater than 500 mL. The aim of this study was to assess the accuracy of surgeons and anaesthetists at predicting intra-operative blood loss. Methods A 6-week prospective study of intermediate and major operations in an academic medical centre was performed. An independent observer interviewed surgical and anaesthetic consultants and registrars, preoperatively asking each to predict expected blood loss in millilitre. Intra-operative blood loss was measured and compared with these predictions. Parameters including the use of anticoagulation and anti-platelet therapy as well as intra-operative hypothermia and hypotension were recorded. Results One hundred sixty-eight operations were included in the study, including 142 elective and 26 emergency operations. Blood loss was predicted to within 500 mL of measured blood loss in 89% of cases. Consultant surgeons tended to underestimate blood loss, doing so in 43% of all cases, while consultant anaesthetists were more likely to overestimate (60% of all operations). Twelve patients (7%) had underestimation of blood loss of more than 500 mL by both surgeon and anaesthetist. Thirty per cent (n = 6\\/20) of patients requiring transfusion of a blood product within 24 hours of surgery had blood loss underestimated by more than 500 mL by both surgeon and anaesthetist. There was no significant difference in prediction between patients on anti-platelet or anticoagulation therapy preoperatively and those not on the said therapies. Conclusion Predicted intra-operative blood loss was within 500 mL of measured blood loss in 89% of operations. In 30% of patients who ultimately receive a blood transfusion, both the surgeon and anaesthetist significantly underestimate
Li, Jian; Bharadwaj, Shruthi S; Guzman, Grace; Vishnubhotla, Ramana; Glover, Sarah C
2015-06-01
Colorectal cancer remains the second leading cause of death in the United States despite improvements in incidence rates and advancements in screening. The present study evaluated the prognostic value of two tumor markers, MET and ROCK I, which have been noted in other cancers to provide more accurate prognoses of patient outcomes than tumor staging alone. We constructed a tissue microarray from surgical specimens of adenocarcinomas from 108 colorectal cancer patients. Using immunohistochemistry, we examined the expression levels of tumor markers MET and ROCK I, with a pathologist blinded to patient identities and clinical outcomes providing the scoring of MET and ROCK I expression. We then used retrospective analysis of patients' survival data to provide correlations with expression levels of MET and ROCK I. Both MET and ROCK I were significantly over-expressed in colorectal cancer tissues, relative to the unaffected adjacent mucosa. Kaplan-Meier survival analysis revealed that patients' 5-year survival was inversely correlated with levels of expression of ROCK I. In contrast, MET was less strongly correlated with five-year survival. ROCK I provides better efficacy in predicting patient outcomes, compared to either tumor staging or MET expression. As a result, ROCK I may provide a less invasive method of assessing patient prognoses and directing therapeutic interventions. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Gaussian Process Regression for WDM System Performance Prediction
DEFF Research Database (Denmark)
Wass, Jesper; Thrane, Jakob; Piels, Molly
2017-01-01
Gaussian process regression is numerically and experimentally investigated to predict the bit error rate of a 24 x 28 CiBd QPSK WDM system. The proposed method produces accurate predictions from multi-dimensional and sparse measurement data.......Gaussian process regression is numerically and experimentally investigated to predict the bit error rate of a 24 x 28 CiBd QPSK WDM system. The proposed method produces accurate predictions from multi-dimensional and sparse measurement data....
de Gier, Camilla; Kirkham, Lea-Ann S; Nørskov-Lauritsen, Niels
2015-12-01
Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the "fuzzy species" strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Nakatsuji, Hiroshi
2012-09-18
Just as Newtonian law governs classical physics, the Schrödinger equation (SE) and the relativistic Dirac equation (DE) rule the world of chemistry. So, if we can solve these equations accurately, we can use computation to predict chemistry precisely. However, for approximately 80 years after the discovery of these equations, chemists believed that they could not solve SE and DE for atoms and molecules that included many electrons. This Account reviews ideas developed over the past decade to further the goal of predictive quantum chemistry. Between 2000 and 2005, I discovered a general method of solving the SE and DE accurately. As a first inspiration, I formulated the structure of the exact wave function of the SE in a compact mathematical form. The explicit inclusion of the exact wave function's structure within the variational space allows for the calculation of the exact wave function as a solution of the variational method. Although this process sounds almost impossible, it is indeed possible, and I have published several formulations and applied them to solve the full configuration interaction (CI) with a very small number of variables. However, when I examined analytical solutions for atoms and molecules, the Hamiltonian integrals in their secular equations diverged. This singularity problem occurred in all atoms and molecules because it originates from the singularity of the Coulomb potential in their Hamiltonians. To overcome this problem, I first introduced the inverse SE and then the scaled SE. The latter simpler idea led to immediate and surprisingly accurate solution for the SEs of the hydrogen atom, helium atom, and hydrogen molecule. The free complement (FC) method, also called the free iterative CI (free ICI) method, was efficient for solving the SEs. In the FC method, the basis functions that span the exact wave function are produced by the Hamiltonian of the system and the zeroth-order wave function. These basis functions are called complement
Accurate, model-based tuning of synthetic gene expression using introns in S. cerevisiae.
Directory of Open Access Journals (Sweden)
Ido Yofe
2014-06-01
Full Text Available Introns are key regulators of eukaryotic gene expression and present a potentially powerful tool for the design of synthetic eukaryotic gene expression systems. However, intronic control over gene expression is governed by a multitude of complex, incompletely understood, regulatory mechanisms. Despite this lack of detailed mechanistic understanding, here we show how a relatively simple model enables accurate and predictable tuning of synthetic gene expression system in yeast using several predictive intron features such as transcript folding and sequence motifs. Using only natural Saccharomyces cerevisiae introns as regulators, we demonstrate fine and accurate control over gene expression spanning a 100 fold expression range. These results broaden the engineering toolbox of synthetic gene expression systems and provide a framework in which precise and robust tuning of gene expression is accomplished.
Energy Technology Data Exchange (ETDEWEB)
Baer, M.R.; Hobbs, M.L.; McGee, B.C.
1998-11-03
Exponential-13,6 (EXP-13,6) potential pammeters for 750 gases composed of 48 elements were determined and assembled in a database, referred to as the JCZS database, for use with the Jacobs Cowperthwaite Zwisler equation of state (JCZ3-EOS)~l) The EXP- 13,6 force constants were obtained by using literature values of Lennard-Jones (LJ) potential functions, by using corresponding states (CS) theory, by matching pure liquid shock Hugoniot data, and by using molecular volume to determine the approach radii with the well depth estimated from high-pressure isen- tropes. The JCZS database was used to accurately predict detonation velocity, pressure, and temperature for 50 dif- 3 Accurate predictions were also ferent explosives with initial densities ranging from 0.25 glcm3 to 1.97 g/cm . obtained for pure liquid shock Hugoniots, static properties of nitrogen, and gas detonations at high initial pressures.
