WorldWideScience

Sample records for accurate operon predictions

  1. A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.; Arkin, Adam P.

    2004-12-01

    We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, and its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.

  2. Operon prediction in Pyrococcus furiosus

    OpenAIRE

    Tran, Thao T.; Dam, Phuongan; Su, Zhengchang; Poole, Farris L.; Adams, Michael W.W.; Zhou, G. Tong; Xu, Ying

    2006-01-01

    Identification of operons in the hyperthermophilic archaeon Pyrococcus furiosus represents an important step to understanding the regulatory mechanisms that enable the organism to adapt and thrive in extreme environments. We have predicted operons in P.furiosus by combining the results from three existing algorithms using a neural network (NN). These algorithms use intergenic distances, phylogenetic profiles, functional categories and gene-order conservation in their operon prediction. Our me...

  3. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  4. Binary particle swarm optimization for operon prediction.

    Science.gov (United States)

    Chuang, Li-Yeh; Tsai, Jui-Hung; Yang, Cheng-Hong

    2010-07-01

    An operon is a fundamental unit of transcription and contains specific functional genes for the construction and regulation of networks at the entire genome level. The correct prediction of operons is vital for understanding gene regulations and functions in newly sequenced genomes. As experimental methods for operon detection tend to be nontrivial and time consuming, various methods for operon prediction have been proposed in the literature. In this study, a binary particle swarm optimization is used for operon prediction in bacterial genomes. The intergenic distance, participation in the same metabolic pathway, the cluster of orthologous groups, the gene length ratio and the operon length are used to design a fitness function. We trained the proper values on the Escherichia coli genome, and used the above five properties to implement feature selection. Finally, our study used the intergenic distance, metabolic pathway and the gene length ratio property to predict operons. Experimental results show that the prediction accuracy of this method reached 92.1%, 93.3% and 95.9% on the Bacillus subtilis genome, the Pseudomonas aeruginosa PA01 genome and the Staphylococcus aureus genome, respectively. This method has enabled us to predict operons with high accuracy for these three genomes, for which only limited data on the properties of the operon structure exists.

  5. High accuracy operon prediction method based on STRING database scores.

    Science.gov (United States)

    Taboada, Blanca; Verde, Cristina; Merino, Enrique

    2010-07-01

    We present a simple and highly accurate computational method for operon prediction, based on intergenic distances and functional relationships between the protein products of contiguous genes, as defined by STRING database (Jensen,L.J., Kuhn,M., Stark,M., Chaffron,S., Creevey,C., Muller,J., Doerks,T., Julien,P., Roth,A., Simonovic,M. et al. (2009) STRING 8-a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res., 37, D412-D416). These two parameters were used to train a neural network on a subset of experimentally characterized Escherichia coli and Bacillus subtilis operons. Our predictive model was successfully tested on the set of experimentally defined operons in E. coli and B. subtilis, with accuracies of 94.6 and 93.3%, respectively. As far as we know, these are the highest accuracies ever obtained for predicting bacterial operons. Furthermore, in order to evaluate the predictable accuracy of our model when using an organism's data set for the training procedure, and a different organism's data set for testing, we repeated the E. coli operon prediction analysis using a neural network trained with B. subtilis data, and a B. subtilis analysis using a neural network trained with E. coli data. Even for these cases, the accuracies reached with our method were outstandingly high, 91.5 and 93%, respectively. These results show the potential use of our method for accurately predicting the operons of any other organism. Our operon predictions for fully-sequenced genomes are available at http://operons.ibt.unam.mx/OperonPredictor/.

  6. Computational operon prediction in whole-genomes and metagenomes.

    Science.gov (United States)

    Zaidi, Syed Shujaat Ali; Zhang, Xuegong

    2017-07-01

    Microbial diversity in unique environmental settings enables abrupt responses catalysed by altering the gene regulation and formation of gene clusters called operons. Operons increases bacterial adaptability, which in turn increases their survival. This review article presents the emergence of computational operon prediction methods for whole microbial genomes and metagenomes, and discusses their strengths and limitations. Most of the whole-genome operon prediction methods struggle to generalize on unrelated genomes. The applicability of universal whole-genome operon prediction methods to metagenomic data is an interesting yet less investigated question. We have evaluated the potential of various operon prediction features for genomic and metagenomic data. Most of operon prediction methods with high accuracy have been compiled into databases. Despite of the high predictive performance, the data among many databases are not completely consistent for similar species. We performed a correlation analysis between the computationally predicted operon databases and experimentally validated data for Escherichia coli, Bacillus subtilis and Mycobacterium tuberculosis. Operon prediction for most of the less characterized microbes cannot be verified due to absence of experimentally validated operons. The generation of validated information for other microbes would test the authenticity of operon databases for other less annotated microbes as well. Advances in sequencing technologies and development of better analysis methods will help researchers to overcome the technological hurdles (such as long sequencing reads and improved contig size) and further improve operon predictions and better utilize operonic information. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  7. A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons.

    Science.gov (United States)

    Tian, Tian; Salis, Howard M

    2015-08-18

    Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Operon prediction using chaos embedded particle swarm optimization.

    Science.gov (United States)

    Chuang, Li-Yeh; Yang, Cheng-Huei; Tsai, Jui-Hung; Yang, Cheng-Hong

    2013-01-01

    Operons contain valuable information for drug design and determining protein functions. Genes within an operon are co-transcribed to a single-strand mRNA and must be coregulated. The identification of operons is, thus, critical for a detailed understanding of the gene regulations. However, currently used experimental methods for operon detection are generally difficult to implement and time consuming. In this paper, we propose a chaotic binary particle swarm optimization (CBPSO) to predict operons in bacterial genomes. The intergenic distance, participation in the same metabolic pathway and the cluster of orthologous groups (COG) properties of the Escherichia coli genome are used to design a fitness function. Furthermore, the Bacillus subtilis, Pseudomonas aeruginosa PA01, Staphylococcus aureus and Mycobacterium tuberculosis genomes are tested and evaluated for accuracy, sensitivity, and specificity. The computational results indicate that the proposed method works effectively in terms of enhancing the performance of the operon prediction. The proposed method also achieved a good balance between sensitivity and specificity when compared to methods from the literature.

  9. Predicted transcription factor binding sites as predictors of operons in Escherichia coli and Streptomyces coelicolor.

    Science.gov (United States)

    Laing, Emma; Sidhu, Khushwant; Hubbard, Simon J

    2008-02-12

    As a polycistronic transcriptional unit of one or more adjacent genes, operons play a key role in regulation and function in prokaryotic biology, and a better understanding of how they are constituted and controlled is needed. Recent efforts have attempted to predict operonic status in sequenced genomes using a variety of techniques and data sources. To date, non-homology based operon prediction strategies have mainly used predicted promoters and terminators present at the extremities of transcriptional unit as predictors, with reasonable success. However, transcription factor binding sites (TFBSs), typically found upstream of the first gene in an operon, have not yet been evaluated. Here we apply a method originally developed for the prediction of TFBSs in Escherichia coli that minimises the need for prior knowledge and tests its ability to predict operons in E. coli and the 'more complex', pharmaceutically important, Streptomyces coelicolor. We demonstrate that through building genome specific TFBS position-specific-weight-matrices (PSWMs) it is possible to predict operons in E. coli and S. coelicolor with 83% and 93% accuracy respectively, using only TFBS as delimiters of operons. Additionally, the 'palindromicity' of TFBS footprint data of E. coli is characterised. TFBS are proposed as novel independent features for use in prokaryotic operon prediction (whether alone or as part of a set of features) given their efficacy as operon predictors in E. coli and S. coelicolor. We also show that TFBS footprint data in E. coli generally contains inverted repeats with significantly (p operon predictions.

  10. Operon structure of Staphylococcus aureus.

    Science.gov (United States)

    ten Broeke-Smits, Nicole J P; Pronk, Tessa E; Jongerius, Ilse; Bruning, Oskar; Wittink, Floyd R; Breit, Timo M; van Strijp, Jos A G; Fluit, Ad C; Boel, C H Edwin

    2010-06-01

    In bacteria, gene regulation is one of the fundamental characteristics of survival, colonization and pathogenesis. Operons play a key role in regulating expression of diverse genes involved in metabolism and virulence. However, operon structures in pathogenic bacteria have been determined only by in silico approaches that are dependent on factors such as intergenic distances and terminator/promoter sequences. Knowledge of operon structures is crucial to fully understand the pathophysiology of infections. Presently, transcriptome data obtained from growth curves in a defined medium were used to predict operons in Staphylococcus aureus. This unbiased approach and the use of five highly reproducible biological replicates resulted in 93.5% significantly regulated genes. These data, combined with Pearson's correlation coefficients of the transcriptional profiles, enabled us to accurately compile 93% of the genome in operon structures. A total of 1640 genes of different functional classes were identified in operons. Interestingly, we found several operons containing virulence genes and showed synergistic effects for two complement convertase inhibitors transcribed in one operon. This is the first experimental approach to fully identify operon structures in S. aureus. It forms the basis for further in vitro regulation studies that will profoundly advance the understanding of bacterial pathophysiology in vivo.

  11. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  12. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  13. Optimal gene partition into operons correlates with gene functional order

    Science.gov (United States)

    Zaslaver, Alon; Mayo, Avi; Ronen, Michal; Alon, Uri

    2006-09-01

    Gene arrangement into operons varies between bacterial species. Genes in a given system can be on one operon in some organisms and on several operons in other organisms. Existing theories explain why genes that work together should be on the same operon, since this allows for advantageous lateral gene transfer and accurate stoichiometry. But what causes the frequent separation into multiple operons of co-regulated genes that act together in a pathway? Here we suggest that separation is due to benefits made possible by differential regulation of each operon. We present a simple mathematical model for the optimal distribution of genes into operons based on a balance of the cost of operons and the benefit of regulation that provides 'just-when-needed' temporal order. The analysis predicts that genes are arranged such that genes on the same operon do not skip functional steps in the pathway. This prediction is supported by genomic data from 137 bacterial genomes. Our work suggests that gene arrangement is not only the result of random historical drift, genome re-arrangement and gene transfer, but has elements that are solutions of an evolutionary optimization problem. Thus gene functional order may be inferred by analyzing the operon structure across different genomes.

  14. Highly Accurate Prediction of Jobs Runtime Classes

    OpenAIRE

    Anat Reiner-Benaim; Anna Grabarnick; Edi Shmueli

    2016-01-01

    Separating the short jobs from the long is a known technique to improve scheduling performance. In this paper we describe a method we developed for accurately predicting the runtimes classes of the jobs to enable this separation. Our method uses the fact that the runtimes can be represented as a mixture of overlapping Gaussian distributions, in order to train a CART classifier to provide the prediction. The threshold that separates the short jobs from the long jobs is determined during the ev...

  15. Accurate predictions for the LHC made easy

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    The data recorded by the LHC experiments is of a very high quality. To get the most out of the data, precise theory predictions, including uncertainty estimates, are needed to reduce as much as possible theoretical bias in the experimental analyses. Recently, significant progress has been made in computing Next-to-Leading Order (NLO) computations, including matching to the parton shower, that allow for these accurate, hadron-level predictions. I shall discuss one of these efforts, the MadGraph5_aMC@NLO program, that aims at the complete automation of predictions at the NLO accuracy within the SM as well as New Physics theories. I’ll illustrate some of the theoretical ideas behind this program, show some selected applications to LHC physics, as well as describe the future plans.

  16. Climate Models have Accurately Predicted Global Warming

    Science.gov (United States)

    Nuccitelli, D. A.

    2016-12-01

    Climate model projections of global temperature changes over the past five decades have proven remarkably accurate, and yet the myth that climate models are inaccurate or unreliable has formed the basis of many arguments denying anthropogenic global warming and the risks it poses to the climate system. Here we compare average global temperature predictions made by both mainstream climate scientists using climate models, and by contrarians using less physically-based methods. We also explore the basis of the myth by examining specific arguments against climate model accuracy and their common characteristics of science denial.

  17. PPO: predictor for prokaryotic operons.

    Science.gov (United States)

    Chuang, Li-Yeh; Tsai, Jui-Hung; Yang, Cheng-Hong

    2010-12-15

    We present an operon predictor for prokaryotic operons (PPO), which can predict operons in the entire prokaryotic genome. The prediction algorithm used in PPO allows the user to select binary particle swarm optimization (BPSO), a genetic algorithm (GA) or some other methods introduced in the literature to predict operons. The operon predictor on our web server and the provided database are easy to access and use. The main features offered are: (i) selection of the prediction algorithm; (ii) adjustable parameter settings of the prediction algorithm; (iii) graphic visualization of results; (iv) integrated database queries; (v) listing of experimentally verified operons; and (vi) related tools. PPO is freely available at http://bio.kuas.edu.tw/PPO/.

  18. DOOR: a database for prokaryotic operons.

    Science.gov (United States)

    Mao, Fenglou; Dam, Phuongan; Chou, Jacky; Olman, Victor; Xu, Ying

    2009-01-01

    We present a database DOOR (Database for prOkaryotic OpeRons) containing computationally predicted operons of all the sequenced prokaryotic genomes. All the operons in DOOR are predicted using our own prediction program, which was ranked to be the best among 14 operon prediction programs by a recent independent review. Currently, the DOOR database contains operons for 675 prokaryotic genomes, and supports a number of search capabilities to facilitate easy access and utilization of the information stored in it. (1) Querying the database: the database provides a search capability for a user to find desired operons and associated information through multiple querying methods. (2) Searching for similar operons: the database provides a search capability for a user to find operons that have similar composition and structure to a query operon. (3) Prediction of cis-regulatory motifs: the database provides a capability for motif identification in the promoter regions of a user-specified group of possibly coregulated operons, using motif-finding tools. (4) Operons for RNA genes: the database includes operons for RNA genes. (5) OperonWiki: the database provides a wiki page (OperonWiki) to facilitate interactions between users and the developer of the database. We believe that DOOR provides a useful resource to many biologists working on bacteria and archaea, which can be accessed at http://csbl1.bmb.uga.edu/OperonDB.

  19. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of Emetabolism, containing P450 genes restricted to the Brassica family and predicted to be involved in secondary metabolism. Operon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid

  20. Customised birthweight standards accurately predict perinatal morbidity.

    Science.gov (United States)

    Figueras, Francesc; Figueras, Josep; Meler, Eva; Eixarch, Elisenda; Coll, Oriol; Gratacos, Eduard; Gardosi, Jason; Carbonell, Xavier

    2007-07-01

    Fetal growth restriction is associated with adverse perinatal outcome but is often not recognised antenatally, and low birthweight centiles based on population norms are used as a proxy instead. This study compared the association between neonatal morbidity and fetal growth status at birth as determined by customised birthweight centiles and currently used centiles based on population standards. Retrospective cohort study. Referral hospital, Barcelona, Spain. A cohort of 13 661 non-malformed singleton deliveries. Both population-based and customised standards for birth weight were applied to the study cohort. Customised weight centiles were calculated by adjusting for maternal height, booking weight, parity, ethnic origin, gestational age at delivery and fetal sex. Newborn morbidity and perinatal death. The association between smallness for gestational age (SGA) and perinatal morbidity was stronger when birthweight limits were customised, and resulted in an additional 4.1% (n=565) neonates being classified as SGA. Compared with non-SGA neonates, this newly identified group had an increased risk of perinatal mortality (OR 3.2; 95% CI 1.6 to 6.2), neurological morbidity (OR 3.2; 95% CI 1.7 to 6.1) and non-neurological morbidity (OR 8; 95% CI 4.8 to 13.6). Customised standards improve the prediction of adverse neonatal outcome. The association between SGA and adverse outcome is independent of the gestational age at delivery.

  1. DOMAC: an accurate, hybrid protein domain prediction server

    OpenAIRE

    Cheng, Jianlin

    2007-01-01

    Protein domain prediction is important for protein structure prediction, structure determination, function annotation, mutagenesis analysis and protein engineering. Here we describe an accurate protein domain prediction server (DOMAC) combining both template-based and ab initio methods. The preliminary version of the server was ranked among the top domain prediction servers in the seventh edition of Critical Assessment of Techniques for Protein Structure Prediction (CASP7), 2006. DOMAC server...

  2. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  3. Adaptive through-thickness integration for accurate springback prediction

    NARCIS (Netherlands)

    Burchitz, I.A.; Meinders, Vincent T.

    2007-01-01

    Accurate numerical prediction of springback in sheet metal forming is essential for the automotive industry. Numerous factors influence the accuracy of prediction of this complex phenomenon by using the finite element method. One of them is the numerical integration through the thickness of shell

  4. ODB: a database for operon organizations, 2011 update.

    Science.gov (United States)

    Okuda, Shujiro; Yoshizawa, Akiyasu C

    2011-01-01

    ODB (Operon DataBase) aims to collect data of all known and conserved operons in completely sequenced genomes. Three newly updated features of this database have been added as follows: (i) Data from included operons were updated. The genome-wide analysis of transcription and transcriptional units has become popular recently and ODB successfully integrates these high-throughput operon data, including genome-wide transcriptional units of five prokaryotes and two eukaryotes. The current version of our database contains information from about 10,000 known operons in more than 50 genomes, and more than 400,000 conserved operons obtained from more than 1000 bacterial genomes. (ii) ODB proposes the idea of reference operons as a new operon prediction tool. A reference operon, a set of possible orthologous genes that organize operons, is defined by clustering all known operons. A large number of known operons, including the recently added genome-wide analysis of operons, allowed us to define more reliable reference operons. (iii) ODB also provides new graphical interfaces. One is for comparative analyses of operon structures in multiple genomes. The other is for visualization of possible operons in multiple genomes obtained from the reference operons. The 2011 updated version of ODB is now available at http://operondb.jp/.

  5. ODB: a database of operons accumulating known operons across multiple genomes.

    Science.gov (United States)

    Okuda, Shujiro; Katayama, Toshiaki; Kawashima, Shuichi; Goto, Susumu; Kanehisa, Minoru

    2006-01-01

    Operon structures play an important role in co-regulation in prokaryotes. Although over 200 complete genome sequences are now available, databases providing genome-wide operon information have been limited to certain specific genomes. Thus, we have developed an ODB (Operon DataBase), which provides a data retrieval system of known operons among the many complete genomes. Additionally, putative operons that are conserved in terms of known operons are also provided. The current version of our database contains about 2000 known operon information in more than 50 genomes and about 13 000 putative operons in more than 200 genomes. This system integrates four types of associations: genome context, gene co-expression obtained from microarray data, functional links in biological pathways and the conservation of gene order across the genomes. These associations are indicators of the genes that organize an operon, and the combination of these indicators allows us to predict more reliable operons. Furthermore, our system validates these predictions using known operon information obtained from the literature. This database integrates known literature-based information and genomic data. In addition, it provides an operon prediction tool, which make the system useful for both bioinformatics researchers and experimental biologists. Our database is accessible at http://odb.kuicr.kyoto-u.ac.jp/.

  6. Accurate Multisteps Traffic Flow Prediction Based on SVM

    Directory of Open Access Journals (Sweden)

    Zhang Mingheng

    2013-01-01

    Full Text Available Accurate traffic flow prediction is prerequisite and important for realizing intelligent traffic control and guidance, and it is also the objective requirement for intelligent traffic management. Due to the strong nonlinear, stochastic, time-varying characteristics of urban transport system, artificial intelligence methods such as support vector machine (SVM are now receiving more and more attentions in this research field. Compared with the traditional single-step prediction method, the multisteps prediction has the ability that can predict the traffic state trends over a certain period in the future. From the perspective of dynamic decision, it is far important than the current traffic condition obtained. Thus, in this paper, an accurate multi-steps traffic flow prediction model based on SVM was proposed. In which, the input vectors were comprised of actual traffic volume and four different types of input vectors were compared to verify their prediction performance with each other. Finally, the model was verified with actual data in the empirical analysis phase and the test results showed that the proposed SVM model had a good ability for traffic flow prediction and the SVM-HPT model outperformed the other three models for prediction.

  7. Accurate identification of fear facial expressions predicts prosocial behavior.

    Science.gov (United States)

    Marsh, Abigail A; Kozak, Megan N; Ambady, Nalini

    2007-05-01

    The fear facial expression is a distress cue that is associated with the provision of help and prosocial behavior. Prior psychiatric studies have found deficits in the recognition of this expression by individuals with antisocial tendencies. However, no prior study has shown accuracy for recognition of fear to predict actual prosocial or antisocial behavior in an experimental setting. In 3 studies, the authors tested the prediction that individuals who recognize fear more accurately will behave more prosocially. In Study 1, participants who identified fear more accurately also donated more money and time to a victim in a classic altruism paradigm. In Studies 2 and 3, participants' ability to identify the fear expression predicted prosocial behavior in a novel task designed to control for confounding variables. In Study 3, accuracy for recognizing fear proved a better predictor of prosocial behavior than gender, mood, or scores on an empathy scale.

  8. Hybrid Predictive Models for Accurate Forecasting in PV Systems

    Directory of Open Access Journals (Sweden)

    Marco Mussetta

    2013-04-01

    Full Text Available The accurate forecasting of energy production from renewable sources represents an important topic also looking at different national authorities that are starting to stimulate a greater responsibility towards plants using non-programmable renewables. In this paper the authors use advanced hybrid evolutionary techniques of computational intelligence applied to photovoltaic systems forecasting, analyzing the predictions obtained by comparing different definitions of the forecasting error.

  9. Plant diversity accurately predicts insect diversity in two tropical landscapes.

    Science.gov (United States)

    Zhang, Kai; Lin, Siliang; Ji, Yinqiu; Yang, Chenxue; Wang, Xiaoyang; Yang, Chunyan; Wang, Hesheng; Jiang, Haisheng; Harrison, Rhett D; Yu, Douglas W

    2016-09-01

    Plant diversity surely determines arthropod diversity, but only moderate correlations between arthropod and plant species richness had been observed until Basset et al. (Science, 338, 2012 and 1481) finally undertook an unprecedentedly comprehensive sampling of a tropical forest and demonstrated that plant species richness could indeed accurately predict arthropod species richness. We now require a high-throughput pipeline to operationalize this result so that we can (i) test competing explanations for tropical arthropod megadiversity, (ii) improve estimates of global eukaryotic species diversity, and (iii) use plant and arthropod communities as efficient proxies for each other, thus improving the efficiency of conservation planning and of detecting forest degradation and recovery. We therefore applied metabarcoding to Malaise-trap samples across two tropical landscapes in China. We demonstrate that plant species richness can accurately predict arthropod (mostly insect) species richness and that plant and insect community compositions are highly correlated, even in landscapes that are large, heterogeneous and anthropogenically modified. Finally, we review how metabarcoding makes feasible highly replicated tests of the major competing explanations for tropical megadiversity. © 2016 John Wiley & Sons Ltd.

  10. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  11. Dementia risk prediction in the population: are screening models accurate?

    Science.gov (United States)

    Stephan, Blossom C M; Kurth, Tobias; Matthews, Fiona E; Brayne, Carol; Dufouil, Carole

    2010-06-01

    Early identification of individuals at risk of dementia will become crucial when effective preventative strategies for this condition are developed. Various dementia prediction models have been proposed, including clinic-based criteria for mild cognitive impairment, and more-broadly constructed algorithms, which synthesize information from known dementia risk factors, such as poor cognition and health. Knowledge of the predictive accuracy of such models will be important if they are to be used in daily clinical practice or to screen the entire older population (individuals aged >or=65 years). This article presents an overview of recent progress in the development of dementia prediction models for use in population screening. In total, 25 articles relating to dementia risk screening met our inclusion criteria for review. Our evaluation of the predictive accuracy of each model shows that most are poor at discriminating at-risk individuals from not-at-risk cases. The best models incorporate diverse sources of information across multiple risk factors. Typically, poor accuracy is associated with single-factor models, long follow-up intervals and the outcome measure of all-cause dementia. A parsimonious and cost-effective consensus model needs to be developed that accurately identifies individuals with a high risk of future dementia.

  12. Use of genomic DNA control features and predicted operon structure in microarray data analysis: ArrayLeaRNA – a Bayesian approach

    Directory of Open Access Journals (Sweden)

    Pin Carmen

    2007-11-01

    Full Text Available Abstract Background Microarrays are widely used for the study of gene expression; however deciding on whether observed differences in expression are significant remains a challenge. Results A computing tool (ArrayLeaRNA has been developed for gene expression analysis. It implements a Bayesian approach which is based on the Gumbel distribution and uses printed genomic DNA control features for normalization and for estimation of the parameters of the Bayesian model and prior knowledge from predicted operon structure. The method is compared with two other approaches: the classical LOWESS normalization followed by a two fold cut-off criterion and the OpWise method (Price, et al. 2006. BMC Bioinformatics. 7, 19, a published Bayesian approach also using predicted operon structure. The three methods were compared on experimental datasets with prior knowledge of gene expression. With ArrayLeaRNA, data normalization is carried out according to the genomic features which reflect the results of equally transcribed genes; also the statistical significance of the difference in expression is based on the variability of the equally transcribed genes. The operon information helps the classification of genes with low confidence measurements. ArrayLeaRNA is implemented in Visual Basic and freely available as an Excel add-in at http://www.ifr.ac.uk/safety/ArrayLeaRNA/ Conclusion We have introduced a novel Bayesian model and demonstrated that it is a robust method for analysing microarray expression profiles. ArrayLeaRNA showed a considerable improvement in data normalization, in the estimation of the experimental variability intrinsic to each hybridization and in the establishment of a clear boundary between non-changing and differentially expressed genes. The method is applicable to data derived from hybridizations of labelled cDNA samples as well as from hybridizations of labelled cDNA with genomic DNA and can be used for the analysis of datasets where

  13. A new, accurate predictive model for incident hypertension.

    Science.gov (United States)

    Völzke, Henry; Fung, Glenn; Ittermann, Till; Yu, Shipeng; Baumeister, Sebastian E; Dörr, Marcus; Lieb, Wolfgang; Völker, Uwe; Linneberg, Allan; Jørgensen, Torben; Felix, Stephan B; Rettig, Rainer; Rao, Bharat; Kroemer, Heyo K

    2013-11-01

    Data mining represents an alternative approach to identify new predictors of multifactorial diseases. This work aimed at building an accurate predictive model for incident hypertension using data mining procedures. The primary study population consisted of 1605 normotensive individuals aged 20-79 years with 5-year follow-up from the population-based study, that is the Study of Health in Pomerania (SHIP). The initial set was randomly split into a training and a testing set. We used a probabilistic graphical model applying a Bayesian network to create a predictive model for incident hypertension and compared the predictive performance with the established Framingham risk score for hypertension. Finally, the model was validated in 2887 participants from INTER99, a Danish community-based intervention study. In the training set of SHIP data, the Bayesian network used a small subset of relevant baseline features including age, mean arterial pressure, rs16998073, serum glucose and urinary albumin concentrations. Furthermore, we detected relevant interactions between age and serum glucose as well as between rs16998073 and urinary albumin concentrations [area under the receiver operating characteristic (AUC 0.76)]. The model was confirmed in the SHIP validation set (AUC 0.78) and externally replicated in INTER99 (AUC 0.77). Compared to the established Framingham risk score for hypertension, the predictive performance of the new model was similar in the SHIP validation set and moderately better in INTER99. Data mining procedures identified a predictive model for incident hypertension, which included innovative and easy-to-measure variables. The findings promise great applicability in screening settings and clinical practice.

  14. Accurate prediction of peptide binding sites on protein surfaces.

    Directory of Open Access Journals (Sweden)

    Evangelia Petsalaki

    2009-03-01

    Full Text Available Many important protein-protein interactions are mediated by the binding of a short peptide stretch in one protein to a large globular segment in another. Recent efforts have provided hundreds of examples of new peptides binding to proteins for which a three-dimensional structure is available (either known experimentally or readily modeled but where no structure of the protein-peptide complex is known. To address this gap, we present an approach that can accurately predict peptide binding sites on protein surfaces. For peptides known to bind a particular protein, the method predicts binding sites with great accuracy, and the specificity of the approach means that it can also be used to predict whether or not a putative or predicted peptide partner will bind. We used known protein-peptide complexes to derive preferences, in the form of spatial position specific scoring matrices, which describe the binding-site environment in globular proteins for each type of amino acid in bound peptides. We then scan the surface of a putative binding protein for sites for each of the amino acids present in a peptide partner and search for combinations of high-scoring amino acid sites that satisfy constraints deduced from the peptide sequence. The method performed well in a benchmark and largely agreed with experimental data mapping binding sites for several recently discovered interactions mediated by peptides, including RG-rich proteins with SMN domains, Epstein-Barr virus LMP1 with TRADD domains, DBC1 with Sir2, and the Ago hook with Argonaute PIWI domain. The method, and associated statistics, is an excellent tool for predicting and studying binding sites for newly discovered peptides mediating critical events in biology.

  15. WGS accurately predicts antimicrobial resistance in Escherichia coli.

    Science.gov (United States)

    Tyson, Gregory H; McDermott, Patrick F; Li, Cong; Chen, Yuansha; Tadesse, Daniel A; Mukherjee, Sampa; Bodeis-Jones, Sonya; Kabera, Claudine; Gaines, Stuart A; Loneragan, Guy H; Edrington, Tom S; Torrence, Mary; Harhay, Dayna M; Zhao, Shaohua

    2015-10-01

    The objective of this study was to determine the effectiveness of WGS in identifying resistance genotypes of MDR Escherichia coli and whether these correlate with observed phenotypes. Seventy-six E. coli strains were isolated from farm cattle and measured for phenotypic resistance to 15 antimicrobials with the Sensititre(®) system. Isolates with resistance to at least four antimicrobials in three classes were selected for WGS using an Illumina MiSeq. Genotypic analysis was conducted with in-house Perl scripts using BLAST analysis to identify known genes and mutations associated with clinical resistance. Over 30 resistance genes and a number of resistance mutations were identified among the E. coli isolates. Resistance genotypes correlated with 97.8% specificity and 99.6% sensitivity to the identified phenotypes. The majority of discordant results were attributable to the aminoglycoside streptomycin, whereas there was a perfect genotype-phenotype correlation for most antibiotic classes such as tetracyclines, quinolones and phenicols. WGS also revealed information about rare resistance mechanisms, such as structural mutations in chromosomal copies of ampC conferring third-generation cephalosporin resistance. WGS can provide comprehensive resistance genotypes and is capable of accurately predicting resistance phenotypes, making it a valuable tool for surveillance. Moreover, the data presented here showing the ability to accurately predict resistance suggest that WGS may be used as a screening tool in selecting anti-infective therapy, especially as costs drop and methods improve. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  16. Accurate Holdup Calculations with Predictive Modeling & Data Integration

    Energy Technology Data Exchange (ETDEWEB)

    Azmy, Yousry [North Carolina State Univ., Raleigh, NC (United States). Dept. of Nuclear Engineering; Cacuci, Dan [Univ. of South Carolina, Columbia, SC (United States). Dept. of Mechanical Engineering

    2017-04-03

    In facilities that process special nuclear material (SNM) it is important to account accurately for the fissile material that enters and leaves the plant. Although there are many stages and processes through which materials must be traced and measured, the focus of this project is material that is “held-up” in equipment, pipes, and ducts during normal operation and that can accumulate over time into significant quantities. Accurately estimating the holdup is essential for proper SNM accounting (vis-à-vis nuclear non-proliferation), criticality and radiation safety, waste management, and efficient plant operation. Usually it is not possible to directly measure the holdup quantity and location, so these must be inferred from measured radiation fields, primarily gamma and less frequently neutrons. Current methods to quantify holdup, i.e. Generalized Geometry Holdup (GGH), primarily rely on simple source configurations and crude radiation transport models aided by ad hoc correction factors. This project seeks an alternate method of performing measurement-based holdup calculations using a predictive model that employs state-of-the-art radiation transport codes capable of accurately simulating such situations. Inverse and data assimilation methods use the forward transport model to search for a source configuration that best matches the measured data and simultaneously provide an estimate of the level of confidence in the correctness of such configuration. In this work the holdup problem is re-interpreted as an inverse problem that is under-determined, hence may permit multiple solutions. A probabilistic approach is applied to solving the resulting inverse problem. This approach rates possible solutions according to their plausibility given the measurements and initial information. This is accomplished through the use of Bayes’ Theorem that resolves the issue of multiple solutions by giving an estimate of the probability of observing each possible solution. To use

  17. Simple Mathematical Models Do Not Accurately Predict Early SIV Dynamics

    Directory of Open Access Journals (Sweden)

    Cecilia Noecker

    2015-03-01

    Full Text Available Upon infection of a new host, human immunodeficiency virus (HIV replicates in the mucosal tissues and is generally undetectable in circulation for 1–2 weeks post-infection. Several interventions against HIV including vaccines and antiretroviral prophylaxis target virus replication at this earliest stage of infection. Mathematical models have been used to understand how HIV spreads from mucosal tissues systemically and what impact vaccination and/or antiretroviral prophylaxis has on viral eradication. Because predictions of such models have been rarely compared to experimental data, it remains unclear which processes included in these models are critical for predicting early HIV dynamics. Here we modified the “standard” mathematical model of HIV infection to include two populations of infected cells: cells that are actively producing the virus and cells that are transitioning into virus production mode. We evaluated the effects of several poorly known parameters on infection outcomes in this model and compared model predictions to experimental data on infection of non-human primates with variable doses of simian immunodifficiency virus (SIV. First, we found that the mode of virus production by infected cells (budding vs. bursting has a minimal impact on the early virus dynamics for a wide range of model parameters, as long as the parameters are constrained to provide the observed rate of SIV load increase in the blood of infected animals. Interestingly and in contrast with previous results, we found that the bursting mode of virus production generally results in a higher probability of viral extinction than the budding mode of virus production. Second, this mathematical model was not able to accurately describe the change in experimentally determined probability of host infection with increasing viral doses. Third and finally, the model was also unable to accurately explain the decline in the time to virus detection with increasing viral

  18. Artificial neural network accurately predicts hepatitis B surface antigen seroclearance.

    Directory of Open Access Journals (Sweden)

    Ming-Hua Zheng

    Full Text Available BACKGROUND & AIMS: Hepatitis B surface antigen (HBsAg seroclearance and seroconversion are regarded as favorable outcomes of chronic hepatitis B (CHB. This study aimed to develop artificial neural networks (ANNs that could accurately predict HBsAg seroclearance or seroconversion on the basis of available serum variables. METHODS: Data from 203 untreated, HBeAg-negative CHB patients with spontaneous HBsAg seroclearance (63 with HBsAg seroconversion, and 203 age- and sex-matched HBeAg-negative controls were analyzed. ANNs and logistic regression models (LRMs were built and tested according to HBsAg seroclearance and seroconversion. Predictive accuracy was assessed with area under the receiver operating characteristic curve (AUROC. RESULTS: Serum quantitative HBsAg (qHBsAg and HBV DNA levels, qHBsAg and HBV DNA reduction were related to HBsAg seroclearance (P<0.001 and were used for ANN/LRM-HBsAg seroclearance building, whereas, qHBsAg reduction was not associated with ANN-HBsAg seroconversion (P = 0.197 and LRM-HBsAg seroconversion was solely based on qHBsAg (P = 0.01. For HBsAg seroclearance, AUROCs of ANN were 0.96, 0.93 and 0.95 for the training, testing and genotype B subgroups respectively. They were significantly higher than those of LRM, qHBsAg and HBV DNA (all P<0.05. Although the performance of ANN-HBsAg seroconversion (AUROC 0.757 was inferior to that for HBsAg seroclearance, it tended to be better than those of LRM, qHBsAg and HBV DNA. CONCLUSIONS: ANN identifies spontaneous HBsAg seroclearance in HBeAg-negative CHB patients with better accuracy, on the basis of easily available serum data. More useful predictors for HBsAg seroconversion are still needed to be explored in the future.

  19. Plasmids as scribbling pads for operon formation and propagation.

    Science.gov (United States)

    Norris, Vic; Merieau, Annabelle

    2013-09-01

    Many bacterial genes are in operons and the process whereby operons are formed is therefore fundamental. To help elucidate this process, we propose in the Scribbling Pad hypothesis that bacteria have been constantly using plasmids for genetic experimentation and, in particular, for the construction of operons. This hypothesis simultaneously solves the problems of the creation of operons and the way operons are propagated. We cite results in the literature to support the hypothesis and make experimental predictions to test it. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. Fast and accurate predictions of covalent bonds in chemical space.

    Science.gov (United States)

    Chang, K Y Samuel; Fias, Stijn; Ramakrishnan, Raghunathan; von Lilienfeld, O Anatole

    2016-05-07

    We assess the predictive accuracy of perturbation theory based estimates of changes in covalent bonding due to linear alchemical interpolations among molecules. We have investigated σ bonding to hydrogen, as well as σ and π bonding between main-group elements, occurring in small sets of iso-valence-electronic molecules with elements drawn from second to fourth rows in the p-block of the periodic table. Numerical evidence suggests that first order Taylor expansions of covalent bonding potentials can achieve high accuracy if (i) the alchemical interpolation is vertical (fixed geometry), (ii) it involves elements from the third and fourth rows of the periodic table, and (iii) an optimal reference geometry is used. This leads to near linear changes in the bonding potential, resulting in analytical predictions with chemical accuracy (∼1 kcal/mol). Second order estimates deteriorate the prediction. If initial and final molecules differ not only in composition but also in geometry, all estimates become substantially worse, with second order being slightly more accurate than first order. The independent particle approximation based second order perturbation theory performs poorly when compared to the coupled perturbed or finite difference approach. Taylor series expansions up to fourth order of the potential energy curve of highly symmetric systems indicate a finite radius of convergence, as illustrated for the alchemical stretching of H2 (+). Results are presented for (i) covalent bonds to hydrogen in 12 molecules with 8 valence electrons (CH4, NH3, H2O, HF, SiH4, PH3, H2S, HCl, GeH4, AsH3, H2Se, HBr); (ii) main-group single bonds in 9 molecules with 14 valence electrons (CH3F, CH3Cl, CH3Br, SiH3F, SiH3Cl, SiH3Br, GeH3F, GeH3Cl, GeH3Br); (iii) main-group double bonds in 9 molecules with 12 valence electrons (CH2O, CH2S, CH2Se, SiH2O, SiH2S, SiH2Se, GeH2O, GeH2S, GeH2Se); (iv) main-group triple bonds in 9 molecules with 10 valence electrons (HCN, HCP, HCAs, HSiN, HSi

  1. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Science.gov (United States)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  2. An Overview of Practical Applications of Protein Disorder Prediction and Drive for Faster, More Accurate Predictions

    Directory of Open Access Journals (Sweden)

    Xin Deng

    2015-07-01

    Full Text Available Protein disordered regions are segments of a protein chain that do not adopt a stable structure. Thus far, a variety of protein disorder prediction methods have been developed and have been widely used, not only in traditional bioinformatics domains, including protein structure prediction, protein structure determination and function annotation, but also in many other biomedical fields. The relationship between intrinsically-disordered proteins and some human diseases has played a significant role in disorder prediction in disease identification and epidemiological investigations. Disordered proteins can also serve as potential targets for drug discovery with an emphasis on the disordered-to-ordered transition in the disordered binding regions, and this has led to substantial research in drug discovery or design based on protein disordered region prediction. Furthermore, protein disorder prediction has also been applied to healthcare by predicting the disease risk of mutations in patients and studying the mechanistic basis of diseases. As the applications of disorder prediction increase, so too does the need to make quick and accurate predictions. To fill this need, we also present a new approach to predict protein residue disorder using wide sequence windows that is applicable on the genomic scale.

  3. Towards more accurate and reliable predictions for nuclear applications

    Directory of Open Access Journals (Sweden)

    Goriely Stephane

    2017-01-01

    Full Text Available The need for nuclear data far from the valley of stability, for applications such as nuclear astrophysics or future nuclear facilities, challenges the robustness as well as the predictive power of present nuclear models. Most of the nuclear data evaluation and prediction are still performed on the basis of phenomenological nuclear models. For the last decades, important progress has been achieved in fundamental nuclear physics, making it now feasible to use more reliable, but also more complex microscopic or semi-microscopic models in the evaluation and prediction of nuclear data for practical applications. Nowadays mean-field models can be tuned at the same level of accuracy as the phenomenological models, renormalized on experimental data if needed, and therefore can replace the phenomenological inputs in the evaluation of nuclear data. The latest achievements to determine nuclear masses within the non-relativistic HFB approach, including the related uncertainties in the model predictions, are discussed. Similarly, recent efforts to determine fission observables within the mean-field approach are described and compared with more traditional existing models.