A machine learning approach to the accurate prediction of multi-leaf collimator positional errors
Carlson, Joel N. K.; Park, Jong Min; Park, So-Yeon; In Park, Jong; Choi, Yunseok; Ye, Sung-Joon
2016-03-01
Discrepancies between planned and delivered movements of multi-leaf collimators (MLCs) are an important source of errors in dose distributions during radiotherapy. In this work we used machine learning techniques to train models to predict these discrepancies, assessed the accuracy of the model predictions, and examined the impact these errors have on quality assurance (QA) procedures and dosimetry. Predictive leaf motion parameters for the models were calculated from the plan files, such as leaf position and velocity, whether the leaf was moving towards or away from the isocenter of the MLC, and many others. Differences in positions between synchronized DICOM-RT planning files and DynaLog files reported during QA delivery were used as a target response for training of the models. The final model is capable of predicting MLC positions during delivery to a high degree of accuracy. For moving MLC leaves, predicted positions were shown to be significantly closer to delivered positions than were planned positions. By incorporating predicted positions into dose calculations in the TPS, increases were shown in gamma passing rates against measured dose distributions recorded during QA delivery. For instance, head and neck plans with 1%/2 mm gamma criteria had an average increase in passing rate of 4.17% (SD = 1.54%). This indicates that the inclusion of predictions during dose calculation leads to a more realistic representation of plan delivery. To assess impact on the patient, dose volumetric histograms (DVH) using delivered positions were calculated for comparison with planned and predicted DVHs. In all cases, predicted dose volumetric parameters were in closer agreement to the delivered parameters than were the planned parameters, particularly for organs at risk on the periphery of the treatment area. By incorporating the predicted positions into the TPS, the treatment planner is given a more realistic view of the dose distribution as it will truly be
Accurate quantum chemical calculations
Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Taylor, Peter R.
1989-01-01
An important goal of quantum chemical calculations is to provide an understanding of chemical bonding and molecular electronic structure. A second goal, the prediction of energy differences to chemical accuracy, has been much harder to attain. First, the computational resources required to achieve such accuracy are very large, and second, it is not straightforward to demonstrate that an apparently accurate result, in terms of agreement with experiment, does not result from a cancellation of errors. Recent advances in electronic structure methodology, coupled with the power of vector supercomputers, have made it possible to solve a number of electronic structure problems exactly using the full configuration interaction (FCI) method within a subspace of the complete Hilbert space. These exact results can be used to benchmark approximate techniques that are applicable to a wider range of chemical and physical problems. The methodology of many-electron quantum chemistry is reviewed. Methods are considered in detail for performing FCI calculations. The application of FCI methods to several three-electron problems in molecular physics are discussed. A number of benchmark applications of FCI wave functions are described. Atomic basis sets and the development of improved methods for handling very large basis sets are discussed: these are then applied to a number of chemical and spectroscopic problems; to transition metals; and to problems involving potential energy surfaces. Although the experiences described give considerable grounds for optimism about the general ability to perform accurate calculations, there are several problems that have proved less tractable, at least with current computer resources, and these and possible solutions are discussed.
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.
2011-01-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
Directory of Open Access Journals (Sweden)
Løvdal Irene S
2012-03-01
Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
2012-01-01
Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404
NESmapper: accurate prediction of leucine-rich nuclear export signals using activity-based profiles.
Directory of Open Access Journals (Sweden)
Shunichi Kosugi
2014-09-01
Full Text Available The nuclear export of proteins is regulated largely through the exportin/CRM1 pathway, which involves the specific recognition of leucine-rich nuclear export signals (NESs in the cargo proteins, and modulates nuclear-cytoplasmic protein shuttling by antagonizing the nuclear import activity mediated by importins and the nuclear import signal (NLS. Although the prediction of NESs can help to define proteins that undergo regulated nuclear export, current methods of predicting NESs, including computational tools and consensus-sequence-based searches, have limited accuracy, especially in terms of their specificity. We found that each residue within an NES largely contributes independently and additively to the entire nuclear export activity. We created activity-based profiles of all classes of NESs with a comprehensive mutational analysis in mammalian cells. The profiles highlight a number of specific activity-affecting residues not only at the conserved hydrophobic positions but also in the linker and flanking regions. We then developed a computational tool, NESmapper, to predict NESs by using profiles that had been further optimized by training and combining the amino acid properties of the NES-flanking regions. This tool successfully reduced the considerable number of false positives, and the overall prediction accuracy was higher than that of other methods, including NESsential and Wregex. This profile-based prediction strategy is a reliable way to identify functional protein motifs. NESmapper is available at http://sourceforge.net/projects/nesmapper.
Tsao, Chao-hsi; Freniere, Edward R.; Smith, Linda
2009-02-01
The use of white LEDs for solid-state lighting to address applications in the automotive, architectural and general illumination markets is just emerging. LEDs promise greater energy efficiency and lower maintenance costs. However, there is a significant amount of design and cost optimization to be done while companies continue to improve semiconductor manufacturing processes and begin to apply more efficient and better color rendering luminescent materials such as phosphor and quantum dot nanomaterials. In the last decade, accurate and predictive opto-mechanical software modeling has enabled adherence to performance, consistency, cost, and aesthetic criteria without the cost and time associated with iterative hardware prototyping. More sophisticated models that include simulation of optical phenomenon, such as luminescence, promise to yield designs that are more predictive - giving design engineers and materials scientists more control over the design process to quickly reach optimum performance, manufacturability, and cost criteria. A design case study is presented where first, a phosphor formulation and excitation source are optimized for a white light. The phosphor formulation, the excitation source and other LED components are optically and mechanically modeled and ray traced. Finally, its performance is analyzed. A blue LED source is characterized by its relative spectral power distribution and angular intensity distribution. YAG:Ce phosphor is characterized by relative absorption, excitation and emission spectra, quantum efficiency and bulk absorption coefficient. Bulk scatter properties are characterized by wavelength dependent scatter coefficients, anisotropy and bulk absorption coefficient.
Predictive Manufacturing: A Classification Strategy to Predict Product Failures
DEFF Research Database (Denmark)
Khan, Abdul Rauf; Schiøler, Henrik; Kulahci, Murat
2018-01-01
manufacturing analytics model that employs a big data approach to predicting product failures; third, we illustrate the issue of high dimensionality, along with statistically redundant information; and, finally, our proposed method will be compared against the well-known classification methods (SVM, K......-nearest neighbor, artificial neural networks). The results from real data show that our predictive manufacturing analytics approach, using genetic algorithms and Voronoi tessellations, is capable of predicting product failure with reasonable accuracy. The potential application of this method contributes...... to accurately predicting product failures, which would enable manufacturers to reduce production costs without compromising product quality....
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Computer-based personality judgments are more accurate than those made by humans.
Youyou, Wu; Kosinski, Michal; Stillwell, David
2015-01-27
Judging others' personalities is an essential skill in successful social living, as personality is a key driver behind people's interactions, behaviors, and emotions. Although accurate personality judgments stem from social-cognitive skills, developments in machine learning show that computer models can also make valid judgments. This study compares the accuracy of human and computer-based personality judgments, using a sample of 86,220 volunteers who completed a 100-item personality questionnaire. We show that (i) computer predictions based on a generic digital footprint (Facebook Likes) are more accurate (r = 0.56) than those made by the participants' Facebook friends using a personality questionnaire (r = 0.49); (ii) computer models show higher interjudge agreement; and (iii) computer personality judgments have higher external validity when predicting life outcomes such as substance use, political attitudes, and physical health; for some outcomes, they even outperform the self-rated personality scores. Computers outpacing humans in personality judgment presents significant opportunities and challenges in the areas of psychological assessment, marketing, and privacy.
A hybrid method for accurate star tracking using star sensor and gyros.
Lu, Jiazhen; Yang, Lie; Zhang, Hao
2017-10-01
Star tracking is the primary operating mode of star sensors. To improve tracking accuracy and efficiency, a hybrid method using a star sensor and gyroscopes is proposed in this study. In this method, the dynamic conditions of an aircraft are determined first by the estimated angular acceleration. Under low dynamic conditions, the star sensor is used to measure the star vector and the vector difference method is adopted to estimate the current angular velocity. Under high dynamic conditions, the angular velocity is obtained by the calibrated gyros. The star position is predicted based on the estimated angular velocity and calibrated gyros using the star vector measurements. The results of the semi-physical experiment show that this hybrid method is accurate and feasible. In contrast with the star vector difference and gyro-assisted methods, the star position prediction result of the hybrid method is verified to be more accurate in two different cases under the given random noise of the star centroid.
Accurate Energies and Structures for Large Water Clusters Using the X3LYP Hybrid Density Functional
Su, Julius T.; Xu, Xin; Goddard, William A., III
2004-01-01
We predict structures and energies of water clusters containing up to 19 waters with X3LYP, an extended hybrid density functional designed to describe noncovalently bound systems as accurately as covalent systems. Our work establishes X3LYP as the most practical ab initio method today for calculating accurate water cluster structures and energies. We compare X3LYP/aug-cc-pVTZ energies to the most accurate theoretical values available (n = 2−6, 8), MP2 with basis set superposition error (BSSE)...
Inverse and Predictive Modeling
Energy Technology Data Exchange (ETDEWEB)
Syracuse, Ellen Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-09-27
The LANL Seismo-Acoustic team has a strong capability in developing data-driven models that accurately predict a variety of observations. These models range from the simple – one-dimensional models that are constrained by a single dataset and can be used for quick and efficient predictions – to the complex – multidimensional models that are constrained by several types of data and result in more accurate predictions. Team members typically build models of geophysical characteristics of Earth and source distributions at scales of 1 to 1000s of km, the techniques used are applicable for other types of physical characteristics at an even greater range of scales. The following cases provide a snapshot of some of the modeling work done by the Seismo- Acoustic team at LANL.
The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis
Kessler, Peter S.; Blank, Carrine; Leigh, John A.
1998-01-01
Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920
Hansmann, Jan; Evers, Maximilian J; Bui, James T; Lokken, R Peter; Lipnik, Andrew J; Gaba, Ron C; Ray, Charles E
2017-09-01
To evaluate albumin-bilirubin (ALBI) and platelet-albumin-bilirubin (PALBI) grades in predicting overall survival in high-risk patients undergoing conventional transarterial chemoembolization for hepatocellular carcinoma (HCC). This single-center retrospective study included 180 high-risk patients (142 men, 59 y ± 9) between April 2007 and January 2015. Patients were considered high-risk based on laboratory abnormalities before the procedure (bilirubin > 2.0 mg/dL, albumin 1.2 mg/dL); presence of ascites, encephalopathy, portal vein thrombus, or transjugular intrahepatic portosystemic shunt; or Model for End-Stage Liver Disease score > 15. Serum albumin, bilirubin, and platelet values were used to determine ALBI and PALBI grades. Overall survival was stratified by ALBI and PALBI grades with substratification by Child-Pugh class (CPC) and Barcelona Liver Clinic Cancer (BCLC) stage using Kaplan-Meier analysis. C-index was used to determine discriminatory ability and survival prediction accuracy. Median survival for 79 ALBI grade 2 patients and 101 ALBI grade 3 patients was 20.3 and 10.7 months, respectively (P .05). ALBI and PALBI grades are accurate survival metrics in high-risk patients undergoing conventional transarterial chemoembolization for HCC. Use of these scores allows for more refined survival stratification within CPC and BCLC stage. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.
Exploring the knowledge behind predictions in everyday cognition: an iterated learning study.
Stephens, Rachel G; Dunn, John C; Rao, Li-Lin; Li, Shu
2015-10-01
Making accurate predictions about events is an important but difficult task. Recent work suggests that people are adept at this task, making predictions that reflect surprisingly accurate knowledge of the distributions of real quantities. Across three experiments, we used an iterated learning procedure to explore the basis of this knowledge: to what extent is domain experience critical to accurate predictions and how accurate are people when faced with unfamiliar domains? In Experiment 1, two groups of participants, one resident in Australia, the other in China, predicted the values of quantities familiar to both (movie run-times), unfamiliar to both (the lengths of Pharaoh reigns), and familiar to one but unfamiliar to the other (cake baking durations and the lengths of Beijing bus routes). While predictions from both groups were reasonably accurate overall, predictions were inaccurate in the selectively unfamiliar domains and, surprisingly, predictions by the China-resident group were also inaccurate for a highly familiar domain: local bus route lengths. Focusing on bus routes, two follow-up experiments with Australia-resident groups clarified the knowledge and strategies that people draw upon, plus important determinants of accurate predictions. For unfamiliar domains, people appear to rely on extrapolating from (not simply directly applying) related knowledge. However, we show that people's predictions are subject to two sources of error: in the estimation of quantities in a familiar domain and extension to plausible values in an unfamiliar domain. We propose that the key to successful predictions is not simply domain experience itself, but explicit experience of relevant quantities.