  4. Accurate Theoretical Predictions of the Properties of Energetic Materials

    Science.gov (United States)

    2008-09-18

    and to investigate the relationships between crystal structure/microstructure and sensitivity, compressibility, polymorphism and crystal shape...Additionally, these procedures and potentials can be used to investigate/predict polymorphism and crystal habits. Sensitivity, the ease with...point group symmetries in which the molecule is coincident with appropriate unit cell symmetry. β- HMX , for example, has Ci point group symmetry and

  5. Learning regulatory programs that accurately predict differential expression with MEDUSA.

    Science.gov (United States)

    Kundaje, Anshul; Lianoglou, Steve; Li, Xuejing; Quigley, David; Arias, Marta; Wiggins, Chris H; Zhang, Li; Leslie, Christina

    2007-12-01

    Inferring gene regulatory networks from high-throughput genomic data is one of the central problems in computational biology. In this paper, we describe a predictive modeling approach for studying regulatory networks, based on a machine learning algorithm called MEDUSA. MEDUSA integrates promoter sequence, mRNA expression, and transcription factor occupancy data to learn gene regulatory programs that predict the differential expression of target genes. Instead of using clustering or correlation of expression profiles to infer regulatory relationships, MEDUSA determines condition-specific regulators and discovers regulatory motifs that mediate the regulation of target genes. In this way, MEDUSA meaningfully models biological mechanisms of transcriptional regulation. MEDUSA solves the problem of predicting the differential (up/down) expression of target genes by using boosting, a technique from statistical learning, which helps to avoid overfitting as the algorithm searches through the high-dimensional space of potential regulators and sequence motifs. Experimental results demonstrate that MEDUSA achieves high prediction accuracy on held-out experiments (test data), that is, data not seen in training. We also present context-specific analysis of MEDUSA regulatory programs for DNA damage and hypoxia, demonstrating that MEDUSA identifies key regulators and motifs in these processes. A central challenge in the field is the difficulty of validating reverse-engineered networks in the absence of a gold standard. Our approach of learning regulatory programs provides at least a partial solution for the problem: MEDUSA's prediction accuracy on held-out data gives a concrete and statistically sound way to validate how well the algorithm performs. With MEDUSA, statistical validation becomes a prerequisite for hypothesis generation and network building rather than a secondary consideration.

  6. Third trimester ultrasound soft-tissue measurements accurately predicts macrosomia.

    Science.gov (United States)

    Maruotti, Giuseppe Maria; Saccone, Gabriele; Martinelli, Pasquale

    2017-04-01

    To evaluate the accuracy of sonographic measurements of fetal soft tissue in the prediction of macrosomia. Electronic databases were searched from their inception until September 2015 with no limit for language. We included only studies assessing the accuracy of sonographic measurements of fetal soft tissue in the abdomen or thigh in the prediction of macrosomia  ≥34 weeks of gestation. The primary outcome was the accuracy of sonographic measurements of fetal soft tissue in the prediction of macrosomia. We generated the forest plot for the pooled sensitivity and specificity with 95% confidence interval (CI). Additionally, summary receiver-operating characteristics (ROC) curves were plotted and the area under the curve (AUC) was also computed to evaluate the overall performance of the diagnostic test accuracy. Three studies, including 287 singleton gestations, were analyzed. The pooled sensitivity of sonographic measurements of abdominal or thigh fetal soft tissue in the prediction of macrosomia was 80% (95% CI: 66-89%) and the pooled specificity was 95% (95% CI: 91-97%). The AUC for diagnostic accuracy of sonographic measurements of fetal soft tissue in the prediction of macrosomia was 0.92 and suggested high diagnostic accuracy. Third-trimester sonographic measurements of fetal soft tissue after 34 weeks may help to detect macrosomia with a high degree of accuracy. The pooled detection rate was 80%. A standardization of measurements criteria, reproducibility, building reference charts of fetal subcutaneous tissue and large studies to assess the optimal cutoff of fetal adipose thickness are necessary before the introduction of fetal soft-tissue markers in the clinical practice.

  7. Accurate prediction of inducible transcription factor binding intensities in vivo.

    Directory of Open Access Journals (Sweden)

    Michael J Guertin

    Full Text Available DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB-seq, that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF, which inducibly binds a target DNA sequence element (HSE following heat shock stress. PB-seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF-bound and HSF-free DNA, and then detecting HSF-bound DNA by high-throughput sequencing. We compared PB-seq binding profiles with ones observed in vivo by ChIP-seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase-seq data and the ChIP-chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF, tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity.

  8. PredictSNP: robust and accurate consensus classifier for prediction of disease-related mutations.

    Directory of Open Access Journals (Sweden)

    Jaroslav Bendl

    2014-01-01

    Full Text Available Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp.

  9. Copeptin does not accurately predict disease severity in imported malaria

    Directory of Open Access Journals (Sweden)

    van Wolfswinkel Marlies E

    2012-01-01

    Full Text Available Abstract Background Copeptin has recently been identified to be a stable surrogate marker for the unstable hormone arginine vasopressin (AVP. Copeptin has been shown to correlate with disease severity in leptospirosis and bacterial sepsis. Hyponatraemia is common in severe imported malaria and dysregulation of AVP release has been hypothesized as an underlying pathophysiological mechanism. The aim of the present study was to evaluate the performance of copeptin as a predictor of disease severity in imported malaria. Methods Copeptin was measured in stored serum samples of 204 patients with imported malaria that were admitted to our Institute for Tropical Diseases in Rotterdam in the period 1999-2010. The occurrence of WHO defined severe malaria was the primary end-point. The diagnostic performance of copeptin was compared to that of previously evaluated biomarkers C-reactive protein, procalcitonin, lactate and sodium. Results Of the 204 patients (141 Plasmodium falciparum, 63 non-falciparum infection, 25 had severe malaria. The Area Under the ROC curve of copeptin for severe disease (0.66 [95% confidence interval 0.59-0.72] was comparable to that of lactate, sodium and procalcitonin. C-reactive protein (0.84 [95% CI 0.79-0.89] had a significantly better performance as a biomarker for severe malaria than the other biomarkers. Conclusions C-reactive protein but not copeptin was found to be an accurate predictor for disease severity in imported malaria. The applicability of copeptin as a marker for severe malaria in clinical practice is limited to exclusion of severe malaria.

  10. Predicting accurate absolute binding energies in aqueous solution

    DEFF Research Database (Denmark)

    Jensen, Jan Halborg

    2015-01-01

    Recent predictions of absolute binding free energies of host-guest complexes in aqueous solution using electronic structure theory have been encouraging for some systems, while other systems remain problematic. In this paper I summarize some of the many factors that could easily contribute 1-3 kcal......-represented by continuum models. While I focus on binding free energies in aqueous solution the approach also applies (with minor adjustments) to any free energy difference such as conformational or reaction free energy differences or activation free energies in any solvent....... mol(-1) errors at 298 K: three-body dispersion effects, molecular symmetry, anharmonicity, spurious imaginary frequencies, insufficient conformational sampling, wrong or changing ionization states, errors in the solvation free energy of ions, and explicit solvent (and ion) effects that are not well...

  11. Accurate prediction of secondary metabolite gene clusters in filamentous fungi

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam; Nielsen, Jakob Blæsbjerg; Klitgaard, Andreas

    2013-01-01

    -chemistry between physically separate gene clusters (superclusters), and validate this both with legacy data and experimentally by prediction and verification of a supercluster consisting of the synthase AN1242 and the prenyltransferase AN11080, as well as identification of the product compound nidulanin A. We have...... used A. nidulans for our method development and validation due to the wealth of available biochemical data, but the method can be applied to any fungus with a sequenced and assembled genome, thus supporting further secondary metabolite pathway elucidation in the fungal kingdom.......Biosynthetic pathways of secondary metabolites from fungi are currently subject to an intense effort to elucidate the genetic basis for these compounds due to their large potential within pharmaceutics and synthetic biochemistry. The preferred method is methodical gene deletions to identify...

  12. Generating highly accurate prediction hypotheses through collaborative ensemble learning

    Science.gov (United States)

    Arsov, Nino; Pavlovski, Martin; Basnarkov, Lasko; Kocarev, Ljupco

    2017-03-01

    Ensemble generation is a natural and convenient way of achieving better generalization performance of learning algorithms by gathering their predictive capabilities. Here, we nurture the idea of ensemble-based learning by combining bagging and boosting for the purpose of binary classification. Since the former improves stability through variance reduction, while the latter ameliorates overfitting, the outcome of a multi-model that combines both strives toward a comprehensive net-balancing of the bias-variance trade-off. To further improve this, we alter the bagged-boosting scheme by introducing collaboration between the multi-model’s constituent learners at various levels. This novel stability-guided classification scheme is delivered in two flavours: during or after the boosting process. Applied among a crowd of Gentle Boost ensembles, the ability of the two suggested algorithms to generalize is inspected by comparing them against Subbagging and Gentle Boost on various real-world datasets. In both cases, our models obtained a 40% generalization error decrease. But their true ability to capture details in data was revealed through their application for protein detection in texture analysis of gel electrophoresis images. They achieve improved performance of approximately 0.9773 AUROC when compared to the AUROC of 0.9574 obtained by an SVM based on recursive feature elimination.

  13. Change in BMI accurately predicted by social exposure to acquaintances.

    Science.gov (United States)

    Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

    2013-01-01

    Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

  14. Change in BMI accurately predicted by social exposure to acquaintances.

    Directory of Open Access Journals (Sweden)

    Rahman O Oloritun

    Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

  15. The evolutionary dynamics of operon distributions in eukaryote genomes.

    Science.gov (United States)

    Cutter, Asher D; Agrawal, Aneil F

    2010-06-01

    Genes in nematode and ascidian genomes frequently occur in operons--multiple genes sharing a common promoter to generate a polycistronic primary transcript--and such genes comprise 15-20% of the coding genome for Caenorhabditis elegans and Ciona intestinalis. Recent work in nematodes has demonstrated that the identity of genes within operons is highly conserved among species and that the unifying feature of genes within operons is that they are expressed in germline tissue. However, it is generally unknown what processes are responsible for generating the distribution of operon sizes across the genome, which are composed of up to eight genes per operon. Here we investigate several models for operon evolution to better understand their abundance, distribution of sizes, and evolutionary dynamics over time. We find that birth-death models of operon evolution reasonably describe the relative abundance of operons of different sizes in the C. elegans and Ciona genomes and generate predictions about the number of monocistronic, nonoperon genes that likely participate in the birth-death process. This theory, and applications to C. elegans and Ciona, motivates several new and testable hypotheses about eukaryote operon evolution.

  16. Biomarker Surrogates Do Not Accurately Predict Sputum Eosinophils and Neutrophils in Asthma

    Science.gov (United States)

    Hastie, Annette T.; Moore, Wendy C.; Li, Huashi; Rector, Brian M.; Ortega, Victor E.; Pascual, Rodolfo M.; Peters, Stephen P.; Meyers, Deborah A.; Bleecker, Eugene R.

    2013-01-01

    Background Sputum eosinophils (Eos) are a strong predictor of airway inflammation, exacerbations, and aid asthma management, whereas sputum neutrophils (Neu) indicate a different severe asthma phenotype, potentially less responsive to TH2-targeted therapy. Variables such as blood Eos, total IgE, fractional exhaled nitric oxide (FeNO) or FEV1% predicted, may predict airway Eos, while age, FEV1%predicted, or blood Neu may predict sputum Neu. Availability and ease of measurement are useful characteristics, but accuracy in predicting airway Eos and Neu, individually or combined, is not established. Objectives To determine whether blood Eos, FeNO, and IgE accurately predict sputum eosinophils, and age, FEV1% predicted, and blood Neu accurately predict sputum neutrophils (Neu). Methods Subjects in the Wake Forest Severe Asthma Research Program (N=328) were characterized by blood and sputum cells, healthcare utilization, lung function, FeNO, and IgE. Multiple analytical techniques were utilized. Results Despite significant association with sputum Eos, blood Eos, FeNO and total IgE did not accurately predict sputum Eos, and combinations of these variables failed to improve prediction. Age, FEV1%predicted and blood Neu were similarly unsatisfactory for prediction of sputum Neu. Factor analysis and stepwise selection found FeNO, IgE and FEV1% predicted, but not blood Eos, correctly predicted 69% of sputum Eospredicted 64% of sputum Neupredict both sputum Eos and Neu accurately assigned only 41% of samples. Conclusion Despite statistically significant associations FeNO, IgE, blood Eos and Neu, FEV1%predicted, and age are poor surrogates, separately and combined, for accurately predicting sputum eosinophils and neutrophils. PMID:23706399

  17. Metagenomic Guilt by Association: An Operonic Perspective

    Science.gov (United States)

    Vey, Gregory

    2013-01-01

    Next-generation sequencing projects continue to drive a vast accumulation of metagenomic sequence data. Given the growth rate of this data, automated approaches to functional annotation are indispensable and a cornerstone heuristic of many computational protocols is the concept of guilt by association. The guilt by association paradigm has been heavily exploited by genomic context methods that offer functional predictions that are complementary to homology-based annotations, thereby offering a means to extend functional annotation. In particular, operon methods that exploit co-directional intergenic distances can provide homology-free functional annotation through the transfer of functions among co-operonic genes, under the assumption that guilt by association is indeed applicable. Although guilt by association is a well-accepted annotative device, its applicability to metagenomic functional annotation has not been definitively demonstrated. Here a large-scale assessment of metagenomic guilt by association is undertaken where functional associations are predicted on the basis of co-directional intergenic distances. Specifically, functional annotations are compared within pairs of adjacent co-directional genes, as well as operons of various lengths (i.e. number of member genes), in order to reveal new information about annotative cohesion versus operon length. The results suggests that co-directional gene pairs offer reduced confidence for metagenomic guilt by association due to difficulty in resolving the existence of functional associations when intergenic distance is the sole predictor of pairwise gene interactions. However, metagenomic operons, particularly those with substantial lengths, appear to be capable of providing a superior basis for metagenomic guilt by association due to increased annotative stability. The need for improved recognition of metagenomic operons is discussed, as well as the limitations of the present work. PMID:23940763

  18. Accurate Prediction of Motor Failures by Application of Multi CBM Tools: A Case Study

    Science.gov (United States)

    Dutta, Rana; Singh, Veerendra Pratap; Dwivedi, Jai Prakash

    2018-02-01

    Motor failures are very difficult to predict accurately with a single condition-monitoring tool as both electrical and the mechanical systems are closely related. Electrical problem, like phase unbalance, stator winding insulation failures can, at times, lead to vibration problem and at the same time mechanical failures like bearing failure, leads to rotor eccentricity. In this case study of a 550 kW blower motor it has been shown that a rotor bar crack was detected by current signature analysis and vibration monitoring confirmed the same. In later months in a similar motor vibration monitoring predicted bearing failure and current signature analysis confirmed the same. In both the cases, after dismantling the motor, the predictions were found to be accurate. In this paper we will be discussing the accurate predictions of motor failures through use of multi condition monitoring tools with two case studies.

  19. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  20. Heart rate during basketball game play and volleyball drills accurately predicts oxygen uptake and energy expenditure.

    Science.gov (United States)

    Scribbans, T D; Berg, K; Narazaki, K; Janssen, I; Gurd, B J

    2015-09-01

    There is currently little information regarding the ability of metabolic prediction equations to accurately predict oxygen uptake and exercise intensity from heart rate (HR) during intermittent sport. The purpose of the present study was to develop and, cross-validate equations appropriate for accurately predicting oxygen cost (VO2) and energy expenditure from HR during intermittent sport participation. Eleven healthy adult males (19.9±1.1yrs) were recruited to establish the relationship between %VO2peak and %HRmax during low-intensity steady state endurance (END), moderate-intensity interval (MOD) and high intensity-interval exercise (HI), as performed on a cycle ergometer. Three equations (END, MOD, and HI) for predicting %VO2peak based on %HRmax were developed. HR and VO2 were directly measured during basketball games (6 male, 20.8±1.0 yrs; 6 female, 20.0±1.3yrs) and volleyball drills (12 female; 20.8±1.0yrs). Comparisons were made between measured and predicted VO2 and energy expenditure using the 3 equations developed and 2 previously published equations. The END and MOD equations accurately predicted VO2 and energy expenditure, while the HI equation underestimated, and the previously published equations systematically overestimated VO2 and energy expenditure. Intermittent sport VO2 and energy expenditure can be accurately predicted from heart rate data using either the END (%VO2peak=%HRmax x 1.008-17.17) or MOD (%VO2peak=%HRmax x 1.2-32) equations. These 2 simple equations provide an accessible and cost-effective method for accurate estimation of exercise intensity and energy expenditure during intermittent sport.

  1. Operon structure of Staphylococcus aureus

    NARCIS (Netherlands)

    ten Broeke-Smits, N.J.P.; Pronk, T.E.; Jongerius, I.; Bruning, O.; Wittink, F.R.; Breit, T.M.; van Strijp, J.A.G.; Fluit, A.C.; Boel, C.H.E.

    2010-01-01

    In bacteria, gene regulation is one of the fundamental characteristics of survival, colonization and pathogenesis. Operons play a key role in regulating expression of diverse genes involved in metabolism and virulence. However, operon structures in pathogenic bacteria have been determined only by in

  2. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  3. Accurate and dynamic predictive model for better prediction in medicine and healthcare.

    Science.gov (United States)

    Alanazi, H O; Abdullah, A H; Qureshi, K N; Ismail, A S

    2017-07-29

    Information and communication technologies (ICTs) have changed the trend into new integrated operations and methods in all fields of life. The health sector has also adopted new technologies to improve the systems and provide better services to customers. Predictive models in health care are also influenced from new technologies to predict the different disease outcomes. However, still, existing predictive models have suffered from some limitations in terms of predictive outcomes performance. In order to improve predictive model performance, this paper proposed a predictive model by classifying the disease predictions into different categories. To achieve this model performance, this paper uses traumatic brain injury (TBI) datasets. TBI is one of the serious diseases worldwide and needs more attention due to its seriousness and serious impacts on human life. The proposed predictive model improves the predictive performance of TBI. The TBI data set is developed and approved by neurologists to set its features. The experiment results show that the proposed model has achieved significant results including accuracy, sensitivity, and specificity.

  4. The post-transcriptional operon

    DEFF Research Database (Denmark)

    2011-01-01

    A post-transcriptional operon is a set of monocistronic mRNAs encoding functionally related proteins that are co-regulated by a group of RNA-binding proteins and/or small non-coding RNAs so that protein expression is coordinated at the post-transcriptional level. The post-transcriptional operon...... model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...

  5. Accurate Prediction of Contact Numbers for Multi-Spanning Helical Membrane Proteins

    Science.gov (United States)

    Li, Bian; Mendenhall, Jeffrey; Nguyen, Elizabeth Dong; Weiner, Brian E.; Fischer, Axel W.; Meiler, Jens

    2017-01-01

    Prediction of the three-dimensional (3D) structures of proteins by computational methods is acknowledged as an unsolved problem. Accurate prediction of important structural characteristics such as contact number is expected to accelerate the otherwise slow progress being made in the prediction of 3D structure of proteins. Here, we present a dropout neural network-based method, TMH-Expo, for predicting the contact number of transmembrane helix (TMH) residues from sequence. Neuronal dropout is a strategy where certain neurons of the network are excluded from back-propagation to prevent co-adaptation of hidden-layer neurons. By using neuronal dropout, overfitting was significantly reduced and performance was noticeably improved. For multi-spanning helical membrane proteins, TMH-Expo achieved a remarkable Pearson correlation coefficient of 0.69 between predicted and experimental values and a mean absolute error of only 1.68. In addition, among those membrane protein–membrane protein interface residues, 76.8% were correctly predicted. Mapping of predicted contact numbers onto structures indicates that contact numbers predicted by TMH-Expo reflect the exposure patterns of TMHs and reveal membrane protein–membrane protein interfaces, reinforcing the potential of predicted contact numbers to be used as restraints for 3D structure prediction and protein–protein docking. TMH-Expo can be accessed via a Web server at www.meilerlab.org. PMID:26804342

  6. Accurate disulfide-bonding network predictions improve ab initio structure prediction of cysteine-rich proteins.

    Science.gov (United States)

    Yang, Jing; He, Bao-Ji; Jang, Richard; Zhang, Yang; Shen, Hong-Bin

    2015-12-01

    Cysteine-rich proteins cover many important families in nature but there are currently no methods specifically designed for modeling the structure of these proteins. The accuracy of disulfide connectivity pattern prediction, particularly for the proteins of higher-order connections, e.g., >3 bonds, is too low to effectively assist structure assembly simulations. We propose a new hierarchical order reduction protocol called Cyscon for disulfide-bonding prediction. The most confident disulfide bonds are first identified and bonding prediction is then focused on the remaining cysteine residues based on SVR training. Compared with purely machine learning-based approaches, Cyscon improved the average accuracy of connectivity pattern prediction by 21.9%. For proteins with more than 5 disulfide bonds, Cyscon improved the accuracy by 585% on the benchmark set of PDBCYS. When applied to 158 non-redundant cysteine-rich proteins, Cyscon predictions helped increase (or decrease) the TM-score (or RMSD) of the ab initio QUARK modeling by 12.1% (or 14.4%). This result demonstrates a new avenue to improve the ab initio structure modeling for cysteine-rich proteins. http://www.csbio.sjtu.edu.cn/bioinf/Cyscon/ zhng@umich.edu or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. An effective method for accurate prediction of the first hyperpolarizability of alkalides.

    Science.gov (United States)

    Wang, Jia-Nan; Xu, Hong-Liang; Sun, Shi-Ling; Gao, Ting; Li, Hong-Zhi; Li, Hui; Su, Zhong-Min

    2012-01-15

    The proper theoretical calculation method for nonlinear optical (NLO) properties is a key factor to design the excellent NLO materials. Yet it is a difficult task to obatin the accurate NLO property of large scale molecule. In present work, an effective intelligent computing method, as called extreme learning machine-neural network (ELM-NN), is proposed to predict accurately the first hyperpolarizability (β(0)) of alkalides from low-accuracy first hyperpolarizability. Compared with neural network (NN) and genetic algorithm neural network (GANN), the root-mean-square deviations of the predicted values obtained by ELM-NN, GANN, and NN with their MP2 counterpart are 0.02, 0.08, and 0.17 a.u., respectively. It suggests that the predicted values obtained by ELM-NN are more accurate than those calculated by NN and GANN methods. Another excellent point of ELM-NN is the ability to obtain the high accuracy level calculated values with less computing cost. Experimental results show that the computing time of MP2 is 2.4-4 times of the computing time of ELM-NN. Thus, the proposed method is a potentially powerful tool in computational chemistry, and it may predict β(0) of the large scale molecules, which is difficult to obtain by high-accuracy theoretical method due to dramatic increasing computational cost. Copyright © 2011 Wiley Periodicals, Inc.

  8. ASTRAL, DRAGON and SEDAN scores predict stroke outcome more accurately than physicians.

    Science.gov (United States)

    Ntaios, G; Gioulekas, F; Papavasileiou, V; Strbian, D; Michel, P

    2016-11-01

    ASTRAL, SEDAN and DRAGON scores are three well-validated scores for stroke outcome prediction. Whether these scores predict stroke outcome more accurately compared with physicians interested in stroke was investigated. Physicians interested in stroke were invited to an online anonymous survey to provide outcome estimates in randomly allocated structured scenarios of recent real-life stroke patients. Their estimates were compared to scores' predictions in the same scenarios. An estimate was considered accurate if it was within 95% confidence intervals of actual outcome. In all, 244 participants from 32 different countries responded assessing 720 real scenarios and 2636 outcomes. The majority of physicians' estimates were inaccurate (1422/2636, 53.9%). 400 (56.8%) of physicians' estimates about the percentage probability of 3-month modified Rankin score (mRS) > 2 were accurate compared with 609 (86.5%) of ASTRAL score estimates (P DRAGON score estimates (P DRAGON score estimates (P DRAGON and SEDAN scores predict outcome of acute ischaemic stroke patients with higher accuracy compared to physicians interested in stroke. © 2016 EAN.

  9. An accurate model for predicting high frequency noise of nanoscale NMOS SOI transistors

    Science.gov (United States)

    Shen, Yanfei; Cui, Jie; Mohammadi, Saeed

    2017-05-01

    A nonlinear and scalable model suitable for predicting high frequency noise of N-type Metal Oxide Semiconductor (NMOS) transistors is presented. The model is developed for a commercial 45 nm CMOS SOI technology and its accuracy is validated through comparison with measured performance of a microwave low noise amplifier. The model employs the virtual source nonlinear core and adds parasitic elements to accurately simulate the RF behavior of multi-finger NMOS transistors up to 40 GHz. For the first time, the traditional long-channel thermal noise model is supplemented with an injection noise model to accurately represent the noise behavior of these short-channel transistors up to 26 GHz. The developed model is simple and easy to extract, yet very accurate.

  10. PlantLoc: an accurate web server for predicting plant protein subcellular localization by substantiality motif

    OpenAIRE

    Tang, Shengnan; Li, Tonghua; Cong, Peisheng; Xiong, Wenwei; Wang, Zhiheng; Sun, Jiangming

    2013-01-01

    Knowledge of subcellular localizations (SCLs) of plant proteins relates to their functions and aids in understanding the regulation of biological processes at the cellular level. We present PlantLoc, a highly accurate and fast webserver for predicting the multi-label SCLs of plant proteins. The PlantLoc server has two innovative characters: building localization motif libraries by a recursive method without alignment and Gene Ontology information; and establishing simple architecture for rapi...

  11. LocARNA-P: Accurate boundary prediction and improved detection of structural RNAs

    DEFF Research Database (Denmark)

    Will, Sebastian; Joshi, Tejal; Hofacker, Ivo L.

    2012-01-01

    Current genomic screens for noncoding RNAs (ncRNAs) predict a large number of genomic regions containing potential structural ncRNAs. The analysis of these data requires highly accurate prediction of ncRNA boundaries and discrimination of promising candidate ncRNAs from weak predictions. Existing...... methods struggle with these goals because they rely on sequence-based multiple sequence alignments, which regularly misalign RNA structure and therefore do not support identification of structural similarities. To overcome this limitation, we compute columnwise and global reliabilities of alignments based...... on sequence and structure similarity; we refer to these structure-based alignment reliabilities as STARs. The columnwise STARs of alignments, or STAR profiles, provide a versatile tool for the manual and automatic analysis of ncRNAs. In particular, we improve the boundary prediction of the widely used nc...

  12. Rapid yet accurate first principle based predictions of alkali halide crystal phases using alchemical perturbation

    CERN Document Server

    Solovyeva, Alisa

    2016-01-01

    We assess the predictive power of alchemical perturbations for estimating fundamental properties in ionic crystals. Using density functional theory we have calculated formation energies, lattice constants, and bulk moduli for all sixteen iso-valence-electronic combinations of pure pristine alkali halides involving elements $A \\in \\{$Na, K, Rb, Cs$\\}$ and $X \\in \\{$F, Cl, Br, I$\\}$. For rock salt, zincblende and cesium chloride symmetry, alchemical Hellmann-Feynman derivatives, evaluated along lattice scans of sixteen reference crystals, have been obtained for all respective 16$\\times$15 combinations of reference and predicted target crystals. Mean absolute errors (MAE) are on par with density functional theory level of accuracy for energies and bulk modulus. Predicted lattice constants are less accurate. NaCl is the best reference salt for alchemical estimates of relative energies (MAE $<$ 40 meV/atom) while alkali fluorides are the worst. By contrast, lattice constants are predicted best using NaF as a re...

  13. Can phenological models predict tree phenology accurately under climate change conditions?

    Science.gov (United States)

    Chuine, Isabelle; Bonhomme, Marc; Legave, Jean Michel; García de Cortázar-Atauri, Inaki; Charrier, Guillaume; Lacointe, André; Améglio, Thierry

    2014-05-01

    The onset of the growing season of trees has been globally earlier by 2.3 days/decade during the last 50 years because of global warming and this trend is predicted to continue according to climate forecast. The effect of temperature on plant phenology is however not linear because temperature has a dual effect on bud development. On one hand, low temperatures are necessary to break bud dormancy, and on the other hand higher temperatures are necessary to promote bud cells growth afterwards. Increasing phenological changes in temperate woody species have strong impacts on forest trees distribution and productivity, as well as crops cultivation areas. Accurate predictions of trees phenology are therefore a prerequisite to understand and foresee the impacts of climate change on forests and agrosystems. Different process-based models have been developed in the last two decades to predict the date of budburst or flowering of woody species. They are two main families: (1) one-phase models which consider only the ecodormancy phase and make the assumption that endodormancy is always broken before adequate climatic conditions for cell growth occur; and (2) two-phase models which consider both the endodormancy and ecodormancy phases and predict a date of dormancy break which varies from year to year. So far, one-phase models have been able to predict accurately tree bud break and flowering under historical climate. However, because they do not consider what happens prior to ecodormancy, and especially the possible negative effect of winter temperature warming on dormancy break, it seems unlikely that they can provide accurate predictions in future climate conditions. It is indeed well known that a lack of low temperature results in abnormal pattern of bud break and development in temperate fruit trees. An accurate modelling of the dormancy break date has thus become a major issue in phenology modelling. Two-phases phenological models predict that global warming should delay

  14. Fast and Accurate Prediction of Stratified Steel Temperature During Holding Period of Ladle

    Science.gov (United States)

    Deodhar, Anirudh; Singh, Umesh; Shukla, Rishabh; Gautham, B. P.; Singh, Amarendra K.

    2017-04-01

    Thermal stratification of liquid steel in a ladle during the holding period and the teeming operation has a direct bearing on the superheat available at the caster and hence on the caster set points such as casting speed and cooling rates. The changes in the caster set points are typically carried out based on temperature measurements at the end of tundish outlet. Thermal prediction models provide advance knowledge of the influence of process and design parameters on the steel temperature at various stages. Therefore, they can be used in making accurate decisions about the caster set points in real time. However, this requires both fast and accurate thermal prediction models. In this work, we develop a surrogate model for the prediction of thermal stratification using data extracted from a set of computational fluid dynamics (CFD) simulations, pre-determined using design of experiments technique. Regression method is used for training the predictor. The model predicts the stratified temperature profile instantaneously, for a given set of process parameters such as initial steel temperature, refractory heat content, slag thickness, and holding time. More than 96 pct of the predicted values are within an error range of ±5 K (±5 °C), when compared against corresponding CFD results. Considering its accuracy and computational efficiency, the model can be extended for thermal control of casting operations. This work also sets a benchmark for developing similar thermal models for downstream processes such as tundish and caster.

  15. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Directory of Open Access Journals (Sweden)

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  16. The HOMR-Now! Model Accurately Predicts 1-Year Death Risk for Hospitalized Patients on Admission.

    Science.gov (United States)

    van Walraven, Carl; Forster, Alan J

    2017-08-01

    The Hospital-patient One-year Mortality Risk (HOMR) score is an externally validated index using health administrative data to accurately predict the risk of death within 1 year of admission to the hospital. This study derived and internally validated a HOMR modification using data that are available when the patient is admitted to the hospital. From all adult hospitalizations at our tertiary-care teaching hospital between 2004 and 2015, we randomly selected one per patient. We added to all HOMR variables that could be determined from our hospital's data systems on admission other factors that might prognosticate. Vital statistics registries determined vital status at 1 year from admission. Of 2,06,396 patients, 32,112 (15.6%) died within 1 year of admission to the hospital. The HOMR-now! model included patient (sex, comorbidities, living and cancer clinic status, and 1-year death risk from population-based life tables) and hospitalization factors (admission year, urgency, service and laboratory-based acuity score). The model explained that more than half of the total variability (Regenkirke's R(2) value of 0.53) was very discriminative (C-statistic 0.92), and accurately predicted death risk (calibration slope 0.98). One-year risk of death can be accurately predicted using routinely collected data available when patients are admitted to the hospital. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. SCPRED: Accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences

    Directory of Open Access Journals (Sweden)

    Chen Ke

    2008-05-01

    Full Text Available Abstract Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is

  18. Adult Spinal Deformity Surgeons Are Unable to Accurately Predict Postoperative Spinal Alignment Using Clinical Judgment Alone.

    Science.gov (United States)

    Ailon, Tamir; Scheer, Justin K; Lafage, Virginie; Schwab, Frank J; Klineberg, Eric; Sciubba, Daniel M; Protopsaltis, Themistocles S; Zebala, Lukas; Hostin, Richard; Obeid, Ibrahim; Koski, Tyler; Kelly, Michael P; Bess, Shay; Shaffrey, Christopher I; Smith, Justin S; Ames, Christopher P

    2016-07-01

    Adult spinal deformity (ASD) surgery seeks to reduce disability and improve quality of life through restoration of spinal alignment. In particular, correction of sagittal malalignment is correlated with patient outcome. Inadequate correction of sagittal deformity is not infrequent. The present study assessed surgeons' ability to accurately predict postoperative alignment. Seventeen cases were presented with preoperative radiographic measurements, and a summary of the operation as performed by the treating physician. Surgeon training, practice characteristics, and use of surgical planning software was assessed. Participants predicted if the surgical plan would lead to adequate deformity correction and attempted to predict postoperative radiographic parameters including sagittal vertical axis (SVA), pelvic tilt (PT), pelvic incidence to lumbar lordosis mismatch (PI-LL), thoracic kyphosis (TK). Seventeen surgeons participated: 71% within 0 to 10 years of practice; 88% devote >25% of their practice to deformity surgery. Surgeons accurately judged adequacy of the surgical plan to achieve correction to specific thresholds of SVA 69% ± 8%, PT 68% ± 9%, and PI-LL 68% ± 11% of the time. However, surgeons correctly predicted the actual postoperative radiographic parameters only 42% ± 6% of the time. They were more successful at predicting PT (61% ± 10%) than SVA (45% ± 8%), PI-LL (26% ± 11%), or TK change (35% ± 21%; p deformity but not number of years in practice or number of three-column osteotomies performed per year. Surgeons failed to correctly predict the adequacy of the proposed surgical plan in approximately one third of presented cases. They were better at determining whether a surgical plan would achieve adequate correction than predicting specific postoperative alignment parameters. Pelvic tilt and SVA were predicted with the greatest accuracy. Copyright © 2016 Scoliosis Research Society. Published by Elsevier Inc. All rights reserved.

  19. Can Triage Nurses Accurately Predict Patient Dispositions in the Emergency Department?

    Science.gov (United States)

    Alexander, Danette; Abbott, Lincoln; Zhou, Qiuping; Staff, Ilene

    2016-11-01

    Contemporary emergency departments experience crowded conditions with poor patient outcomes. If triage nurses could accurately predict admission, one theoretical intervention to reduce crowding is to place patients in the admission cue on arrival to the emergency department. The purpose of this study was to determine if triage nurses could accurately predict patient dispositions. This prospective study was conducted in a tertiary academic hospital's emergency department using a data collection tool embedded in the ED electronic information system. Study variables included the predicted and actual disposition, as well as level of care, gender, age, and Emergency Severity Index level. Data were collected for 28 consecutive days from September 17 through October 9, 2013. Sensitivity and specificity, positive and negative predictive values, and accuracy of prediction, as well as the associations between patient characteristics and nurse prediction, were calculated. A total of 5,135 cases were included in the analysis. The triage nurses predicted admissions with a sensitivity of 71.5% and discharges with a specificity of 88.0%. Accuracy was significantly higher for younger patients and for patients at very low or very high severity levels. Although the ability to predict admissions at triage by nurses was not adequate to support a change in the bed procurement process, a specificity of 88.0% could have implications for rapid ED discharges or other low-acuity processes designed within the emergency department. Further studies in additional settings and on alternative interventions are needed. Copyright © 2016 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

  20. Can phenological models predict tree phenology accurately in the future? The unrevealed hurdle of endodormancy break.

    Science.gov (United States)

    Chuine, Isabelle; Bonhomme, Marc; Legave, Jean-Michel; García de Cortázar-Atauri, Iñaki; Charrier, Guillaume; Lacointe, André; Améglio, Thierry

    2016-10-01

    The onset of the growing season of trees has been earlier by 2.3 days per decade during the last 40 years in temperate Europe because of global warming. The effect of temperature on plant phenology is, however, not linear because temperature has a dual effect on bud development. On one hand, low temperatures are necessary to break bud endodormancy, and, on the other hand, higher temperatures are necessary to promote bud cell growth afterward. Different process-based models have been developed in the last decades to predict the date of budbreak of woody species. They predict that global warming should delay or compromise endodormancy break at the species equatorward range limits leading to a delay or even impossibility to flower or set new leaves. These models are classically parameterized with flowering or budbreak dates only, with no information on the endodormancy break date because this information is very scarce. Here, we evaluated the efficiency of a set of phenological models to accurately predict the endodormancy break dates of three fruit trees. Our results show that models calibrated solely with budbreak dates usually do not accurately predict the endodormancy break date. Providing endodormancy break date for the model parameterization results in much more accurate prediction of this latter, with, however, a higher error than that on budbreak dates. Most importantly, we show that models not calibrated with endodormancy break dates can generate large discrepancies in forecasted budbreak dates when using climate scenarios as compared to models calibrated with endodormancy break dates. This discrepancy increases with mean annual temperature and is therefore the strongest after 2050 in the southernmost regions. Our results claim for the urgent need of massive measurements of endodormancy break dates in forest and fruit trees to yield more robust projections of phenological changes in a near future. © 2016 John Wiley & Sons Ltd.

  1. The life-cycle of operons.

    Science.gov (United States)

    Price, Morgan N; Arkin, Adam P; Alm, Eric J

    2006-06-01

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution may be driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although genes within operons are usually closely spaced because of a neutral bias toward deletion and because of selection against large overlaps, genes in highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution may be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  2. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  3. Ensemble predictive model for more accurate soil organic carbon spectroscopic estimation

    Science.gov (United States)

    Vašát, Radim; Kodešová, Radka; Borůvka, Luboš

    2017-07-01

    A myriad of signal pre-processing strategies and multivariate calibration techniques has been explored in attempt to improve the spectroscopic prediction of soil organic carbon (SOC) over the last few decades. Therefore, to come up with a novel, more powerful, and accurate predictive approach to beat the rank becomes a challenging task. However, there may be a way, so that combine several individual predictions into a single final one (according to ensemble learning theory). As this approach performs best when combining in nature different predictive algorithms that are calibrated with structurally different predictor variables, we tested predictors of two different kinds: 1) reflectance values (or transforms) at each wavelength and 2) absorption feature parameters. Consequently we applied four different calibration techniques, two per each type of predictors: a) partial least squares regression and support vector machines for type 1, and b) multiple linear regression and random forest for type 2. The weights to be assigned to individual predictions within the ensemble model (constructed as a weighted average) were determined by an automated procedure that ensured the best solution among all possible was selected. The approach was tested at soil samples taken from surface horizon of four sites differing in the prevailing soil units. By employing the ensemble predictive model the prediction accuracy of SOC improved at all four sites. The coefficient of determination in cross-validation (R2cv) increased from 0.849, 0.611, 0.811 and 0.644 (the best individual predictions) to 0.864, 0.650, 0.824 and 0.698 for Site 1, 2, 3 and 4, respectively. Generally, the ensemble model affected the final prediction so that the maximal deviations of predicted vs. observed values of the individual predictions were reduced, and thus the correlation cloud became thinner as desired.

  4. Limb-Enhancer Genie: An accessible resource of accurate enhancer predictions in the developing limb.

    Directory of Open Access Journals (Sweden)

    Remo Monti

    2017-08-01

    Full Text Available Epigenomic mapping of enhancer-associated chromatin modifications facilitates the genome-wide discovery of tissue-specific enhancers in vivo. However, reliance on single chromatin marks leads to high rates of false-positive predictions. More sophisticated, integrative methods have been described, but commonly suffer from limited accessibility to the resulting predictions and reduced biological interpretability. Here we present the Limb-Enhancer Genie (LEG, a collection of highly accurate, genome-wide predictions of enhancers in the developing limb, available through a user-friendly online interface. We predict limb enhancers using a combination of >50 published limb-specific datasets and clusters of evolutionarily conserved transcription factor binding sites, taking advantage of the patterns observed at previously in vivo validated elements. By combining different statistical models, our approach outperforms current state-of-the-art methods and provides interpretable measures of feature importance. Our results indicate that including a previously unappreciated score that quantifies tissue-specific nuclease accessibility significantly improves prediction performance. We demonstrate the utility of our approach through in vivo validation of newly predicted elements. Moreover, we describe general features that can guide the type of datasets to include when predicting tissue-specific enhancers genome-wide, while providing an accessible resource to the general biological community and facilitating the functional interpretation of genetic studies of limb malformations.

  5. More accurate recombination prediction in HIV-1 using a robust decoding algorithm for HMMs

    Directory of Open Access Journals (Sweden)

    Brown Daniel G

    2011-05-01

    Full Text Available Abstract Background Identifying recombinations in HIV is important for studying the epidemiology of the virus and aids in the design of potential vaccines and treatments. The previous widely-used tool for this task uses the Viterbi algorithm in a hidden Markov model to model recombinant sequences. Results We apply a new decoding algorithm for this HMM that improves prediction accuracy. Exactly locating breakpoints is usually impossible, since different subtypes are highly conserved in some sequence regions. Our algorithm identifies these sites up to a certain error tolerance. Our new algorithm is more accurate in predicting the location of recombination breakpoints. Our implementation of the algorithm is available at http://www.cs.uwaterloo.ca/~jmtruszk/jphmm_balls.tar.gz. Conclusions By explicitly accounting for uncertainty in breakpoint positions, our algorithm offers more reliable predictions of recombination breakpoints in HIV-1. We also document a new domain of use for our new decoding approach in HMMs.