Can numerical simulations accurately predict hydrodynamic instabilities in liquid films?
Denner, Fabian; Charogiannis, Alexandros; Pradas, Marc; van Wachem, Berend G. M.; Markides, Christos N.; Kalliadasis, Serafim
2014-11-01
Understanding the dynamics of hydrodynamic instabilities in liquid film flows is an active field of research in fluid dynamics and non-linear science in general. Numerical simulations offer a powerful tool to study hydrodynamic instabilities in film flows and can provide deep insights into the underlying physical phenomena. However, the direct comparison of numerical results and experimental results is often hampered by several reasons. For instance, in numerical simulations the interface representation is problematic and the governing equations and boundary conditions may be oversimplified, whereas in experiments it is often difficult to extract accurate information on the fluid and its behavior, e.g. determine the fluid properties when the liquid contains particles for PIV measurements. In this contribution we present the latest results of our on-going, extensive study on hydrodynamic instabilities in liquid film flows, which includes direct numerical simulations, low-dimensional modelling as well as experiments. The major focus is on wave regimes, wave height and wave celerity as a function of Reynolds number and forcing frequency of a falling liquid film. Specific attention is paid to the differences in numerical and experimental results and the reasons for these differences. The authors are grateful to the EPSRC for their financial support (Grant EP/K008595/1).
Kountouris, Petros; Hirst, Jonathan D
2010-07-31
Beta-turns are secondary structure elements usually classified as coil. Their prediction is important, because of their role in protein folding and their frequent occurrence in protein chains. We have developed a novel method that predicts beta-turns and their types using information from multiple sequence alignments, predicted secondary structures and, for the first time, predicted dihedral angles. Our method uses support vector machines, a supervised classification technique, and is trained and tested on three established datasets of 426, 547 and 823 protein chains. We achieve a Matthews correlation coefficient of up to 0.49, when predicting the location of beta-turns, the highest reported value to date. Moreover, the additional dihedral information improves the prediction of beta-turn types I, II, IV, VIII and "non-specific", achieving correlation coefficients up to 0.39, 0.33, 0.27, 0.14 and 0.38, respectively. Our results are more accurate than other methods. We have created an accurate predictor of beta-turns and their types. Our method, called DEBT, is available online at http://comp.chem.nottingham.ac.uk/debt/.
Directory of Open Access Journals (Sweden)
Chang Wang
Full Text Available The composting industry has been growing rapidly in China because of a boom in the animal industry. Therefore, a rapid and accurate assessment of the quality of commercial organic fertilizers is of the utmost importance. In this study, a novel technique that combines near infrared (NIR spectroscopy with partial least squares (PLS analysis is developed for rapidly and accurately assessing commercial organic fertilizers quality. A total of 104 commercial organic fertilizers were collected from full-scale compost factories in Jiangsu Province, east China. In general, the NIR-PLS technique showed accurate predictions of the total organic matter, water soluble organic nitrogen, pH, and germination index; less accurate results of the moisture, total nitrogen, and electrical conductivity; and the least accurate results for water soluble organic carbon. Our results suggested the combined NIR-PLS technique could be applied as a valuable tool to rapidly and accurately assess the quality of commercial organic fertilizers.
Wang, Chang; Huang, Chichao; Qian, Jian; Xiao, Jian; Li, Huan; Wen, Yongli; He, Xinhua; Ran, Wei; Shen, Qirong; Yu, Guanghui
2014-01-01
The composting industry has been growing rapidly in China because of a boom in the animal industry. Therefore, a rapid and accurate assessment of the quality of commercial organic fertilizers is of the utmost importance. In this study, a novel technique that combines near infrared (NIR) spectroscopy with partial least squares (PLS) analysis is developed for rapidly and accurately assessing commercial organic fertilizers quality. A total of 104 commercial organic fertilizers were collected from full-scale compost factories in Jiangsu Province, east China. In general, the NIR-PLS technique showed accurate predictions of the total organic matter, water soluble organic nitrogen, pH, and germination index; less accurate results of the moisture, total nitrogen, and electrical conductivity; and the least accurate results for water soluble organic carbon. Our results suggested the combined NIR-PLS technique could be applied as a valuable tool to rapidly and accurately assess the quality of commercial organic fertilizers.
Kahramanoglou, Christina; Webster, Christine L.; el-Robh, Mohamed Samir; Belyaeva, Tamara A.; Busby, Stephen J. W.
2006-01-01
Transcription of the Escherichia coli melAB operon is regulated by the MelR protein, an AraC family member whose activity is modulated by the binding of melibiose. In the absence of melibiose, MelR is unable to activate the melAB promoter but autoregulates its own expression by repressing the melR promoter. Melibiose triggers MelR-dependent activation of the melAB promoter and relieves MelR-dependent repression of the melR promoter. Twenty-nine single amino acid substitutions in MelR that res...
Branny, P; de la Torre, F; Garel, J R
1998-04-01
The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.
Calorimetry end-point predictions
International Nuclear Information System (INIS)
Fox, M.A.
1981-01-01
This paper describes a portion of the work presently in progress at Rocky Flats in the field of calorimetry. In particular, calorimetry end-point predictions are outlined. The problems associated with end-point predictions and the progress made in overcoming these obstacles are discussed. The two major problems, noise and an accurate description of the heat function, are dealt with to obtain the most accurate results. Data are taken from an actual calorimeter and are processed by means of three different noise reduction techniques. The processed data are then utilized by one to four algorithms, depending on the accuracy desired to determined the end-point
Large arterial occlusive strokes as a medical emergency: need to accurately predict clot location.