  6. DeepCpG: accurate prediction of single-cell DNA methylation states using deep learning.

    Science.gov (United States)

    Angermueller, Christof; Lee, Heather J; Reik, Wolf; Stegle, Oliver

    2017-04-11

    Recent technological advances have enabled DNA methylation to be assayed at single-cell resolution. However, current protocols are limited by incomplete CpG coverage and hence methods to predict missing methylation states are critical to enable genome-wide analyses. We report DeepCpG, a computational approach based on deep neural networks to predict methylation states in single cells. We evaluate DeepCpG on single-cell methylation data from five cell types generated using alternative sequencing protocols. DeepCpG yields substantially more accurate predictions than previous methods. Additionally, we show that the model parameters can be interpreted, thereby providing insights into how sequence composition affects methylation variability.

  7. Prediction of Accurate Thermochemistry of Medium and Large Sized Radicals Using Connectivity-Based Hierarchy (CBH).

    Science.gov (United States)

    Sengupta, Arkajyoti; Raghavachari, Krishnan

    2014-10-14

    Accurate modeling of the chemical reactions in many diverse areas such as combustion, photochemistry, or atmospheric chemistry strongly depends on the availability of thermochemical information of the radicals involved. However, accurate thermochemical investigations of radical systems using state of the art composite methods have mostly been restricted to the study of hydrocarbon radicals of modest size. In an alternative approach, systematic error-canceling thermochemical hierarchy of reaction schemes can be applied to yield accurate results for such systems. In this work, we have extended our connectivity-based hierarchy (CBH) method to the investigation of radical systems. We have calibrated our method using a test set of 30 medium sized radicals to evaluate their heats of formation. The CBH-rad30 test set contains radicals containing diverse functional groups as well as cyclic systems. We demonstrate that the sophisticated error-canceling isoatomic scheme (CBH-2) with modest levels of theory is adequate to provide heats of formation accurate to ∼1.5 kcal/mol. Finally, we predict heats of formation of 19 other large and medium sized radicals for which the accuracy of available heats of formation are less well-known.

  8. Computational analysis of Ciona intestinalis operons.

    Science.gov (United States)

    Zeller, Robert W

    2010-07-01

    Operons are clusters of genes that are co-regulated from a common promoter. Operons are typically associated with prokaryotes, although a small number of eukaryotes have been shown to possess them. Among metazoans, operons have been extensively characterized in the nematode Caenorhabditis elegans in which ∼15% of the total genes are organized into operons. The most recent genome assembly for the ascidian Ciona intestinalis placed ∼20% of the genes (2909 total) into 1310 operons. The majority of these operons are composed of two genes, while the largest are composed of six. Here is reported a computational analysis of the genes that comprise the Ciona operons. Gene ontology (GO) terms were identified for about two-thirds of the operon-encoded genes. Using the extensive collection of public EST libraries, estimates of temporal patterns of gene expression were generated for the operon-encoded genes. Lastly, conservation of operons was analyzed by determining how many operon-encoded genes were present in the ascidian Ciona savignyi and whether these genes were organized in orthologous operons. Over 68% of the operon-encoded genes could be assigned one or more GO terms and 697 of the 1310 operons contained genes in which all genes had at least one GO term. Of these 697 operons, GO terms were shared by all of the genes within 146 individual operons, suggesting that most operons encode genes with unrelated functions. An analysis of operon gene expression from nine different EST libraries indicated that for 587 operons, all of the genes that comprise an individual operon were expressed together in at least one EST library, suggesting that these genes may be co-regulated. About 50% (74/146) of the operons with shared GO terms also showed evidence of gene co-regulation. Comparisons with the C. savignyi genome identified orthologs for 1907 of 2909 operon genes. About 38% (504/1310) of the operons are conserved between the two Ciona species. These results suggest that like

  9. Machine Learning Predictions of Molecular Properties: Accurate Many-Body Potentials and Nonlocality in Chemical Space.

    Science.gov (United States)

    Hansen, Katja; Biegler, Franziska; Ramakrishnan, Raghunathan; Pronobis, Wiktor; von Lilienfeld, O Anatole; Müller, Klaus-Robert; Tkatchenko, Alexandre

    2015-06-18

    Simultaneously accurate and efficient prediction of molecular properties throughout chemical compound space is a critical ingredient toward rational compound design in chemical and pharmaceutical industries. Aiming toward this goal, we develop and apply a systematic hierarchy of efficient empirical methods to estimate atomization and total energies of molecules. These methods range from a simple sum over atoms, to addition of bond energies, to pairwise interatomic force fields, reaching to the more sophisticated machine learning approaches that are capable of describing collective interactions between many atoms or bonds. In the case of equilibrium molecular geometries, even simple pairwise force fields demonstrate prediction accuracy comparable to benchmark energies calculated using density functional theory with hybrid exchange-correlation functionals; however, accounting for the collective many-body interactions proves to be essential for approaching the “holy grail” of chemical accuracy of 1 kcal/mol for both equilibrium and out-of-equilibrium geometries. This remarkable accuracy is achieved by a vectorized representation of molecules (so-called Bag of Bonds model) that exhibits strong nonlocality in chemical space. In addition, the same representation allows us to predict accurate electronic properties of molecules, such as their polarizability and molecular frontier orbital energies.

  10. Accurate prediction of emission energies with TD-DFT methods for platinum and iridium OLED materials.

    Science.gov (United States)

    Morello, Glenn R

    2017-06-01

    Accurate prediction of triplet excitation energies for transition metal complexes has proven to be a difficult task when confronted with a variety of metal centers and ligand types. Specifically, phosphorescent transition metal light emitters, typically based on iridium or platinum, often give calculated results of varying accuracy when compared to experimentally determined T1 emission values. Developing a computational protocol for reliably calculating OLED emission energies will allow for the prediction of a complex's color prior to synthesis, saving time and resources in the laboratory. A comprehensive investigation into the dependence of the DFT functional, basis set, and solvent model is presented here, with the aim of identifying an accurate method while remaining computationally cost-effective. A protocol that uses TD-DFT excitation energies on ground-state geometries was used to predict triplet emission values of 34 experimentally characterized complexes, using a combination of gas phase B3LYP/LANL2dz for optimization and B3LYP/CEP-31G/PCM(THF) for excitation energies. Results show excellent correlation with experimental emission values of iridium and platinum complexes for a wide range of emission energies. The set of complexes tested includes neutral and charged complexes, as well as a variety of different ligand types.

  11. Development and Validation of a Multidisciplinary Tool for Accurate and Efficient Rotorcraft Noise Prediction (MUTE)

    Science.gov (United States)

    Liu, Yi; Anusonti-Inthra, Phuriwat; Diskin, Boris

    2011-01-01

    A physics-based, systematically coupled, multidisciplinary prediction tool (MUTE) for rotorcraft noise was developed and validated with a wide range of flight configurations and conditions. MUTE is an aggregation of multidisciplinary computational tools that accurately and efficiently model the physics of the source of rotorcraft noise, and predict the noise at far-field observer locations. It uses systematic coupling approaches among multiple disciplines including Computational Fluid Dynamics (CFD), Computational Structural Dynamics (CSD), and high fidelity acoustics. Within MUTE, advanced high-order CFD tools are used around the rotor blade to predict the transonic flow (shock wave) effects, which generate the high-speed impulsive noise. Predictions of the blade-vortex interaction noise in low speed flight are also improved by using the Particle Vortex Transport Method (PVTM), which preserves the wake flow details required for blade/wake and fuselage/wake interactions. The accuracy of the source noise prediction is further improved by utilizing a coupling approach between CFD and CSD, so that the effects of key structural dynamics, elastic blade deformations, and trim solutions are correctly represented in the analysis. The blade loading information and/or the flow field parameters around the rotor blade predicted by the CFD/CSD coupling approach are used to predict the acoustic signatures at far-field observer locations with a high-fidelity noise propagation code (WOPWOP3). The predicted results from the MUTE tool for rotor blade aerodynamic loading and far-field acoustic signatures are compared and validated with a variation of experimental data sets, such as UH60-A data, DNW test data and HART II test data.

  12. The MIDAS touch for Accurately Predicting the Stress-Strain Behavior of Tantalum

    Energy Technology Data Exchange (ETDEWEB)

    Jorgensen, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-03-02

    Testing the behavior of metals in extreme environments is not always feasible, so material scientists use models to try and predict the behavior. To achieve accurate results it is necessary to use the appropriate model and material-specific parameters. This research evaluated the performance of six material models available in the MIDAS database [1] to determine at which temperatures and strain-rates they perform best, and to determine to which experimental data their parameters were optimized. Additionally, parameters were optimized for the Johnson-Cook model using experimental data from Lassila et al [2].

  13. Accurate prediction of severe allergic reactions by a small set of environmental parameters (NDVI, temperature).

    Science.gov (United States)

    Notas, George; Bariotakis, Michail; Kalogrias, Vaios; Andrianaki, Maria; Azariadis, Kalliopi; Kampouri, Errika; Theodoropoulou, Katerina; Lavrentaki, Katerina; Kastrinakis, Stelios; Kampa, Marilena; Agouridakis, Panagiotis; Pirintsos, Stergios; Castanas, Elias

    2015-01-01

    Severe allergic reactions of unknown etiology,necessitating a hospital visit, have an important impact in the life of affected individuals and impose a major economic burden to societies. The prediction of clinically severe allergic reactions would be of great importance, but current attempts have been limited by the lack of a well-founded applicable methodology and the wide spatiotemporal distribution of allergic reactions. The valid prediction of severe allergies (and especially those needing hospital treatment) in a region, could alert health authorities and implicated individuals to take appropriate preemptive measures. In the present report we have collecterd visits for serious allergic reactions of unknown etiology from two major hospitals in the island of Crete, for two distinct time periods (validation and test sets). We have used the Normalized Difference Vegetation Index (NDVI), a satellite-based, freely available measurement, which is an indicator of live green vegetation at a given geographic area, and a set of meteorological data to develop a model capable of describing and predicting severe allergic reaction frequency. Our analysis has retained NDVI and temperature as accurate identifiers and predictors of increased hospital severe allergic reactions visits. Our approach may contribute towards the development of satellite-based modules, for the prediction of severe allergic reactions in specific, well-defined geographical areas. It could also probably be used for the prediction of other environment related diseases and conditions.

  14. SIFTER search: a web server for accurate phylogeny-based protein function prediction.

    Science.gov (United States)

    Sahraeian, Sayed M; Luo, Kevin R; Brenner, Steven E

    2015-07-01

    We are awash in proteins discovered through high-throughput sequencing projects. As only a minuscule fraction of these have been experimentally characterized, computational methods are widely used for automated annotation. Here, we introduce a user-friendly web interface for accurate protein function prediction using the SIFTER algorithm. SIFTER is a state-of-the-art sequence-based gene molecular function prediction algorithm that uses a statistical model of function evolution to incorporate annotations throughout the phylogenetic tree. Due to the resources needed by the SIFTER algorithm, running SIFTER locally is not trivial for most users, especially for large-scale problems. The SIFTER web server thus provides access to precomputed predictions on 16 863 537 proteins from 232 403 species. Users can explore SIFTER predictions with queries for proteins, species, functions, and homologs of sequences not in the precomputed prediction set. The SIFTER web server is accessible at http://sifter.berkeley.edu/ and the source code can be downloaded. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Accurate bearing remaining useful life prediction based on Weibull distribution and artificial neural network

    Science.gov (United States)

    Ben Ali, Jaouher; Chebel-Morello, Brigitte; Saidi, Lotfi; Malinowski, Simon; Fnaiech, Farhat

    2015-05-01

    Accurate remaining useful life (RUL) prediction of critical assets is an important challenge in condition based maintenance to improve reliability and decrease machine's breakdown and maintenance's cost. Bearing is one of the most important components in industries which need to be monitored and the user should predict its RUL. The challenge of this study is to propose an original feature able to evaluate the health state of bearings and to estimate their RUL by Prognostics and Health Management (PHM) techniques. In this paper, the proposed method is based on the data-driven prognostic approach. The combination of Simplified Fuzzy Adaptive Resonance Theory Map (SFAM) neural network and Weibull distribution (WD) is explored. WD is used just in the training phase to fit measurement and to avoid areas of fluctuation in the time domain. SFAM training process is based on fitted measurements at present and previous inspection time points as input. However, the SFAM testing process is based on real measurements at present and previous inspections. Thanks to the fuzzy learning process, SFAM has an important ability and a good performance to learn nonlinear time series. As output, seven classes are defined; healthy bearing and six states for bearing degradation. In order to find the optimal RUL prediction, a smoothing phase is proposed in this paper. Experimental results show that the proposed method can reliably predict the RUL of rolling element bearings (REBs) based on vibration signals. The proposed prediction approach can be applied to prognostic other various mechanical assets.

  16. Partin Tables cannot accurately predict the pathological stage at radical prostatectomy.

    Science.gov (United States)

    Bhojani, N; Ahyai, S; Graefen, M; Capitanio, U; Suardi, N; Shariat, S F; Jeldres, C; Erbersdobler, A; Schlomm, T; Haese, A; Steuber, T; Heinzer, H; Montorsi, F; Huland, H; Karakiewicz, P I

    2009-02-01

    The Partin Tables represent the most commonly used staging tool for radical prostatectomy (RP) candidates. The Partin Tables' predictions are used to guide the type (nerve preserving RP) and/or the extent (RP with wide resection) of RP. We examined the ability of the Partin Tables' predictions incorrectly assigning the stage at RP. The testing of the Partin Tables (external validation) was based on 3105 patients treated with RP at a single European institution. Standard validation metrics were used (area under the receiver operating characteristics curve, AUC) to test the three endpoints predicted by the Partin Tables, namely the presence of extracapsular extension (ECE), seminal vesicle invasion (SVI), and lymph node invasion (LNI). Ideal predictions are denoted with 100% accuracy vs. 50% for entirely random predictions. For the 2001 version of the Tables the accuracy defined by the AUC was 79.7, 77.8, and 73.0 for ECE, SVI, and LNI, respectively. For the 2007 version of the Tables the corresponding accuracy estimates were 79.8, 80.5, and 76.2. The relationship between predicted probabilities and observed rates was poor. The Partin Tables are meant to guide clinicians about the safety of nerve bundle preservation at RP, about the need for seminal vesicle resection or for lymphadenectomy. Therefore, the use of the Partin Tables predictions may significantly affect the type and/or the extent of RP. In their present format the Partin Tables are not accurate enough to influence the pre-operative decision making regarding the type or extent of RP.

  17. Accurate Prediction and Validation of Response to Endocrine Therapy in Breast Cancer.

    Science.gov (United States)

    Turnbull, Arran K; Arthur, Laura M; Renshaw, Lorna; Larionov, Alexey A; Kay, Charlene; Dunbier, Anita K; Thomas, Jeremy S; Dowsett, Mitch; Sims, Andrew H; Dixon, J Michael

    2015-07-10

    Aromatase inhibitors (AIs) have an established role in the treatment of breast cancer. Response rates are only 50% to 70% in the neoadjuvant setting and lower in advanced disease. Accurate biomarkers are urgently needed to predict response in these settings and to determine which individuals will benefit from adjuvant AI therapy. Pretreatment and on-treatment (after 2 weeks and 3 months) biopsies were obtained from 89 postmenopausal women who had estrogen receptor-alpha positive breast cancer and were receiving neoadjuvant letrozole for transcript profiling. Dynamic clinical response was assessed with use of three-dimensional ultrasound measurements. The molecular response to letrozole was characterized and a four-gene classifier of clinical response was established (accuracy of 96%) on the basis of the level of two genes before treatment (one gene [IL6ST] was associated with immune signaling, and the other [NGFRAP1] was associated with apoptosis) and the level of two proliferation genes (ASPM, MCM4) after 2 weeks of therapy. The four-gene signature was found to be 91% accurate in a blinded, completely independent validation data set of patients treated with anastrozole. Matched 2-week on-treatment biopsies were associated with improved predictive power as compared with pretreatment biopsies alone. This signature also significantly predicted recurrence-free survival (P = .029) and breast cancer -specific survival (P = .009). We demonstrate that the test can also be performed with use of quantitative polymerase chain reaction or immunohistochemistry. A four-gene predictive model of clinical response to AIs by 2 weeks has been generated and validated. Deregulated immune and apoptotic responses before treatment and cell proliferation that is not reduced 2 weeks after initiation of treatment are functional characteristics of breast tumors that do not respond to AIs. © 2015 by American Society of Clinical Oncology.

  18. Investigating Evolutionary Dynamics of RHA1 Operons.

    Science.gov (United States)

    Chen, Yong; Geng, Dandan; Ehrhardt, Kristina; Zhang, Shaoqiang

    2016-01-01

    Grouping genes as operons is an important genomic feature of prokaryotic organisms. The comprehensive understanding of the operon organizations would be helpful to decipher transcriptional mechanisms, cellular pathways, and the evolutionary landscape of prokaryotic genomes. Although thousands of prokaryotes have been sequenced, genome-wide investigation of the evolutionary dynamics (division and recombination) of operons among these genomes remains unexplored. Here, we systematically analyzed the operon dynamics of Rhodococcus jostii RHA1 (RHA1), an oleaginous bacterium with high potential applications in biofuel, by comparing 340 prokaryotic genomes that were carefully selected from different genera. Interestingly, 99% of RHA1 operons were observed to exhibit evolutionary events of division and recombination among the 340 compared genomes. An operon that encodes all enzymes related to histidine biosynthesis in RHA1 (His-operon) was found to be segmented into smaller gene groups (sub-operons) in diverse genomes. These sub-operons were further reorganized with different functional genes as novel operons that are related to different biochemical processes. Comparatively, the operons involved in the functional categories of lipid transport and metabolism are relatively conserved among the 340 compared genomes. At the pathway level, RHA1 operons found to be significantly conserved were involved in ribosome synthesis, oxidative phosphorylation, and fatty acid synthesis. These analyses provide evolutionary insights of operon organization and the dynamic associations of various biochemical pathways in different prokaryotes.

  19. Microbiome Data Accurately Predicts the Postmortem Interval Using Random Forest Regression Models

    Directory of Open Access Journals (Sweden)

    Aeriel Belk

    2018-02-01

    Full Text Available Death investigations often include an effort to establish the postmortem interval (PMI in cases in which the time of death is uncertain. The postmortem interval can lead to the identification of the deceased and the validation of witness statements and suspect alibis. Recent research has demonstrated that microbes provide an accurate clock that starts at death and relies on ecological change in the microbial communities that normally inhabit a body and its surrounding environment. Here, we explore how to build the most robust Random Forest regression models for prediction of PMI by testing models built on different sample types (gravesoil, skin of the torso, skin of the head, gene markers (16S ribosomal RNA (rRNA, 18S rRNA, internal transcribed spacer regions (ITS, and taxonomic levels (sequence variants, species, genus, etc.. We also tested whether particular suites of indicator microbes were informative across different datasets. Generally, results indicate that the most accurate models for predicting PMI were built using gravesoil and skin data using the 16S rRNA genetic marker at the taxonomic level of phyla. Additionally, several phyla consistently contributed highly to model accuracy and may be candidate indicators of PMI.

  20. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

    Science.gov (United States)

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

    2017-01-09

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. ILT based defect simulation of inspection images accurately predicts mask defect printability on wafer

    Science.gov (United States)

    Deep, Prakash; Paninjath, Sankaranarayanan; Pereira, Mark; Buck, Peter

    2016-05-01

    At advanced technology nodes mask complexity has been increased because of large-scale use of resolution enhancement technologies (RET) which includes Optical Proximity Correction (OPC), Inverse Lithography Technology (ILT) and Source Mask Optimization (SMO). The number of defects detected during inspection of such mask increased drastically and differentiation of critical and non-critical defects are more challenging, complex and time consuming. Because of significant defectivity of EUVL masks and non-availability of actinic inspection, it is important and also challenging to predict the criticality of defects for printability on wafer. This is one of the significant barriers for the adoption of EUVL for semiconductor manufacturing. Techniques to decide criticality of defects from images captured using non actinic inspection images is desired till actinic inspection is not available. High resolution inspection of photomask images detects many defects which are used for process and mask qualification. Repairing all defects is not practical and probably not required, however it's imperative to know which defects are severe enough to impact wafer before repair. Additionally, wafer printability check is always desired after repairing a defect. AIMSTM review is the industry standard for this, however doing AIMSTM review for all defects is expensive and very time consuming. Fast, accurate and an economical mechanism is desired which can predict defect printability on wafer accurately and quickly from images captured using high resolution inspection machine. Predicting defect printability from such images is challenging due to the fact that the high resolution images do not correlate with actual mask contours. The challenge is increased due to use of different optical condition during inspection other than actual scanner condition, and defects found in such images do not have correlation with actual impact on wafer. Our automated defect simulation tool predicts

  2. Accurate De Novo Prediction of Protein Contact Map by Ultra-Deep Learning Model

    Science.gov (United States)

    Li, Zhen; Zhang, Renyu

    2017-01-01

    Motivation Protein contacts contain key information for the understanding of protein structure and function and thus, contact prediction from sequence is an important problem. Recently exciting progress has been made on this problem, but the predicted contacts for proteins without many sequence homologs is still of low quality and not very useful for de novo structure prediction. Method This paper presents a new deep learning method that predicts contacts by integrating both evolutionary coupling (EC) and sequence conservation information through an ultra-deep neural network formed by two deep residual neural networks. The first residual network conducts a series of 1-dimensional convolutional transformation of sequential features; the second residual network conducts a series of 2-dimensional convolutional transformation of pairwise information including output of the first residual network, EC information and pairwise potential. By using very deep residual networks, we can accurately model contact occurrence patterns and complex sequence-structure relationship and thus, obtain higher-quality contact prediction regardless of how many sequence homologs are available for proteins in question. Results Our method greatly outperforms existing methods and leads to much more accurate contact-assisted folding. Tested on 105 CASP11 targets, 76 past CAMEO hard targets, and 398 membrane proteins, the average top L long-range prediction accuracy obtained by our method, one representative EC method CCMpred and the CASP11 winner MetaPSICOV is 0.47, 0.21 and 0.30, respectively; the average top L/10 long-range accuracy of our method, CCMpred and MetaPSICOV is 0.77, 0.47 and 0.59, respectively. Ab initio folding using our predicted contacts as restraints but without any force fields can yield correct folds (i.e., TMscore>0.6) for 203 of the 579 test proteins, while that using MetaPSICOV- and CCMpred-predicted contacts can do so for only 79 and 62 of them, respectively. Our contact

  3. Accurate De Novo Prediction of Protein Contact Map by Ultra-Deep Learning Model.

    Science.gov (United States)

    Wang, Sheng; Sun, Siqi; Li, Zhen; Zhang, Renyu; Xu, Jinbo

    2017-01-01

    Protein contacts contain key information for the understanding of protein structure and function and thus, contact prediction from sequence is an important problem. Recently exciting progress has been made on this problem, but the predicted contacts for proteins without many sequence homologs is still of low quality and not very useful for de novo structure prediction. This paper presents a new deep learning method that predicts contacts by integrating both evolutionary coupling (EC) and sequence conservation information through an ultra-deep neural network formed by two deep residual neural networks. The first residual network conducts a series of 1-dimensional convolutional transformation of sequential features; the second residual network conducts a series of 2-dimensional convolutional transformation of pairwise information including output of the first residual network, EC information and pairwise potential. By using very deep residual networks, we can accurately model contact occurrence patterns and complex sequence-structure relationship and thus, obtain higher-quality contact prediction regardless of how many sequence homologs are available for proteins in question. Our method greatly outperforms existing methods and leads to much more accurate contact-assisted folding. Tested on 105 CASP11 targets, 76 past CAMEO hard targets, and 398 membrane proteins, the average top L long-range prediction accuracy obtained by our method, one representative EC method CCMpred and the CASP11 winner MetaPSICOV is 0.47, 0.21 and 0.30, respectively; the average top L/10 long-range accuracy of our method, CCMpred and MetaPSICOV is 0.77, 0.47 and 0.59, respectively. Ab initio folding using our predicted contacts as restraints but without any force fields can yield correct folds (i.e., TMscore>0.6) for 203 of the 579 test proteins, while that using MetaPSICOV- and CCMpred-predicted contacts can do so for only 79 and 62 of them, respectively. Our contact-assisted models also have

  4. Accurate De Novo Prediction of Protein Contact Map by Ultra-Deep Learning Model.

    Directory of Open Access Journals (Sweden)

    Sheng Wang

    2017-01-01

    Full Text Available Protein contacts contain key information for the understanding of protein structure and function and thus, contact prediction from sequence is an important problem. Recently exciting progress has been made on this problem, but the predicted contacts for proteins without many sequence homologs is still of low quality and not very useful for de novo structure prediction.This paper presents a new deep learning method that predicts contacts by integrating both evolutionary coupling (EC and sequence conservation information through an ultra-deep neural network formed by two deep residual neural networks. The first residual network conducts a series of 1-dimensional convolutional transformation of sequential features; the second residual network conducts a series of 2-dimensional convolutional transformation of pairwise information including output of the first residual network, EC information and pairwise potential. By using very deep residual networks, we can accurately model contact occurrence patterns and complex sequence-structure relationship and thus, obtain higher-quality contact prediction regardless of how many sequence homologs are available for proteins in question.Our method greatly outperforms existing methods and leads to much more accurate contact-assisted folding. Tested on 105 CASP11 targets, 76 past CAMEO hard targets, and 398 membrane proteins, the average top L long-range prediction accuracy obtained by our method, one representative EC method CCMpred and the CASP11 winner MetaPSICOV is 0.47, 0.21 and 0.30, respectively; the average top L/10 long-range accuracy of our method, CCMpred and MetaPSICOV is 0.77, 0.47 and 0.59, respectively. Ab initio folding using our predicted contacts as restraints but without any force fields can yield correct folds (i.e., TMscore>0.6 for 203 of the 579 test proteins, while that using MetaPSICOV- and CCMpred-predicted contacts can do so for only 79 and 62 of them, respectively. Our contact

  5. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  6. OrthoReD: a rapid and accurate orthology prediction tool with low computational requirement.

    Science.gov (United States)

    Battenberg, Kai; Lee, Ernest K; Chiu, Joanna C; Berry, Alison M; Potter, Daniel

    2017-06-21

    Identifying orthologous genes is an initial step required for phylogenetics, and it is also a common strategy employed in functional genetics to find candidates for functionally equivalent genes across multiple species. At the same time, in silico orthology prediction tools often require large computational resources only available on computing clusters. Here we present OrthoReD, an open-source orthology prediction tool with accuracy comparable to published tools that requires only a desktop computer. The low computational resource requirement of OrthoReD is achieved by repeating orthology searches on one gene of interest at a time, thereby generating a reduced dataset to limit the scope of orthology search for each gene of interest. The output of OrthoReD was highly similar to the outputs of two other published orthology prediction tools, OrthologID and/or OrthoDB, for the three dataset tested, which represented three phyla with different ranges of species diversity and different number of genomes included. Median CPU time for ortholog prediction per gene by OrthoReD executed on a desktop computer was <15 min even for the largest dataset tested, which included all coding sequences of 100 bacterial species. With high-throughput sequencing, unprecedented numbers of genes from non-model organisms are available with increasing need for clear information about their orthologies and/or functional equivalents in model organisms. OrthoReD is not only fast and accurate as an orthology prediction tool, but also gives researchers flexibility in the number of genes analyzed at a time, without requiring a high-performance computing cluster.

  7. Investigating Evolutionary Dynamics of RHA1 Operons

    OpenAIRE

    Yong Chen; Dandan Geng; Kristina Ehrhardt; Shaoqiang Zhang

    2016-01-01

    Grouping genes as operons is an important genomic feature of prokaryotic organisms. The comprehensive understanding of the operon organizations would be helpful to decipher transcriptional mechanisms, cellular pathways, and the evolutionary landscape of prokaryotic genomes. Although thousands of prokaryotes have been sequenced, genome-wide investigation of the evolutionary dynamics (division and recombination) of operons among these genomes remains unexplored. Here, we systematically analyzed...

  8. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  9. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  10. APIS: accurate prediction of hot spots in protein interfaces by combining protrusion index with solvent accessibility.

    Science.gov (United States)

    Xia, Jun-Feng; Zhao, Xing-Ming; Song, Jiangning; Huang, De-Shuang

    2010-04-08

    It is well known that most of the binding free energy of protein interaction is contributed by a few key hot spot residues. These residues are crucial for understanding the function of proteins and studying their interactions. Experimental hot spots detection methods such as alanine scanning mutagenesis are not applicable on a large scale since they are time consuming and expensive. Therefore, reliable and efficient computational methods for identifying hot spots are greatly desired and urgently required. In this work, we introduce an efficient approach that uses support vector machine (SVM) to predict hot spot residues in protein interfaces. We systematically investigate a wide variety of 62 features from a combination of protein sequence and structure information. Then, to remove redundant and irrelevant features and improve the prediction performance, feature selection is employed using the F-score method. Based on the selected features, nine individual-feature based predictors are developed to identify hot spots using SVMs. Furthermore, a new ensemble classifier, namely APIS (A combined model based on Protrusion Index and Solvent accessibility), is developed to further improve the prediction accuracy. The results on two benchmark datasets, ASEdb and BID, show that this proposed method yields significantly better prediction accuracy than those previously published in the literature. In addition, we also demonstrate the predictive power of our proposed method by modelling two protein complexes: the calmodulin/myosin light chain kinase complex and the heat shock locus gene products U and V complex, which indicate that our method can identify more hot spots in these two complexes compared with other state-of-the-art methods. We have developed an accurate prediction model for hot spot residues, given the structure of a protein complex. A major contribution of this study is to propose several new features based on the protrusion index of amino acid residues, which

  11. Accurate prediction of vaccine stability under real storage conditions and during temperature excursions.

    Science.gov (United States)

    Clénet, Didier

    2018-01-13

    Due to their thermosensitivity, most vaccines must be kept refrigerated from production to use. To successfully carry out global immunization programs, ensuring the stability of vaccines is crucial. In this context, two important issues are critical, namely: (i) predicting vaccine stability and (ii) preventing product damage due to excessive temperature excursions outside of the recommended storage conditions (cold chain break). We applied a combination of advanced kinetics and statistical analyses on vaccine forced degradation data to accurately describe the loss of antigenicity for a multivalent freeze-dried inactivated virus vaccine containing three variants. The screening of large amounts of kinetic models combined with a statistical model selection approach resulted in the identification of two-step kinetic models. Predictions based on kinetic analysis and experimental stability data were in agreement, with approximately five percentage points difference from real values for long-term stability storage conditions, after excursions of temperature and during experimental shipments of freeze-dried products. Results showed that modeling a few months of forced degradation can be used to predict various time and temperature profiles endured by vaccines, i.e. long-term stability, short time excursions outside the labeled storage conditions or shipments at ambient temperature, with high accuracy. Pharmaceutical applications of the presented kinetics-based approach are discussed. Copyright © 2018. Published by Elsevier B.V.

  12. Intermolecular potentials and the accurate prediction of the thermodynamic properties of water

    Energy Technology Data Exchange (ETDEWEB)

    Shvab, I.; Sadus, Richard J., E-mail: rsadus@swin.edu.au [Centre for Molecular Simulation, Swinburne University of Technology, PO Box 218, Hawthorn, Victoria 3122 (Australia)

    2013-11-21

    The ability of intermolecular potentials to correctly predict the thermodynamic properties of liquid water at a density of 0.998 g/cm{sup 3} for a wide range of temperatures (298–650 K) and pressures (0.1–700 MPa) is investigated. Molecular dynamics simulations are reported for the pressure, thermal pressure coefficient, thermal expansion coefficient, isothermal and adiabatic compressibilities, isobaric and isochoric heat capacities, and Joule-Thomson coefficient of liquid water using the non-polarizable SPC/E and TIP4P/2005 potentials. The results are compared with both experiment data and results obtained from the ab initio-based Matsuoka-Clementi-Yoshimine non-additive (MCYna) [J. Li, Z. Zhou, and R. J. Sadus, J. Chem. Phys. 127, 154509 (2007)] potential, which includes polarization contributions. The data clearly indicate that both the SPC/E and TIP4P/2005 potentials are only in qualitative agreement with experiment, whereas the polarizable MCYna potential predicts some properties within experimental uncertainty. This highlights the importance of polarizability for the accurate prediction of the thermodynamic properties of water, particularly at temperatures beyond 298 K.

  13. Urinary Squamous Epithelial Cells Do Not Accurately Predict Urine Culture Contamination, but May Predict Urinalysis Performance in Predicting Bacteriuria.

    Science.gov (United States)

    Mohr, Nicholas M; Harland, Karisa K; Crabb, Victoria; Mutnick, Rachel; Baumgartner, David; Spinosi, Stephanie; Haarstad, Michael; Ahmed, Azeemuddin; Schweizer, Marin; Faine, Brett

    2016-03-01

    The presence of squamous epithelial cells (SECs) has been advocated to identify urinary contamination despite a paucity of evidence supporting this practice. We sought to determine the value of using quantitative SECs as a predictor of urinalysis contamination. Retrospective cross-sectional study of adults (≥18 years old) presenting to a tertiary academic medical center who had urinalysis with microscopy and urine culture performed. Patients with missing or implausible demographic data were excluded (2.5% of total sample). The primary analysis aimed to determine an SEC threshold that predicted urine culture contamination using receiver operating characteristics (ROC) curve analysis. The a priori secondary analysis explored how demographic variables (age, sex, body mass index) may modify the SEC test performance and whether SECs impacted traditional urinalysis indicators of bacteriuria. A total of 19,328 records were included. ROC curve analysis demonstrated that SEC count was a poor predictor of urine culture contamination (area under the ROC curve = 0.680, 95% confidence interval [CI] = 0.671 to 0.689). In secondary analysis, the positive likelihood ratio (LR+) of predicting bacteriuria via urinalysis among noncontaminated specimens was 4.98 (95% CI = 4.59 to 5.40) in the absence of SECs, but the LR+ fell to 2.35 (95% CI = 2.17 to 2.54) for samples with more than 8 SECs/low-powered field (lpf). In an independent validation cohort, urinalysis samples with fewer than 8 SECs/lpf predicted bacteriuria better (sensitivity = 75%, specificity = 84%) than samples with more than 8 SECs/lpf (sensitivity = 86%, specificity = 70%; diagnostic odds ratio = 17.5 [14.9 to 20.7] vs. 8.7 [7.3 to 10.5]). Squamous epithelial cells are a poor predictor of urine culture contamination, but may predict poor predictive performance of traditional urinalysis measures. © 2016 by the Society for Academic Emergency Medicine.

  14. Accurate Prediction of Complex Structure and Affinity for a Flexible Protein Receptor and Its Inhibitor.

    Science.gov (United States)

    Bekker, Gert-Jan; Kamiya, Narutoshi; Araki, Mitsugu; Fukuda, Ikuo; Okuno, Yasushi; Nakamura, Haruki

    2017-06-13

    In order to predict the accurate binding configuration as well as the binding affinity for a flexible protein receptor and its inhibitor drug, enhanced sampling with multicanonical molecular dynamics (McMD) simulation and thermodynamic integration (TI) were combined as a general drug docking method. CDK2, cyclin-dependent kinase 2, is involved in the cell cycle regulation. Malfunctions in CDK2 can cause tumorigenesis, and thus it is a potential drug target. Here, we performed a long McMD simulation for docking the inhibitor CS3 to CDK2 starting from the unbound structure. Subsequently, a potential binding/unbinding pathway was given from the multicanonical ensemble, and the binding free energy was readily computed by TI along the pathway. Using this combination, the correct binding configuration of CS3 to CDK2 was obtained, and its affinity coincided well with the experimental value.

  15. Fast and accurate prediction of numerical relativity waveforms from binary black hole mergers using surrogate models

    CERN Document Server

    Blackman, Jonathan; Galley, Chad R; Szilagyi, Bela; Scheel, Mark A; Tiglio, Manuel; Hemberger, Daniel A

    2015-01-01

    Simulating a binary black hole coalescence by solving Einstein's equations is computationally expensive, requiring days to months of supercomputing time. In this paper, we construct an accurate and fast-to-evaluate surrogate model for numerical relativity (NR) waveforms from non-spinning binary black hole coalescences with mass ratios from $1$ to $10$ and durations corresponding to about $15$ orbits before merger. Our surrogate, which is built using reduced order modeling techniques, is distinct from traditional modeling efforts. We find that the full multi-mode surrogate model agrees with waveforms generated by NR to within the numerical error of the NR code. In particular, we show that our modeling strategy produces surrogates which can correctly predict NR waveforms that were {\\em not} used for the surrogate's training. For all practical purposes, then, the surrogate waveform model is equivalent to the high-accuracy, large-scale simulation waveform but can be evaluated in a millisecond to a second dependin...

  16. Can physicians accurately predict which patients will lose weight, improve nutrition and increase physical activity?

    Science.gov (United States)

    Pollak, Kathryn I; Coffman, Cynthia J; Alexander, Stewart C; Tulsky, James A; Lyna, Pauline; Dolor, Rowena J; Cox, Mary E; Brouwer, Rebecca J Namenek; Bodner, Michael E; Østbye, Truls

    2012-10-01

    Physician counselling may help patients increase physical activity, improve nutrition and lose weight. However, physicians have low outcome expectations that patients will change. The aims are to describe the accuracy of physicians' outcome expectations about whether patients will follow weight loss, nutrition and physical activity recommendations. The relationships between physician outcome expectations and patient motivation and confidence also are assessed. This was an observational study that audio recorded encounters between 40 primary care physicians and 461 of their overweight or obese patients. We surveyed physicians to assess outcome expectations that patients will lose weight, improve nutrition and increase physical activity after counselling. We assessed actual patient change in behaviours from baseline to 3 months after the encounter and changes in motivation and confidence from baseline to immediately post-encounter. Right after the visit, ~55% of the time physicians were optimistic that their individual patients would improve. Physicians were not very accurate about which patients actually would improve weight, nutrition and physical activity. More patients had higher confidence to lose weight when physicians thought that patients would be likely to follow their weight loss recommendations. Physicians are moderately optimistic that patients will follow their weight loss, nutrition and physical activity recommendations. Patients might perceive physicians' confidence in them and thus feel more confident themselves. Physicians, however, are not very accurate in predicting which patients will or will not change behaviours. Their optimism, although helpful for patient confidence, might make physicians less receptive to learning effective counselling techniques.

  17. In vitro transcription accurately predicts lac repressor phenotype in vivo in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Matthew Almond Sochor

    2014-07-01

    Full Text Available A multitude of studies have looked at the in vivo and in vitro behavior of the lac repressor binding to DNA and effector molecules in order to study transcriptional repression, however these studies are not always reconcilable. Here we use in vitro transcription to directly mimic the in vivo system in order to build a self consistent set of experiments to directly compare in vivo and in vitro genetic repression. A thermodynamic model of the lac repressor binding to operator DNA and effector is used to link DNA occupancy to either normalized in vitro mRNA product or normalized in vivo fluorescence of a regulated gene, YFP. An accurate measurement of repressor, DNA and effector concentrations were made both in vivo and in vitro allowing for direct modeling of the entire thermodynamic equilibrium. In vivo repression profiles are accurately predicted from the given in vitro parameters when molecular crowding is considered. Interestingly, our measured repressor–operator DNA affinity differs significantly from previous in vitro measurements. The literature values are unable to replicate in vivo binding data. We therefore conclude that the repressor-DNA affinity is much weaker than previously thought. This finding would suggest that in vitro techniques that are specifically designed to mimic the in vivo process may be necessary to replicate the native system.

  18. A machine learned classifier that uses gene expression data to accurately predict estrogen receptor status.

    Directory of Open Access Journals (Sweden)

    Meysam Bastani

    Full Text Available BACKGROUND: Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. METHODS: To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. RESULTS: This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. CONCLUSIONS: Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions.

  19. Measuring solar reflectance Part I: Defining a metric that accurately predicts solar heat gain

    Energy Technology Data Exchange (ETDEWEB)

    Levinson, Ronnen; Akbari, Hashem; Berdahl, Paul

    2010-05-14

    Solar reflectance can vary with the spectral and angular distributions of incident sunlight, which in turn depend on surface orientation, solar position and atmospheric conditions. A widely used solar reflectance metric based on the ASTM Standard E891 beam-normal solar spectral irradiance underestimates the solar heat gain of a spectrally selective 'cool colored' surface because this irradiance contains a greater fraction of near-infrared light than typically found in ordinary (unconcentrated) global sunlight. At mainland U.S. latitudes, this metric RE891BN can underestimate the annual peak solar heat gain of a typical roof or pavement (slope {le} 5:12 [23{sup o}]) by as much as 89 W m{sup -2}, and underestimate its peak surface temperature by up to 5 K. Using R{sub E891BN} to characterize roofs in a building energy simulation can exaggerate the economic value N of annual cool-roof net energy savings by as much as 23%. We define clear-sky air mass one global horizontal ('AM1GH') solar reflectance R{sub g,0}, a simple and easily measured property that more accurately predicts solar heat gain. R{sub g,0} predicts the annual peak solar heat gain of a roof or pavement to within 2 W m{sup -2}, and overestimates N by no more than 3%. R{sub g,0} is well suited to rating the solar reflectances of roofs, pavements and walls. We show in Part II that R{sub g,0} can be easily and accurately measured with a pyranometer, a solar spectrophotometer or version 6 of the Solar Spectrum Reflectometer.

  20. A Machine Learned Classifier That Uses Gene Expression Data to Accurately Predict Estrogen Receptor Status

    Science.gov (United States)

    Bastani, Meysam; Vos, Larissa; Asgarian, Nasimeh; Deschenes, Jean; Graham, Kathryn; Mackey, John; Greiner, Russell

    2013-01-01

    Background Selecting the appropriate treatment for breast cancer requires accurately determining the estrogen receptor (ER) status of the tumor. However, the standard for determining this status, immunohistochemical analysis of formalin-fixed paraffin embedded samples, suffers from numerous technical and reproducibility issues. Assessment of ER-status based on RNA expression can provide more objective, quantitative and reproducible test results. Methods To learn a parsimonious RNA-based classifier of hormone receptor status, we applied a machine learning tool to a training dataset of gene expression microarray data obtained from 176 frozen breast tumors, whose ER-status was determined by applying ASCO-CAP guidelines to standardized immunohistochemical testing of formalin fixed tumor. Results This produced a three-gene classifier that can predict the ER-status of a novel tumor, with a cross-validation accuracy of 93.17±2.44%. When applied to an independent validation set and to four other public databases, some on different platforms, this classifier obtained over 90% accuracy in each. In addition, we found that this prediction rule separated the patients' recurrence-free survival curves with a hazard ratio lower than the one based on the IHC analysis of ER-status. Conclusions Our efficient and parsimonious classifier lends itself to high throughput, highly accurate and low-cost RNA-based assessments of ER-status, suitable for routine high-throughput clinical use. This analytic method provides a proof-of-principle that may be applicable to developing effective RNA-based tests for other biomarkers and conditions. PMID:24312637

  1. Highly Accurate Prediction of Protein-Protein Interactions via Incorporating Evolutionary Information and Physicochemical Characteristics

    Directory of Open Access Journals (Sweden)

    Zheng-Wei Li

    2016-08-01

    Full Text Available Protein-protein interactions (PPIs occur at almost all levels of cell functions and play crucial roles in various cellular processes. Thus, identification of PPIs is critical for deciphering the molecular mechanisms and further providing insight into biological processes. Although a variety of high-throughput experimental techniques have been developed to identify PPIs, existing PPI pairs by experimental approaches only cover a small fraction of the whole PPI networks, and further, those approaches hold inherent disadvantages, such as being time-consuming, expensive, and having high false positive rate. Therefore, it is urgent and imperative to develop automatic in silico approaches to predict PPIs efficiently and accurately. In this article, we propose a novel mixture of physicochemical and evolutionary-based feature extraction method for predicting PPIs using our newly developed discriminative vector machine (DVM classifier. The improvements of the proposed method mainly consist in introducing an effective feature extraction method that can capture discriminative features from the evolutionary-based information and physicochemical characteristics, and then a powerful and robust DVM classifier is employed. To the best of our knowledge, it is the first time that DVM model is applied to the field of bioinformatics. When applying the proposed method to the Yeast and Helicobacter pylori (H. pylori datasets, we obtain excellent prediction accuracies of 94.35% and 90.61%, respectively. The computational results indicate that our method is effective and robust for predicting PPIs, and can be taken as a useful supplementary tool to the traditional experimental methods for future proteomics research.

  2. Improved CYP3A4 Molecular Models Accurately Predict Phe215 Requirement for Raloxifene Dehydrogenation Selectivity

    Science.gov (United States)

    Moore, Chad D.; Shahrokh, Kiumars; Sontum, Stephen F.; Cheatham, Thomas E.; Yost, Garold S.

    2010-01-01

    The use of molecular modeling in conjunction with site-directed mutagenesis has extensively been used to study substrate orientation within cytochrome P450 active sites, and to identify potential residues involved in positioning and catalytic mechanisms of these substrates. However, because docking studies utilize static models to simulate dynamic P450 enzymes, the effectiveness of these studies are highly dependent on accurate enzyme models. This study employed a cytochrome P450 3A4 (CYP3A4) crystal structure (PDB code:1W0E) to predict the sites of metabolism of the known CYP3A4 substrate raloxifene. In addition, partial charges were incorporated into the P450 heme moiety to investigate the effect of the modified CYP3A4 model on metabolite prediction with the ligand-docking program Autodock. Dehydrogenation of raloxifene to an electrophilic di-quinone methide intermediate has been linked to the potent inactivation of CYP3A4. Active site residues involved in the positioning and/or catalysis of raloxifene supporting dehydrogenation were identified with the two models, and site-directed mutagenesis studies were conducted to validate the models. The addition of partial charges to the heme moiety increased accuracy of the docking studies, increasing the number of conformations predicting dehydrogenation, and facilitating the identification of substrate/active site residue interactions. Based on the improved model, the Phe215 residue was hypothesized to play an important role in orienting raloxifene for dehydrogenation through a combination of electrostatic and steric interactions. Substitution of this residue with glycine or glutamine significantly decreased dehydrogenation rates without concurrent changes in the rates of raloxifene oxygenation. Thus, the improved structural model predicted novel enzyme/substrate interactions that control the selective dehydrogenation of raloxifene to its protein-binding intermediate. PMID:20812728

  3. A Critical Review for Developing Accurate and Dynamic Predictive Models Using Machine Learning Methods in Medicine and Health Care.

    Science.gov (United States)

    Alanazi, Hamdan O; Abdullah, Abdul Hanan; Qureshi, Kashif Naseer

    2017-04-01

    Recently, Artificial Intelligence (AI) has been used widely in medicine and health care sector. In machine learning, the classification or prediction is a major field of AI. Today, the study of existing predictive models based on machine learning methods is extremely active. Doctors need accurate predictions for the outcomes of their patients' diseases. In addition, for accurate predictions, timing is another significant factor that influences treatment decisions. In this paper, existing predictive models in medicine and health care have critically reviewed. Furthermore, the most famous machine learning methods have explained, and the confusion between a statistical approach and machine learning has clarified. A review of related literature reveals that the predictions of existing predictive models differ even when the same dataset is used. Therefore, existing predictive models are essential, and current methods must be improved.

  4. A Simple and Accurate Model to Predict Responses to Multi-electrode Stimulation in the Retina.

    Science.gov (United States)

    Maturana, Matias I; Apollo, Nicholas V; Hadjinicolaou, Alex E; Garrett, David J; Cloherty, Shaun L; Kameneva, Tatiana; Grayden, David B; Ibbotson, Michael R; Meffin, Hamish

    2016-04-01

    Implantable electrode arrays are widely used in therapeutic stimulation of the nervous system (e.g. cochlear, retinal, and cortical implants). Currently, most neural prostheses use serial stimulation (i.e. one electrode at a time) despite this severely limiting the repertoire of stimuli that can be applied. Methods to reliably predict the outcome of multi-electrode stimulation have not been available. Here, we demonstrate that a linear-nonlinear model accurately predicts neural responses to arbitrary patterns of stimulation using in vitro recordings from single retinal ganglion cells (RGCs) stimulated with a subretinal multi-electrode array. In the model, the stimulus is projected onto a low-dimensional subspace and then undergoes a nonlinear transformation to produce an estimate of spiking probability. The low-dimensional subspace is estimated using principal components analysis, which gives the neuron's electrical receptive field (ERF), i.e. the electrodes to which the neuron is most sensitive. Our model suggests that stimulation proportional to the ERF yields a higher efficacy given a fixed amount of power when compared to equal amplitude stimulation on up to three electrodes. We find that the model captures the responses of all the cells recorded in the study, suggesting that it will generalize to most cell types in the retina. The model is computationally efficient to evaluate and, therefore, appropriate for future real-time applications including stimulation strategies that make use of recorded neural activity to improve the stimulation strategy.

  5. A Simple and Accurate Model to Predict Responses to Multi-electrode Stimulation in the Retina.

    Directory of Open Access Journals (Sweden)

    Matias I Maturana

    2016-04-01

    Full Text Available Implantable electrode arrays are widely used in therapeutic stimulation of the nervous system (e.g. cochlear, retinal, and cortical implants. Currently, most neural prostheses use serial stimulation (i.e. one electrode at a time despite this severely limiting the repertoire of stimuli that can be applied. Methods to reliably predict the outcome of multi-electrode stimulation have not been available. Here, we demonstrate that a linear-nonlinear model accurately predicts neural responses to arbitrary patterns of stimulation using in vitro recordings from single retinal ganglion cells (RGCs stimulated with a subretinal multi-electrode array. In the model, the stimulus is projected onto a low-dimensional subspace and then undergoes a nonlinear transformation to produce an estimate of spiking probability. The low-dimensional subspace is estimated using principal components analysis, which gives the neuron's electrical receptive field (ERF, i.e. the electrodes to which the neuron is most sensitive. Our model suggests that stimulation proportional to the ERF yields a higher efficacy given a fixed amount of power when compared to equal amplitude stimulation on up to three electrodes. We find that the model captures the responses of all the cells recorded in the study, suggesting that it will generalize to most cell types in the retina. The model is computationally efficient to evaluate and, therefore, appropriate for future real-time applications including stimulation strategies that make use of recorded neural activity to improve the stimulation strategy.

  6. Accurate load prediction by BEM with airfoil data from 3D RANS simulations

    Science.gov (United States)

    Schneider, Marc S.; Nitzsche, Jens; Hennings, Holger

    2016-09-01

    In this paper, two methods for the extraction of airfoil coefficients from 3D CFD simulations of a wind turbine rotor are investigated, and these coefficients are used to improve the load prediction of a BEM code. The coefficients are extracted from a number of steady RANS simulations, using either averaging of velocities in annular sections, or an inverse BEM approach for determination of the induction factors in the rotor plane. It is shown that these 3D rotor polars are able to capture the rotational augmentation at the inner part of the blade as well as the load reduction by 3D effects close to the blade tip. They are used as input to a simple BEM code and the results of this BEM with 3D rotor polars are compared to the predictions of BEM with 2D airfoil coefficients plus common empirical corrections for stall delay and tip loss. While BEM with 2D airfoil coefficients produces a very different radial distribution of loads than the RANS simulation, the BEM with 3D rotor polars manages to reproduce the loads from RANS very accurately for a variety of load cases, as long as the blade pitch angle is not too different from the cases from which the polars were extracted.

  7. ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers

    Energy Technology Data Exchange (ETDEWEB)

    Visel, Axel; Blow, Matthew J.; Li, Zirong; Zhang, Tao; Akiyama, Jennifer A.; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Wright, Crystal; Chen, Feng; Afzal, Veena; Ren, Bing; Rubin, Edward M.; Pennacchio, Len A.

    2009-02-01

    A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. We tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.

  8. Accurate First-Principles Spectra Predictions for Planetological and Astrophysical Applications at Various T-Conditions

    Science.gov (United States)

    Rey, M.; Nikitin, A. V.; Tyuterev, V.

    2014-06-01

    Knowledge of near infrared intensities of rovibrational transitions of polyatomic molecules is essential for the modeling of various planetary atmospheres, brown dwarfs and for other astrophysical applications 1,2,3. For example, to analyze exoplanets, atmospheric models have been developed, thus making the need to provide accurate spectroscopic data. Consequently, the spectral characterization of such planetary objects relies on the necessity of having adequate and reliable molecular data in extreme conditions (temperature, optical path length, pressure). On the other hand, in the modeling of astrophysical opacities, millions of lines are generally involved and the line-by-line extraction is clearly not feasible in laboratory measurements. It is thus suggested that this large amount of data could be interpreted only by reliable theoretical predictions. There exists essentially two theoretical approaches for the computation and prediction of spectra. The first one is based on empirically-fitted effective spectroscopic models. Another way for computing energies, line positions and intensities is based on global variational calculations using ab initio surfaces. They do not yet reach the spectroscopic accuracy stricto sensu but implicitly account for all intramolecular interactions including resonance couplings in a wide spectral range. The final aim of this work is to provide reliable predictions which could be quantitatively accurate with respect to the precision of available observations and as complete as possible. All this thus requires extensive first-principles quantum mechanical calculations essentially based on three necessary ingredients which are (i) accurate intramolecular potential energy surface and dipole moment surface components well-defined in a large range of vibrational displacements and (ii) efficient computational methods combined with suitable choices of coordinates to account for molecular symmetry properties and to achieve a good numerical

  9. Accurate and robust genomic prediction of celiac disease using statistical learning.

    Directory of Open Access Journals (Sweden)

    Gad Abraham

    2014-02-01

    Full Text Available Practical application of genomic-based risk stratification to clinical diagnosis is appealing yet performance varies widely depending on the disease and genomic risk score (GRS method. Celiac disease (CD, a common immune-mediated illness, is strongly genetically determined and requires specific HLA haplotypes. HLA testing can exclude diagnosis but has low specificity, providing little information suitable for clinical risk stratification. Using six European cohorts, we provide a proof-of-concept that statistical learning approaches which simultaneously model all SNPs can generate robust and highly accurate predictive models of CD based on genome-wide SNP profiles. The high predictive capacity replicated both in cross-validation within each cohort (AUC of 0.87-0.89 and in independent replication across cohorts (AUC of 0.86-0.9, despite differences in ethnicity. The models explained 30-35% of disease variance and up to ∼43% of heritability. The GRS's utility was assessed in different clinically relevant settings. Comparable to HLA typing, the GRS can be used to identify individuals without CD with ≥99.6% negative predictive value however, unlike HLA typing, fine-scale stratification of individuals into categories of higher-risk for CD can identify those that would benefit from more invasive and costly definitive testing. The GRS is flexible and its performance can be adapted to the clinical situation by adjusting the threshold cut-off. Despite explaining a minority of disease heritability, our findings indicate a genomic risk score provides clinically relevant information to improve upon current diagnostic pathways for CD and support further studies evaluating the clinical utility of this approach in CD and other complex diseases.

  10. Can radiation therapy treatment planning system accurately predict surface doses in postmastectomy radiation therapy patients?

    Science.gov (United States)

    Wong, Sharon; Back, Michael; Tan, Poh Wee; Lee, Khai Mun; Baggarley, Shaun; Lu, Jaide Jay

    2012-01-01

    Skin doses have been an important factor in the dose prescription for breast radiotherapy. Recent advances in radiotherapy treatment techniques, such as intensity-modulated radiation therapy (IMRT) and new treatment schemes such as hypofractionated breast therapy have made the precise determination of the surface dose necessary. Detailed information of the dose at various depths of the skin is also critical in designing new treatment strategies. The purpose of this work was to assess the accuracy of surface dose calculation by a clinically used treatment planning system and those measured by thermoluminescence dosimeters (TLDs) in a customized chest wall phantom. This study involved the construction of a chest wall phantom for skin dose assessment. Seven TLDs were distributed throughout each right chest wall phantom to give adequate representation of measured radiation doses. Point doses from the CMS Xio® treatment planning system (TPS) were calculated for each relevant TLD positions and results correlated. There were no significant difference between measured absorbed dose by TLD and calculated doses by the TPS (p > 0.05 (1-tailed). Dose accuracy of up to 2.21% was found. The deviations from the calculated absorbed doses were overall larger (3.4%) when wedges and bolus were used. 3D radiotherapy TPS is a useful and accurate tool to assess the accuracy of surface dose. Our studies have shown that radiation treatment accuracy expressed as a comparison between calculated doses (by TPS) and measured doses (by TLD dosimetry) can be accurately predicted for tangential treatment of the chest wall after mastectomy. Copyright © 2012 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights reserved.

  11. Accurate prediction of spectral phonon relaxation time and thermal conductivity of intrinsic and perturbed materials

    Science.gov (United States)

    Feng, Tianli

    The prediction of spectral phonon relaxation time, mean-free-path, and thermal conductivity can provide significant insights into the thermal conductivity of bulk and nanomaterials, which are important for thermal management and thermoelectric applications. We perform frequency-domain normal mode analysis (NMA) on pure bulk argon and pure bulk germanium. Spectral phonon properties, including the phonon dispersion, relaxation time, mean free path, and thermal conductivity of argon and germanium at different temperatures have been calculated. We find the dependence of phonon relaxation time tau on frequency o and temperature T vary from ~o-1.3 to ~o -1.8 and ~T-0.8 to ~T-1.8 for argon, and from ~o-0.6 to ~o-2.8 and ~T -0.4 to ~T-2.5 for germanium. The predicted thermal conductivities are in reasonable agreement with those obtained from the Green-Kubo method. We show, using both analytical derivations and numerical simulations, that the eigenvectors are necessary in time-domain NMA but unnecessary in frequency-domain NMA. The function of eigenvectors in frequency-domain NMA is to distinguish each phonon branch. Furthermore, it is found in solids not only the phonon frequency but also the phonon eigenvector can shift from harmonic lattice profile at finite temperature, due to thermal expansion and anharmonicity of interatomic potential. The anharmonicity of phonon eigenvector, different with that of frequency, only exists in the materials which contain at least two types of atoms and two different interatomic forces. Introducing anharmonic eigenvectors makes it easier to distinguish phonon branches in frequency-domain NMA although does not influence the results. For time-domain NMA, anharmonic eigenvectors make the results more accurate than harmonic eigenvectors. In addition, the phonon spectral relaxation time of defective silicon is calculated from frequency-domain NMA based on molecular dynamics. We show that the thermal conductivity k predicted from this approach

  12. Artificial neural networks accurately predict mortality in patients with nonvariceal upper GI bleeding.

    Science.gov (United States)

    Rotondano, Gianluca; Cipolletta, Livio; Grossi, Enzo; Koch, Maurizio; Intraligi, Marco; Buscema, Massimo; Marmo, Riccardo

    2011-02-01

    Risk stratification systems that accurately identify patients with a high risk for bleeding through the use of clinical predictors of mortality before endoscopic examination are needed. Computerized (artificial) neural networks (ANNs) are adaptive tools that may improve prognostication. To assess the capability of an ANN to predict mortality in patients with nonvariceal upper GI bleeding and compare the predictive performance of the ANN with that of the Rockall score. Prospective, multicenter study. Academic and community hospitals. This study involved 2380 patients with nonvariceal upper GI bleeding. Upper GI endoscopy. The primary outcome variable was 30-day mortality, defined as any death occurring within 30 days of the index bleeding episode. Other outcome variables were recurrent bleeding and need for surgery. We performed analysis of certified outcomes of 2380 patients with nonvariceal upper GI bleeding. The Rockall score was compared with a supervised ANN (TWIST system, Semeion), adopting the same result validation protocol with random allocation of the sample in training and testing subsets and subsequent crossover. Overall, death occurred in 112 cases (4.70%). Of 68 pre-endoscopic input variables, 17 were selected and used by the ANN versus 16 included in the Rockall score. The sensitivity of the ANN-based model was 83.8% (76.7-90.8) versus 71.4% (62.8-80.0) for the Rockall score. Specificity was 97.5 (96.8-98.2) and 52.0 (49.8 4.2), respectively. Accuracy was 96.8% (96.0-97.5) versus 52.9% (50.8-55.0) (Pperformance of the ANN-based model for prediction of mortality was significantly superior to that of the complete Rockall score (area under the curve 0.95 [0.92-0.98] vs 0.67 [0.65-0.69]; P<.001). External validation on a subsequent independent population is needed, patients with variceal bleeding and obscure GI hemorrhage are excluded. In patients with nonvariceal upper GI bleeding, ANNs are significantly superior to the Rockall score in predicting the

  13. Predicting accurate fluorescent spectra for high molecular weight polycyclic aromatic hydrocarbons using density functional theory

    Science.gov (United States)

    Powell, Jacob; Heider, Emily C.; Campiglia, Andres; Harper, James K.

    2016-10-01

    The ability of density functional theory (DFT) methods to predict accurate fluorescence spectra for polycyclic aromatic hydrocarbons (PAHs) is explored. Two methods, PBE0 and CAM-B3LYP, are evaluated both in the gas phase and in solution. Spectra for several of the most toxic PAHs are predicted and compared to experiment, including three isomers of C24H14 and a PAH containing heteroatoms. Unusually high-resolution experimental spectra are obtained for comparison by analyzing each PAH at 4.2 K in an n-alkane matrix. All theoretical spectra visually conform to the profiles of the experimental data but are systematically offset by a small amount. Specifically, when solvent is included the PBE0 functional overestimates peaks by 16.1 ± 6.6 nm while CAM-B3LYP underestimates the same transitions by 14.5 ± 7.6 nm. These calculated spectra can be empirically corrected to decrease the uncertainties to 6.5 ± 5.1 and 5.7 ± 5.1 nm for the PBE0 and CAM-B3LYP methods, respectively. A comparison of computed spectra in the gas phase indicates that the inclusion of n-octane shifts peaks by +11 nm on average and this change is roughly equivalent for PBE0 and CAM-B3LYP. An automated approach for comparing spectra is also described that minimizes residuals between a given theoretical spectrum and all available experimental spectra. This approach identifies the correct spectrum in all cases and excludes approximately 80% of the incorrect spectra, demonstrating that an automated search of theoretical libraries of spectra may eventually become feasible.

  14. Accurate secondary structure prediction and fold recognition for circular dichroism spectroscopy.

    Science.gov (United States)

    Micsonai, András; Wien, Frank; Kernya, Linda; Lee, Young-Ho; Goto, Yuji; Réfrégiers, Matthieu; Kardos, József

    2015-06-16

    Circular dichroism (CD) spectroscopy is a widely used technique for the study of protein structure. Numerous algorithms have been developed for the estimation of the secondary structure composition from the CD spectra. These methods often fail to provide acceptable results on α/β-mixed or β-structure-rich proteins. The problem arises from the spectral diversity of β-structures, which has hitherto been considered as an intrinsic limitation of the technique. The predictions are less reliable for proteins of unusual β-structures such as membrane proteins, protein aggregates, and amyloid fibrils. Here, we show that the parallel/antiparallel orientation and the twisting of the β-sheets account for the observed spectral diversity. We have developed a method called β-structure selection (BeStSel) for the secondary structure estimation that takes into account the twist of β-structures. This method can reliably distinguish parallel and antiparallel β-sheets and accurately estimates the secondary structure for a broad range of proteins. Moreover, the secondary structure components applied by the method are characteristic to the protein fold, and thus the fold can be predicted to the level of topology in the CATH classification from a single CD spectrum. By constructing a web server, we offer a general tool for a quick and reliable structure analysis using conventional CD or synchrotron radiation CD (SRCD) spectroscopy for the protein science research community. The method is especially useful when X-ray or NMR techniques fail. Using BeStSel on data collected by SRCD spectroscopy, we investigated the structure of amyloid fibrils of various disease-related proteins and peptides.

  15. The presence of prostate cancer on saturation biopsy can be accurately predicted.

    Science.gov (United States)

    Ahyai, Sascha A; Isbarn, Hendrik; Karakiewicz, Pierre I; Chun, Felix K H; Reichert, Mathias; Walz, Jochen; Steuber, Thomas; Jeldres, Claudio; Schlomm, Thorsten; Heinzer, Hans; Salomon, Georg; Budäus, Lars; Perrotte, Paul; Huland, Hartwig; Graefen, Markus; Haese, Alexander

    2010-03-01

    To improve the ability of our previously reported saturation biopsy nomogram quantifying the risk of prostate cancer, as the use of office-based saturation biopsy has increased. Saturation biopsies of 540 men with one or more previously negative 6-12 core biopsies were used to develop a multivariable logistic regression model-based nomogram, predicting the probability of prostate cancer. Candidate predictors were used in their original or stratified format, and consisted of age, total prostate-specific antigen (PSA) level, percentage free PSA (%fPSA), gland volume, findings on a digital rectal examination, cumulative number of previous biopsy sessions, presence of high-grade prostatic intraepithelial neoplasia on any previous biopsy, and presence of atypical small acinar proliferation (ASAP) on any previous biopsy. Two hundred bootstraps re-samples were used to adjust for overfit bias. Prostate cancer was diagnosed in 39.4% of saturation biopsies. Age, total PSA, %fPSA, gland volume, number of previous biopsies, and presence of ASAP at any previous biopsy were independent predictors for prostate cancer (all P < 0.05). The nomogram was 77.2% accurate and had a virtually perfect correlation between predicted and observed rates of prostate cancer. We improved the accuracy of the saturation biopsy nomogram from 72% to 77%; it relies on three previously included variables, i.e. age, %fPSA and prostate volume, and on three previously excluded variables, i.e. PSA, the number of previous biopsy sessions, and evidence of ASAP on previous biopsy. Our study represents the largest series of saturation biopsies to date.

  16. ROCK I Has More Accurate Prognostic Value than MET in Predicting Patient Survival in Colorectal Cancer.

    Science.gov (United States)

    Li, Jian; Bharadwaj, Shruthi S; Guzman, Grace; Vishnubhotla, Ramana; Glover, Sarah C

    2015-06-01

    Colorectal cancer remains the second leading cause of death in the United States despite improvements in incidence rates and advancements in screening. The present study evaluated the prognostic value of two tumor markers, MET and ROCK I, which have been noted in other cancers to provide more accurate prognoses of patient outcomes than tumor staging alone. We constructed a tissue microarray from surgical specimens of adenocarcinomas from 108 colorectal cancer patients. Using immunohistochemistry, we examined the expression levels of tumor markers MET and ROCK I, with a pathologist blinded to patient identities and clinical outcomes providing the scoring of MET and ROCK I expression. We then used retrospective analysis of patients' survival data to provide correlations with expression levels of MET and ROCK I. Both MET and ROCK I were significantly over-expressed in colorectal cancer tissues, relative to the unaffected adjacent mucosa. Kaplan-Meier survival analysis revealed that patients' 5-year survival was inversely correlated with levels of expression of ROCK I. In contrast, MET was less strongly correlated with five-year survival. ROCK I provides better efficacy in predicting patient outcomes, compared to either tumor staging or MET expression. As a result, ROCK I may provide a less invasive method of assessing patient prognoses and directing therapeutic interventions. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Cluster abundance in chameleon f(R) gravity I: toward an accurate halo mass function prediction

    Science.gov (United States)

    Cataneo, Matteo; Rapetti, David; Lombriser, Lucas; Li, Baojiu

    2016-12-01

    We refine the mass and environment dependent spherical collapse model of chameleon f(R) gravity by calibrating a phenomenological correction inspired by the parameterized post-Friedmann framework against high-resolution N-body simulations. We employ our method to predict the corresponding modified halo mass function, and provide fitting formulas to calculate the enhancement of the f(R) halo abundance with respect to that of General Relativity (GR) within a precision of lesssim 5% from the results obtained in the simulations. Similar accuracy can be achieved for the full f(R) mass function on the condition that the modeling of the reference GR abundance of halos is accurate at the percent level. We use our fits to forecast constraints on the additional scalar degree of freedom of the theory, finding that upper bounds competitive with current Solar System tests are within reach of cluster number count analyses from ongoing and upcoming surveys at much larger scales. Importantly, the flexibility of our method allows also for this to be applied to other scalar-tensor theories characterized by a mass and environment dependent spherical collapse.

  18. Accurate prediction of DnaK-peptide binding via homology modelling and experimental data.

    Directory of Open Access Journals (Sweden)

    Joost Van Durme

    2009-08-01

    Full Text Available Molecular chaperones are essential elements of the protein quality control machinery that governs translocation and folding of nascent polypeptides, refolding and degradation of misfolded proteins, and activation of a wide range of client proteins. The prokaryotic heat-shock protein DnaK is the E. coli representative of the ubiquitous Hsp70 family, which specializes in the binding of exposed hydrophobic regions in unfolded polypeptides. Accurate prediction of DnaK binding sites in E. coli proteins is an essential prerequisite to understand the precise function of this chaperone and the properties of its substrate proteins. In order to map DnaK binding sites in protein sequences, we have developed an algorithm that combines sequence information from peptide binding experiments and structural parameters from homology modelling. We show that this combination significantly outperforms either single approach. The final predictor had a Matthews correlation coefficient (MCC of 0.819 when assessed over the 144 tested peptide sequences to detect true positives and true negatives. To test the robustness of the learning set, we have conducted a simulated cross-validation, where we omit sequences from the learning sets and calculate the rate of repredicting them. This resulted in a surprisingly good MCC of 0.703. The algorithm was also able to perform equally well on a blind test set of binders and non-binders, of which there was no prior knowledge in the learning sets. The algorithm is freely available at http://limbo.vib.be.

  19. Fast and Accurate Prediction of Numerical Relativity Waveforms from Binary Black Hole Coalescences Using Surrogate Models.

    Science.gov (United States)

    Blackman, Jonathan; Field, Scott E; Galley, Chad R; Szilágyi, Béla; Scheel, Mark A; Tiglio, Manuel; Hemberger, Daniel A

    2015-09-18

    Simulating a binary black hole coalescence by solving Einstein's equations is computationally expensive, requiring days to months of supercomputing time. Using reduced order modeling techniques, we construct an accurate surrogate model, which is evaluated in a millisecond to a second, for numerical relativity (NR) waveforms from nonspinning binary black hole coalescences with mass ratios in [1, 10] and durations corresponding to about 15 orbits before merger. We assess the model's uncertainty and show that our modeling strategy predicts NR waveforms not used for the surrogate's training with errors nearly as small as the numerical error of the NR code. Our model includes all spherical-harmonic _{-2}Y_{ℓm} waveform modes resolved by the NR code up to ℓ=8. We compare our surrogate model to effective one body waveforms from 50M_{⊙} to 300M_{⊙} for advanced LIGO detectors and find that the surrogate is always more faithful (by at least an order of magnitude in most cases).

  20. Accurate prediction of pregnancy viability by means of a simple scoring system.

    Science.gov (United States)

    Bottomley, Cecilia; Van Belle, Vanya; Kirk, Emma; Van Huffel, Sabine; Timmerman, Dirk; Bourne, Tom

    2013-01-01

    What is the performance of a simple scoring system to predict whether women will have an ongoing viable intrauterine pregnancy beyond the first trimester? A simple scoring system using demographic and initial ultrasound variables accurately predicts pregnancy viability beyond the first trimester with an area under the curve (AUC) in a receiver operating characteristic curve of 0.924 [95% confidence interval (CI) 0.900-0.947] on an independent test set. Individual demographic and ultrasound factors, such as maternal age, vaginal bleeding and gestational sac size, are strong predictors of miscarriage. Previous mathematical models have combined individual risk factors with reasonable performance. A simple scoring system derived from a mathematical model that can be easily implemented in clinical practice has not previously been described for the prediction of ongoing viability. This was a prospective observational study in a single early pregnancy assessment centre during a 9-month period. A cohort of 1881 consecutive women undergoing transvaginal ultrasound scan at a gestational age system was derived from this. This scoring system was tested on an independent test data set. The final outcome based on a total of 1435 participants was an ongoing viable pregnancy in 885 (61.7%) and early pregnancy loss in 550 (38.3%) women. The scoring system using significant demographic variables alone (maternal age and amount of bleeding) to predict ongoing viability gave an AUC of 0.724 (95% CI = 0.692-0.756) in the training set and 0.729 (95% CI = 0.684-0.774) in the test set. The scoring system using significant ultrasound variables alone (mean gestation sac diameter, mean yolk sac diameter and the presence of fetal heart beat) gave an AUC of 0.873 (95% CI = 0.850-0.897) and 0.900 (95% CI = 0.871-0.928) in the training and the test sets, respectively. The final scoring system using demographic and ultrasound variables together gave an AUC of 0.901 (95% CI = 0.881-0.920) and 0

  1. Unilateral prostate cancer cannot be accurately predicted in low-risk patients.

    Science.gov (United States)

    Isbarn, Hendrik; Karakiewicz, Pierre I; Vogel, Susanne; Jeldres, Claudio; Lughezzani, Giovanni; Briganti, Alberto; Montorsi, Francesco; Perrotte, Paul; Ahyai, Sascha A; Budäus, Lars; Eichelberg, Christian; Heuer, Roman; Köllermann, Jens; Sauter, Guido; Schlomm, Thorsten; Steuber, Thomas; Haese, Alexander; Zacharias, Mario; Fisch, Margit; Heinzer, Hans; Huland, Hartwig; Chun, Felix K H; Graefen, Markus

    2010-07-01

    Hemiablative therapy (HAT) is increasing in popularity for treatment of patients with low-risk prostate cancer (PCa). The validity of this therapeutic modality, which exclusively treats PCa within a single prostate lobe, rests on accurate staging. We tested the accuracy of unilaterally unremarkable biopsy findings in cases of low-risk PCa patients who are potential candidates for HAT. The study population consisted of 243 men with clinical stage predict the presence of unilateral PCa. This was reflected in an overall accuracy of 58% (95% confidence interval, 50.6-65.8%). Two-thirds of patients with unilateral low-risk PCa, confirmed by clinical stage and biopsy findings, have bilateral or non-organ-confined PCa at radical prostatectomy. This alarming finding questions the safety and validity of HAT. (c) 2010 Elsevier Inc. All rights reserved.

  2. Raoult's law revisited: accurately predicting equilibrium relative humidity points for humidity control experiments.

    Science.gov (United States)

    Bowler, Michael G; Bowler, David R; Bowler, Matthew W

    2017-04-01

    The humidity surrounding a sample is an important variable in scientific experiments. Biological samples in particular require not just a humid atmosphere but often a relative humidity (RH) that is in equilibrium with a stabilizing solution required to maintain the sample in the same state during measurements. The controlled dehydration of macromolecular crystals can lead to significant increases in crystal order, leading to higher diffraction quality. Devices that can accurately control the humidity surrounding crystals while monitoring diffraction have led to this technique being increasingly adopted, as the experiments become easier and more reproducible. Matching the RH to the mother liquor is the first step in allowing the stable mounting of a crystal. In previous work [Wheeler, Russi, Bowler & Bowler (2012). Acta Cryst. F68, 111-114], the equilibrium RHs were measured for a range of concentrations of the most commonly used precipitants in macromolecular crystallography and it was shown how these related to Raoult's law for the equilibrium vapour pressure of water above a solution. However, a discrepancy between the measured values and those predicted by theory could not be explained. Here, a more precise humidity control device has been used to determine equilibrium RH points. The new results are in agreement with Raoult's law. A simple argument in statistical mechanics is also presented, demonstrating that the equilibrium vapour pressure of a solvent is proportional to its mole fraction in an ideal solution: Raoult's law. The same argument can be extended to the case where the solvent and solute molecules are of different sizes, as is the case with polymers. The results provide a framework for the correct maintenance of the RH surrounding a sample.

  3. The cyanase operon and cyanate metabolism.

    Science.gov (United States)

    Anderson, P M; Sung, Y C; Fuchs, J A

    1990-12-01

    Cyanase is an inducible enzyme in E. coli that catalyzes bicarbonate-dependent decomposition of cyanate. It is encoded as part of an operon we have named the cyn operon, which includes three genes in the following order: cynT (cyanate permease), cynS (cyanase), and cynX (protein of unknown function). The direction of transcription is opposite to that of the lac operon, and the 3'-end of the cyn operon overlaps the 3'-end of the lac operon by 98 nucleotides. The gene cynR (regulatory protein) is located upstream from the cyn operon, and its transcription is opposite that of the cyn operon. The genes of the cyn operon and the cynR gene have been cloned, sequenced and over-expressed. Cyanate at concentrations of about 1 mM is toxic to strains of E. coli lacking the cyanase gene, but strains in which the inducible gene for cyanase is present can grow on cyanate as the sole source of nitrogen at concentrations as high as 20 mM. The presence of cyanase itself is not sufficient to overcome cyanate toxicity--the permease must also be present. Strains lacking the cyanase gene, but having a functional permease gene, are extremely sensitive to cyanate. Uptake of cyanate involves the product of the permease gene in an energy-dependent process. It appears that the cyn operon has evolved to function in detoxification/decomposition of cyanate arising from both intra- and extracellular sources.

  4. Functional Operons in Secondary Metabolic Gene Clusters in Glarea lozoyensis (Fungi, Ascomycota, Leotiomycetes).

    Science.gov (United States)

    Yue, Qun; Chen, Li; Li, Yan; Bills, Gerald F; Zhang, Xinyu; Xiang, Meichun; Li, Shaojie; Che, Yongsheng; Wang, Chengshu; Niu, Xuemei; An, Zhiqiang; Liu, Xingzhong

    2015-06-16

    Operons are multigene transcriptional units which occur mostly in prokaryotes but rarely in eukaryotes. Protein-coding operons have not been reported in the Fungi even though they represent a very diverse kingdom of organisms. Here, we report a functional operon involved in the secondary metabolism of the fungus Glarea lozoyensis belonging to Leotiomycetes (Ascomycota). Two contiguous genes, glpks3 and glnrps7, encoding polyketide synthase and nonribosomal peptide synthetase, respectively, are cotranscribed into one dicistronic mRNA under the control of the same promoter, and the mRNA is then translated into two individual proteins, GLPKS3 and GLNRPS7. Heterologous expression in Aspergillus nidulans shows that the GLPKS3-GLNRPS7 enzyme complex catalyzes the biosynthesis of a novel pyrrolidinedione-containing compound, xenolozoyenone (compound 1), which indicates the operon is functional. Although it is structurally similar to prokaryotic operons, the glpks3-glnrps7 operon locus has a monophylogenic origin from fungi rather than having been horizontally transferred from prokaryotes. Moreover, two additional operons, glpks28-glnrps8 and glpks29-glnrps9, were verified at the transcriptional level in the same fungus. This is the first report of protein-coding operons in a member of the Fungi. Operons are multigene transcriptional units which occur mostly in prokaryotes but rarely in eukaryotes. Three operon-like gene structures for secondary metabolism that were discovered in the filamentous fungus Glarea lozoyensis are the first examples of protein-coding operons identified in a member of the Fungi. Among them, the glpks3-glnrps7 operon is responsible for the biosynthesis of xenolozoyenone, which is a novel tetramic acid-containing compound. Although structurally similar to prokaryotic operons, the glpks3-glnrps7 operon locus did not result from horizontal gene transfer from prokaryotes. In addition, operonlike structures have been predicted in silico to be common in

  5. A new somatic cell count index to more accurately predict milk yield losses

    Directory of Open Access Journals (Sweden)

    J. Jeretina

    2017-10-01

    Full Text Available Intramammary infection and clinical mastitis in dairy cows leads to considerable economic losses for farmers. The somatic cell concentration in cow's milk has been shown to be an excellent indicator for the prevalence of subclinical mastitis. In this study, a new somatic cell count index (SCCI was proposed for the accurate prediction of milk yield losses caused by elevated somatic cell count (SCC. In all, 97 238 lactations (55 207 Holstein cows from 2328 herds were recorded between 2010 and 2014 under different scenarios (high and low levels of SCC, four lactation stages, different milk yield intensities, and parities (1, 2, and  ≥  3. The standard shape of the curve for SCC was determined using completed standard lactations of healthy cows. The SCCI was defined as the sum of the differences between the measured interpolated values of the natural logarithm of SCC (ln(SCC and the values for the standard shape of the curve for SCC for a particular period, divided by the total area enclosed by the standard curve and upper limit of ln(SCC  =  10 for SCC. The phenotypic potential of milk yield (305-day milk yield – MY305 was calculated using regression coefficients estimated from the linear regression model for parity and breeding values of cows for milk yield. The extent of daily milk yield loss caused by increased SCC was found to be mainly related to the early stage of lactation. Depending on the possible scenarios, the estimated milk yield loss from MY305 for primiparous cows was at least 0.8 to 0.9 kg day−1 and for multiparous cows it ranged from 1.3 to 4.3 kg day−1. Thus, the SCCI was a suitable indicator for estimating daily milk yield losses associated with increased SCC and might provide farmers reliable information to take appropriate measures for ensuring good health of cows and reducing milk yield losses at the herd level.

  6. Towards Accurate Prediction of Unbalance Response, Oil Whirl and Oil Whip of Flexible Rotors Supported by Hydrodynamic Bearings

    Directory of Open Access Journals (Sweden)

    Rob Eling

    2016-09-01

    Full Text Available Journal bearings are used to support rotors in a wide range of applications. In order to ensure reliable operation, accurate analyses of these rotor-bearing systems are crucial. Coupled analysis of the rotor and the journal bearing is essential in the case that the rotor is flexible. The accuracy of prediction of the model at hand depends on its comprehensiveness. In this study, we construct three bearing models of increasing modeling comprehensiveness and use these to predict the response of two different rotor-bearing systems. The main goal is to evaluate the correlation with measurement data as a function of modeling comprehensiveness: 1D versus 2D pressure prediction, distributed versus lumped thermal model, Newtonian versus non-Newtonian fluid description and non-mass-conservative versus mass-conservative cavitation description. We conclude that all three models predict the existence of critical speeds and whirl for both rotor-bearing systems. However, the two more comprehensive models in general show better correlation with measurement data in terms of frequency and amplitude. Furthermore, we conclude that a thermal network model comprising temperature predictions of the bearing surroundings is essential to obtain accurate predictions. The results of this study aid in developing accurate and computationally-efficient models of flexible rotors supported by plain journal bearings.

  7. Paley's multiplier method does not accurately predict adult height in children with bone sarcoma

    National Research Council Canada - National Science Library

    Gilg, Magdalena Maria; Wibmer, Christine; Andreou, Dimosthenis; Avian, Alexander; Sovinz, Petra; Maurer-Ertl, Werner; Tunn, Per-Ulf; Leithner, Andreas

    2014-01-01

    .... Paley's multiplier is used for height prediction in healthy children, and has been suggested as a method to make growth predictions for children with osteosarcoma and Ewing's sarcoma when considering...