Vanacker, Peter; Faouzi, Mohamed; Eskandari, Ashraf; Maeder, Philippe; Meuli, Reto; Michel, Patrik
2017-10-01
Endovascular treatment for acute ischemic stroke with a large intracranial occlusion was recently shown to be effective. Timely knowledge of the presence, site, and extent of arterial occlusions in the ischemic territory has the potential to influence patient selection for endovascular treatment. We aimed to find predictors of large vessel occlusive strokes, on the basis of available demographic, clinical, radiological, and laboratory data in the emergency setting. Patients enrolled in ASTRAL registry with acute ischemic stroke and computed tomography (CT)-angiography within 12 h of stroke onset were selected and categorized according to occlusion site. Easily accessible variables were used in a multivariate analysis. Of 1645 patients enrolled, a significant proportion (46.2%) had a large vessel occlusion in the ischemic territory. The main clinical predictors of any arterial occlusion were in-hospital stroke [odd ratios (OR) 2.1, 95% confidence interval 1.4-3.1], higher initial National Institute of Health Stroke Scale (OR 1.1, 1.1-1.2), presence of visual field defects (OR 1.9, 1.3-2.6), dysarthria (OR 1.4, 1.0-1.9), or hemineglect (OR 2.0, 1.4-2.8) at admission and atrial fibrillation (OR 1.7, 1.2-2.3). Further, the following radiological predictors were identified: time-to-imaging (OR 0.9, 0.9-1.0), early ischemic changes (OR 2.3, 1.7-3.2), and silent lesions on CT (OR 0.7, 0.5-1.0). The area under curve for this analysis was 0.85. Looking at different occlusion sites, National Institute of Health Stroke Scale and early ischemic changes on CT were independent predictors in all subgroups. Neurological deficits, stroke risk factors, and CT findings accurately identify acute ischemic stroke patients at risk of symptomatic vessel occlusion. Predicting the presence of these occlusions may impact emergency stroke care in regions with limited access to noninvasive vascular imaging.
Remaining dischargeable time prediction for lithium-ion batteries using unscented Kalman filter
Dong, Guangzhong; Wei, Jingwen; Chen, Zonghai; Sun, Han; Yu, Xiaowei
2017-10-01
To overcome the range anxiety, one of the important strategies is to accurately predict the range or dischargeable time of the battery system. To accurately predict the remaining dischargeable time (RDT) of a battery, a RDT prediction framework based on accurate battery modeling and state estimation is presented in this paper. Firstly, a simplified linearized equivalent-circuit-model is developed to simulate the dynamic characteristics of a battery. Then, an online recursive least-square-algorithm method and unscented-Kalman-filter are employed to estimate the system matrices and SOC at every prediction point. Besides, a discrete wavelet transform technique is employed to capture the statistical information of past dynamics of input currents, which are utilized to predict the future battery currents. Finally, the RDT can be predicted based on the battery model, SOC estimation results and predicted future battery currents. The performance of the proposed methodology has been verified by a lithium-ion battery cell. Experimental results indicate that the proposed method can provide an accurate SOC and parameter estimation and the predicted RDT can solve the range anxiety issues.
High-order accurate numerical algorithm for three-dimensional transport prediction
Energy Technology Data Exchange (ETDEWEB)
Pepper, D W [Savannah River Lab., Aiken, SC; Baker, A J
1980-01-01
The numerical solution of the three-dimensional pollutant transport equation is obtained with the method of fractional steps; advection is solved by the method of moments and diffusion by cubic splines. Topography and variable mesh spacing are accounted for with coordinate transformations. First estimate wind fields are obtained by interpolation to grid points surrounding specific data locations. Numerical results agree with results obtained from analytical Gaussian plume relations for ideal conditions. The numerical model is used to simulate the transport of tritium released from the Savannah River Plant on 2 May 1974. Predicted ground level air concentration 56 km from the release point is within 38% of the experimentally measured value.
Accurate SHAPE-directed RNA secondary structure modeling, including pseudoknots.
Hajdin, Christine E; Bellaousov, Stanislav; Huggins, Wayne; Leonard, Christopher W; Mathews, David H; Weeks, Kevin M
2013-04-02
A pseudoknot forms in an RNA when nucleotides in a loop pair with a region outside the helices that close the loop. Pseudoknots occur relatively rarely in RNA but are highly overrepresented in functionally critical motifs in large catalytic RNAs, in riboswitches, and in regulatory elements of viruses. Pseudoknots are usually excluded from RNA structure prediction algorithms. When included, these pairings are difficult to model accurately, especially in large RNAs, because allowing this structure dramatically increases the number of possible incorrect folds and because it is difficult to search the fold space for an optimal structure. We have developed a concise secondary structure modeling approach that combines SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) experimental chemical probing information and a simple, but robust, energy model for the entropic cost of single pseudoknot formation. Structures are predicted with iterative refinement, using a dynamic programming algorithm. This melded experimental and thermodynamic energy function predicted the secondary structures and the pseudoknots for a set of 21 challenging RNAs of known structure ranging in size from 34 to 530 nt. On average, 93% of known base pairs were predicted, and all pseudoknots in well-folded RNAs were identified.
The economic value of accurate wind power forecasting to utilities
Energy Technology Data Exchange (ETDEWEB)
Watson, S J [Rutherford Appleton Lab., Oxfordshire (United Kingdom); Giebel, G; Joensen, A [Risoe National Lab., Dept. of Wind Energy and Atmospheric Physics, Roskilde (Denmark)
1999-03-01
With increasing penetrations of wind power, the need for accurate forecasting is becoming ever more important. Wind power is by its very nature intermittent. For utility schedulers this presents its own problems particularly when the penetration of wind power capacity in a grid reaches a significant level (>20%). However, using accurate forecasts of wind power at wind farm sites, schedulers are able to plan the operation of conventional power capacity to accommodate the fluctuating demands of consumers and wind farm output. The results of a study to assess the value of forecasting at several potential wind farm sites in the UK and in the US state of Iowa using the Reading University/Rutherford Appleton Laboratory National Grid Model (NGM) are presented. The results are assessed for different types of wind power forecasting, namely: persistence, optimised numerical weather prediction or perfect forecasting. In particular, it will shown how the NGM has been used to assess the value of numerical weather prediction forecasts from the Danish Meteorological Institute model, HIRLAM, and the US Nested Grid Model, which have been `site tailored` by the use of the linearized flow model WA{sup s}P and by various Model output Statistics (MOS) and autoregressive techniques. (au)
Predictive modeling of complications.
Osorio, Joseph A; Scheer, Justin K; Ames, Christopher P
2016-09-01
Predictive analytic algorithms are designed to identify patterns in the data that allow for accurate predictions without the need for a hypothesis. Therefore, predictive modeling can provide detailed and patient-specific information that can be readily applied when discussing the risks of surgery with a patient. There are few studies using predictive modeling techniques in the adult spine surgery literature. These types of studies represent the beginning of the use of predictive analytics in spine surgery outcomes. We will discuss the advancements in the field of spine surgery with respect to predictive analytics, the controversies surrounding the technique, and the future directions.
Accurate van der Waals force field for gas adsorption in porous materials.
Sun, Lei; Yang, Li; Zhang, Ya-Dong; Shi, Qi; Lu, Rui-Feng; Deng, Wei-Qiao
2017-09-05
An accurate van der Waals force field (VDW FF) was derived from highly precise quantum mechanical (QM) calculations. Small molecular clusters were used to explore van der Waals interactions between gas molecules and porous materials. The parameters of the accurate van der Waals force field were determined by QM calculations. To validate the force field, the prediction results from the VDW FF were compared with standard FFs, such as UFF, Dreiding, Pcff, and Compass. The results from the VDW FF were in excellent agreement with the experimental measurements. This force field can be applied to the prediction of the gas density (H 2 , CO 2 , C 2 H 4 , CH 4 , N 2 , O 2 ) and adsorption performance inside porous materials, such as covalent organic frameworks (COFs), zeolites and metal organic frameworks (MOFs), consisting of H, B, N, C, O, S, Si, Al, Zn, Mg, Ni, and Co. This work provides a solid basis for studying gas adsorption in porous materials. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Computer-based personality judgments are more accurate than those made by humans
Youyou, Wu; Kosinski, Michal; Stillwell, David
2015-01-01
Judging others’ personalities is an essential skill in successful social living, as personality is a key driver behind people’s interactions, behaviors, and emotions. Although accurate personality judgments stem from social-cognitive skills, developments in machine learning show that computer models can also make valid judgments. This study compares the accuracy of human and computer-based personality judgments, using a sample of 86,220 volunteers who completed a 100-item personality questionnaire. We show that (i) computer predictions based on a generic digital footprint (Facebook Likes) are more accurate (r = 0.56) than those made by the participants’ Facebook friends using a personality questionnaire (r = 0.49); (ii) computer models show higher interjudge agreement; and (iii) computer personality judgments have higher external validity when predicting life outcomes such as substance use, political attitudes, and physical health; for some outcomes, they even outperform the self-rated personality scores. Computers outpacing humans in personality judgment presents significant opportunities and challenges in the areas of psychological assessment, marketing, and privacy. PMID:25583507
Fast and accurate covalent bond predictions using perturbation theory in chemical space
Chang, Kuang-Yu; von Lilienfeld, Anatole
I will discuss the predictive accuracy of perturbation theory based estimates of changes in covalent bonding due to linear alchemical interpolations among systems of different chemical composition. We have investigated single, double, and triple bonds occurring in small sets of iso-valence-electronic molecular species with elements drawn from second to fourth rows in the p-block of the periodic table. Numerical evidence suggests that first order estimates of covalent bonding potentials can achieve chemical accuracy (within 1 kcal/mol) if the alchemical interpolation is vertical (fixed geometry) among chemical elements from third and fourth row of the periodic table. When applied to nonbonded systems of molecular dimers or solids such as III-V semiconductors, alanates, alkali halides, and transition metals, similar observations hold, enabling rapid predictions of van der Waals energies, defect energies, band-structures, crystal structures, and lattice constants.
Predictive value of diminutive colonic adenoma trial: the PREDICT trial.
Schoenfeld, Philip; Shad, Javaid; Ormseth, Eric; Coyle, Walter; Cash, Brooks; Butler, James; Schindler, William; Kikendall, Walter J; Furlong, Christopher; Sobin, Leslie H; Hobbs, Christine M; Cruess, David; Rex, Douglas
2003-05-01
Diminutive adenomas (1-9 mm in diameter) are frequently found during colon cancer screening with flexible sigmoidoscopy (FS). This trial assessed the predictive value of these diminutive adenomas for advanced adenomas in the proximal colon. In a multicenter, prospective cohort trial, we matched 200 patients with normal FS and 200 patients with diminutive adenomas on FS for age and gender. All patients underwent colonoscopy. The presence of advanced adenomas (adenoma >or= 10 mm in diameter, villous adenoma, adenoma with high grade dysplasia, and colon cancer) and adenomas (any size) was recorded. Before colonoscopy, patients completed questionnaires about risk factors for adenomas. The prevalence of advanced adenomas in the proximal colon was similar in patients with diminutive adenomas and patients with normal FS (6% vs. 5.5%, respectively) (relative risk, 1.1; 95% confidence interval [CI], 0.5-2.6). Diminutive adenomas on FS did not accurately predict advanced adenomas in the proximal colon: sensitivity, 52% (95% CI, 32%-72%); specificity, 50% (95% CI, 49%-51%); positive predictive value, 6% (95% CI, 4%-8%); and negative predictive value, 95% (95% CI, 92%-97%). Male gender (odds ratio, 1.63; 95% CI, 1.01-2.61) was associated with an increased risk of proximal colon adenomas. Diminutive adenomas on sigmoidoscopy may not accurately predict advanced adenomas in the proximal colon.
Zuñiga, Cristal; Li, Chien-Ting; Huelsman, Tyler; Levering, Jennifer; Zielinski, Daniel C; McConnell, Brian O; Long, Christopher P; Knoshaug, Eric P; Guarnieri, Michael T; Antoniewicz, Maciek R; Betenbaugh, Michael J; Zengler, Karsten
2016-09-01
The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. © 2016 American Society of Plant Biologists. All rights reserved.