  8. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2017-07-01

    Full Text Available Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  9. Interplay of gene expression noise and ultrasensitive dynamics affects bacterial operon organization.

    Science.gov (United States)

    Ray, J Christian J; Igoshin, Oleg A

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes.

  10. Interplay of gene expression noise and ultrasensitive dynamics affects bacterial operon organization.

    Directory of Open Access Journals (Sweden)

    J Christian J Ray

    Full Text Available Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes.

  11. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  12. Towards more accurate wind and solar power prediction by improving NWP model physics

    Science.gov (United States)

    Steiner, Andrea; Köhler, Carmen; von Schumann, Jonas; Ritter, Bodo

    2014-05-01

    The growing importance and successive expansion of renewable energies raise new challenges for decision makers, economists, transmission system operators, scientists and many more. In this interdisciplinary field, the role of Numerical Weather Prediction (NWP) is to reduce the errors and provide an a priori estimate of remaining uncertainties associated with the large share of weather-dependent power sources. For this purpose it is essential to optimize NWP model forecasts with respect to those prognostic variables which are relevant for wind and solar power plants. An improved weather forecast serves as the basis for a sophisticated power forecasts. Consequently, a well-timed energy trading on the stock market, and electrical grid stability can be maintained. The German Weather Service (DWD) currently is involved with two projects concerning research in the field of renewable energy, namely ORKA*) and EWeLiNE**). Whereas the latter is in collaboration with the Fraunhofer Institute (IWES), the project ORKA is led by energy & meteo systems (emsys). Both cooperate with German transmission system operators. The goal of the projects is to improve wind and photovoltaic (PV) power forecasts by combining optimized NWP and enhanced power forecast models. In this context, the German Weather Service aims to improve its model system, including the ensemble forecasting system, by working on data assimilation, model physics and statistical post processing. This presentation is focused on the identification of critical weather situations and the associated errors in the German regional NWP model COSMO-DE. First steps leading to improved physical parameterization schemes within the NWP-model are presented. Wind mast measurements reaching up to 200 m height above ground are used for the estimation of the (NWP) wind forecast error at heights relevant for wind energy plants. One particular problem is the daily cycle in wind speed. The transition from stable stratification during

  13. Accurate wavelength prediction of photonic crystal resonant reflection and applications in refractive index measurement

    DEFF Research Database (Denmark)

    Hermannsson, Pétur Gordon; Vannahme, Christoph; Smith, Cameron L. C.

    2014-01-01

    In the past decade, photonic crystal resonant reflectors have been increasingly used as the basis for label-free biochemical assays in lab-on-a-chip applications. In both designing and interpreting experimental results, an accurate model describing the optical behavior of such structures is essen...

  14. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  15. LOCUSTRA: accurate prediction of local protein structure using a two-layer support vector machine approach.

    Science.gov (United States)

    Zimmermann, Olav; Hansmann, Ulrich H E

    2008-09-01

    Constraint generation for 3d structure prediction and structure-based database searches benefit from fine-grained prediction of local structure. In this work, we present LOCUSTRA, a novel scheme for the multiclass prediction of local structure that uses two layers of support vector machines (SVM). Using a 16-letter structural alphabet from de Brevern et al. (Proteins: Struct., Funct., Bioinf. 2000, 41, 271-287), we assess its prediction ability for an independent test set of 222 proteins and compare our method to three-class secondary structure prediction and direct prediction of dihedral angles. The prediction accuracy is Q16=61.0% for the 16 classes of the structural alphabet and Q3=79.2% for a simple mapping to the three secondary classes helix, sheet, and coil. We achieve a mean phi(psi) error of 24.74 degrees (38.35 degrees) and a median RMSDA (root-mean-square deviation of the (dihedral) angles) per protein chain of 52.1 degrees. These results compare favorably with related approaches. The LOCUSTRA web server is freely available to researchers at http://www.fz-juelich.de/nic/cbb/service/service.php.

  16. An accurate and efficient method to predict the electronic excitation energies of BODIPY fluorescent dyes.

    Science.gov (United States)

    Wang, Jia-Nan; Jin, Jun-Ling; Geng, Yun; Sun, Shi-Ling; Xu, Hong-Liang; Lu, Ying-Hua; Su, Zhong-Min

    2013-03-15

    Recently, the extreme learning machine neural network (ELMNN) as a valid computing method has been proposed to predict the nonlinear optical property successfully (Wang et al., J. Comput. Chem. 2012, 33, 231). In this work, first, we follow this line of work to predict the electronic excitation energies using the ELMNN method. Significantly, the root mean square deviation of the predicted electronic excitation energies of 90 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) derivatives between the predicted and experimental values has been reduced to 0.13 eV. Second, four groups of molecule descriptors are considered when building the computing models. The results show that the quantum chemical descriptions have the closest intrinsic relation with the electronic excitation energy values. Finally, a user-friendly web server (EEEBPre: Prediction of electronic excitation energies for BODIPY dyes), which is freely accessible to public at the web site: http://202.198.129.218, has been built for prediction. This web server can return the predicted electronic excitation energy values of BODIPY dyes that are high consistent with the experimental values. We hope that this web server would be helpful to theoretical and experimental chemists in related research. Copyright © 2012 Wiley Periodicals, Inc.

  17. Accurate predictions of iron redox state in silicate glasses: A multivariate approach using X-ray absorption spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dyar, M. Darby; McCanta, Molly; Breves, Elly; Carey, C. J.; Lanzirotti, Antonio

    2016-03-01

    Pre-edge features in the K absorption edge of X-ray absorption spectra are commonly used to predict Fe3+ valence state in silicate glasses. However, this study shows that using the entire spectral region from the pre-edge into the extended X-ray absorption fine-structure region provides more accurate results when combined with multivariate analysis techniques. The least absolute shrinkage and selection operator (lasso) regression technique yields %Fe3+ values that are accurate to ±3.6% absolute when the full spectral region is employed. This method can be used across a broad range of glass compositions, is easily automated, and is demonstrated to yield accurate results from different synchrotrons. It will enable future studies involving X-ray mapping of redox gradients on standard thin sections at 1 × 1 μm pixel sizes.

  18. Accurate predictions of iron redox state in silicate glasses: A multivariate approach using X-ray absorption spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dyar, M. Darby; McCanta, Molly; Breves, Elly; Carey, C. J.; Lanzirotti, Antonio

    2016-03-01

    Pre-edge features in the K absorption edge of X-ray absorption spectra are commonly used to predict Fe3+ valence state in silicate glasses. However, this study shows that using the entire spectral region from the pre-edge into the extended X-ray absorption fine-structure region provides more accurate results when combined with multivariate analysis techniques. The least absolute shrinkage and selection operator (lasso) regression technique yields %Fe3+ values that are accurate to ±3.6% absolute when the full spectral region is employed. This method can be used across a broad range of glass compositions, is easily automated, and is demonstrated to yield accurate results from different synchrotrons. It will enable future studies involving X-ray mapping of redox gradients on standard thin sections at 1 × 1 μm pixel sizes.

  19. Accurate microRNA target prediction correlates with protein repression levels

    Directory of Open Access Journals (Sweden)

    Simossis Victor A

    2009-09-01

    Full Text Available Abstract Background MicroRNAs are small endogenously expressed non-coding RNA molecules that regulate target gene expression through translation repression or messenger RNA degradation. MicroRNA regulation is performed through pairing of the microRNA to sites in the messenger RNA of protein coding genes. Since experimental identification of miRNA target genes poses difficulties, computational microRNA target prediction is one of the key means in deciphering the role of microRNAs in development and disease. Results DIANA-microT 3.0 is an algorithm for microRNA target prediction which is based on several parameters calculated individually for each microRNA and combines conserved and non-conserved microRNA recognition elements into a final prediction score, which correlates with protein production fold change. Specifically, for each predicted interaction the program reports a signal to noise ratio and a precision score which can be used as an indication of the false positive rate of the prediction. Conclusion Recently, several computational target prediction programs were benchmarked based on a set of microRNA target genes identified by the pSILAC method. In this assessment DIANA-microT 3.0 was found to achieve the highest precision among the most widely used microRNA target prediction programs reaching approximately 66%. The DIANA-microT 3.0 prediction results are available online in a user friendly web server at http://www.microrna.gr/microT

  20. Sensor Data Fusion for Accurate Cloud Presence Prediction Using Dempster-Shafer Evidence Theory

    Directory of Open Access Journals (Sweden)

    Jesse S. Jin

    2010-10-01

    Full Text Available Sensor data fusion technology can be used to best extract useful information from multiple sensor observations. It has been widely applied in various applications such as target tracking, surveillance, robot navigation, signal and image processing. This paper introduces a novel data fusion approach in a multiple radiation sensor environment using Dempster-Shafer evidence theory. The methodology is used to predict cloud presence based on the inputs of radiation sensors. Different radiation data have been used for the cloud prediction. The potential application areas of the algorithm include renewable power for virtual power station where the prediction of cloud presence is the most challenging issue for its photovoltaic output. The algorithm is validated by comparing the predicted cloud presence with the corresponding sunshine occurrence data that were recorded as the benchmark. Our experiments have indicated that comparing to the approaches using individual sensors, the proposed data fusion approach can increase correct rate of cloud prediction by ten percent, and decrease unknown rate of cloud prediction by twenty three percent.

  1. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  2. How accurate and statistically robust are catalytic site predictions based on closeness centrality?

    Directory of Open Access Journals (Sweden)

    Livesay Dennis R

    2007-05-01

    Full Text Available Abstract Background We examine the accuracy of enzyme catalytic residue predictions from a network representation of protein structure. In this model, amino acid α-carbons specify vertices within a graph and edges connect vertices that are proximal in structure. Closeness centrality, which has shown promise in previous investigations, is used to identify important positions within the network. Closeness centrality, a global measure of network centrality, is calculated as the reciprocal of the average distance between vertex i and all other vertices. Results We benchmark the approach against 283 structurally unique proteins within the Catalytic Site Atlas. Our results, which are inline with previous investigations of smaller datasets, indicate closeness centrality predictions are statistically significant. However, unlike previous approaches, we specifically focus on residues with the very best scores. Over the top five closeness centrality scores, we observe an average true to false positive rate ratio of 6.8 to 1. As demonstrated previously, adding a solvent accessibility filter significantly improves predictive power; the average ratio is increased to 15.3 to 1. We also demonstrate (for the first time that filtering the predictions by residue identity improves the results even more than accessibility filtering. Here, we simply eliminate residues with physiochemical properties unlikely to be compatible with catalytic requirements from consideration. Residue identity filtering improves the average true to false positive rate ratio to 26.3 to 1. Combining the two filters together has little affect on the results. Calculated p-values for the three prediction schemes range from 2.7E-9 to less than 8.8E-134. Finally, the sensitivity of the predictions to structure choice and slight perturbations is examined. Conclusion Our results resolutely confirm that closeness centrality is a viable prediction scheme whose predictions are statistically

  3. Towards more accurate prediction of ubiquitination sites: a comprehensive review of current methods, tools and features.

    Science.gov (United States)

    Chen, Zhen; Zhou, Yuan; Zhang, Ziding; Song, Jiangning

    2015-07-01

    Protein ubiquitination is one of the most important reversible post-translational modifications (PTMs). In many biochemical, pathological and pharmaceutical studies on understanding the function of proteins in biological processes, identification of ubiquitination sites is an important first step. However, experimental approaches for identifying ubiquitination sites are often expensive, labor-intensive and time-consuming, partly due to the dynamics and reversibility of ubiquitination. In silico prediction of ubiquitination sites is potentially a useful strategy for whole proteome annotation. A number of bioinformatics approaches and tools have recently been developed for predicting protein ubiquitination sites. However, these tools have different methodologies, prediction algorithms, functionality and features, which complicate their utility and application. The purpose of this review is to aid users in selecting appropriate tools for specific analyses and circumstances. We first compared five popular webservers and standalone software options, assessing their performance on four up-to-date ubiquitination benchmark datasets from Saccharomyces cerevisiae, Homo sapiens, Mus musculus and Arabidopsis thaliana. We then discussed and summarized these tools to guide users in choosing among the tools efficiently and rapidly. Finally, we assessed the importance of features of existing tools for ubiquitination site prediction, ranking them by performance. We also discussed the features that make noticeable contributions to species-specific ubiquitination site prediction. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  4. DOOR 2.0: presenting operons and their functions through dynamic and integrated views.

    Science.gov (United States)

    Mao, Xizeng; Ma, Qin; Zhou, Chuan; Chen, Xin; Zhang, Hanyuan; Yang, Jincai; Mao, Fenglou; Lai, Wei; Xu, Ying

    2014-01-01

    We have recently developed a new version of the DOOR operon database, DOOR 2.0, which is available online at http://csbl.bmb.uga.edu/DOOR/ and will be updated on a regular basis. DOOR 2.0 contains genome-scale operons for 2072 prokaryotes with complete genomes, three times the number of genomes covered in the previous version published in 2009. DOOR 2.0 has a number of new features, compared with its previous version, including (i) more than 250,000 transcription units, experimentally validated or computationally predicted based on RNA-seq data, providing a dynamic functional view of the underlying operons; (ii) an integrated operon-centric data resource that provides not only operons for each covered genome but also their functional and regulatory information such as their cis-regulatory binding sites for transcription initiation and termination, gene expression levels estimated based on RNA-seq data and conservation information across multiple genomes; (iii) a high-performance web service for online operon prediction on user-provided genomic sequences; (iv) an intuitive genome browser to support visualization of user-selected data; and (v) a keyword-based Google-like search engine for finding the needed information intuitively and rapidly in this database.

  5. Nurses and physicians in a medical admission unit can accurately predict mortality of acutely admitted patients

    DEFF Research Database (Denmark)

    Brabrand, Mikkel; Hallas, Jesper; Knudsen, Torben

    2014-01-01

    BACKGROUND: There exist several risk stratification systems for predicting mortality of emergency patients. However, some are complex in clinical use and others have been developed using suboptimal methodology. The objective was to evaluate the capability of the staff at a medical admission unit......-hospital mortality upon the patients' arrival. We calculated discriminatory power as the area under the receiver-operating-characteristic curve (AUROC) and accuracy of prediction (calibration) by Hosmer-Lemeshow goodness-of-fit test. RESULTS: We had a total of 2,848 admissions (2,463 patients). 89 (3.1%) died while......: Using only clinical intuition, staff in a medical admission unit has a good ability to identify patients at increased risk of dying while admitted. When nursing staff and physicians agreed on their prediction, discriminatory power and calibration were excellent....

  6. A random protein-creatinine ratio accurately predicts baseline proteinuria in early pregnancy.

    Science.gov (United States)

    Hirshberg, Adi; Draper, Jennifer; Curley, Cara; Sammel, Mary D; Schwartz, Nadav

    2014-12-01

    Data surrounding the use of a random urine protein:creatinine ratio (PCR) in the diagnosis of preeclampsia is conflicting. We sought to determine whether PCR in early pregnancy can replace the 24-hour urine collection as the primary screening test in patients at risk for baseline proteinuria. Women requiring a baseline evaluation for proteinuria supplied a urine sample the morning after their 24-hour collection. The PCR was analyzed as a predictor of significant proteinuria (≥150 mg). A regression equation to estimate the 24-hour protein value from the PCR was then developed. Sixty of 135 subjects enrolled completed the study. The median 24-hour urine protein and PCR were 90 mg (IQR: 50-145) and 0.063 (IQR: 0.039-0.083), respectively. Fifteen patients (25%) had significant proteinuria. PCR was strongly correlated with the 24-hour protein value (r = 0.99, p protein = 46.5 + 904.2*PCR] accurately estimates the actual 24-hour protein (95% CI: ±88 mg). A random urine PCR accurately estimates the 24-hour protein excretion in the first half of pregnancy and can be used as the primary screening test for baseline proteinuria in at-risk patients.

  7. Evolutionary dynamics of nematode operons: easy come, slow go.

    Science.gov (United States)

    Qian, Wenfeng; Zhang, Jianzhi

    2008-03-01

    Operons are widespread in prokaryotes, but are uncommon in eukaryotes, except nematode worms, where approximately 15% of genes reside in over 1100 operons in the model organism Caenorhabditis elegans. It is unclear how operons have become abundant in nematode genomes. The "one-way street" hypothesis asserts that once formed by chance, operons are very difficult to break, because the breakage would leave downstream genes in an operon without a promoter, and hence, unexpressed. To test this hypothesis, we analyzed the presence and absence of C. elegans operons in Caenorhabditis briggsae, Caenorhabditis remanei, and Caenorhabditis brenneri, using Pristionchus pacificus and Brugia malayi as outgroups, and identified numerous operon gains and losses. Coupled with experimental examination of trans-splicing patterns, our comparative genomic analysis revealed diverse molecular mechanisms of operon losses, including inversion, insertion, and relocation, but the presence of internal promoters was not found to facilitate operon losses. In several cases, the data allowed inference of mechanisms by which downstream genes are expressed after operon breakage. We found that the rate of operon gain is approximately 3.3 times that of operon loss. Thus, the evolutionary dynamics of nematode operons is better described as "easy come, slow go," rather than a "one-way street." Based on a mathematic model of operon gains and losses and additional assumptions, we projected that the number of operons in C. elegans will continue to rise by 6%-18% in future evolution before reaching equilibrium between operon gains and losses.

  8. Operon and non-operon gene clusters in the C. elegans genome.

    Science.gov (United States)

    Blumenthal, Thomas; Davis, Paul; Garrido-Lecca, Alfonso

    2015-04-28

    Nearly 15% of the ~20,000 C. elegans genes are contained in operons, multigene clusters controlled by a single promoter. The vast majority of these are of a type where the genes in the cluster are ~100 bp apart and the pre-mRNA is processed by 3' end formation accompanied by trans-splicing. A spliced leader, SL2, is specialized for operon processing. Here we summarize current knowledge on several variations on this theme including: (1) hybrid operons, which have additional promoters between genes; (2) operons with exceptionally long (> 1 kb) intercistronic regions; (3) operons with a second 3' end formation site close to the trans-splice site; (4) alternative operons, in which the exons are sometimes spliced as a single gene and sometimes as two genes; (5) SL1-type operons, which use SL1 instead of SL2 to trans-splice and in which there is no intercistronic space; (6) operons that make dicistronic mRNAs; and (7) non-operon gene clusters, in which either two genes use a single exon as the 3' end of one and the 5' end of the next, or the 3' UTR of one gene serves as the outron of the next. Each of these variations is relatively infrequent, but together they show a remarkable variety of tight-linkage gene arrangements in the C. elegans genome.

  9. Safe surgery: how accurate are we at predicting intra-operative blood loss?

    LENUS (Irish Health Repository)

    2012-02-01

    Introduction Preoperative estimation of intra-operative blood loss by both anaesthetist and operating surgeon is a criterion of the World Health Organization\\'s surgical safety checklist. The checklist requires specific preoperative planning when anticipated blood loss is greater than 500 mL. The aim of this study was to assess the accuracy of surgeons and anaesthetists at predicting intra-operative blood loss. Methods A 6-week prospective study of intermediate and major operations in an academic medical centre was performed. An independent observer interviewed surgical and anaesthetic consultants and registrars, preoperatively asking each to predict expected blood loss in millilitre. Intra-operative blood loss was measured and compared with these predictions. Parameters including the use of anticoagulation and anti-platelet therapy as well as intra-operative hypothermia and hypotension were recorded. Results One hundred sixty-eight operations were included in the study, including 142 elective and 26 emergency operations. Blood loss was predicted to within 500 mL of measured blood loss in 89% of cases. Consultant surgeons tended to underestimate blood loss, doing so in 43% of all cases, while consultant anaesthetists were more likely to overestimate (60% of all operations). Twelve patients (7%) had underestimation of blood loss of more than 500 mL by both surgeon and anaesthetist. Thirty per cent (n = 6\\/20) of patients requiring transfusion of a blood product within 24 hours of surgery had blood loss underestimated by more than 500 mL by both surgeon and anaesthetist. There was no significant difference in prediction between patients on anti-platelet or anticoagulation therapy preoperatively and those not on the said therapies. Conclusion Predicted intra-operative blood loss was within 500 mL of measured blood loss in 89% of operations. In 30% of patients who ultimately receive a blood transfusion, both the surgeon and anaesthetist significantly underestimate

  10. Are predictive equations for estimating resting energy expenditure accurate in Asian Indian male weightlifters?

    Directory of Open Access Journals (Sweden)

    Mini Joseph

    2017-01-01

    Full Text Available Background: The accuracy of existing predictive equations to determine the resting energy expenditure (REE of professional weightlifters remains scarcely studied. Our study aimed at assessing the REE of male Asian Indian weightlifters with indirect calorimetry and to compare the measured REE (mREE with published equations. A new equation using potential anthropometric variables to predict REE was also evaluated. Materials and Methods: REE was measured on 30 male professional weightlifters aged between 17 and 28 years using indirect calorimetry and compared with the eight formulas predicted by Harris–Benedicts, Mifflin-St. Jeor, FAO/WHO/UNU, ICMR, Cunninghams, Owen, Katch-McArdle, and Nelson. Pearson correlation coefficient, intraclass correlation coefficient, and multiple linear regression analysis were carried out to study the agreement between the different methods, association with anthropometric variables, and to formulate a new prediction equation for this population. Results: Pearson correlation coefficients between mREE and the anthropometric variables showed positive significance with suprailiac skinfold thickness, lean body mass (LBM, waist circumference, hip circumference, bone mineral mass, and body mass. All eight predictive equations underestimated the REE of the weightlifters when compared with the mREE. The highest mean difference was 636 kcal/day (Owen, 1986 and the lowest difference was 375 kcal/day (Cunninghams, 1980. Multiple linear regression done stepwise showed that LBM was the only significant determinant of REE in this group of sportspersons. A new equation using LBM as the independent variable for calculating REE was computed. REE for weightlifters = −164.065 + 0.039 (LBM (confidence interval −1122.984, 794.854]. This new equation reduced the mean difference with mREE by 2.36 + 369.15 kcal/day (standard error = 67.40. Conclusion: The significant finding of this study was that all the prediction equations

  11. FATHMM-XF: accurate prediction of pathogenic point mutations via extended features.

    Science.gov (United States)

    Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin

    2018-02-01

    We present FATHMM-XF, a method for predicting pathogenic point mutations in the human genome. Drawing on an extensive feature set, FATHMM-XF outperforms competitors on benchmark tests, particularly in non-coding regions where the majority of pathogenic mutations are likely to be found. The FATHMM-XF web server is available at http://fathmm.biocompute.org.uk/fathmm-xf/, and as tracks on the Genome Tolerance Browser: http://gtb.biocompute.org.uk. Predictions are provided for human genome version GRCh37/hg19. The data used for this project can be downloaded from: http://fathmm.biocompute.org.uk/fathmm-xf/. mark.rogers@bristol.ac.uk or c.campbell@bristol.ac.uk. Supplementary data are available at Bioinformatics online.

  12. Using an Allometric Equation to Accurately Predict the Energy Expenditure of Children and Adolescents With Nonalcoholic Fatty Liver Disease.

    Science.gov (United States)

    Martincevic, Inez; Mouzaki, Marialena

    2017-03-01

    Pediatric patients with nonalcoholic fatty liver disease (NAFLD) require targeted nutrition therapy that relies on calculating energy needs. Common energy equations are inaccurate in predicting resting energy expenditure (REE), influencing total energy expenditure (TEE) estimates. Equations based on allometric scaling are simple, accurate, void of subjective activity and/or stress factor bias, and they estimate TEE. To investigate the predictive accuracy of an allometric energy equation (AEE) in predicting TEE of children and adolescents with NAFLD. Retrospective study performed in a single institution. The allometric equation was used to calculate AEE, and the results were compared with TEE calculated using indirect calorimetry data (measured REE) multiplied by an activity factor (AF) of 1.5 or 1.7. Fifty-six patients with a mean age of 13 years were included in this study. The agreement between TEE (using an AF of 1.5) and AEE was -96 kcal/d (confidence interval, -29 to 221). The predictive accuracy of the allometric equation was not different between obese and nonobese patients. Allometric equations allow for accurate estimation of TEE in children with NAFLD.

  13. Ability to predict repetitions to momentary failure is not perfectly accurate, though improves with resistance training experience

    Directory of Open Access Journals (Sweden)

    James Steele

    2017-11-01

    Full Text Available ‘Repetitions in Reserve’ (RIR scales in resistance training (RT are used to control effort but assume people accurately predict performance a priori (i.e. the number of possible repetitions to momentary failure (MF. This study examined the ability of trainees with different experience levels to predict number of repetitions to MF. One hundred and forty-one participants underwent a full body RT session involving single sets to MF and were asked to predict the number of repetitions they could complete before reaching MF on each exercise. Participants underpredicted the number of repetitions they could perform to MF (Standard error of measurements [95% confidence intervals] for combined sample ranged between 2.64 [2.36–2.99] and 3.38 [3.02–3.83]. There was a tendency towards improved accuracy with greater experience. Ability to predict repetitions to MF is not perfectly accurate among most trainees though may improve with experience. Thus, RIR should be used cautiously in prescription of RT. Trainers and trainees should be aware of this as it may have implications for the attainment of training goals, particularly muscular hypertrophy.

  14. Ability to predict repetitions to momentary failure is not perfectly accurate, though improves with resistance training experience

    Science.gov (United States)

    Endres, Andreas; Fisher, James; Gentil, Paulo; Giessing, Jürgen

    2017-01-01

    ‘Repetitions in Reserve’ (RIR) scales in resistance training (RT) are used to control effort but assume people accurately predict performance a priori (i.e. the number of possible repetitions to momentary failure (MF)). This study examined the ability of trainees with different experience levels to predict number of repetitions to MF. One hundred and forty-one participants underwent a full body RT session involving single sets to MF and were asked to predict the number of repetitions they could complete before reaching MF on each exercise. Participants underpredicted the number of repetitions they could perform to MF (Standard error of measurements [95% confidence intervals] for combined sample ranged between 2.64 [2.36–2.99] and 3.38 [3.02–3.83]). There was a tendency towards improved accuracy with greater experience. Ability to predict repetitions to MF is not perfectly accurate among most trainees though may improve with experience. Thus, RIR should be used cautiously in prescription of RT. Trainers and trainees should be aware of this as it may have implications for the attainment of training goals, particularly muscular hypertrophy. PMID:29204323

  15. FastRNABindR: Fast and Accurate Prediction of Protein-RNA Interface Residues.

    Directory of Open Access Journals (Sweden)

    Yasser El-Manzalawy

    Full Text Available A wide range of biological processes, including regulation of gene expression, protein synthesis, and replication and assembly of many viruses are mediated by RNA-protein interactions. However, experimental determination of the structures of protein-RNA complexes is expensive and technically challenging. Hence, a number of computational tools have been developed for predicting protein-RNA interfaces. Some of the state-of-the-art protein-RNA interface predictors rely on position-specific scoring matrix (PSSM-based encoding of the protein sequences. The computational efforts needed for generating PSSMs severely limits the practical utility of protein-RNA interface prediction servers. In this work, we experiment with two approaches, random sampling and sequence similarity reduction, for extracting a representative reference database of protein sequences from more than 50 million protein sequences in UniRef100. Our results suggest that random sampled databases produce better PSSM profiles (in terms of the number of hits used to generate the profile and the distance of the generated profile to the corresponding profile generated using the entire UniRef100 data as well as the accuracy of the machine learning classifier trained using these profiles. Based on our results, we developed FastRNABindR, an improved version of RNABindR for predicting protein-RNA interface residues using PSSM profiles generated using 1% of the UniRef100 sequences sampled uniformly at random. To the best of our knowledge, FastRNABindR is the only protein-RNA interface residue prediction online server that requires generation of PSSM profiles for query sequences and accepts hundreds of protein sequences per submission. Our approach for determining the optimal BLAST database for a protein-RNA interface residue classification task has the potential of substantially speeding up, and hence increasing the practical utility of, other amino acid sequence based predictors of protein

  16. Accurate Stabilities of Laccase Mutants Predicted with a Modified FoldX Protocol

    DEFF Research Database (Denmark)

    Christensen, Niels Johan; Kepp, Kasper Planeta

    2012-01-01

    Fungal laccases are multi-copper enzymes of industrial importance due to their high stability, multi-functionality, and oxidizing power. This paper reports computational protocols that quantify the relative stability (∆∆G of folding) of mutants of high-redox-potential laccases (TvLIIIb and PM1L) ...... forces governing the high stability of fungal laccases, most notably the hydrophobic and Van der Waal's interactions in the folded state, which provide most of the predictive power....

  17. Geriatric nutritional risk index accurately predicts cardiovascular mortality in incident hemodialysis patients.

    Science.gov (United States)

    Takahashi, Hiroshi; Ito, Yasuhiko; Ishii, Hideki; Aoyama, Toru; Kamoi, Daisuke; Kasuga, Hirotake; Yasuda, Kaoru; Maruyama, Shoichi; Matsuo, Seiichi; Murohara, Toyoaki; Yuzawa, Yukio

    2014-07-01

    Cardiovascular disease (CVD) is a leading cause of death in end-stage renal disease (ESRD) patients. Protein-energy wasting (PEW) or malnutrition is common in this population, and is associated with increasing risk of mortality. The geriatric nutritional risk index (GNRI) has been developed as a tool to assess the nutritional risk, and is associated with mortality not only in elderly patients but also in ESRD patients. However, whether the GNRI could predict the mortality due to CVD remains unclear in this population. We investigated the prognostic value of GNRI at initiation of hemodialysis (HD) therapy for CVD mortality in a large cohort of ESRD patients. Serum albumin, body weight, and height for calculating GNRI were measured in 1568 ESRD patients. Thereafter, the patients were divided into quartiles according to GNRI levels [quartile 1 (Q1): 97.3], and were followed up for up to 10 years. GNRI levels independently correlated with serum C-reactive-protein levels (β = -0.126, p index was also greater in an established CVD risk model with GNRI (0.749) compared to that with albumin (0.730), body mass index (0.732), and alone (0.710). Similar results were observed for all-cause mortality. GNRI at initiation of HD therapy could predict CVD mortality with incremental value of the predictability compared to serum albumin and body mass index in ESRD patients. Copyright © 2013 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  18. How accurate is Density Functional Theory in Predicting Reaction Energies Relevant to Phase Stability?

    Science.gov (United States)

    Hautier, Geoffroy; Ong, Shyue Ping; Jain, Anubhav; Moore, Charles J.; Ceder, Gerbrand

    2012-02-01

    Density Functional Theory (DFT) computations can be used to build computational phase diagrams that are used to understand the stability of known phases but also to assess the stability of novel, predicted compounds. The quality and predictive power of those phase diagrams rely on the accuracy of DFT in modeling reaction energies and we will present in this talk the results of a large scale comparison between experimentally measured and DFT computed reaction energies. For starters, we will show that only certain reaction energies are directly relevant to phase stability of multicomponent systems and that very often those reaction energies are not the commonly studied reactions from the elements. Using data from different experimental thermochemical tables and DFT high-throughput computing, we will present the results of a statistical study based on more than 130 reaction energies relevant to phase stability and from binary oxides to ternary oxides. We will show that the typical error are around 30 meV/at and therefore an order of magnitude lower than the errors in reaction energies from the elements. Finally, we will discuss the broad implications of our results on the evaluation of ab initio phase diagrams and on the computational prediction of new solid phases.

  19. Mini-Mental Status Examination: a short form of MMSE was as accurate as the original MMSE in predicting dementia

    DEFF Research Database (Denmark)

    Schultz-Larsen, Kirsten; Lomholt, Rikke Kirstine; Kreiner, Svend

    2006-01-01

    as the original MMSE in predicting dementia. STUDY DESIGN AND SETTING: A population-based post hoc examination of the performance characteristics of the MMSE for detecting dementia in an existing data set of 243 elderly persons. RESULTS: Sensitivity, specificity, and predictive values were computed.......4%), and positive predictive value (71.0%) but equal area under the receiver operating characteristic curve. Cross-validation on follow-up data confirmed the results. CONCLUSION: A short, valid MMSE, which is as sensitive and specific as the original MMSE for the screening of cognitive impairments and dementia......OBJECTIVES: This study assesses the properties of the Mini-Mental State Examination (MMSE) with the purpose of improving the efficiencies of the methods of screening for cognitive impairment and dementia. A specific purpose was to determine whether an abbreviated version would be as accurate...

  20. Accurate cut-offs for predicting endoscopic activity and mucosal healing in Crohn's disease with fecal calprotectin

    Directory of Open Access Journals (Sweden)

    Juan María Vázquez-Morón

    Full Text Available Background: Fecal biomarkers, especially fecal calprotectin, are useful for predicting endoscopic activity in Crohn's disease; however, the cut-off point remains unclear. The aim of this paper was to analyze whether faecal calprotectin and M2 pyruvate kinase are good tools for generating highly accurate scores for the prediction of the state of endoscopic activity and mucosal healing. Methods: The simple endoscopic score for Crohn's disease and the Crohn's disease activity index was calculated for 71 patients diagnosed with Crohn's. Fecal calprotectin and M2-PK were measured by the enzyme-linked immunosorbent assay test. Results: A fecal calprotectin cut-off concentration of ≥ 170 µg/g (sensitivity 77.6%, specificity 95.5% and likelihood ratio +17.06 predicts a high probability of endoscopic activity, and a fecal calprotectin cut-off of ≤ 71 µg/g (sensitivity 95.9%, specificity 52.3% and likelihood ratio -0.08 predicts a high probability of mucosal healing. Three clinical groups were identified according to the data obtained: endoscopic activity (calprotectin ≥ 170, mucosal healing (calprotectin ≤ 71 and uncertainty (71 > calprotectin < 170, with significant differences in endoscopic values (F = 26.407, p < 0.01. Clinical activity or remission modified the probabilities of presenting endoscopic activity (100% vs 89% or mucosal healing (75% vs 87% in the diagnostic scores generated. M2-PK was insufficiently accurate to determine scores. Conclusions: The highly accurate scores for fecal calprotectin provide a useful tool for interpreting the probabilities of presenting endoscopic activity or mucosal healing, and are valuable in the specific clinical context.

  1. Size-extensivity-corrected multireference configuration interaction schemes to accurately predict bond dissociation energies of oxygenated hydrocarbons.

    Science.gov (United States)

    Oyeyemi, Victor B; Krisiloff, David B; Keith, John A; Libisch, Florian; Pavone, Michele; Carter, Emily A

    2014-01-28

    Oxygenated hydrocarbons play important roles in combustion science as renewable fuels and additives, but many details about their combustion chemistry remain poorly understood. Although many methods exist for computing accurate electronic energies of molecules at equilibrium geometries, a consistent description of entire combustion reaction potential energy surfaces (PESs) requires multireference correlated wavefunction theories. Here we use bond dissociation energies (BDEs) as a foundational metric to benchmark methods based on multireference configuration interaction (MRCI) for several classes of oxygenated compounds (alcohols, aldehydes, carboxylic acids, and methyl esters). We compare results from multireference singles and doubles configuration interaction to those utilizing a posteriori and a priori size-extensivity corrections, benchmarked against experiment and coupled cluster theory. We demonstrate that size-extensivity corrections are necessary for chemically accurate BDE predictions even in relatively small molecules and furnish examples of unphysical BDE predictions resulting from using too-small orbital active spaces. We also outline the specific challenges in using MRCI methods for carbonyl-containing compounds. The resulting complete basis set extrapolated, size-extensivity-corrected MRCI scheme produces BDEs generally accurate to within 1 kcal/mol, laying the foundation for this scheme's use on larger molecules and for more complex regions of combustion PESs.

  2. Can magnetic resonance imaging accurately predict concordant pain provocation during provocative disc injection?

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Chang Ho; Kim, Yun Hwan; Kim, Jung Hyuk; Chung, Kyoo Byung; Sung, Deuk Jae [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea); Lee, Sang-Heon [Korea University Anam Hospital, Korea University College of Medicine, Department of Physical Medicine and Rehabilitation, Seoul (Korea); Derby, Richard [Spinal Diagnostics and Treatment Center, Daly City, CA (United States); Stanford University Medical Center, Division of Physical Medicine and Rehabilitation, Stanford, CA (United States)

    2009-09-15

    To correlate magnetic resonance (MR) image findings with pain response by provocation discography in patients with discogenic low back pain, with an emphasis on the combination analysis of a high intensity zone (HIZ) and disc contour abnormalities. Sixty-two patients (aged 17-68 years) with axial low back pain that was likely to be disc related underwent lumbar discography (178 discs tested). The MR images were evaluated for disc degeneration, disc contour abnormalities, HIZ, and endplate abnormalities. Based on the combination of an HIZ and disc contour abnormalities, four classes were determined: (1) normal or bulging disc without HIZ; (2) normal or bulging disc with HIZ; (3) disc protrusion without HIZ; (4) disc protrusion with HIZ. These MR image findings and a new combined MR classification were analyzed in the base of concordant pain determined by discography. Disc protrusion with HIZ [sensitivity 45.5%; specificity 97.8%; positive predictive value (PPV), 87.0%] correlated significantly with concordant pain provocation (P < 0.01). A normal or bulging disc with HIZ was not associated with reproduction of pain. Disc degeneration (sensitivity 95.4%; specificity 38.8%; PPV 33.9%), disc protrusion (sensitivity 68.2%; specificity 80.6%; PPV 53.6%), and HIZ (sensitivity 56.8%; specificity 83.6%; PPV 53.2%) were not helpful in the identification of a disc with concordant pain. The proposed MR classification is useful to predict a disc with concordant pain. Disc protrusion with HIZ on MR imaging predicted positive discography in patients with discogenic low back pain. (orig.)

  3. Surface temperatures in New York City: Geospatial data enables the accurate prediction of radiative heat transfer.

    Science.gov (United States)

    Ghandehari, Masoud; Emig, Thorsten; Aghamohamadnia, Milad

    2018-02-02

    Despite decades of research seeking to derive the urban energy budget, the dynamics of thermal exchange in the densely constructed environment is not yet well understood. Using New York City as a study site, we present a novel hybrid experimental-computational approach for a better understanding of the radiative heat transfer in complex urban environments. The aim of this work is to contribute to the calculation of the urban energy budget, particularly the stored energy. We will focus our attention on surface thermal radiation. Improved understanding of urban thermodynamics incorporating the interaction of various bodies, particularly in high rise cities, will have implications on energy conservation at the building scale, and for human health and comfort at the urban scale. The platform presented is based on longwave hyperspectral imaging of nearly 100 blocks of Manhattan, in addition to a geospatial radiosity model that describes the collective radiative heat exchange between multiple buildings. Despite assumptions in surface emissivity and thermal conductivity of buildings walls, the close comparison of temperatures derived from measurements and computations is promising. Results imply that the presented geospatial thermodynamic model of urban structures can enable accurate and high resolution analysis of instantaneous urban surface temperatures.

  4. DisoMCS: Accurately Predicting Protein Intrinsically Disordered Regions Using a Multi-Class Conservative Score Approach.

    Directory of Open Access Journals (Sweden)

    Zhiheng Wang

    Full Text Available The precise prediction of protein intrinsically disordered regions, which play a crucial role in biological procedures, is a necessary prerequisite to further the understanding of the principles and mechanisms of protein function. Here, we propose a novel predictor, DisoMCS, which is a more accurate predictor of protein intrinsically disordered regions. The DisoMCS bases on an original multi-class conservative score (MCS obtained by sequence-order/disorder alignment. Initially, near-disorder regions are defined on fragments located at both the terminus of an ordered region connecting a disordered region. Then the multi-class conservative score is generated by sequence alignment against a known structure database and represented as order, near-disorder and disorder conservative scores. The MCS of each amino acid has three elements: order, near-disorder and disorder profiles. Finally, the MCS is exploited as features to identify disordered regions in sequences. DisoMCS utilizes a non-redundant data set as the training set, MCS and predicted secondary structure as features, and a conditional random field as the classification algorithm. In predicted near-disorder regions a residue is determined as an order or a disorder according to the optimized decision threshold. DisoMCS was evaluated by cross-validation, large-scale prediction, independent tests and CASP (Critical Assessment of Techniques for Protein Structure Prediction tests. All results confirmed that DisoMCS was very competitive in terms of accuracy of prediction when compared with well-established publicly available disordered region predictors. It also indicated our approach was more accurate when a query has higher homologous with the knowledge database.The DisoMCS is available at http://cal.tongji.edu.cn/disorder/.

  5. Heat capacities of xenotime-type ceramics: An accurate ab initio prediction

    Science.gov (United States)

    Ji, Yaqi; Beridze, George; Bosbach, Dirk; Kowalski, Piotr M.

    2017-10-01

    Because of ability to incorporate actinides into their structure, the lanthanide phosphate ceramics (LnPO4) are considered as potential matrices for the disposal of nuclear waste. Here we present highly reliable ab initio prediction of the variation of heat capacities and the standard entropies of these compounds in zircon structure along lanthanide series (Ln = Dy, …,Lu) and validate them against the existing experimental data. These data are helpful for assessment of thermodynamic parameters of these materials in the context of using them as matrices for immobilization of radionuclides for the purpose of nuclear waste management.