Wang, Nu; Boswell, Paul G
2017-10-20
Gradient retention times are difficult to project from the underlying retention factor (k) vs. solvent composition (φ) relationships. A major reason for this difficulty is that gradients produced by HPLC pumps are imperfect - gradient delay, gradient dispersion, and solvent mis-proportioning are all difficult to account for in calculations. However, we recently showed that a gradient "back-calculation" methodology can measure these imperfections and take them into account. In RPLC, when the back-calculation methodology was used, error in projected gradient retention times is as low as could be expected based on repeatability in the k vs. φ relationships. HILIC, however, presents a new challenge: the selectivity of HILIC columns drift strongly over time. Retention is repeatable in short time, but selectivity frequently drifts over the course of weeks. In this study, we set out to understand if the issue of selectivity drift can be avoid by doing our experiments quickly, and if there any other factors that make it difficult to predict gradient retention times from isocratic k vs. φ relationships when gradient imperfections are taken into account with the back-calculation methodology. While in past reports, the accuracy of retention projections was >5%, the back-calculation methodology brought our error down to ∼1%. This result was 6-43 times more accurate than projections made using ideal gradients and 3-5 times more accurate than the same retention projections made using offset gradients (i.e., gradients that only took gradient delay into account). Still, the error remained higher in our HILIC projections than in RPLC. Based on the shape of the back-calculated gradients, we suspect the higher error is a result of prominent gradient distortion caused by strong, preferential water uptake from the mobile phase into the stationary phase during the gradient - a factor our model did not properly take into account. It appears that, at least with the stationary phase
Bendl, Jaroslav; Musil, Miloš; Štourač, Jan; Zendulka, Jaroslav; Damborský, Jiří; Brezovský, Jan
2016-05-01
An important message taken from human genome sequencing projects is that the human population exhibits approximately 99.9% genetic similarity. Variations in the remaining parts of the genome determine our identity, trace our history and reveal our heritage. The precise delineation of phenotypically causal variants plays a key role in providing accurate personalized diagnosis, prognosis, and treatment of inherited diseases. Several computational methods for achieving such delineation have been reported recently. However, their ability to pinpoint potentially deleterious variants is limited by the fact that their mechanisms of prediction do not account for the existence of different categories of variants. Consequently, their output is biased towards the variant categories that are most strongly represented in the variant databases. Moreover, most such methods provide numeric scores but not binary predictions of the deleteriousness of variants or confidence scores that would be more easily understood by users. We have constructed three datasets covering different types of disease-related variants, which were divided across five categories: (i) regulatory, (ii) splicing, (iii) missense, (iv) synonymous, and (v) nonsense variants. These datasets were used to develop category-optimal decision thresholds and to evaluate six tools for variant prioritization: CADD, DANN, FATHMM, FitCons, FunSeq2 and GWAVA. This evaluation revealed some important advantages of the category-based approach. The results obtained with the five best-performing tools were then combined into a consensus score. Additional comparative analyses showed that in the case of missense variations, protein-based predictors perform better than DNA sequence-based predictors. A user-friendly web interface was developed that provides easy access to the five tools' predictions, and their consensus scores, in a user-understandable format tailored to the specific features of different categories of variations. To
Zuñiga, Cristal; Li, Chien-Ting; Zielinski, Daniel C.; Guarnieri, Michael T.; Antoniewicz, Maciek R.; Zengler, Karsten
2016-01-01
The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. PMID:27372244
Taxi-Out Time Prediction for Departures at Charlotte Airport Using Machine Learning Techniques
Lee, Hanbong; Malik, Waqar; Jung, Yoon C.
2016-01-01
Predicting the taxi-out times of departures accurately is important for improving airport efficiency and takeoff time predictability. In this paper, we attempt to apply machine learning techniques to actual traffic data at Charlotte Douglas International Airport for taxi-out time prediction. To find the key factors affecting aircraft taxi times, surface surveillance data is first analyzed. From this data analysis, several variables, including terminal concourse, spot, runway, departure fix and weight class, are selected for taxi time prediction. Then, various machine learning methods such as linear regression, support vector machines, k-nearest neighbors, random forest, and neural networks model are applied to actual flight data. Different traffic flow and weather conditions at Charlotte airport are also taken into account for more accurate prediction. The taxi-out time prediction results show that linear regression and random forest techniques can provide the most accurate prediction in terms of root-mean-square errors. We also discuss the operational complexity and uncertainties that make it difficult to predict the taxi times accurately.
Predictability of the 2012 Great Arctic Cyclone on medium-range timescales
Yamagami, Akio; Matsueda, Mio; Tanaka, Hiroshi L.
2018-03-01
Arctic Cyclones (ACs) can have a significant impact on the Arctic region. Therefore, the accurate prediction of ACs is important in anticipating their associated environmental and societal costs. This study investigates the predictability of the 2012 Great Arctic Cyclone (AC12) that exhibited a minimum central pressure of 964 hPa on 6 August 2012, using five medium-range ensemble forecasts. We show that the development and position of AC12 were better predicted in forecasts initialized on and after 4 August 2012. In addition, the position of AC12 was more predictable than its development. A comparison of ensemble members, classified by the error in predictability of the development and position of AC12, revealed that an accurate prediction of upper-level fields, particularly temperature, was important for the prediction of this event. The predicted position of AC12 was influenced mainly by the prediction of the polar vortex, whereas the predicted development of AC12 was dependent primarily on the prediction of the merging of upper-level warm cores. Consequently, an accurate prediction of the polar vortex position and the development of the warm core through merging resulted in better prediction of AC12.
Antonios, Tarek F T; Nama, Vivek; Wang, Duolao; Manyonda, Isaac T
2013-09-01
Preeclampsia is a major cause of maternal and neonatal mortality and morbidity. The incidence of preeclampsia seems to be rising because of increased prevalence of predisposing disorders, such as essential hypertension, diabetes, and obesity, and there is increasing evidence to suggest widespread microcirculatory abnormalities before the onset of preeclampsia. We hypothesized that quantifying capillary rarefaction could be helpful in the clinical prediction of preeclampsia. We measured skin capillary density according to a well-validated protocol at 5 consecutive predetermined visits in 322 consecutive white women, of whom 16 subjects developed preeclampsia. We found that structural capillary rarefaction at 20-24 weeks of gestation yielded a sensitivity of 0.87 with a specificity of 0.50 at the cutoff of 2 capillaries/field with the area under the curve of the receiver operating characteristic value of 0.70, whereas capillary rarefaction at 27-32 weeks of gestation yielded a sensitivity of 0.75 and a higher specificity of 0.77 at the cutoff of 8 capillaries/field with area under the curve of the receiver operating characteristic value of 0.82. Combining capillary rarefaction with uterine artery Doppler pulsatility index increased the sensitivity and specificity of the prediction. Multivariable analysis shows that the odds of preeclampsia are increased in women with previous history of preeclampsia or chronic hypertension and in those with increased uterine artery Doppler pulsatility index, but the most powerful and independent predictor of preeclampsia was capillary rarefaction at 27-32 weeks. Quantifying structural rarefaction of skin capillaries in pregnancy is a potentially useful clinical marker for the prediction of preeclampsia.
Probability-based collaborative filtering model for predicting gene–disease associations
Zeng, Xiangxiang; Ding, Ningxiang; Rodríguez-Patón, Alfonso; Zou, Quan
2017-01-01
Background Accurately predicting pathogenic human genes has been challenging in recent research. Considering extensive gene–disease data verified by biological experiments, we can apply computational methods to perform accurate predictions with reduced time and expenses. Methods We propose a probability-based collaborative filtering model (PCFM) to predict pathogenic human genes. Several kinds of data sets, containing data of humans and data of other nonhuman species, are integrated in our mo...
Predicting scholars' scientific impact.
Directory of Open Access Journals (Sweden)
Amin Mazloumian
Full Text Available We tested the underlying assumption that citation counts are reliable predictors of future success, analyzing complete citation data on the careers of ~150,000 scientists. Our results show that i among all citation indicators, the annual citations at the time of prediction is the best predictor of future citations, ii future citations of a scientist's published papers can be predicted accurately (r(2 = 0.80 for a 1-year prediction, P<0.001 but iii future citations of future work are hardly predictable.