  6. Deep Learning Accurately Predicts Estrogen Receptor Status in Breast Cancer Metabolomics Data.

    Science.gov (United States)

    Alakwaa, Fadhl M; Chaudhary, Kumardeep; Garmire, Lana X

    2018-01-05

    Metabolomics holds the promise as a new technology to diagnose highly heterogeneous diseases. Conventionally, metabolomics data analysis for diagnosis is done using various statistical and machine learning based classification methods. However, it remains unknown if deep neural network, a class of increasingly popular machine learning methods, is suitable to classify metabolomics data. Here we use a cohort of 271 breast cancer tissues, 204 positive estrogen receptor (ER+), and 67 negative estrogen receptor (ER-) to test the accuracies of feed-forward networks, a deep learning (DL) framework, as well as six widely used machine learning models, namely random forest (RF), support vector machines (SVM), recursive partitioning and regression trees (RPART), linear discriminant analysis (LDA), prediction analysis for microarrays (PAM), and generalized boosted models (GBM). DL framework has the highest area under the curve (AUC) of 0.93 in classifying ER+/ER- patients, compared to the other six machine learning algorithms. Furthermore, the biological interpretation of the first hidden layer reveals eight commonly enriched significant metabolomics pathways (adjusted P-value learning methods. Among them, protein digestion and absorption and ATP-binding cassette (ABC) transporters pathways are also confirmed in integrated analysis between metabolomics and gene expression data in these samples. In summary, deep learning method shows advantages for metabolomics based breast cancer ER status classification, with both the highest prediction accuracy (AUC = 0.93) and better revelation of disease biology. We encourage the adoption of feed-forward networks based deep learning method in the metabolomics research community for classification.

  7. PSI: a comprehensive and integrative approach for accurate plant subcellular localization prediction.

    Directory of Open Access Journals (Sweden)

    Lili Liu

    Full Text Available Predicting the subcellular localization of proteins conquers the major drawbacks of high-throughput localization experiments that are costly and time-consuming. However, current subcellular localization predictors are limited in scope and accuracy. In particular, most predictors perform well on certain locations or with certain data sets while poorly on others. Here, we present PSI, a novel high accuracy web server for plant subcellular localization prediction. PSI derives the wisdom of multiple specialized predictors via a joint-approach of group decision making strategy and machine learning methods to give an integrated best result. The overall accuracy obtained (up to 93.4% was higher than best individual (CELLO by ~10.7%. The precision of each predicable subcellular location (more than 80% far exceeds that of the individual predictors. It can also deal with multi-localization proteins. PSI is expected to be a powerful tool in protein location engineering as well as in plant sciences, while the strategy employed could be applied to other integrative problems. A user-friendly web server, PSI, has been developed for free access at http://bis.zju.edu.cn/psi/.

  8. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences.

    Science.gov (United States)

    Chen, Peng; Li, Jinyan; Wong, Limsoon; Kuwahara, Hiroyuki; Huang, Jianhua Z; Gao, Xin

    2013-08-01

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. Copyright © 2013 Wiley Periodicals, Inc.

  9. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    KAUST Repository

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  10. Size matters. The width and location of a ureteral stone accurately predict the chance of spontaneous passage

    Energy Technology Data Exchange (ETDEWEB)

    Jendeberg, Johan; Geijer, Haakan; Alshamari, Muhammed; Liden, Mats [Oerebro University Hospital, Department of Radiology, Faculty of Medicine and Health, Oerebro (Sweden); Cierzniak, Bartosz [Oerebro University, Department of Surgery, Faculty of Medicine and Health, Oerebro (Sweden)

    2017-11-15

    To determine how to most accurately predict the chance of spontaneous passage of a ureteral stone using information in the diagnostic non-enhanced computed tomography (NECT) and to create predictive models with smaller stone size intervals than previously possible. Retrospectively 392 consecutive patients with ureteric stone on NECT were included. Three radiologists independently measured the stone size. Stone location, side, hydronephrosis, CRP, medical expulsion therapy (MET) and all follow-up radiology until stone expulsion or 26 weeks were recorded. Logistic regressions were performed with spontaneous stone passage in 4 weeks and 20 weeks as the dependent variable. The spontaneous passage rate in 20 weeks was 312 out of 392 stones, 98% in 0-2 mm, 98% in 3 mm, 81% in 4 mm, 65% in 5 mm, 33% in 6 mm and 9% in ≥6.5 mm wide stones. The stone size and location predicted spontaneous ureteric stone passage. The side and the grade of hydronephrosis only predicted stone passage in specific subgroups. Spontaneous passage of a ureteral stone can be predicted with high accuracy with the information available in the NECT. We present a prediction method based on stone size and location. (orig.)

  11. Prognostic breast cancer signature identified from 3D culture model accurately predicts clinical outcome across independent datasets

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Katherine J.; Patrick, Denis R.; Bissell, Mina J.; Fournier, Marcia V.

    2008-10-20

    One of the major tenets in breast cancer research is that early detection is vital for patient survival by increasing treatment options. To that end, we have previously used a novel unsupervised approach to identify a set of genes whose expression predicts prognosis of breast cancer patients. The predictive genes were selected in a well-defined three dimensional (3D) cell culture model of non-malignant human mammary epithelial cell morphogenesis as down-regulated during breast epithelial cell acinar formation and cell cycle arrest. Here we examine the ability of this gene signature (3D-signature) to predict prognosis in three independent breast cancer microarray datasets having 295, 286, and 118 samples, respectively. Our results show that the 3D-signature accurately predicts prognosis in three unrelated patient datasets. At 10 years, the probability of positive outcome was 52, 51, and 47 percent in the group with a poor-prognosis signature and 91, 75, and 71 percent in the group with a good-prognosis signature for the three datasets, respectively (Kaplan-Meier survival analysis, p<0.05). Hazard ratios for poor outcome were 5.5 (95% CI 3.0 to 12.2, p<0.0001), 2.4 (95% CI 1.6 to 3.6, p<0.0001) and 1.9 (95% CI 1.1 to 3.2, p = 0.016) and remained significant for the two larger datasets when corrected for estrogen receptor (ER) status. Hence the 3D-signature accurately predicts breast cancer outcome in both ER-positive and ER-negative tumors, though individual genes differed in their prognostic ability in the two subtypes. Genes that were prognostic in ER+ patients are AURKA, CEP55, RRM2, EPHA2, FGFBP1, and VRK1, while genes prognostic in ER patients include ACTB, FOXM1 and SERPINE2 (Kaplan-Meier p<0.05). Multivariable Cox regression analysis in the largest dataset showed that the 3D-signature was a strong independent factor in predicting breast cancer outcome. The 3D-signature accurately predicts breast cancer outcome across multiple datasets and holds prognostic

  12. Accurate prediction of thermodynamic properties of alkyl peroxides by combining density functional theory calculation with least-square calibration.

    Science.gov (United States)

    Liu, Cun-Xi; Li, Ze-Rong; Zhou, Chong-Wen; Li, Xiang-Yuan

    2009-05-01

    Owing to the significance in kinetic modeling of the oxidation and combustion mechanisms of hydrocarbons, a fast and relatively accurate method was developed for the prediction of Delta(f)H(298)(o) of alkyl peroxides. By this method, a raw Delta(f)H(298)(o) value was calculated from the optimized geometry and vibration frequencies at B3LYP/6-31G(d,p) level and then an accurate Delta(f)H(298)(o) value was obtained by a least-square procedure. The least-square procedure is a six-parameter linear equation and is validated by a leave-one out technique, giving a cross-validation squared correlation coefficient q(2) of 0.97 and a squared correlation coefficient of 0.98 for the final model. Calculated results demonstrated that the least-square calibration leads to a remarkable reduction of error and to the accurate Delta(f)H(298)(o) values within the chemical accuracy of 8 kJ mol(-1) except (CH(3))(2)CHCH(2)CH(2)CH(2)OOH which has an error of 8.69 kJ mol(-1). Comparison of the results by CBS-Q, CBS-QB3, G2, and G3 revealed that B3LYP/6-31G(d,p) in combination with a least-square calibration is reliable in the accurate prediction of the standard enthalpies of formation for alkyl peroxides. Standard entropies at 298 K and heat capacities in the temperature range of 300-1500 K for alkyl peroxides were also calculated using the rigid rotor-harmonic oscillator approximation. 2008 Wiley Periodicals, Inc.

  13. Predicting accurate absolute binding energies in aqueous solution: thermodynamic considerations for electronic structure methods.

    Science.gov (United States)

    Jensen, Jan H

    2015-05-21

    Recent predictions of absolute binding free energies of host-guest complexes in aqueous solution using electronic structure theory have been encouraging for some systems, while other systems remain problematic. In this paper I summarize some of the many factors that could easily contribute 1-3 kcal mol(-1) errors at 298 K: three-body dispersion effects, molecular symmetry, anharmonicity, spurious imaginary frequencies, insufficient conformational sampling, wrong or changing ionization states, errors in the solvation free energy of ions, and explicit solvent (and ion) effects that are not well-represented by continuum models. While I focus on binding free energies in aqueous solution the approach also applies (with minor adjustments) to any free energy difference such as conformational or reaction free energy differences or activation free energies in any solvent.

  14. Method for accurate shape prediction of 3D structure fabricated by x-ray lithography

    Science.gov (United States)

    Horade, Mitsuhiro; Khumpuang, Sommawan; Sugiyama, Susumu

    2005-02-01

    The paper describes about a useful study on the deformed shapes of microstructures fabricated by PCT (Plane-pattern to Cross-section Transfer) Technique. Previously, we have introduced the PCT technique as an additional process to conventional X-ray lithography for an extension of 2.5-dimensional structure to 3-dimensional structure. The PMMA (poly-methylmethacrylate) has been used as the X-ray resist. So far, microneedle and microlens arrays have been successfully fabricated in various shapes and dimensions. The production cost of X-ray mask has been known as the most expensive process for LIGA step, therefore, to predict the resulting shapes of structure precisely before fabricating the mask is relatively important. Although, the 2-D pattern on the X-ray mask can form a similar shape resulting in 3-D structure, the distorted shapes of microstructures have been observed. A linear-edged pattern on the X-ray mask resulted as an exponential-edged structure and an exponential-edged pattern resulted as an exceeding curvature, for example. This problem causes a change in the functional property of the array. In the case of our microneedle array, the linear-edge is highly required since it increases the strength of microneedle. We have investigated and suggested a calculation method fir a shape-prediction of microstructure fabricated by PCT technique in this work. The compensation calculation by our theories for an X-ray mask design can solve the undesired shape resulting after X-ray exposure. Moreover, the dosage control and suitable developing time are given in order to see through the current condition of the currently used synchrotron radiation light-source.

  15. Polarizable charge equilibration model for predicting accurate electrostatic interactions in molecules and solids

    Science.gov (United States)

    Naserifar, Saber; Brooks, Daniel J.; Goddard, William A.; Cvicek, Vaclav

    2017-03-01

    Electrostatic interactions play a critical role in determining the properties, structures, and dynamics of chemical, biochemical, and material systems. These interactions are described well at the level of quantum mechanics (QM) but not so well for the various models used in force field simulations of these systems. We propose and validate a new general methodology, denoted PQEq, to predict rapidly and dynamically the atomic charges and polarization underlying the electrostatic interactions. Here the polarization is described using an atomic sized Gaussian shaped electron density that can polarize away from the core in response to internal and external electric fields, while at the same time adjusting the charge on each core (described as a Gaussian function) so as to achieve a constant chemical potential across all atoms of the system. The parameters for PQEq are derived from experimental atomic properties of all elements up to Nobelium (atomic no. = 102). We validate PQEq by comparing to QM interaction energy as probe dipoles are brought along various directions up to 30 molecules containing H, C, N, O, F, Si, P, S, and Cl atoms. We find that PQEq predicts interaction energies in excellent agreement with QM, much better than other common charge models such as obtained from QM using Mulliken or ESP charges and those from standard force fields (OPLS and AMBER). Since PQEq increases the accuracy of electrostatic interactions and the response to external electric fields, we expect that PQEq will be useful for a large range of applications including ligand docking to proteins, catalytic reactions, electrocatalysis, ferroelectrics, and growth of ceramics and films, where it could be incorporated into standard force fields as OPLS, AMBER, CHARMM, Dreiding, ReaxFF, and UFF.

  16. The antenatal urinary tract dilation classification system accurately predicts severity of kidney and urinary tract abnormalities.

    Science.gov (United States)

    Kaspar, C D W; Lo, M; Bunchman, T E; Xiao, N

    2017-10-01

    Urinary tract dilation (UTD) is a commonly diagnosed prenatal condition; however, it is currently unknown which features lead to benign and resolving or pathologic abnormalities. A consensus UTD classification system (antenatal UTD classification, UTD-A) was created by Nguyen et al. in 2014 [1], but has not yet been validated. To evaluate the ability of the UTD-A system to identify kidney and urinary tract (KUT) abnormalities, assess whether UTD-A can predict severity of KUT conditions, and perform a cost analysis of screening ultrasound (US). A retrospective single-center study was conducted at an academic medical center. Inclusion criteria were: neonates in the well or sick nursery who had a complete abdominal or limited renal US performed in the first 30 days of life between January 01, 2011 and December 31, 2013. Data were collected on prenatal US characteristics from which UTD-A classification was retrospectively applied, and postnatal data were collected up to 2 years following birth. A total of 203 patients were identified. Of the 36 abnormal postnatal KUT diagnoses, 90% were identified prenatally as UTD A1 or UTD A2-3. The remaining 10% developed postnatal KUT abnormalities due to myelomeningocele, such as VUR or UTD, which were not evident prenatally. Overall sensitivity and specificity of the UTD-A system was 0.767 (95% CI 0.577, 0.901) and 0.836 (95% CI 0.758, 0.897), respectively, when resolved UTD was counted as a normal diagnosis. Postnatal diagnoses differed by UTD-A classification as shown in the Summary fig. Of all the obstructive uropathies, 90.9% occurred in the UTD A2-3 class and none occurred in UTD-A Normal. Rate of postnatally resolved UTD was significantly higher in the UTD A1 group (78%) compared with UTD A2-3 (31%) or UTD-A Normal (12%, all P system revealed important differences in the severity of UTD abnormalities. With repeated validation in larger cohorts, the UTD-A classification may be used to offer a prognosis for parents

  17. DrugECs: An Ensemble System with Feature Subspaces for Accurate Drug-Target Interaction Prediction

    Directory of Open Access Journals (Sweden)

    Jinjian Jiang

    2017-01-01

    Full Text Available Background. Drug-target interaction is key in drug discovery, especially in the design of new lead compound. However, the work to find a new lead compound for a specific target is complicated and hard, and it always leads to many mistakes. Therefore computational techniques are commonly adopted in drug design, which can save time and costs to a significant extent. Results. To address the issue, a new prediction system is proposed in this work to identify drug-target interaction. First, drug-target pairs are encoded with a fragment technique and the software “PaDEL-Descriptor.” The fragment technique is for encoding target proteins, which divides each protein sequence into several fragments in order and encodes each fragment with several physiochemical properties of amino acids. The software “PaDEL-Descriptor” creates encoding vectors for drug molecules. Second, the dataset of drug-target pairs is resampled and several overlapped subsets are obtained, which are then input into kNN (k-Nearest Neighbor classifier to build an ensemble system. Conclusion. Experimental results on the drug-target dataset showed that our method performs better and runs faster than the state-of-the-art predictors.

  18. The development and verification of a highly accurate collision prediction model for automated noncoplanar plan delivery

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Victoria Y.; Tran, Angelia; Nguyen, Dan; Cao, Minsong; Ruan, Dan; Low, Daniel A.; Sheng, Ke, E-mail: ksheng@mednet.ucla.edu [Department of Radiation Oncology, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, California 90024 (United States)

    2015-11-15

    attributed to phantom setup errors due to the slightly deformable and flexible phantom extremities. The estimated site-specific safety buffer distance with 0.001% probability of collision for (gantry-to-couch, gantry-to-phantom) was (1.23 cm, 3.35 cm), (1.01 cm, 3.99 cm), and (2.19 cm, 5.73 cm) for treatment to the head, lung, and prostate, respectively. Automated delivery to all three treatment sites was completed in 15 min and collision free using a digital Linac. Conclusions: An individualized collision prediction model for the purpose of noncoplanar beam delivery was developed and verified. With the model, the study has demonstrated the feasibility of predicting deliverable beams for an individual patient and then guiding fully automated noncoplanar treatment delivery. This work motivates development of clinical workflows and quality assurance procedures to allow more extensive use and automation of noncoplanar beam geometries.

  19. How Accurate Are the Anthropometry Equations in in Iranian Military Men in Predicting Body Composition?

    Science.gov (United States)

    Shakibaee, Abolfazl; Faghihzadeh, Soghrat; Alishiri, Gholam Hossein; Ebrahimpour, Zeynab; Faradjzadeh, Shahram; Sobhani, Vahid; Asgari, Alireza

    2015-12-01

    The body composition varies according to different life styles (i.e. intake calories and caloric expenditure). Therefore, it is wise to record military personnel's body composition periodically and encourage those who abide to the regulations. Different methods have been introduced for body composition assessment: invasive and non-invasive. Amongst them, the Jackson and Pollock equation is most popular. The recommended anthropometric prediction equations for assessing men's body composition were compared with dual-energy X-ray absorptiometry (DEXA) gold standard to develop a modified equation to assess body composition and obesity quantitatively among Iranian military men. A total of 101 military men aged 23 - 52 years old with a mean age of 35.5 years were recruited and evaluated in the present study (average height, 173.9 cm and weight, 81.5 kg). The body-fat percentages of subjects were assessed both with anthropometric assessment and DEXA scan. The data obtained from these two methods were then compared using multiple regression analysis. The mean and standard deviation of body fat percentage of the DEXA assessment was 21.2 ± 4.3 and body fat percentage obtained from three Jackson and Pollock 3-, 4- and 7-site equations were 21.1 ± 5.8, 22.2 ± 6.0 and 20.9 ± 5.7, respectively. There was a strong correlation between these three equations and DEXA (R² = 0.98). The mean percentage of body fat obtained from the three equations of Jackson and Pollock was very close to that of body fat obtained from DEXA; however, we suggest using a modified Jackson-Pollock 3-site equation for volunteer military men because the 3-site equation analysis method is simpler and faster than other methods.

  20. A Novel Fibrosis Index Comprising a Non-Cholesterol Sterol Accurately Predicts HCV-Related Liver Cirrhosis

    DEFF Research Database (Denmark)

    Ydreborg, Magdalena; Lisovskaja, Vera; Lagging, Martin

    2014-01-01

    Diagnosis of liver cirrhosis is essential in the management of chronic hepatitis C virus (HCV) infection. Liver biopsy is invasive and thus entails a risk of complications as well as a potential risk of sampling error. Therefore, non-invasive diagnostic tools are preferential. The aim...... of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive...... significance for liver fibrosis in 278 patients originally included in a multicenter phase III treatment trial for chronic HCV infection. A stepwise multivariate logistic model selection was performed with liver cirrhosis, defined as Ishak fibrosis stage 5-6, as the outcome variable. A new index, referred...

  1. Industrial Compositional Streamline Simulation for Efficient and Accurate Prediction of Gas Injection and WAG Processes

    Energy Technology Data Exchange (ETDEWEB)

    Margot Gerritsen

    2008-10-31

    Gas-injection processes are widely and increasingly used for enhanced oil recovery (EOR). In the United States, for example, EOR production by gas injection accounts for approximately 45% of total EOR production and has tripled since 1986. The understanding of the multiphase, multicomponent flow taking place in any displacement process is essential for successful design of gas-injection projects. Due to complex reservoir geometry, reservoir fluid properties and phase behavior, the design of accurate and efficient numerical simulations for the multiphase, multicomponent flow governing these processes is nontrivial. In this work, we developed, implemented and tested a streamline based solver for gas injection processes that is computationally very attractive: as compared to traditional Eulerian solvers in use by industry it computes solutions with a computational speed orders of magnitude higher and a comparable accuracy provided that cross-flow effects do not dominate. We contributed to the development of compositional streamline solvers in three significant ways: improvement of the overall framework allowing improved streamline coverage and partial streamline tracing, amongst others; parallelization of the streamline code, which significantly improves wall clock time; and development of new compositional solvers that can be implemented along streamlines as well as in existing Eulerian codes used by industry. We designed several novel ideas in the streamline framework. First, we developed an adaptive streamline coverage algorithm. Adding streamlines locally can reduce computational costs by concentrating computational efforts where needed, and reduce mapping errors. Adapting streamline coverage effectively controls mass balance errors that mostly result from the mapping from streamlines to pressure grid. We also introduced the concept of partial streamlines: streamlines that do not necessarily start and/or end at wells. This allows more efficient coverage and avoids

  2. Easy-to-use, general, and accurate multi-Kinect calibration and its application to gait monitoring for fall prediction.

    Science.gov (United States)

    Staranowicz, Aaron N; Ray, Christopher; Mariottini, Gian-Luca

    2015-01-01

    Falls are the most-common causes of unintentional injury and death in older adults. Many clinics, hospitals, and health-care providers are urgently seeking accurate, low-cost, and easy-to-use technology to predict falls before they happen, e.g., by monitoring the human walking pattern (or "gait"). Despite the wide popularity of Microsoft's Kinect and the plethora of solutions for gait monitoring, no strategy has been proposed to date to allow non-expert users to calibrate the cameras, which is essential to accurately fuse the body motion observed by each camera in a single frame of reference. In this paper, we present a novel multi-Kinect calibration algorithm that has advanced features when compared to existing methods: 1) is easy to use, 2) it can be used in any generic Kinect arrangement, and 3) it provides accurate calibration. Extensive real-world experiments have been conducted to validate our algorithm and to compare its performance against other multi-Kinect calibration approaches, especially to show the improved estimate of gait parameters. Finally, a MATLAB Toolbox has been made publicly available for the entire research community.

  3. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    Science.gov (United States)

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  4. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  5. New and Accurate Predictive Model for the Efficacy of Extracorporeal Shock Wave Therapy in Managing Patients With Chronic Plantar Fasciitis.

    Science.gov (United States)

    Yin, Mengchen; Chen, Ni; Huang, Quan; Marla, Anastasia Sulindro; Ma, Junming; Ye, Jie; Mo, Wen

    2017-12-01

    index was .4243, .3003, and .7189, respectively. The Hosmer-Lemeshow test showed a good fitting of the predictive model, with an overall accuracy of 89.6%. This study establishes a new and accurate predictive model for the efficacy of ESWT in managing patients with chronic plantar fasciitis. The use of these parameters, in the form of a predictive model for ESWT efficacy, has the potential to improve decision-making in the application of ESWT. Copyright © 2017 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  6. Non-isothermal kinetics model to predict accurate phase transformation and hardness of 22MnB5 boron steel

    Energy Technology Data Exchange (ETDEWEB)

    Bok, H.-H.; Kim, S.N.; Suh, D.W. [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Barlat, F., E-mail: f.barlat@postech.ac.kr [Graduate Institute of Ferrous Technology, POSTECH, San 31, Hyoja-dong, Nam-gu, Pohang, Gyeongsangbuk-do (Korea, Republic of); Lee, M.-G., E-mail: myounglee@korea.ac.kr [Department of Materials Science and Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul (Korea, Republic of)

    2015-02-25

    A non-isothermal phase transformation kinetics model obtained by modifying the well-known JMAK approach is proposed for application to a low carbon boron steel (22MnB5) sheet. In the modified kinetics model, the parameters are functions of both temperature and cooling rate, and can be identified by a numerical optimization method. Moreover, in this approach the transformation start and finish temperatures are variable instead of the constants that depend on chemical composition. These variable reference temperatures are determined from the measured CCT diagram using dilatation experiments. The kinetics model developed in this work captures the complex transformation behavior of the boron steel sheet sample accurately. In particular, the predicted hardness and phase fractions in the specimens subjected to a wide range of cooling rates were validated by experiments.

  7. Accurate pan-specific prediction of peptide-MHC class II binding affinity with improved binding core identification

    DEFF Research Database (Denmark)

    Andreatta, Massimo; Karosiene, Edita; Rasmussen, Michael

    2015-01-01

    by T helper lymphocytes. NetMHCIIpan is a state-of-the-art method for the quantitative prediction of peptide binding to any human or mouse MHC class II molecule of known sequence. In this paper, we describe an updated version of the method with improved peptide binding register identification. Binding...... with known binding registers, the new method NetMHCIIpan-3.1 significantly outperformed the earlier 3.0 version. We illustrate the impact of accurate binding core identification for the interpretation of T cell cross-reactivity using tetramer double staining with a CMV epitope and its variants mapped...... to the epitope binding core. NetMHCIIpan is publicly available at http://www.cbs.dtu.dk/services/NetMHCIIpan-3.1....

  8. Effect of computational grid on accurate prediction of a wind turbine rotor using delayed detached-eddy simulations

    Energy Technology Data Exchange (ETDEWEB)

    Bangga, Galih; Weihing, Pascal; Lutz, Thorsten; Krämer, Ewald [University of Stuttgart, Stuttgart (Germany)

    2017-05-15

    The present study focuses on the impact of grid for accurate prediction of the MEXICO rotor under stalled conditions. Two different blade mesh topologies, O and C-H meshes, and two different grid resolutions are tested for several time step sizes. The simulations are carried out using Delayed detached-eddy simulation (DDES) with two eddy viscosity RANS turbulence models, namely Spalart- Allmaras (SA) and Menter Shear stress transport (SST) k-ω. A high order spatial discretization, WENO (Weighted essentially non- oscillatory) scheme, is used in these computations. The results are validated against measurement data with regards to the sectional loads and the chordwise pressure distributions. The C-H mesh topology is observed to give the best results employing the SST k-ω turbulence model, but the computational cost is more expensive as the grid contains a wake block that increases the number of cells.

  9. ODB: a database for operon organizations, 2011 update

    OpenAIRE

    Okuda, Shujiro; Yoshizawa, Akiyasu C

    2011-01-01

    ODB (Operon DataBase) aims to collect data of all known and conserved operons in completely sequenced genomes. Three newly updated features of this database have been added as follows: (i) Data from included operons were updated. The genome-wide analysis of transcription and transcriptional units has become popular recently and ODB successfully integrates these high-throughput operon data, including genome-wide transcriptional units of five prokaryotes and two eukaryotes. The current version ...

  10. Total reference air kerma can accurately predict isodose surface volumes in cervix cancer brachytherapy. A multicenter study.

    Science.gov (United States)

    Nkiwane, Karen S; Andersen, Else; Champoudry, Jerome; de Leeuw, Astrid; Swamidas, Jamema; Lindegaard, Jacob; Pötter, Richard; Kirisits, Christian; Tanderup, Kari

    To demonstrate that V 60  Gy, V 75  Gy, and V 85  Gy isodose surface volumes can be accurately estimated from total reference air kerma (TRAK) in cervix cancer MRI-guided brachytherapy (BT). 60 Gy, 75 Gy, and 85 Gy isodose surface volumes levels were obtained from treatment planning systems (V TPS ) for 239 EMBRACE study patients from five institutions treated with various dose rates, fractionation schedules and applicators. An equation for estimating V TPS from TRAK was derived. Furthermore, a surrogate Point A dose (Point A*) was proposed and tested for correlation with V 75  Gy. Predicted volumes V pred  = 4965 (TRAK/dref) 3/2 + 170 (TRAK/dref) - 1.5 gave the best fit to V TPS . The difference between V TPS and predicted volumes was 0.0% ± 2.3%. All volumes were predicted within 10%. The prediction was valid for (1) high-dose rate and pulsed dose rate, (2) intracavitary vs. intracavitary/interstitial applicators, and (3) tandem-ring, tandem-ovoid, and mold. Point A* = 14 TRAK was converted to total EQD 2 and showed high correlation with V 75  Gy. TRAK derived Isodose surface volumes may become a tool for assessment of treatment intensity. Furthermore, surrogate Point A ∗ doses can be applied for both intracavitary and intracavitary/interstitial BT and can be used to compare treatments across fractionation schedules. Copyright © 2017 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

  11. A novel fibrosis index comprising a non-cholesterol sterol accurately predicts HCV-related liver cirrhosis.

    Directory of Open Access Journals (Sweden)

    Magdalena Ydreborg

    Full Text Available Diagnosis of liver cirrhosis is essential in the management of chronic hepatitis C virus (HCV infection. Liver biopsy is invasive and thus entails a risk of complications as well as a potential risk of sampling error. Therefore, non-invasive diagnostic tools are preferential. The aim of the present study was to create a model for accurate prediction of liver cirrhosis based on patient characteristics and biomarkers of liver fibrosis, including a panel of non-cholesterol sterols reflecting cholesterol synthesis and absorption and secretion. We evaluated variables with potential predictive significance for liver fibrosis in 278 patients originally included in a multicenter phase III treatment trial for chronic HCV infection. A stepwise multivariate logistic model selection was performed with liver cirrhosis, defined as Ishak fibrosis stage 5-6, as the outcome variable. A new index, referred to as Nordic Liver Index (NoLI in the paper, was based on the model: Log-odds (predicting cirrhosis = -12.17+ (age × 0.11 + (BMI (kg/m(2 × 0.23 + (D7-lathosterol (μg/100 mg cholesterol×(-0.013 + (Platelet count (x10(9/L × (-0.018 + (Prothrombin-INR × 3.69. The area under the ROC curve (AUROC for prediction of cirrhosis was 0.91 (95% CI 0.86-0.96. The index was validated in a separate cohort of 83 patients and the AUROC for this cohort was similar (0.90; 95% CI: 0.82-0.98. In conclusion, the new index may complement other methods in diagnosing cirrhosis in patients with chronic HCV infection.

  12. Predicting suitable optoelectronic properties of monoclinic VON semiconductor crystals for photovoltaics using accurate first-principles computations

    KAUST Repository

    Harb, Moussab

    2015-08-26

    Using accurate first-principles quantum calculations based on DFT (including the perturbation theory DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we predict essential fundamental properties (such as bandgap, optical absorption coefficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit relatively high absorption efficiencies in the visible range, high dielectric constants, high charge carrier mobilities and much lower exciton binding energies than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties are found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices like Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.

  13. Predicting suitable optoelectronic properties of monoclinic VON semiconductor crystals for photovoltaics using accurate first-principles computations.

    Science.gov (United States)

    Harb, Moussab

    2015-10-14

    Using accurate first-principles quantum calculations based on DFT (including the DFPT) with the range-separated hybrid HSE06 exchange-correlation functional, we can predict the essential fundamental properties (such as bandgap, optical absorption co-efficient, dielectric constant, charge carrier effective masses and exciton binding energy) of two stable monoclinic vanadium oxynitride (VON) semiconductor crystals for solar energy conversion applications. In addition to the predicted band gaps in the optimal range for making single-junction solar cells, both polymorphs exhibit a relatively high absorption efficiency in the visible range, high dielectric constant, high charge carrier mobility and much lower exciton binding energy than the thermal energy at room temperature. Moreover, their optical absorption, dielectric and exciton dissociation properties were found to be better than those obtained for semiconductors frequently utilized in photovoltaic devices such as Si, CdTe and GaAs. These novel results offer a great opportunity for this stoichiometric VON material to be properly synthesized and considered as a new good candidate for photovoltaic applications.

  14. Accurate prediction of complex free surface flow around a high speed craft using a single-phase level set method

    Science.gov (United States)

    Broglia, Riccardo; Durante, Danilo

    2017-11-01

    This paper focuses on the analysis of a challenging free surface flow problem involving a surface vessel moving at high speeds, or planing. The investigation is performed using a general purpose high Reynolds free surface solver developed at CNR-INSEAN. The methodology is based on a second order finite volume discretization of the unsteady Reynolds-averaged Navier-Stokes equations (Di Mascio et al. in A second order Godunov—type scheme for naval hydrodynamics, Kluwer Academic/Plenum Publishers, Dordrecht, pp 253-261, 2001; Proceedings of 16th international offshore and polar engineering conference, San Francisco, CA, USA, 2006; J Mar Sci Technol 14:19-29, 2009); air/water interface dynamics is accurately modeled by a non standard level set approach (Di Mascio et al. in Comput Fluids 36(5):868-886, 2007a), known as the single-phase level set method. In this algorithm the governing equations are solved only in the water phase, whereas the numerical domain in the air phase is used for a suitable extension of the fluid dynamic variables. The level set function is used to track the free surface evolution; dynamic boundary conditions are enforced directly on the interface. This approach allows to accurately predict the evolution of the free surface even in the presence of violent breaking waves phenomena, maintaining the interface sharp, without any need to smear out the fluid properties across the two phases. This paper is aimed at the prediction of the complex free-surface flow field generated by a deep-V planing boat at medium and high Froude numbers (from 0.6 up to 1.2). In the present work, the planing hull is treated as a two-degree-of-freedom rigid object. Flow field is characterized by the presence of thin water sheets, several energetic breaking waves and plungings. The computational results include convergence of the trim angle, sinkage and resistance under grid refinement; high-quality experimental data are used for the purposes of validation, allowing to

  15. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  16. Do measures of surgical effectiveness at 1 year after lumbar spine surgery accurately predict 2-year outcomes?

    Science.gov (United States)

    Adogwa, Owoicho; Elsamadicy, Aladine A; Han, Jing L; Cheng, Joseph; Karikari, Isaac; Bagley, Carlos A

    2016-12-01

    OBJECTIVE With the recent passage of the Patient Protection and Affordable Care Act, there has been a dramatic shift toward critical analyses of quality and longitudinal assessment of subjective and objective outcomes after lumbar spine surgery. Accordingly, the emergence and routine use of real-world institutional registries have been vital to the longitudinal assessment of quality. However, prospectively obtaining longitudinal outcomes for patients at 24 months after spine surgery remains a challenge. The aim of this study was to assess if 12-month measures of treatment effectiveness accurately predict long-term outcomes (24 months). METHODS A nationwide, multiinstitutional, prospective spine outcomes registry was used for this study. Enrollment criteria included available demographic, surgical, and clinical outcomes data. All patients had prospectively collected outcomes measures and a minimum 2-year follow-up. Patient-reported outcomes instruments (Oswestry Disability Index [ODI], SF-36, and visual analog scale [VAS]-back pain/leg pain) were completed before surgery and then at 3, 6, 12, and 24 months after surgery. The Health Transition Index of the SF-36 was used to determine the 1- and 2-year minimum clinically important difference (MCID), and logistic regression modeling was performed to determine if achieving MCID at 1 year adequately predicted improvement and achievement of MCID at 24 months. RESULTS The study group included 969 patients: 300 patients underwent anterior lumbar interbody fusion (ALIF), 606 patients underwent transforaminal lumbar interbody fusion (TLIF), and 63 patients underwent lateral interbody fusion (LLIF). There was a significant correlation between the 12- and 24-month ODI (r = 0.82; p MCID thresholds for ODI at 12 months were 13-fold (p MCID at 24 months. Similarly, for the TLIF and LLIF cohorts, patients achieving MCID thresholds for ODI at 12 months were 13-fold and 14-fold (p MCID at 24 months. Outcome measures obtained at 12

  17. A composite score combining waist circumference and body mass index more accurately predicts body fat percentage in 6-to 13-year-old children

    NARCIS (Netherlands)

    Aeberli, I.; Gut-Knabenhans, M.; Kusche-Ammann, R.S.; Molinari, L.; Zimmermann, M.B.

    2013-01-01

    Body mass index (BMI) and waist circumference (WC) are widely used to predict % body fat (BF) and classify degrees of pediatric adiposity. However, both measures have limitations. The aim of this study was to evaluate whether a combination of WC and BMI would more accurately predict %BF than either

  18. Accurate prediction of immunogenic T-cell epitopes from epitope sequences using the genetic algorithm-based ensemble learning.

    Science.gov (United States)

    Zhang, Wen; Niu, Yanqing; Zou, Hua; Luo, Longqiang; Liu, Qianchao; Wu, Weijian

    2015-01-01

    T-cell epitopes play the important role in T-cell immune response, and they are critical components in the epitope-based vaccine design. Immunogenicity is the ability to trigger an immune response. The accurate prediction of immunogenic T-cell epitopes is significant for designing useful vaccines and understanding the immune system. In this paper, we attempt to differentiate immunogenic epitopes from non-immunogenic epitopes based on their primary structures. First of all, we explore a variety of sequence-derived features, and analyze their relationship with epitope immunogenicity. To effectively utilize various features, a genetic algorithm (GA)-based ensemble method is proposed to determine the optimal feature subset and develop the high-accuracy ensemble model. In the GA optimization, a chromosome is to represent a feature subset in the search space. For each feature subset, the selected features are utilized to construct the base predictors, and an ensemble model is developed by taking the average of outputs from base predictors. The objective of GA is to search for the optimal feature subset, which leads to the ensemble model with the best cross validation AUC (area under ROC curve) on the training set. Two datasets named 'IMMA2' and 'PAAQD' are adopted as the benchmark datasets. Compared with the state-of-the-art methods POPI, POPISK, PAAQD and our previous method, the GA-based ensemble method produces much better performances, achieving the AUC score of 0.846 on IMMA2 dataset and the AUC score of 0.829 on PAAQD dataset. The statistical analysis demonstrates the performance improvements of GA-based ensemble method are statistically significant. The proposed method is a promising tool for predicting the immunogenic epitopes. The source codes and datasets are available in S1 File.

  19. A global analysis of adaptive evolution of operons in cyanobacteria.

    Science.gov (United States)

    Memon, Danish; Singh, Abhay K; Pakrasi, Himadri B; Wangikar, Pramod P

    2013-02-01

    Operons are an important feature of prokaryotic genomes. Evolution of operons is hypothesized to be adaptive and has contributed significantly towards coordinated optimization of functions. Two conflicting theories, based on (i) in situ formation to achieve co-regulation and (ii) horizontal gene transfer of functionally linked gene clusters, are generally considered to explain why and how operons have evolved. Furthermore, effects of operon evolution on genomic traits such as intergenic spacing, operon size and co-regulation are relatively less explored. Based on the conservation level in a set of diverse prokaryotes, we categorize the operonic gene pair associations and in turn the operons as ancient and recently formed. This allowed us to perform a detailed analysis of operonic structure in cyanobacteria, a morphologically and physiologically diverse group of photoautotrophs. Clustering based on operon conservation showed significant similarity with the 16S rRNA-based phylogeny, which groups the cyanobacterial strains into three clades. Clade C, dominated by strains that are believed to have undergone genome reduction, shows a larger fraction of operonic genes that are tightly packed in larger sized operons. Ancient operons are in general larger, more tightly packed, better optimized for co-regulation and part of key cellular processes. A sub-clade within Clade B, which includes Synechocystis sp. PCC 6803, shows a reverse trend in intergenic spacing. Our results suggest that while in situ formation and vertical descent may be a dominant mechanism of operon evolution in cyanobacteria, optimization of intergenic spacing and co-regulation are part of an ongoing process in the life-cycle of operons.

  20. Body mass index continues to accurately predict percent body fat as women age despite changes in muscle mass and height.

    Science.gov (United States)

    Ablove, Tova; Binkley, Neil; Leadley, Sarah; Shelton, James; Ablove, Robert

    2015-07-01

    Body mass index (BMI) is commonly used to predict obesity in clinical practice because it is suggested to closely correlate with percent body fat (%BF). With aging, women lose both lean mass and height. Because of this, many clinicians question whether BMI is an accurate predictor of obesity in aging women. In evaluating the equation for BMI (weight/height(2)), it is clear that both variables can have a dramatic effect on BMI calculation. We evaluated the relationship between BMI and %BF, as measured by dual-energy x-ray absorptiometry, in the setting of age-related changes in height loss and body composition in women. Our objective is to determine whether BMI continues to correlate with %BF as women age. Study participants were identified using data from five osteoporosis clinical trials, where healthy participants had full-body dual-energy x-ray absorptiometry scans. Deidentified data from 274 women aged between 35 and 95 years were evaluated. %BF, weight, age, tallest height, actual height, and appendicular lean mass were collected from all participants. BMI was calculated using the actual height and the tallest height of each study participant. %BF was compared with BMI and stratified for age. BMI calculated using the tallest height and BMI calculated using actual height both had strong correlations with %BF. Surprisingly, the effects of changes in height and lean body mass balance each other out in BMI calculation. There continues to be a strong correlation between BMI and %BF in adult women as they age.

  1. Genome-wide analysis of trans-splicing in the nematode Pristionchus pacificus unravels conserved gene functions for germline and dauer development in divergent operons.

    Science.gov (United States)

    Sinha, Amit; Langnick, Claudia; Sommer, Ralf J; Dieterich, Christoph

    2014-09-01

    Discovery of trans-splicing in multiple metazoan lineages led to the identification of operon-like gene organization in diverse organisms, including trypanosomes, tunicates, and nematodes, but the functional significance of such operons is not completely understood. To see whether the content or organization of operons serves similar roles across species, we experimentally defined operons in the nematode model Pristionchus pacificus. We performed affinity capture experiments on mRNA pools to specifically enrich for transcripts that are trans-spliced to either the SL1- or SL2-spliced leader, using spliced leader-specific probes. We obtained distinct trans-splicing patterns from the analysis of three mRNA pools (total mRNA, SL1 and SL2 fraction) by RNA-seq. This information was combined with a genome-wide analysis of gene orientation and spacing. We could confirm 2219 operons by RNA-seq data out of 6709 candidate operons, which were predicted by sequence information alone. Our gene order comparison of the Caenorhabditis elegans and P. pacificus genomes shows major changes in operon organization in the two species. Notably, only 128 out of 1288 operons in C. elegans are conserved in P. pacificus. However, analysis of gene-expression profiles identified conserved functions such as an enrichment of germline-expressed genes and higher expression levels of operonic genes during recovery from dauer arrest in both species. These results provide support for the model that a necessity for increased transcriptional efficiency in the context of certain developmental processes could be a selective constraint for operon evolution in metazoans. Our method is generally applicable to other metazoans to see if similar functional constraints regulate gene organization into operons. © 2014 Sinha et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. A rapid and accurate approach for prediction of interactomes from co-elution data (PrInCE).

    Science.gov (United States)

    Stacey, R Greg; Skinnider, Michael A; Scott, Nichollas E; Foster, Leonard J

    2017-10-23

    An organism's protein interactome, or complete network of protein-protein interactions, defines the protein complexes that drive cellular processes. Techniques for studying protein complexes have traditionally applied targeted strategies such as yeast two-hybrid or affinity purification-mass spectrometry to assess protein interactions. However, given the vast number of protein complexes, more scalable methods are necessary to accelerate interaction discovery and to construct whole interactomes. We recently developed a complementary technique based on the use of protein correlation profiling (PCP) and stable isotope labeling in amino acids in cell culture (SILAC) to assess chromatographic co-elution as evidence of interacting proteins. Importantly, PCP-SILAC is also capable of measuring protein interactions simultaneously under multiple biological conditions, allowing the detection of treatment-specific changes to an interactome. Given the uniqueness and high dimensionality of co-elution data, new tools are needed to compare protein elution profiles, control false discovery rates, and construct an accurate interactome. Here we describe a freely available bioinformatics pipeline, PrInCE, for the analysis of co-elution data. PrInCE is a modular, open-source library that is computationally inexpensive, able to use label and label-free data, and capable of detecting tens of thousands of protein-protein interactions. Using a machine learning approach, PrInCE offers greatly reduced run time, more predicted interactions at the same stringency, prediction of protein complexes, and greater ease of use over previous bioinformatics tools for co-elution data. PrInCE is implemented in Matlab (version R2017a). Source code and standalone executable programs for Windows and Mac OSX are available at https://github.com/fosterlab/PrInCE , where usage instructions can be found. An example dataset and output are also provided for testing purposes. PrInCE is the first fast and easy

  3. Chloride:Sodium Ratio May Accurately Predict Corrected Chloride Disorders and the Presence of Unmeasured Anions in Dogs and Cats.

    Science.gov (United States)

    Goggs, Robert; Myers, Marc; De Rosa, Sage; Zager, Erik; Fletcher, Daniel J

    2017-01-01

    Disorders of chloride and mixed acid-base disturbances are common in veterinary emergency medicine. Rapid identification of these alterations and the presence of unmeasured anions aid prompt patient assessment and management. This study aimed to determine in dogs and cats if site-specific reference values for [Cl-]:[Na+] ratio and [Na+] - [Cl-] difference accurately identify corrected chloride abnormalities and to evaluate the predictive ability of the [Cl-]:[Na+] ratio for the identification of unmeasured anions. A database containing 33,117 canine, and 7,604 feline blood gas and electrolyte profiles was generated. Institution reference intervals were used to calculate site-specific reference values for the [Cl-]:[Na+] ratio and the [Na+] - [Cl-] difference. Contingency tables were used to assess the ability of these values to correctly identify corrected chloride disorders. Unmeasured anions were estimated by calculating strong ion gap (SIG). Continuous variables were compared using the Mann-Whitney U test. Correlations between continuous variables were assessed using Spearman's rho (rs). In dogs, site-specific reference values for the [Cl-]:[Na+] ratio correctly identified 94.6% of profiles as hyper-, normo-, or hypochloremic. For dogs with normal sodium concentrations, site-specific reference values for the [Na+] - [Cl-] difference correctly identified 97.0% of profiles. In dogs with metabolic acidosis (base deficit > 4.0), [Cl-]:[Na+] ratio and SIG were moderately but significantly negatively correlated (rs -0.592, P SIG was significantly greater in dogs with metabolic acidosis and hypochloremia compared to those without hypochloremia (P SIG were moderately significantly negatively correlated (rs -0.730, P SIG was significantly greater in cats with metabolic acidosis and hypochloremia compared to those without hypochloremia (P < 0.0001). Site-specific values for [Cl-]:[Na+] ratio and [Na+] - [Cl-] difference accurately identify

  4. Germline expression influences operon organization in the Caenorhabditis elegans genome.

    Science.gov (United States)

    Reinke, Valerie; Cutter, Asher D

    2009-04-01

    Operons are found across multiple kingdoms and phyla, from prokaryotes to chordates. In the nematode Caenorhabditis elegans, the genome contains >1000 operons that compose approximately 15% of the protein-coding genes. However, determination of the force(s) promoting the origin and maintenance of operons in C. elegans has proved elusive. Compared to bacterial operons, genes within a C. elegans operon often show poor coexpression and only sometimes encode proteins with related functions. Using analysis of microarray and large-scale in situ hybridization data, we demonstrate that almost all operon-encoded genes are expressed in germline tissue. However, genes expressed during spermatogenesis are excluded from operons. Operons group together along chromosomes in local clusters that also contain monocistronic germline-expressed genes. Additionally, germline expression of genes in operons is largely independent of the molecular function of the encoded proteins. These analyses demonstrate that mechanisms governing germline gene expression influence operon origination and/or maintenance. Thus, gene expression in a specific tissue can have profound effects on the evolution of genome organization.

  5. Identification and analysis of internal promoters in Caenorhabditis elegans operons.

    Science.gov (United States)

    Huang, Peiming; Pleasance, Erin D; Maydan, Jason S; Hunt-Newbury, Rebecca; O'Neil, Nigel J; Mah, Allan; Baillie, David L; Marra, Marco A; Moerman, Donald G; Jones, Steven J M

    2007-10-01

    The current Caenorhabditis elegans genomic annotation has many genes organized in operons. Using directionally stitched promoterGFP methodology, we have conducted the largest survey to date on the regulatory regions of annotated C. elegans operons and identified 65, over 25% of those studied, with internal promoters. We have termed these operons "hybrid operons." GFP expression patterns driven from internal promoters differ in tissue specificity from expression of operon promoters, and serial analysis of gene expression data reveals that there is a lack of expression correlation between genes in many hybrid operons. The average length of intergenic regions with putative promoter activity in hybrid operons is larger than previous estimates for operons as a whole. Genes with internal promoters are more commonly involved in gene duplications and have a significantly lower incidence of alternative splicing than genes without internal promoters, although we have observed almost all trans-splicing patterns in these two distinct groups. Finally, internal promoter constructs are able to rescue lethal knockout phenotypes, demonstrating their necessity in gene regulation and survival. Our work suggests that hybrid operons are common in the C. elegans genome and that internal promoters influence not only gene organization and expression but also operon evolution.

  6. Operons are a conserved feature of nematode genomes.

    Science.gov (United States)

    Pettitt, Jonathan; Philippe, Lucas; Sarkar, Debjani; Johnston, Christopher; Gothe, Henrike Johanna; Massie, Diane; Connolly, Bernadette; Müller, Berndt

    2014-08-01

    The organization of genes into operons, clusters of genes that are co-transcribed to produce polycistronic pre-mRNAs, is a trait found in a wide range of eukaryotic groups, including multiple animal phyla. Operons are present in the class Chromadorea, one of the two main nematode classes, but their distribution in the other class, the Enoplea, is not known. We have surveyed the genomes of Trichinella spiralis, Trichuris muris, and Romanomermis culicivorax and identified the first putative operons in members of the Enoplea. Consistent with the mechanism of polycistronic RNA resolution in other nematodes, the mRNAs produced by genes downstream of the first gene in the T. spiralis and T. muris operons are trans-spliced to spliced leader RNAs, and we are able to detect polycistronic RNAs derived from these operons. Importantly, a putative intercistronic region from one of these potential enoplean operons confers polycistronic processing activity when expressed as part of a chimeric operon in Caenorhabditis elegans. We find that T. spiralis genes located in operons have an increased likelihood of having operonic C. elegans homologs. However, operon structure in terms of synteny and gene content is not tightly conserved between the two taxa, consistent with models of operon evolution. We have nevertheless identified putative operons conserved between Enoplea and Chromadorea. Our data suggest that operons and "spliced leader" (SL) trans-splicing predate the radiation of the nematode phylum, an inference which is supported by the phylogenetic profile of proteins known to be involved in nematode SL trans-splicing. Copyright © 2014 by the Genetics Society of America.

  7. Computational identification of operon-like transcriptional loci in eukaryotes.

    Science.gov (United States)

    Nannapaneni, Kishore; Ben-Shahar, Yehuda; Keen, Henry L; Welsh, Michael J; Casavant, Thomas L; Scheetz, Todd E

    2013-07-01

    Operons are primarily a bacterial phenomenon, not commonly observed in eukaryotes. However, new research indicates that operons are found in higher organisms as well. There are instances of operons found in C. elegans, Drosophila melanogaster and other eukaryotic species. We developed a prototype using positional, structural and gene expression information to identify candidate operons. We focused our efforts on "trans-spliced" operons in which the pre-mRNA is trans-spliced into individual transcripts and subsequently translated, as widely observed in C. elegans and some instances in Drosophila. We identify several candidate operons in Drosophila melanogaster of which two have been subsequently molecularly validated. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  9. Engineering adherent bacteria by creating a single synthetic curli operon.

    Science.gov (United States)

    Drogue, Benoît; Thomas, Philippe; Balvay, Laurent; Prigent-Combaret, Claire; Dorel, Corinne

    2012-11-16

    The method described here consists in redesigning E. coli adherence properties by assembling the minimum number of curli genes under the control of a strong and metal-overinducible promoter, and in visualizing and quantifying the resulting gain of bacterial adherence. This method applies appropriate engineering principles of abstraction and standardization of synthetic biology, and results in the BBa_K540000 Biobrick (Best new Biobrick device, engineered, iGEM 2011). The first step consists in the design of the synthetic operon devoted to curli overproduction in response to metal, and therefore in increasing the adherence abilities of the wild type strain. The original curli operon was modified in silico in order to optimize transcriptional and translational signals and escape the "natural" regulation of curli. This approach allowed to test with success our current understanding of curli production. Moreover, simplifying the curli regulation by switching the endogenous complex promoter (more than 10 transcriptional regulators identified) to a simple metal-regulated promoter makes adherence much easier to control. The second step includes qualitative and quantitative assessment of adherence abilities by implementation of simple methods. These methods are applicable to a large range of adherent bacteria regardless of biological structures involved in biofilm formation. Adherence test in 24-well polystyrene plates provides a quick preliminary visualization of the bacterial biofilm after crystal violet staining. This qualitative test can be sharpened by the quantification of the percentage of adherence. Such a method is very simple but more accurate than only crystal violet staining as described previously with both a good repeatability and reproducibility. Visualization of GFP-tagged bacteria on glass slides by fluorescence or laser confocal microscopy allows to strengthen the results obtained with the 24-well plate test by direct observation of the phenomenon.

  10. Single nucleotide polymorphism in the genes of mce1 and mce4 operons of Mycobacterium tuberculosis: analysis of clinical isolates and standard reference strains.

    Science.gov (United States)

    Pasricha, Rashmi; Chandolia, Amita; Ponnan, Prija; Saini, Neeraj Kumar; Sharma, Sangeeta; Chopra, Madhu; Basil, Mandira Varma; Brahmachari, Vani; Bose, Mridula

    2011-02-23

    The presence of four mammalian cell entry (mce) operons in Mycobacterium tuberculosis suggests the essentiality of the functions of the genes in these operons. The differential expression of the four mce operons in different phases of in vitro growth and in infected animals reported earlier from our laboratory further justifies the apparent redundancy for these genes in the genome.Here we investigate the extent of polymorphism in eight genes in the mce1 and mce4 operons of M. tuberculosis from four standard reference strains (H37Rv, H37Ra, LVS (Low Virulent Strain) and BCG) and 112 clinical isolates varying in their drug susceptibility profile, analysed by direct sequencing and Sequenom MassARRAY platform. We discovered 20 single nucleotide polymorphisms (SNPs) in the two operons. The comparative analysis of the genes of mce1 and mce4 operons revealed that yrbE1A [Rv0167] was most polymorphic in mce1 operon while yrbE4A [Rv3501c] and lprN [Rv3495c] had the highest number of SNPs in the mce4 operon. Of 20 SNPs, 12 were found to be nonsynonymous and were further analysed for their pathological relevance to M. tuberculosis using web servers PolyPhen and PMut, which predicted five deleterious nonsynonymous SNPs. A mutation from proline to serine at position 359 of the native Mce1A protein was most deleterious as predicted by both PolyPhen and PMut servers. Energy minimization of the structure of native Mce1A protein and mutated protein was performed using InsightII. The mutated Mce1A protein showed structural changes that could account for the effects of this mutation. Our results show that SNPs in the coding sequences of mce1 and mce4 operons in clinical isolates can be significantly high. Moreover, mce4 operon is significantly more polymorphic than mce1 operon (p operon and synonymous substitutions are more in mce4 operon. In silico modeling predict that nonsynonymous SNP at mce1A [Rv0169], a virulence gene could play a pivotal role in causing functional changes in M

  11. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  12. Accurate particle speed prediction by improved particle speed measurement and 3-dimensional particle size and shape characterization technique

    DEFF Research Database (Denmark)

    Cernuschi, Federico; Rothleitner, Christian; Clausen, Sønnik

    2017-01-01

    methods, e.g. laser light scattering, and velocity by the double disk (DD) method. In this article we present two novel techniques, which allow a more accurate measurement of mass, velocity and shape, and we later compare the experimentally obtained flow velocities of particles with a simulation that also...... includes the particle's shape parameter, known as sphericity. Mass and sphericity are obtained from 3-dimensional data with an industrial X-ray computed tomography (CT) scanner. CT data can be used to accurately determine the volume-basis median of the particles (using the volume-equivalent particle......Accurate particle mass and velocity measurement is needed for interpreting test results in erosion tests of materials and coatings. The impact and damage of a surface is influenced by the kinetic energy of a particle, i.e. particle mass and velocity. Particle mass is usually determined with optical...

  13. Accurate long-term prediction of height during the first four years of growth hormone treatment in prepubertal children with growth hormone deficiency or Turner Syndrome.

    Science.gov (United States)

    Ranke, Michael B; Lindberg, Anders; Brosz, Mathias; Kaspers, Stefan; Loftus, Jane; Wollmann, Hartmut; Kołtowska-Haggstrom, Maria; Roelants, Mathieu

    2012-01-01

    The study aim was to develop and validate models for long-term prediction of growth in prepubertal children with idiopathic growth hormone deficiency (GHD) or Turner syndrome (TS) for optimal, cost-effective growth hormone (GH) therapy. Height was predicted by sequential application of annual prediction algorithms for height velocity in cohorts of GHD (n = 664) and TS (n = 607) as documented within KIGS (Pfizer International Growth Database). As height prediction models also require an estimate of weight, new algorithms for weight increase during the first to fourth prepubertal years on GH were developed. When height was predicted from the start of GH treatment, the predicted and observed mean (SD) gain over 4 years was 30.4 (3.4) cm and 30.1 (4.9) cm, respectively, in GHD patients, and 27.2 (2.2) cm and 26.6 (3.5) cm, respectively, in TS patients. For all 4 years, gains of weight SD scores (SDS) were accurately described as a function of weight SDS and observed gain in height SDS (R(2) > 0.89). In GHD and TS patients treated with GH, an accurate prepubertal long-term prediction of height development in groups is possible. Based on this, an optimal individual height outcome could be simulated. Copyright © 2012 S. Karger AG, Basel.

  14. Characterization of the cyn operon in Escherichia coli K12.

    Science.gov (United States)

    Sung, Y C; Fuchs, J A

    1988-10-15

    Escherichia coli can overcome the toxicity of environmental cyanate by hydrolysis of cyanate to ammonia and bicarbonate. This reaction is catalyzed by the enzyme cyanase, encoded by the cynS gene. The nucleotide sequence of cynS has been reported (Sung, Y.-c., Anderson, P. M., and Fuchs, J. A. (1987) J. Bacteriol. 169, 5224-5230). The nucleotide sequence of the complete cyn operon has now been determined. The cyn operon is approximately 2600 base pairs and includes cynT, cynS, and cynX, which encode cyanate permease, cyanase, and a protein of unknown function, respectively. Two cyanate-inducible transcripts of 1500 and 2500 nucleotides, respectively, were detected by Northern blot analysis. S1 nuclease mapping experiments indicated that two different cyn mRNAs have a common 5'-end and two different 3'-ends. One 3'-end was located within the coding region of cynX, whereas the other 3'-end includes the entire DNA sequence of cynX. The longer transcript contained 98 nucleotides complementary to lac mRNA produced by the predominant lac transcription termination sequence. Termination vectors were used to show that both 3'-ends were generated by sequences that caused transcriptional termination in vivo. Expression vectors were used to demonstrate that a protein corresponding to the expected size was synthesized from the DNA fragment containing the open reading frame designated cynX. The predicted amino acid sequence of cynX indicates that it is a very hydrophobic protein. The level of cynX expression was significantly less than that of cynT or cynS expression.

  15. Towards accurate prediction of unbalance response, oil whirl and oil whip of flexible rotors supported by hydrodynamic bearings

    NARCIS (Netherlands)

    Eling, R.P.T.; te Wierik, M.; van Ostayen, R.A.J.; Rixen, D.J.

    2016-01-01

    Journal bearings are used to support rotors in a wide range of applications. In order to ensure reliable operation, accurate analyses of these rotor-bearing systems are crucial. Coupled analysis of the rotor and the journal bearing is essential in the case that the rotor is flexible. The accuracy of

  16. Natural selection for operons depends on genome size.

    Science.gov (United States)

    Nuñez, Pablo A; Romero, Héctor; Farber, Marisa D; Rocha, Eduardo P C

    2013-01-01

    In prokaryotes, genome size is associated with metabolic versatility, regulatory complexity, effective population size, and horizontal transfer rates. We therefore analyzed the covariation of genome size and operon conservation to assess the evolutionary models of operon formation and maintenance. In agreement with previous results, intraoperonic pairs of essential and of highly expressed genes are more conserved. Interestingly, intraoperonic pairs of genes are also more conserved when they encode proteins at similar cell concentrations, suggesting a role of cotranscription in diminishing the cost of waste and shortfall in gene expression. Larger genomes have fewer and smaller operons that are also less conserved. Importantly, lower conservation in larger genomes was observed for all classes of operons in terms of gene expression, essentiality, and balanced protein concentration. We reached very similar conclusions in independent analyses of three major bacterial clades (α- and β-Proteobacteria and Firmicutes). Operon conservation is inversely correlated to the abundance of transcription factors in the genome when controlled for genome size. This suggests a negative association between the complexity of genetic networks and operon conservation. These results show that genome size and/or its proxies are key determinants of the intensity of natural selection for operon organization. Our data fit better the evolutionary models based on the advantage of coregulation than those based on genetic linkage or stochastic gene expression. We suggest that larger genomes with highly complex genetic networks and many transcription factors endure weaker selection for operons than smaller genomes with fewer alternative tools for genetic regulation.

  17. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel(+) strains.IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  18. Metazoan operons accelerate recovery from growth-arrested states.

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L Ryan; Sternberg, Paul W

    2011-06-10

    Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly upregulated during recovery from growth-arrested states. This expression pattern is anticorrelated to nonoperon genes, consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. We provide evidence that operons become advantageous because, by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Random forest algorithm yields accurate quantitative prediction models of benthic light at intertidal sites affected by toxic Lyngbya majuscula blooms

    NARCIS (Netherlands)

    Kehoe, M.J.; O’ Brien, K.; Grinham, A.; Rissik, D.; Ahern, K.S.; Maxwell, P.

    2012-01-01

    It is shown that targeted high frequency monitoring and modern machine learning methods lead to highly predictive models of benthic light flux. A state-of-the-art machine learning technique was used in conjunction with a high frequency data set to calibrate and test predictive benthic lights models

  20. Is it possible to accurately predict outcome of a drop-foot in patients admitted to a hospital stroke unit?

    NARCIS (Netherlands)

    Cioncoloni, D.; Veerbeek, J.M.; van Wegen, E.E.H.; Kwakkel, G.

    2013-01-01

    The aim of this study was to determine whether recovery from a drop-foot at 6 months can be predicted within 72 h after stroke and to investigate the effect of timing on the accuracy of prediction. One hundred and five patients with a first-ever anterior circulation stroke without full voluntary

  1. PSSP-RFE: accurate prediction of protein structural class by recursive feature extraction from PSI-BLAST profile, physical-chemical property and functional annotations.

    Directory of Open Access Journals (Sweden)

    Liqi Li

    Full Text Available Protein structure prediction is critical to functional annotation of the massively accumulated biological sequences, which prompts an imperative need for the development of high-throughput technologies. As a first and key step in protein structure prediction, protein structural class prediction becomes an increasingly challenging task. Amongst most homological-based approaches, the accuracies of protein structural class prediction are sufficiently high for high similarity datasets, but still far from being satisfactory for low similarity datasets, i.e., below 40% in pairwise sequence similarity. Therefore, we present a novel method for accurate and reliable protein structural class prediction for both high and low similarity datasets. This method is based on Support Vector Machine (SVM in conjunction with integrated features from position-specific score matrix (PSSM, PROFEAT and Gene Ontology (GO. A feature selection approach, SVM-RFE, is also used to rank the integrated feature vectors through recursively removing the feature with the lowest ranking score. The definitive top features selected by SVM-RFE are input into the SVM engines to predict the structural class of a query protein. To validate our method, jackknife tests were applied to seven widely used benchmark datasets, reaching overall accuracies between 84.61% and 99.79%, which are significantly higher than those achieved by state-of-the-art tools. These results suggest that our method could serve as an accurate and cost-effective alternative to existing methods in protein structural classification, especially for low similarity datasets.

  2. ADMET evaluation in drug discovery: 15. Accurate prediction of rat oral acute toxicity using relevance vector machine and consensus modeling.

    Science.gov (United States)

    Lei, Tailong; Li, Youyong; Song, Yunlong; Li, Dan; Sun, Huiyong; Hou, Tingjun

    2016-01-01

    Determination of acute toxicity, expressed as median lethal dose (LD50), is one of the most important steps in drug discovery pipeline. Because in vivo assays for oral acute toxicity in mammals are time-consuming and costly, there is thus an urgent need to develop in silico prediction models of oral acute toxicity. In this study, based on a comprehensive data set containing 7314 diverse chemicals with rat oral LD50 values, relevance vector machine (RVM) technique was employed to build the regression models for the prediction of oral acute toxicity in rate, which were compared with those built using other six machine learning approaches, including k-nearest-neighbor regression, random forest (RF), support vector machine, local approximate Gaussian process, multilayer perceptron ensemble, and eXtreme gradient boosting. A subset of the original molecular descriptors and structural fingerprints (PubChem or SubFP) was chosen by the Chi squared statistics. The prediction capabilities of individual QSAR models, measured by q ext (2) for the test set containing 2376 molecules, ranged from 0.572 to 0.659. Considering the overall prediction accuracy for the test set, RVM with Laplacian kernel and RF were recommended to build in silico models with better predictivity for rat oral acute toxicity. By combining the predictions from individual models, four consensus models were developed, yielding better prediction capabilities for the test set (q ext (2) = 0.669-0.689). Finally, some essential descriptors and substructures relevant to oral acute toxicity were identified and analyzed, and they may be served as property or substructure alerts to avoid toxicity. We believe that the best consensus model with high prediction accuracy can be used as a reliable virtual screening tool to filter out compounds with high rat oral acute toxicity. Graphical abstractWorkflow of combinatorial QSAR modelling to predict rat oral acute toxicity.

  3. Nurses and physicians in a medical admission unit can accurately predict mortality of acutely admitted patients: a prospective cohort study.

    Directory of Open Access Journals (Sweden)

    Mikkel Brabrand

    Full Text Available There exist several risk stratification systems for predicting mortality of emergency patients. However, some are complex in clinical use and others have been developed using suboptimal methodology. The objective was to evaluate the capability of the staff at a medical admission unit (MAU to use clinical intuition to predict in-hospital mortality of acutely admitted patients.This is an observational prospective cohort study of adult patients (15 years or older admitted to a MAU at a regional teaching hospital. The nursing staff and physicians predicted in-hospital mortality upon the patients' arrival. We calculated discriminatory power as the area under the receiver-operating-characteristic curve (AUROC and accuracy of prediction (calibration by Hosmer-Lemeshow goodness-of-fit test.We had a total of 2,848 admissions (2,463 patients. 89 (3.1% died while admitted. The nursing staff assessed 2,404 admissions and predicted mortality in 1,820 (63.9%. AUROC was 0.823 (95% CI: 0.762-0.884 and calibration poor. Physicians assessed 738 admissions and predicted mortality in 734 (25.8% of all admissions. AUROC was 0.761 (95% CI: 0.657-0.864 and calibration poor. AUROC and calibration increased with experience. When nursing staff and physicians were in agreement (±5%, discriminatory power was very high, 0.898 (95% CI: 0.773-1.000, and calibration almost perfect. Combining an objective risk prediction score with staff predictions added very little.Using only clinical intuition, staff in a medical admission unit has a good ability to identify patients at increased risk of dying while admitted. When nursing staff and physicians agreed on their prediction, discriminatory power and calibration were excellent.

  4. Accurate and computationally efficient prediction of thermochemical properties of biomolecules using the generalized connectivity-based hierarchy.

    Science.gov (United States)

    Sengupta, Arkajyoti; Ramabhadran, Raghunath O; Raghavachari, Krishnan

    2014-08-14

    In this study we have used the connectivity-based hierarchy (CBH) method to derive accurate heats of formation of a range of biomolecules, 18 amino acids and 10 barbituric acid/uracil derivatives. The hierarchy is based on the connectivity of the different atoms in a large molecule. It results in error-cancellation reaction schemes that are automated, general, and can be readily used for a broad range of organic molecules and biomolecules. Herein, we first locate stable conformational and tautomeric forms of these biomolecules using an accurate level of theory (viz. CCSD(T)/6-311++G(3df,2p)). Subsequently, the heats of formation of the amino acids are evaluated using the CBH-1 and CBH-2 schemes and routinely employed density functionals or wave function-based methods. The calculated heats of formation obtained herein using modest levels of theory and are in very good agreement with those obtained using more expensive W1-F12 and W2-F12 methods on amino acids and G3 results on barbituric acid derivatives. Overall, the present study (a) highlights the small effect of including multiple conformers in determining the heats of formation of biomolecules and (b) in concurrence with previous CBH studies, proves that use of the more effective error-cancelling isoatomic scheme (CBH-2) results in more accurate heats of formation with modestly sized basis sets along with common density functionals or wave function-based methods.

  5. Accurate prediction of protein secondary structure and solvent accessibility by consensus combiners of sequence and structure information

    Directory of Open Access Journals (Sweden)

    Vullo Alessandro

    2007-06-01

    Full Text Available Abstract Background Structural properties of proteins such as secondary structure and solvent accessibility contribute to three-dimensional structure prediction, not only in the ab initio case but also when homology information to known structures is available. Structural properties are also routinely used in protein analysis even when homology is available, largely because homology modelling is lower throughput than, say, secondary structure prediction. Nonetheless, predictors of secondary structure and solvent accessibility are virtually always ab initio. Results Here we develop high-throughput machine learning systems for the prediction of protein secondary structure and solvent accessibility that exploit homology to proteins of known structure, where available, in the form of simple structural frequency profiles extracted from sets of PDB templates. We compare these systems to their state-of-the-art ab initio counterparts, and with a number of baselines in which secondary structures and solvent accessibilities are extracted directly from the templates. We show that structural information from templates greatly improves secondary structure and solvent accessibility prediction quality, and that, on average, the systems significantly enrich the information contained in the templates. For sequence similarity exceeding 30%, secondary structure prediction quality is approximately 90%, close to its theoretical maximum, and 2-class solvent accessibility roughly 85%. Gains are robust with respect to template selection noise, and significant for marginal sequence similarity and for short alignments, supporting the claim that these improved predictions may prove beneficial beyond the case in which clear homology is available. Conclusion The predictive system are publicly available at the address http://distill.ucd.ie.

  6. An evolutionary model-based algorithm for accurate phylogenetic breakpoint mapping and subtype prediction in HIV-1.

    Directory of Open Access Journals (Sweden)

    Sergei L Kosakovsky Pond

    2009-11-01

    Full Text Available Genetically diverse pathogens (such as Human Immunodeficiency virus type 1, HIV-1 are frequently stratified into phylogenetically or immunologically defined subtypes for classification purposes. Computational identification of such subtypes is helpful in surveillance, epidemiological analysis and detection of novel variants, e.g., circulating recombinant forms in HIV-1. A number of conceptually and technically different techniques have been proposed for determining the subtype of a query sequence, but there is not a universally optimal approach. We present a model-based phylogenetic method for automatically subtyping an HIV-1 (or other viral or bacterial sequence, mapping the location of breakpoints and assigning parental sequences in recombinant strains as well as computing confidence levels for the inferred quantities. Our Subtype Classification Using Evolutionary ALgorithms (SCUEAL procedure is shown to perform very well in a variety of simulation scenarios, runs in parallel when multiple sequences are being screened, and matches or exceeds the performance of existing approaches on typical empirical cases. We applied SCUEAL to all available polymerase (pol sequences from two large databases, the Stanford Drug Resistance database and the UK HIV Drug Resistance Database. Comparing with subtypes which had previously been assigned revealed that a minor but substantial (approximately 5% fraction of pure subtype sequences may in fact be within- or inter-subtype recombinants. A free implementation of SCUEAL is provided as a module for the HyPhy package and the Datamonkey web server. Our method is especially useful when an accurate automatic classification of an unknown strain is desired, and is positioned to complement and extend faster but less accurate methods. Given the increasingly frequent use of HIV subtype information in studies focusing on the effect of subtype on treatment, clinical outcome, pathogenicity and vaccine design, the importance

  7. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    Science.gov (United States)

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-03-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria.

  8. Functional analysis of putative operons in Brugia malayi.

    Science.gov (United States)

    Liu, Canhui; Oliveira, Ana; Chauhan, Chitra; Ghedin, Elodie; Unnasch, Thomas R

    2010-01-01

    Operons are a common mode of gene organization in Caenorhabditis elegans. Similar gene arrangements suggest that functional operons may exist in Brugia malayi. To definitively test this hypothesis, a bicistronic reporter vector consisting of an upstream firefly luciferase gene and a downstream renilla luciferase gene was constructed. The genome was then surveyed to identify 15 gene pairs that were likely to represent operons. Two of four domains upstream of the 5' gene from these clusters exhibited promoter activity. When constructs replicating the promoter and intergenic arrangement found in the native putative operon were transfected into embryos, both firefly and renilla activities were detected, while constructs with the promoter alone or intergenic region alone produced no activity from the downstream reporter. These data confirm that functional operons exist in B. malayi. Mutation of three U-rich element homologues present in one of the operons resulted in a decrease in downstream renilla reporter activity, suggesting that these were important in mRNA maturation. Hemi-nested reverse transcriptase-PCR assays demonstrated that while the mRNA encoding the native downstream open reading frame of one operon contained an SL1 spliced leader at its 5' end, the renilla gene mRNA produced from the corresponding transgenic construct did not. Copyright 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  9. Fundamental relationship between operon organization and gene expression

    Science.gov (United States)

    Lim, Han N.; Lee, Yeong; Hussein, Razika

    2011-01-01

    Half a century has passed since the discovery of operons (groups of genes that are transcribed together as a single mRNA). Despite the importance of operons in bacterial gene networks, the relationship between their organization and gene expression remains poorly understood. Here we show using synthetic operons in Escherichia coli that the expression of a given gene increases with the length of the operon and as its position moves farther from the end of the operon. These findings can be explained by a common mechanism; increasing the distance from the start of a gene to the end of the operon (termed the “transcription distance”) provides more time for translation to occur during transcription, resulting in increased expression. We confirmed experimentally that the increased expression is indeed due to increased translation. Furthermore our analysis indicates the translation initiation rate for an mRNA is sixfold greater during transcription than after its release, which amplifies the impact of the transcription distance on gene expression. As a result of these mechanisms, gene expression increases by ∼40% for each 1,000 nucleotides of transcription distance. In summary, we demonstrate that a fundamental relationship exists between gene expression and the number, length, and order of the genes in an operon. This relationship has important implications for understanding the functional basis of genome organization and practical applications for synthetic biology. PMID:21670266

  10. A phylogenomic analysis of the Actinomycetales mce operons

    Directory of Open Access Journals (Sweden)

    Riley Lee W

    2007-02-01

    Full Text Available Abstract Background The genome of Mycobacterium tuberculosis harbors four copies of a cluster of genes termed mce operons. Despite extensive research that has demonstrated the importance of these operons on infection outcome, their physiological function remains obscure. Expanding databases of complete microbial genome sequences facilitate a comparative genomic approach that can provide valuable insight into the role of uncharacterized proteins. Results The M. tuberculosis mce loci each include two yrbE and six mce genes, which have homology to ABC transporter permeases and substrate-binding proteins, respectively. Operons with an identical structure were identified in all Mycobacterium species examined, as well as in five other Actinomycetales genera. Some of the Actinomycetales mce operons include an mkl gene, which encodes an ATPase resembling those of ABC uptake transporters. The phylogenetic profile of Mkl orthologs exactly matched that of the Mce and YrbE proteins. Through topology and motif analyses of YrbE homologs, we identified a region within the penultimate cytoplasmic loop that may serve as the site of interaction with the putative cognate Mkl ATPase. Homologs of the exported proteins encoded adjacent to the M. tuberculosis mce operons were detected in a conserved chromosomal location downstream of the majority of Actinomycetales operons. Operons containing linked mkl, yrbE and mce genes, resembling the classic organization of an ABC importer, were found to be common in Gram-negative bacteria and appear to be associated with changes in properties of the cell surface. Conclusion Evidence presented suggests that the mce operons of Actinomycetales species and related operons in Gram-negative bacteria encode a subfamily of ABC uptake transporters with a possible role in remodeling the cell envelope.

  11. Is demography destiny? Application of machine learning techniques to accurately predict population health outcomes from a minimal demographic dataset.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available For years, we have relied on population surveys to keep track of regional public health statistics, including the prevalence of non-communicable diseases. Because of the cost and limitations of such surveys, we often do not have the up-to-date data on health outcomes of a region. In this paper, we examined the feasibility of inferring regional health outcomes from socio-demographic data that are widely available and timely updated through national censuses and community surveys. Using data for 50 American states (excluding Washington DC from 2007 to 2012, we constructed a machine-learning model to predict the prevalence of six non-communicable disease (NCD outcomes (four NCDs and two major clinical risk factors, based on population socio-demographic characteristics from the American Community Survey. We found that regional prevalence estimates for non-communicable diseases can be reasonably predicted. The predictions were highly correlated with the observed data, in both the states included in the derivation model (median correlation 0.88 and those excluded from the development for use as a completely separated validation sample (median correlation 0.85, demonstrating that the model had sufficient external validity to make good predictions, based on demographics alone, for areas not included in the model development. This highlights both the utility of this sophisticated approach to model development, and the vital importance of simple socio-demographic characteristics as both indicators and determinants of chronic disease.

  12. A Maximal Graded Exercise Test to Accurately Predict VO2max in 18-65-Year-Old Adults

    Science.gov (United States)

    George, James D.; Bradshaw, Danielle I.; Hyde, Annette; Vehrs, Pat R.; Hager, Ronald L.; Yanowitz, Frank G.

    2007-01-01

    The purpose of this study was to develop an age-generalized regression model to predict maximal oxygen uptake (VO sub 2 max) based on a maximal treadmill graded exercise test (GXT; George, 1996). Participants (N = 100), ages 18-65 years, reached a maximal level of exertion (mean plus or minus standard deviation [SD]; maximal heart rate [HR sub…

  13. Combined AFP-CRUT with microvascular invasion accurately predicts mortality risk in patients with hepatocellular carcinoma following curative liver resection.

    Science.gov (United States)

    Huang, Gui-Qian; Zhu, Gui-Qi; Huang, Sha; You, Jie; Shi, Ke-Qing; Hu, Bin; Ruan, Lu-Yi; Zhou, Meng-Tao; Braddock, Martin; Zheng, Ming-Hua

    2015-01-01

    To establish and validate an equation of α-fetoprotein (AFP) change rate over unit time (AFP-CRUT) as a potential predictor of survival after resection in patients with hepatocellular carcinoma (HCC). The AFP-CRUT was constructed based on dynamic variation in AFP over time and then categorized into quintiles. The area under the receiver operating characteristic (ROC) curve showed the performance for survival prediction. As independent risk factors associated with mortality, microvascular invasion (MVI) (p = 0.003) and AFP-CRUT quintiles (p = 0.048) were combined to enhance the predictive effect. The highest 5-year overall survival rate following curative liver resection (93%) was observed in patients with MVI absent and AFP-CRUT in quintile 1 (49.64 to 209.61). In contrast, the lowest 5-year overall survival (7%) was obtained in quintile 5 (-469.29 to 6.45) with MVI present. In validation cohorts at both 12 and 24 months, AFP-CRUT performed well as a potential prognostic biomarker. Combining AFP-CRUT quintiles with MVI may predict significantly improved outcomes and enhance the predictive power for patient responses to therapeutic intervention.

  14. Should clinicians use average or peak scores on a dynamic risk-assessment measure to most accurately predict inpatient aggression?

    Science.gov (United States)

    Chu, Chi Meng; Thomas, Stuart D M; Daffern, Michael; Ogloff, James R P

    2013-12-01

    Recent advancements in risk assessment have led to the development of dynamic risk-assessment measures that are predictive of inpatient aggression in the short term. However, there are several areas within this field that warrant further empirical investigation, including whether the average, maximum, or most recent risk state assessment is the most valid for predicting subsequent aggression in the medium term. This prospective study compared the predictive validity of three indices (i.e. mean score, peak score, and most recent single time-point rating) of the Dynamic Appraisal of Situational Aggression (DASA) for inpatient aggression. Daily risk ratings were completed for 60 psychiatric inpatients (from the acute wards of a forensic psychiatric hospital) for up to 6 months; a total of 1054 DASA ratings were obtained. Results showed that mean and peak scores on the DASA were better predictors of interpersonal violence, verbal threat, and any inpatient aggression than the DASA single time-point most recent ratings. Overall, the results support the use of the prior week's mean and peak scores to aid the prediction of inpatient aggression within inpatient forensic psychiatric settings in the short to medium term. These results also have practical implications for clinicians considering risk-management strategies and the scoring of clinically-relevant items on risk-assessment measures. © 2012 The Authors; International Journal of Mental Health Nursing © 2012 Australian College of Mental Health Nurses Inc.

  15. Formation of NO from N2/O2 mixtures in a flow reactor: Toward an accurate prediction of thermal NO

    DEFF Research Database (Denmark)

    Abian, Maria; Alzueta, Maria U.; Glarborg, Peter

    2015-01-01

    We have conducted flow reactor experiments for NO formation from N2/O2 mixtures at high temperatures and atmospheric pressure, controlling accurately temperature and reaction time. Under these conditions, atomic oxygen equilibrates rapidly with O2. The experimental results were interpreted...... by a detailed chemical model to determine the rate constant for the reaction N2 + O ⇌ NO + N (R1). We obtain k1 = 1.4 × 1014 exp(-38,300/T) cm3 mol-1 s-1 at 1700-1800 K, with an error limit of ±30%. This value is 25% below the recommendation of Baulch et al. for k1, while it corresponds to a value k1b...

  16. From dimer to condensed phases at extreme conditions: accurate predictions of the properties of water by a Gaussian charge polarizable model.

    Science.gov (United States)

    Paricaud, Patrice; Predota, Milan; Chialvo, Ariel A; Cummings, Peter T

    2005-06-22

    Water exhibits many unusual properties that are essential for the existence of life. Water completely changes its character from ambient to supercritical conditions in a way that makes it possible to sustain life at extreme conditions, leading to conjectures that life may have originated in deep-sea vents. Molecular simulation can be very useful in exploring biological and chemical systems, particularly at extreme conditions for which experiments are either difficult or impossible; however this scenario entails an accurate molecular model for water applicable over a wide range of state conditions. Here, we present a Gaussian charge polarizable model (GCPM) based on the model developed earlier by Chialvo and Cummings [Fluid Phase Equilib. 150, 73 (1998)] which is, to our knowledge, the first that satisfies the water monomer and dimer properties, and simultaneously yields very accurate predictions of dielectric, structural, vapor-liquid equilibria, and transport properties, over the entire fluid range. This model would be appropriate for simulating biological and chemical systems at both ambient and extreme conditions. The particularity of the GCPM model is the use of Gaussian distributions instead of points to represent the partial charges on the water molecules. These charge distributions combined with a dipole polarizability and a Buckingham exp-6 potential are found to play a crucial role for the successful and simultaneous predictions of a variety of water properties. This work not only aims at presenting an accurate model for water, but also at proposing strategies to develop classical accurate models for the predictions of structural, dynamic, and thermodynamic properties.