Sengupta, Arkajyoti; Ramabhadran, Raghunath O; Raghavachari, Krishnan
2014-08-14
In this study we have used the connectivity-based hierarchy (CBH) method to derive accurate heats of formation of a range of biomolecules, 18 amino acids and 10 barbituric acid/uracil derivatives. The hierarchy is based on the connectivity of the different atoms in a large molecule. It results in error-cancellation reaction schemes that are automated, general, and can be readily used for a broad range of organic molecules and biomolecules. Herein, we first locate stable conformational and tautomeric forms of these biomolecules using an accurate level of theory (viz. CCSD(T)/6-311++G(3df,2p)). Subsequently, the heats of formation of the amino acids are evaluated using the CBH-1 and CBH-2 schemes and routinely employed density functionals or wave function-based methods. The calculated heats of formation obtained herein using modest levels of theory and are in very good agreement with those obtained using more expensive W1-F12 and W2-F12 methods on amino acids and G3 results on barbituric acid derivatives. Overall, the present study (a) highlights the small effect of including multiple conformers in determining the heats of formation of biomolecules and (b) in concurrence with previous CBH studies, proves that use of the more effective error-cancelling isoatomic scheme (CBH-2) results in more accurate heats of formation with modestly sized basis sets along with common density functionals or wave function-based methods.
Accurate determination of rates from non-uniformly sampled relaxation data
Energy Technology Data Exchange (ETDEWEB)
Stetz, Matthew A.; Wand, A. Joshua, E-mail: wand@upenn.edu [University of Pennsylvania Perelman School of Medicine, Johnson Research Foundation and Department of Biochemistry and Biophysics (United States)
2016-08-15
The application of non-uniform sampling (NUS) to relaxation experiments traditionally used to characterize the fast internal motion of proteins is quantitatively examined. Experimentally acquired Poisson-gap sampled data reconstructed with iterative soft thresholding are compared to regular sequentially sampled (RSS) data. Using ubiquitin as a model system, it is shown that 25 % sampling is sufficient for the determination of quantitatively accurate relaxation rates. When the sampling density is fixed at 25 %, the accuracy of rates is shown to increase sharply with the total number of sampled points until eventually converging near the inherent reproducibility of the experiment. Perhaps contrary to some expectations, it is found that accurate peak height reconstruction is not required for the determination of accurate rates. Instead, inaccuracies in rates arise from inconsistencies in reconstruction across the relaxation series that primarily manifest as a non-linearity in the recovered peak height. This indicates that the performance of an NUS relaxation experiment cannot be predicted from comparison of peak heights using a single RSS reference spectrum. The generality of these findings was assessed using three alternative reconstruction algorithms, eight different relaxation measurements, and three additional proteins that exhibit varying degrees of spectral complexity. From these data, it is revealed that non-linearity in peak height reconstruction across the relaxation series is strongly correlated with errors in NUS-derived relaxation rates. Importantly, it is shown that this correlation can be exploited to reliably predict the performance of an NUS-relaxation experiment by using three or more RSS reference planes from the relaxation series. The RSS reference time points can also serve to provide estimates of the uncertainty of the sampled intensity, which for a typical relaxation times series incurs no penalty in total acquisition time.
Ouwerkerk, Wouter; Voors, Adriaan A.; Zwinderman, Aeilko H.
2014-01-01
The present paper systematically reviews and compares existing prediction models in order to establish the strongest variables, models, and model characteristics in patients with heart failure predicting outcome. To improve decision making accurately predicting mortality and heart-failure
Kearns, F L; Hudson, P S; Boresch, S; Woodcock, H L
2016-01-01
Enzyme activity is inherently linked to free energies of transition states, ligand binding, protonation/deprotonation, etc.; these free energies, and thus enzyme function, can be affected by residue mutations, allosterically induced conformational changes, and much more. Therefore, being able to predict free energies associated with enzymatic processes is critical to understanding and predicting their function. Free energy simulation (FES) has historically been a computational challenge as it requires both the accurate description of inter- and intramolecular interactions and adequate sampling of all relevant conformational degrees of freedom. The hybrid quantum mechanical molecular mechanical (QM/MM) framework is the current tool of choice when accurate computations of macromolecular systems are essential. Unfortunately, robust and efficient approaches that employ the high levels of computational theory needed to accurately describe many reactive processes (ie, ab initio, DFT), while also including explicit solvation effects and accounting for extensive conformational sampling are essentially nonexistent. In this chapter, we will give a brief overview of two recently developed methods that mitigate several major challenges associated with QM/MM FES: the QM non-Boltzmann Bennett's acceptance ratio method and the QM nonequilibrium work method. We will also describe usage of these methods to calculate free energies associated with (1) relative properties and (2) along reaction paths, using simple test cases with relevance to enzymes examples. © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Mini Joseph
2017-01-01
Full Text Available Background: The accuracy of existing predictive equations to determine the resting energy expenditure (REE of professional weightlifters remains scarcely studied. Our study aimed at assessing the REE of male Asian Indian weightlifters with indirect calorimetry and to compare the measured REE (mREE with published equations. A new equation using potential anthropometric variables to predict REE was also evaluated. Materials and Methods: REE was measured on 30 male professional weightlifters aged between 17 and 28 years using indirect calorimetry and compared with the eight formulas predicted by Harris–Benedicts, Mifflin-St. Jeor, FAO/WHO/UNU, ICMR, Cunninghams, Owen, Katch-McArdle, and Nelson. Pearson correlation coefficient, intraclass correlation coefficient, and multiple linear regression analysis were carried out to study the agreement between the different methods, association with anthropometric variables, and to formulate a new prediction equation for this population. Results: Pearson correlation coefficients between mREE and the anthropometric variables showed positive significance with suprailiac skinfold thickness, lean body mass (LBM, waist circumference, hip circumference, bone mineral mass, and body mass. All eight predictive equations underestimated the REE of the weightlifters when compared with the mREE. The highest mean difference was 636 kcal/day (Owen, 1986 and the lowest difference was 375 kcal/day (Cunninghams, 1980. Multiple linear regression done stepwise showed that LBM was the only significant determinant of REE in this group of sportspersons. A new equation using LBM as the independent variable for calculating REE was computed. REE for weightlifters = −164.065 + 0.039 (LBM (confidence interval −1122.984, 794.854]. This new equation reduced the mean difference with mREE by 2.36 + 369.15 kcal/day (standard error = 67.40. Conclusion: The significant finding of this study was that all the prediction equations