  17. Accurate prediction of the electronic properties of low-dimensional graphene derivatives using a screened hybrid density functional.

    Science.gov (United States)

    Barone, Veronica; Hod, Oded; Peralta, Juan E; Scuseria, Gustavo E

    2011-04-19

    Over the last several years, low-dimensional graphene derivatives, such as carbon nanotubes and graphene nanoribbons, have played a central role in the pursuit of a plausible carbon-based nanotechnology. Their electronic properties can be either metallic or semiconducting depending purely on morphology, but predicting their electronic behavior has proven challenging. The combination of experimental efforts with modeling of these nanometer-scale structures has been instrumental in gaining insight into their physical and chemical properties and the processes involved at these scales. Particularly, approximations based on density functional theory have emerged as a successful computational tool for predicting the electronic structure of these materials. In this Account, we review our efforts in modeling graphitic nanostructures from first principles with hybrid density functionals, namely the Heyd-Scuseria-Ernzerhof (HSE) screened exchange hybrid and the hybrid meta-generalized functional of Tao, Perdew, Staroverov, and Scuseria (TPSSh). These functionals provide a powerful tool for quantitatively studying structure-property relations and the effects of external perturbations such as chemical substitutions, electric and magnetic fields, and mechanical deformations on the electronic and magnetic properties of these low-dimensional carbon materials. We show how HSE and TPSSh successfully predict the electronic properties of these materials, providing a good description of their band structure and density of states, their work function, and their magnetic ordering in the cases in which magnetism arises. Moreover, these approximations are capable of successfully predicting optical transitions (first and higher order) in both metallic and semiconducting single-walled carbon nanotubes of various chiralities and diameters with impressive accuracy. This versatility includes the correct prediction of the trigonal warping splitting in metallic nanotubes. The results predicted

  18. Accurate prediction of secreted substrates and identification of a conserved putative secretion signal for type III secretion systems.

    Directory of Open Access Journals (Sweden)

    Ram Samudrala

    2009-04-01

    Full Text Available The type III secretion system is an essential component for virulence in many Gram-negative bacteria. Though components of the secretion system apparatus are conserved, its substrates--effector proteins--are not. We have used a novel computational approach to confidently identify new secreted effectors by integrating protein sequence-based features, including evolutionary measures such as the pattern of homologs in a range of other organisms, G+C content, amino acid composition, and the N-terminal 30 residues of the protein sequence. The method was trained on known effectors from the plant pathogen Pseudomonas syringae and validated on a set of effectors from the animal pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium after eliminating effectors with detectable sequence similarity. We show that this approach can predict known secreted effectors with high specificity and sensitivity. Furthermore, by considering a large set of effectors from multiple organisms, we computationally identify a common putative secretion signal in the N-terminal 20 residues of secreted effectors. This signal can be used to discriminate 46 out of 68 total known effectors from both organisms, suggesting that it is a real, shared signal applicable to many type III secreted effectors. We use the method to make novel predictions of secreted effectors in S. Typhimurium, some of which have been experimentally validated. We also apply the method to predict secreted effectors in the genetically intractable human pathogen Chlamydia trachomatis, identifying the majority of known secreted proteins in addition to providing a number of novel predictions. This approach provides a new way to identify secreted effectors in a broad range of pathogenic bacteria for further experimental characterization and provides insight into the nature of the type III secretion signal.

  19. An Optimized Method for Accurate Fetal Sex Prediction and Sex Chromosome Aneuploidy Detection in Non-Invasive Prenatal Testing.

    Science.gov (United States)

    Wang, Ting; He, Quanze; Li, Haibo; Ding, Jie; Wen, Ping; Zhang, Qin; Xiang, Jingjing; Li, Qiong; Xuan, Liming; Kong, Lingyin; Mao, Yan; Zhu, Yijun; Shen, Jingjing; Liang, Bo; Li, Hong

    2016-01-01

    Massively parallel sequencing (MPS) combined with bioinformatic analysis has been widely applied to detect fetal chromosomal aneuploidies such as trisomy 21, 18, 13 and sex chromosome aneuploidies (SCAs) by sequencing cell-free fetal DNA (cffDNA) from maternal plasma, so-called non-invasive prenatal testing (NIPT). However, many technical challenges, such as dependency on correct fetal sex prediction, large variations of chromosome Y measurement and high sensitivity to random reads mapping, may result in higher false negative rate (FNR) and false positive rate (FPR) in fetal sex prediction as well as in SCAs detection. Here, we developed an optimized method to improve the accuracy of the current method by filtering out randomly mapped reads in six specific regions of the Y chromosome. The method reduces the FNR and FPR of fetal sex prediction from nearly 1% to 0.01% and 0.06%, respectively and works robustly under conditions of low fetal DNA concentration (1%) in testing and simulation of 92 samples. The optimized method was further confirmed by large scale testing (1590 samples), suggesting that it is reliable and robust enough for clinical testing.

  20. An Optimized Method for Accurate Fetal Sex Prediction and Sex Chromosome Aneuploidy Detection in Non-Invasive Prenatal Testing.

    Directory of Open Access Journals (Sweden)

    Ting Wang

    Full Text Available Massively parallel sequencing (MPS combined with bioinformatic analysis has been widely applied to detect fetal chromosomal aneuploidies such as trisomy 21, 18, 13 and sex chromosome aneuploidies (SCAs by sequencing cell-free fetal DNA (cffDNA from maternal plasma, so-called non-invasive prenatal testing (NIPT. However, many technical challenges, such as dependency on correct fetal sex prediction, large variations of chromosome Y measurement and high sensitivity to random reads mapping, may result in higher false negative rate (FNR and false positive rate (FPR in fetal sex prediction as well as in SCAs detection. Here, we developed an optimized method to improve the accuracy of the current method by filtering out randomly mapped reads in six specific regions of the Y chromosome. The method reduces the FNR and FPR of fetal sex prediction from nearly 1% to 0.01% and 0.06%, respectively and works robustly under conditions of low fetal DNA concentration (1% in testing and simulation of 92 samples. The optimized method was further confirmed by large scale testing (1590 samples, suggesting that it is reliable and robust enough for clinical testing.

  1. Accurate microRNA target prediction using detailed binding site accessibility and machine learning on proteomics data

    Directory of Open Access Journals (Sweden)

    Martin eReczko

    2012-01-01

    Full Text Available MicroRNAs (miRNAs are a class of small regulatory genes regulating gene expression by targetingmessenger RNA. Though computational methods for miRNA target prediction are the prevailingmeans to analyze their function, they still miss a large fraction of the targeted genes and additionallypredict a large number of false positives. Here we introduce a novel algorithm called DIANAmicroT-ANN which combines multiple novel target site features through an artificial neural network(ANN and is trained using recently published high-throughput data measuring the change of proteinlevels after miRNA overexpression, providing positive and negative targeting examples. The featurescharacterizing each miRNA recognition element include binding structure, conservation level and aspecific profile of structural accessibility. The ANN is trained to integrate the features of eachrecognition element along the 3’ untranslated region into a targeting score, reproducing the relativerepression fold change of the protein. Tested on two different sets the algorithm outperforms otherwidely used algorithms and also predicts a significant number of unique and reliable targets notpredicted by the other methods. For 542 human miRNAs DIANA-microT-ANN predicts 120,000targets not provided by TargetScan 5.0. The algorithm is freely available athttp://microrna.gr/microT-ANN.

  2. Central venous parathyroid hormone monitoring using a novel, specific anatomic method accurately predicts cure during minimally invasive parathyroidectomy.

    Science.gov (United States)

    Edwards, Courtney M; Folek, Jessica; Dayawansa, Samantha; Govednik, Cara M; Quinn, Courtney E; Sigmond, Benjamin R; Lee, Cortney Y; Angel, Melissa S; Hendricks, John C; Lairmore, Terry C

    2016-12-01

    Measurement of intraoperative parathyroid hormone (PTH) levels is an important adjunct to confirm biochemical cure during parathyroidectomy. The purpose of this study was to evaluate a simplified anatomic technique for PTH sampling from the central veins through the minimally invasive neck incision, and to compare the predictive accuracy of central and peripheral PTH values. A specific anatomic method for central PTH sampling was employed in 48 patients. Samples were drawn simultaneously from peripheral and central veins at baseline and 10 minutes postexcision of all hyperfunctioning parathyroid glands. The central venous PTH levels independently predicted biochemical cure according to the Miami criterion in all the patients. There was no significant difference in the postexcision central and peripheral values, which were 24.40 + 1.86 and 21.69 + 1.74, respectively (P = .877, ANOVA test). This study provides the original description of a simplified technique for measurement of intraoperative PTH levels in the central veins with direct comparison to peripheral venous levels, and confirmation of accuracy in predicting biochemical cure when relying on centrally obtained values alone. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. IPMiner: hidden ncRNA-protein interaction sequential pattern mining with stacked autoencoder for accurate computational prediction.

    Science.gov (United States)

    Pan, Xiaoyong; Fan, Yong-Xian; Yan, Junchi; Shen, Hong-Bin

    2016-08-09

    Non-coding RNAs (ncRNAs) play crucial roles in many biological processes, such as post-transcription of gene regulation. ncRNAs mainly function through interaction with RNA binding proteins (RBPs). To understand the function of a ncRNA, a fundamental step is to identify which protein is involved into its interaction. Therefore it is promising to computationally predict RBPs, where the major challenge is that the interaction pattern or motif is difficult to be found. In this study, we propose a computational method IPMiner (Interaction Pattern Miner) to predict ncRNA-protein interactions from sequences, which makes use of deep learning and further improves its performance using stacked ensembling. One of the IPMiner's typical merits is that it is able to mine the hidden sequential interaction patterns from sequence composition features of protein and RNA sequences using stacked autoencoder, and then the learned hidden features are fed into random forest models. Finally, stacked ensembling is used to integrate different predictors to further improve the prediction performance. The experimental results indicate that IPMiner achieves superior performance on the tested lncRNA-protein interaction dataset with an accuracy of 0.891, sensitivity of 0.939, specificity of 0.831, precision of 0.945 and Matthews correlation coefficient of 0.784, respectively. We further comprehensively investigate IPMiner on other RNA-protein interaction datasets, which yields better performance than the state-of-the-art methods, and the performance has an increase of over 20 % on some tested benchmarked datasets. In addition, we further apply IPMiner for large-scale prediction of ncRNA-protein network, that achieves promising prediction performance. By integrating deep neural network and stacked ensembling, from simple sequence composition features, IPMiner can automatically learn high-level abstraction features, which had strong discriminant ability for RNA-protein detection. IPMiner achieved

  4. Which dialysis unit blood pressure is the most accurate for predicting home blood pressure in patients undergoing hemodialysis?

    Science.gov (United States)

    Yoon, In-Cheol; Choi, Hye-Min; Oh, Dong-Jin

    2017-01-01

    We investigated which dialysis unit blood pressure (BP) is the most useful for predicting home BP in patients undergoing hemodialysis (HD). Patients undergoing HD who had been treated > 3 months were included in this study. Exclusion criteria were hospitalized patients with acute illness and changes in dry weight and anti-hypertensive drugs 2 weeks before the study. We used the dialysis unit BP recording data, such as pre-HD, intra-HD, post-HD, mean pre-HD, and post-HD (pre-post-HD), mean pre-HD, intra-HD, and post-HD (pre-intra-post-HD) BP. Home BP (the same period of dialysis unit BP) was monitored as a reference method during 2 weeks using the same automatic oscillometric device. Patients were asked to record their BP three times daily (wake up, between noon and 6:00 PM, and at bedtime). Significant differences were detected between home systolic blood pressure (SBP) and pre-HD, post-HD, and intra-HD SBP (p = 0.003, p = 0.001, p = 0.016, respectively). In contrast, no differences were observed between home SBP and pre-intra-post-HD and pre-post-HD SBP (p = 0.235, p = 0.307, respectively). Areas under the receiver operating characteristic curve for pre-intra-post-HD and prepost-HD SBP with 2-week home BP as the reference standard were 0.812 and 0.801, respectively. These results suggest that pre-intra-post-HD and pre-post-HD SBP had similar accuracy for predicting mean 2-week home SBP in HD patients. Therefore, pre-intra-post-HD and pre-post-HD SBP should be useful for predicting home SBP in HD patients if ambulatory or home BP measurements are unavailable.

  5. Accuration of Time Series and Spatial Interpolation Method for Prediction of Precipitation Distribution on the Geographical Information System

    Science.gov (United States)

    Prasetyo, S. Y. J.; Hartomo, K. D.

    2018-01-01

    The Spatial Plan of the Province of Central Java 2009-2029 identifies that most regencies or cities in Central Java Province are very vulnerable to landslide disaster. The data are also supported by other data from Indonesian Disaster Risk Index (In Indonesia called Indeks Risiko Bencana Indonesia) 2013 that suggest that some areas in Central Java Province exhibit a high risk of natural disasters. This research aims to develop an application architecture and analysis methodology in GIS to predict and to map rainfall distribution. We propose our GIS architectural application of “Multiplatform Architectural Spatiotemporal” and data analysis methods of “Triple Exponential Smoothing” and “Spatial Interpolation” as our significant scientific contribution. This research consists of 2 (two) parts, namely attribute data prediction using TES method and spatial data prediction using Inverse Distance Weight (IDW) method. We conduct our research in 19 subdistricts in the Boyolali Regency, Central Java Province, Indonesia. Our main research data is the biweekly rainfall data in 2000-2016 Climatology, Meteorology, and Geophysics Agency (In Indonesia called Badan Meteorologi, Klimatologi, dan Geofisika) of Central Java Province and Laboratory of Plant Disease Observations Region V Surakarta, Central Java. The application architecture and analytical methodology of “Multiplatform Architectural Spatiotemporal” and spatial data analysis methodology of “Triple Exponential Smoothing” and “Spatial Interpolation” can be developed as a GIS application framework of rainfall distribution for various applied fields. The comparison between the TES and IDW methods show that relative to time series prediction, spatial interpolation exhibit values that are approaching actual. Spatial interpolation is closer to actual data because computed values are the rainfall data of the nearest location or the neighbour of sample values. However, the IDW’s main weakness is that some

  6. A Simple PB/LIE Free Energy Function Accurately Predicts the Peptide Binding Specificity of the Tiam1 PDZ Domain

    Directory of Open Access Journals (Sweden)

    Nicolas Panel

    2017-09-01

    Full Text Available PDZ domains generally bind short amino acid sequences at the C-terminus of target proteins, and short peptides can be used as inhibitors or model ligands. Here, we used experimental binding assays and molecular dynamics simulations to characterize 51 complexes involving the Tiam1 PDZ domain and to test the performance of a semi-empirical free energy function. The free energy function combined a Poisson-Boltzmann (PB continuum electrostatic term, a van der Waals interaction energy, and a surface area term. Each term was empirically weighted, giving a Linear Interaction Energy or “PB/LIE” free energy. The model yielded a mean unsigned deviation of 0.43 kcal/mol and a Pearson correlation of 0.64 between experimental and computed free energies, which was superior to a Null model that assumes all complexes have the same affinity. Analyses of the models support several experimental observations that indicate the orientation of the α2 helix is a critical determinant for peptide specificity. The models were also used to predict binding free energies for nine new variants, corresponding to point mutants of the Syndecan1 and Caspr4 peptides. The predictions did not reveal improved binding; however, they suggest that an unnatural amino acid could be used to increase protease resistance and peptide lifetimes in vivo. The overall performance of the model should allow its use in the design of new PDZ ligands in the future.

  7. A Simple PB/LIE Free Energy Function Accurately Predicts the Peptide Binding Specificity of the Tiam1 PDZ Domain.

    Science.gov (United States)

    Panel, Nicolas; Sun, Young Joo; Fuentes, Ernesto J; Simonson, Thomas

    2017-01-01

    PDZ domains generally bind short amino acid sequences at the C-terminus of target proteins, and short peptides can be used as inhibitors or model ligands. Here, we used experimental binding assays and molecular dynamics simulations to characterize 51 complexes involving the Tiam1 PDZ domain and to test the performance of a semi-empirical free energy function. The free energy function combined a Poisson-Boltzmann (PB) continuum electrostatic term, a van der Waals interaction energy, and a surface area term. Each term was empirically weighted, giving a Linear Interaction Energy or "PB/LIE" free energy. The model yielded a mean unsigned deviation of 0.43 kcal/mol and a Pearson correlation of 0.64 between experimental and computed free energies, which was superior to a Null model that assumes all complexes have the same affinity. Analyses of the models support several experimental observations that indicate the orientation of the α2 helix is a critical determinant for peptide specificity. The models were also used to predict binding free energies for nine new variants, corresponding to point mutants of the Syndecan1 and Caspr4 peptides. The predictions did not reveal improved binding; however, they suggest that an unnatural amino acid could be used to increase protease resistance and peptide lifetimes in vivo. The overall performance of the model should allow its use in the design of new PDZ ligands in the future.

  8. Generalized spin-ratio scaled MP2 method for accurate prediction of intermolecular interactions for neutral and ionic species.

    Science.gov (United States)

    Tan, Samuel; Barrera Acevedo, Santiago; Izgorodina, Ekaterina I

    2017-02-14

    The accurate calculation of intermolecular interactions is important to our understanding of properties in large molecular systems. The high computational cost of the current "gold standard" method, coupled cluster with singles and doubles and perturbative triples (CCSD(T), limits its application to small- to medium-sized systems. Second-order Møller-Plesset perturbation (MP2) theory is a cheaper alternative for larger systems, although at the expense of its decreased accuracy, especially when treating van der Waals complexes. In this study, a new modification of the spin-component scaled MP2 method was proposed for a wide range of intermolecular complexes including two well-known datasets, S22 and S66, and a large dataset of ionic liquids consisting of 174 single ion pairs, IL174. It was found that the spin ratio, ϵΔs=EINT(OS)EINT(SS), calculated as the ratio of the opposite-spin component to the same-spin component of the interaction correlation energy fell in the range of 0.1 and 1.6, in contrast to the range of 3-4 usually observed for the ratio of absolute correlation energy, ϵs=EOSESS, in individual molecules. Scaled coefficients were found to become negative when the spin ratio fell in close proximity to 1.0, and therefore, the studied intermolecular complexes were divided into two groups: (1) complexes with ϵΔsratio scaled second-order Møller-Plesset perturbation, treats both dispersion-driven and hydrogen-bonded complexes equally well, thus validating its robustness with respect to the interaction type ranging from ionic to neutral species at minimal computational cost.

  9. Can Fan-Beam Interactive Computed Tomography Accurately Predict Indirect Decompression in Minimally Invasive Spine Surgery Fusion Procedures?

    Science.gov (United States)

    Janssen, Insa; Lang, Gernot; Navarro-Ramirez, Rodrigo; Jada, Ajit; Berlin, Connor; Hilis, Aaron; Zubkov, Micaella; Gandevia, Lena; Härtl, Roger

    2017-11-01

    Recently, novel mobile intraoperative fan-beam computed tomography (CT) was introduced, allowing for real-time navigation and immediate intraoperative evaluation of neural decompression in spine surgery. This study sought to investigate whether intraoperatively assessed neural decompression during minimally invasive spine surgery (MISS) has a predictive value for clinical and radiographic outcome. A retrospective study of patients undergoing intraoperative CT (iCT)-guided extreme lateral interbody fusion or transforaminal lumbar interbody fusion was conducted. 1) Preoperative, 2) intraoperative (after cage implantation, 3) postoperative, and 4) follow-up radiographic and clinical parameters obtained from radiography or CT were quantified. Thirty-four patients (41 spinal segments) were analyzed. iCT-based navigation was successfully accomplished in all patients. Radiographic parameters showed significant improvement from preoperatively to intraoperatively after cage implantation in both MISS procedures (extreme lateral interbody fusion/transforaminal lumbar interbody fusion) (P ≤ 0.05). Radiologic parameters for both MISS fusion procedures did not show significant differences to the assessed radiographic measures at follow-up (P > 0.05). Radiologic outcome values did not decrease when compared intraoperatively (after cage implantation) to latest follow-up. Intraoperative fan-beam CT is capable of assessing neural decompression intraoperatively with high accuracy, allowing for precise prediction of radiologic outcome and earliest possible feedback during MISS fusion procedures. These findings are highly valuable for routine practice and future investigations toward finding a threshold for neural decompression that translates into clinical improvement. If sufficient neural decompression has been confirmed with iCT imaging studies, additional postoperative and/or follow-up imaging studies might no longer be required if patients remain asymptomatic. Copyright © 2017

  10. Statistical analysis of the spatial distribution of operons in the transcriptional regulation network of Escherichia coli

    OpenAIRE

    Warren, P. B.; Wolde, P.R. ten

    2003-01-01

    We have performed a statistical analysis of the spatial distribution of operons in the transcriptional regulation network of Escherichia coli. The analysis reveals that operons that regulate each other and operons that are coregulated tend to lie next to each other on the genome. Moreover, these pairs of operons tend to be transcribed in diverging directions. This spatial arrangement of operons allows the upstream regulatory regions to interfere with each other. This affords additional regula...

  11. Generalized spin-ratio scaled MP2 method for accurate prediction of intermolecular interactions for neutral and ionic species

    Science.gov (United States)

    Tan, Samuel; Barrera Acevedo, Santiago; Izgorodina, Ekaterina I.

    2017-02-01

    The accurate calculation of intermolecular interactions is important to our understanding of properties in large molecular systems. The high computational cost of the current "gold standard" method, coupled cluster with singles and doubles and perturbative triples (CCSD(T), limits its application to small- to medium-sized systems. Second-order Møller-Plesset perturbation (MP2) theory is a cheaper alternative for larger systems, although at the expense of its decreased accuracy, especially when treating van der Waals complexes. In this study, a new modification of the spin-component scaled MP2 method was proposed for a wide range of intermolecular complexes including two well-known datasets, S22 and S66, and a large dataset of ionic liquids consisting of 174 single ion pairs, IL174. It was found that the spin ratio, ɛΔ s=E/INT O SEIN T S S , calculated as the ratio of the opposite-spin component to the same-spin component of the interaction correlation energy fell in the range of 0.1 and 1.6, in contrast to the range of 3-4 usually observed for the ratio of absolute correlation energy, ɛs=E/OSES S , in individual molecules. Scaled coefficients were found to become negative when the spin ratio fell in close proximity to 1.0, and therefore, the studied intermolecular complexes were divided into two groups: (1) complexes with ɛΔ s< 1 and (2) complexes with ɛΔ s≥ 1 . A separate set of coefficients was obtained for both groups. Exclusion of counterpoise correction during scaling was found to produce superior results due to decreased error. Among a series of Dunning's basis sets, cc-pVTZ and cc-pVQZ were found to be the best performing ones, with a mean absolute error of 1.4 kJ mol-1 and maximum errors below 6.2 kJ mol-1. The new modification, spin-ratio scaled second-order Møller-Plesset perturbation, treats both dispersion-driven and hydrogen-bonded complexes equally well, thus validating its robustness with respect to the interaction type ranging from ionic

  12. Integrating metabolic performance, thermal tolerance, and plasticity enables for more accurate predictions on species vulnerability to acute and chronic effects of global warming.

    Science.gov (United States)

    Magozzi, Sarah; Calosi, Piero

    2015-01-01

    Predicting species vulnerability to global warming requires a comprehensive, mechanistic understanding of sublethal and lethal thermal tolerances. To date, however, most studies investigating species physiological responses to increasing temperature have focused on the underlying physiological traits of either acute or chronic tolerance in isolation. Here we propose an integrative, synthetic approach including the investigation of multiple physiological traits (metabolic performance and thermal tolerance), and their plasticity, to provide more accurate and balanced predictions on species and assemblage vulnerability to both acute and chronic effects of global warming. We applied this approach to more accurately elucidate relative species vulnerability to warming within an assemblage of six caridean prawns occurring in the same geographic, hence macroclimatic, region, but living in different thermal habitats. Prawns were exposed to four incubation temperatures (10, 15, 20 and 25 °C) for 7 days, their metabolic rates and upper thermal limits were measured, and plasticity was calculated according to the concept of Reaction Norms, as well as Q10 for metabolism. Compared to species occupying narrower/more stable thermal niches, species inhabiting broader/more variable thermal environments (including the invasive Palaemon macrodactylus) are likely to be less vulnerable to extreme acute thermal events as a result of their higher upper thermal limits. Nevertheless, they may be at greater risk from chronic exposure to warming due to the greater metabolic costs they incur. Indeed, a trade-off between acute and chronic tolerance was apparent in the assemblage investigated. However, the invasive species P. macrodactylus represents an exception to this pattern, showing elevated thermal limits and plasticity of these limits, as well as a high metabolic control. In general, integrating multiple proxies for species physiological acute and chronic responses to increasing

  13. Reliable and accurate point-based prediction of cumulative infiltration using soil readily available characteristics: A comparison between GMDH, ANN, and MLR

    Science.gov (United States)

    Rahmati, Mehdi

    2017-08-01

    Developing accurate and reliable pedo-transfer functions (PTFs) to predict soil non-readily available characteristics is one of the most concerned topic in soil science and selecting more appropriate predictors is a crucial factor in PTFs' development. Group method of data handling (GMDH), which finds an approximate relationship between a set of input and output variables, not only provide an explicit procedure to select the most essential PTF input variables, but also results in more accurate and reliable estimates than other mostly applied methodologies. Therefore, the current research was aimed to apply GMDH in comparison with multivariate linear regression (MLR) and artificial neural network (ANN) to develop several PTFs to predict soil cumulative infiltration point-basely at specific time intervals (0.5-45 min) using soil readily available characteristics (RACs). In this regard, soil infiltration curves as well as several soil RACs including soil primary particles (clay (CC), silt (Si), and sand (Sa)), saturated hydraulic conductivity (Ks), bulk (Db) and particle (Dp) densities, organic carbon (OC), wet-aggregate stability (WAS), electrical conductivity (EC), and soil antecedent (θi) and field saturated (θfs) water contents were measured at 134 different points in Lighvan watershed, northwest of Iran. Then, applying GMDH, MLR, and ANN methodologies, several PTFs have been developed to predict cumulative infiltrations using two sets of selected soil RACs including and excluding Ks. According to the test data, results showed that developed PTFs by GMDH and MLR procedures using all soil RACs including Ks resulted in more accurate (with E values of 0.673-0.963) and reliable (with CV values lower than 11 percent) predictions of cumulative infiltrations at different specific time steps. In contrast, ANN procedure had lower accuracy (with E values of 0.356-0.890) and reliability (with CV values up to 50 percent) compared to GMDH and MLR. The results also revealed

  14. Deterministic and stochastic population-level simulations of an artificial lac operon genetic network

    Directory of Open Access Journals (Sweden)

    Zygourakis Kyriacos

    2011-07-01

    Full Text Available Abstract Background The lac operon genetic switch is considered as a paradigm of genetic regulation. This system has a positive feedback loop due to the LacY permease boosting its own production by the facilitated transport of inducer into the cell and the subsequent de-repression of the lac operon genes. Previously, we have investigated the effect of stochasticity in an artificial lac operon network at the single cell level by comparing corresponding deterministic and stochastic kinetic models. Results This work focuses on the dynamics of cell populations by incorporating the above kinetic scheme into two Monte Carlo (MC simulation frameworks. The first MC framework assumes stochastic reaction occurrence, accounts for stochastic DNA duplication, division and partitioning and tracks all daughter cells to obtain the statistics of the entire cell population. In order to better understand how stochastic effects shape cell population distributions, we develop a second framework that assumes deterministic reaction dynamics. By comparing the predictions of the two frameworks, we conclude that stochasticity can create or destroy bimodality, and may enhance phenotypic heterogeneity. Conclusions Our results show how various sources of stochasticity act in synergy with the positive feedback architecture, thereby shaping the behavior at the cell population level. Further, the insights obtained from the present study allow us to construct simpler and less computationally intensive models that can closely approximate the dynamics of heterogeneous cell populations.

  15. HDL size is more accurate than HDL cholesterol to predict carotid subclinical atherosclerosis in individuals classified as low cardiovascular risk.

    Science.gov (United States)

    Parra, Eliane Soler; Panzoldo, Natalia Baratella; Zago, Vanessa Helena de Souza; Scherrer, Daniel Zanetti; Alexandre, Fernanda; Bakkarat, Jamal; Nunes, Valeria Sutti; Nakandakare, Edna Regina; Quintão, Eder Carlos Rocha; Nadruz-Jr, Wilson; de Faria, Eliana Cotta; Sposito, Andrei C

    2014-01-01

    Misclassification of patients as low cardiovascular risk (LCR) remains a major concern and challenges the efficacy of traditional risk markers. Due to its strong association with cholesterol acceptor capacity, high-density lipoprotein (HDL) size has been appointed as a potential risk marker. Hence, we investigate whether HDL size improves the predictive value of HDL-cholesterol in the identification of carotid atherosclerotic burden in individuals stratified to be at LCR. 284 individuals (40-75 years) classified as LCR by the current US guidelines were selected in a three-step procedure from primary care centers of the cities of Campinas and Americana, SP, Brazil. Apolipoprotein B-containing lipoproteins were precipitated by polyethylene glycol and HDL size was measured by dynamic light scattering (DLS) technique. Participants were classified in tertiles of HDL size (8.22 nm). Carotid intima-media thickness (cIMT) 8.22 nm was independently associated with low cIMT in either unadjusted and adjusted models for age, gender and Homeostasis Model Assessment 2 index for insulin sensitivity, ethnicity and body mass index (Odds ratio 0.23; 95% confidence interval 0.07-0.74, p = 0.013). The mean HDL size estimated with DLS constitutes a better predictor for subclinical carotid atherosclerosis than the conventional measurements of plasma HDL-cholesterol in individuals classified as LCR.

  16. HDL size is more accurate than HDL cholesterol to predict carotid subclinical atherosclerosis in individuals classified as low cardiovascular risk.

    Directory of Open Access Journals (Sweden)

    Eliane Soler Parra

    Full Text Available Misclassification of patients as low cardiovascular risk (LCR remains a major concern and challenges the efficacy of traditional risk markers. Due to its strong association with cholesterol acceptor capacity, high-density lipoprotein (HDL size has been appointed as a potential risk marker. Hence, we investigate whether HDL size improves the predictive value of HDL-cholesterol in the identification of carotid atherosclerotic burden in individuals stratified to be at LCR.284 individuals (40-75 years classified as LCR by the current US guidelines were selected in a three-step procedure from primary care centers of the cities of Campinas and Americana, SP, Brazil. Apolipoprotein B-containing lipoproteins were precipitated by polyethylene glycol and HDL size was measured by dynamic light scattering (DLS technique. Participants were classified in tertiles of HDL size (8.22 nm. Carotid intima-media thickness (cIMT 8.22 nm was independently associated with low cIMT in either unadjusted and adjusted models for age, gender and Homeostasis Model Assessment 2 index for insulin sensitivity, ethnicity and body mass index (Odds ratio 0.23; 95% confidence interval 0.07-0.74, p = 0.013.The mean HDL size estimated with DLS constitutes a better predictor for subclinical carotid atherosclerosis than the conventional measurements of plasma HDL-cholesterol in individuals classified as LCR.

  17. Mass Spectrometry Profiling of HLA-Associated Peptidomes in Mono-allelic Cells Enables More Accurate Epitope Prediction.

    Science.gov (United States)

    Abelin, Jennifer G; Keskin, Derin B; Sarkizova, Siranush; Hartigan, Christina R; Zhang, Wandi; Sidney, John; Stevens, Jonathan; Lane, William; Zhang, Guang Lan; Eisenhaure, Thomas M; Clauser, Karl R; Hacohen, Nir; Rooney, Michael S; Carr, Steven A; Wu, Catherine J

    2017-02-21

    Identification of human leukocyte antigen (HLA)-bound peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS) is poised to provide a deep understanding of rules underlying antigen presentation. However, a key obstacle is the ambiguity that arises from the co-expression of multiple HLA alleles. Here, we have implemented a scalable mono-allelic strategy for profiling the HLA peptidome. By using cell lines expressing a single HLA allele, optimizing immunopurifications, and developing an application-specific spectral search algorithm, we identified thousands of peptides bound to 16 different HLA class I alleles. These data enabled the discovery of subdominant binding motifs and an integrative analysis quantifying the contribution of factors critical to epitope presentation, such as protein cleavage and gene expression. We trained neural-network prediction algorithms with our large dataset (>24,000 peptides) and outperformed algorithms trained on datasets of peptides with measured affinities. We thus demonstrate a strategy for systematically learning the rules of endogenous antigen presentation. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Predicting the effectiveness of extracorporeal shock wave lithotripsy on urinary tract stones. Risk groups for accurate retreatment.

    Science.gov (United States)

    Hevia, M; García, Á; Ancizu, F J; Merino, I; Velis, J M; Tienza, A; Algarra, R; Doménech, P; Diez-Caballero, F; Rosell, D; Pascual, J I; Robles, J E

    2017-09-01

    Extracorporeal shock wave lithotripsy (ESWL) is a non-invasive, safe and effective treatment for urinary tract lithiasis. Its effectiveness varies depending on the location and size of the stones as well as other factors; several sessions are occasionally required. The objective is to attempt to predict its success or failure, when the influential variables are known beforehand. We analysed 211 patients who had had previous CT scans and were treated with ESWL between 2010 and 2014. The influential variables in requiring retreatment were studied using binary logistic regression models (univariate and multivariate analysis): maximum density, maximum diameter, area, location, disintegration and distance from the adipose panniculus. With the influential variables, a risk model was designed by assessing all possible combinations with logistic regression (version 20.0 IBM SPSS). The independent influential variables on the need for retreatment are: maximum density >864HU, maximum diameter >7.5mm and pyelocaliceal location. Using these variables, the best model includes 3risk groups with a probability of requiring significantly different retreatment: group 1-low risk (0 variables) with 20.2%; group 2-intermediate risk (1-2 variables) with 49.2%; and group 3-high risk (3 variables) with 62.5%. The density, maximum diameter and pyelocaliceal location of the stones are determinant factors in terms of the effectiveness of treatment with ESWL. Using these variables, which can be obtained in advance of deciding on a treatment, the designed risk model provides a precise approach in choosing the most appropriate treatment for each particular case. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Infectious titres of sheep scrapie and bovine spongiform encephalopathy agents cannot be accurately predicted from quantitative laboratory test results.

    Science.gov (United States)

    González, Lorenzo; Thorne, Leigh; Jeffrey, Martin; Martin, Stuart; Spiropoulos, John; Beck, Katy E; Lockey, Richard W; Vickery, Christopher M; Holder, Thomas; Terry, Linda

    2012-11-01

    It is widely accepted that abnormal forms of the prion protein (PrP) are the best surrogate marker for the infectious agent of prion diseases and, in practice, the detection of such disease-associated (PrP(d)) and/or protease-resistant (PrP(res)) forms of PrP is the cornerstone of diagnosis and surveillance of the transmissible spongiform encephalopathies (TSEs). Nevertheless, some studies question the consistent association between infectivity and abnormal PrP detection. To address this discrepancy, 11 brain samples of sheep affected with natural scrapie or experimental bovine spongiform encephalopathy were selected on the basis of the magnitude and predominant types of PrP(d) accumulation, as shown by immunohistochemical (IHC) examination; contra-lateral hemi-brain samples were inoculated at three different dilutions into transgenic mice overexpressing ovine PrP and were also subjected to quantitative analysis by three biochemical tests (BCTs). Six samples gave 'low' infectious titres (10⁶·⁵ to 10⁶·⁷ LD₅₀ g⁻¹) and five gave 'high titres' (10⁸·¹ to ≥ 10⁸·⁷ LD₅₀ g⁻¹) and, with the exception of the Western blot analysis, those two groups tended to correspond with samples with lower PrP(d)/PrP(res) results by IHC/BCTs. However, no statistical association could be confirmed due to high individual sample variability. It is concluded that although detection of abnormal forms of PrP by laboratory methods remains useful to confirm TSE infection, infectivity titres cannot be predicted from quantitative test results, at least for the TSE sources and host PRNP genotypes used in this study. Furthermore, the near inverse correlation between infectious titres and Western blot results (high protease pre-treatment) argues for a dissociation between infectivity and PrP(res).

  20. Predicting College Students' First Year Success: Should Soft Skills Be Taken into Consideration to More Accurately Predict the Academic Achievement of College Freshmen?

    Science.gov (United States)

    Powell, Erica Dion

    2013-01-01

    This study presents a survey developed to measure the skills of entering college freshmen in the areas of responsibility, motivation, study habits, literacy, and stress management, and explores the predictive power of this survey as a measure of academic performance during the first semester of college. The survey was completed by 334 incoming…

  1. In 'big bang' major incidents do triage tools accurately predict clinical priority?: a systematic review of the literature.

    Science.gov (United States)

    Kilner, T M; Brace, S J; Cooke, M W; Stallard, N; Bleetman, A; Perkins, G D

    2011-05-01

    The term "big bang" major incidents is used to describe sudden, usually traumatic,catastrophic events, involving relatively large numbers of injured individuals, where demands on clinical services rapidly outstrip the available resources. Triage tools support the pre-hospital provider to prioritise which patients to treat and/or transport first based upon clinical need. The aim of this review is to identify existing triage tools and to determine the extent to which their reliability and validity have been assessed. A systematic review of the literature was conducted to identify and evaluate published data validating the efficacy of the triage tools. Studies using data from trauma patients that report on the derivation, validation and/or reliability of the specific pre-hospital triage tools were eligible for inclusion.Purely descriptive studies, reviews, exercises or reports (without supporting data) were excluded. The search yielded 1982 papers. After initial scrutiny of title and abstract, 181 papers were deemed potentially applicable and from these 11 were identified as relevant to this review (in first figure). There were two level of evidence one studies, three level of evidence two studies and six level of evidence three studies. The two level of evidence one studies were prospective validations of Clinical Decision Rules (CDR's) in children in South Africa, all the other studies were retrospective CDR derivation, validation or cohort studies. The quality of the papers was rated as good (n=3), fair (n=7), poor (n=1). There is limited evidence for the validity of existing triage tools in big bang major incidents.Where evidence does exist it focuses on sensitivity and specificity in relation to prediction of trauma death or severity of injury based on data from single or small number patient incidents. The Sacco system is unique in combining survivability modelling with the degree by which the system is overwhelmed in the triage decision system. The

  2. Physiologically based pharmacokinetic modelling and in vivo [I]/Ki accurately predict P-glycoproteinmediated drug-drug interactions with dabigatran etexilate

    Science.gov (United States)

    Zhao, Yuansheng; Hu, Zhe-Yi

    2014-01-01

    Background and purpose In vitro inhibitory potency (Ki)-based predictions of P-glycoprotein (P-gp)-mediated drug-drug interactions (DDIs) are hampered by the substantial variability in inhibitory potency. In this study, in vivo-based [I]/Ki values were used to predict the DDI risks of a P-gp substrate dabigatran etexilate (DABE) using physiologically based pharmacokinetic (PBPK) modelling. Experimental approach A baseline PBPK model was established with digoxin, a known P-gp substrate. The Km (P-gp transport) of digoxin in the baseline PBPK model was adjusted to Kmi to fit the change of digoxin pharmacokinetics in the presence of a P-gp inhibitor. Then ‘in vivo’ [I]/Ki of this P-gp inhibitor was calculated using Kmi/Km. Baseline PBPK model was developed for DABE, and the ‘in vivo’ [I]/Ki was incorporated into this model to simulate the static effect of P-gp inhibitor on DABE pharmacokinetics. This approach was verified by comparing the observed and the simulated DABE pharmacokinetics in the presence of five different P-gp inhibitors. Key results This approach accurately predicted the effects of five P-gp inhibitors on DABE pharmacokinetics (98–133% and 89–104% for the ratios of AUC and Cmax respectively). The effects of 16 other P-gp inhibitors on the pharmacokinetics of DABE were also confidently simulated. Conclusions and implications ‘In vivo’ [I]/Ki and PBPK modelling, used in combination, can accurately predict P-gp-mediated DDIs. The described framework provides a mechanistic basis for the proper design of clinical DDI studies, as well as avoiding unnecessary clinical DDI studies. PMID:24283665

  3. An Accurate GPS-IMU/DR Data Fusion Method for Driverless Car Based on a Set of Predictive Models and Grid Constraints.

    Science.gov (United States)

    Wang, Shiyao; Deng, Zhidong; Yin, Gang

    2016-02-24

    A high-performance differential global positioning system (GPS)  receiver with real time kinematics provides absolute localization for driverless cars. However, it is not only susceptible to multipath effect but also unable to effectively fulfill precise error correction in a wide range of driving areas. This paper proposes an accurate GPS-inertial measurement unit (IMU)/dead reckoning (DR) data fusion method based on a set of predictive models and occupancy grid constraints. First, we employ a set of autoregressive and moving average (ARMA) equations that have different structural parameters to build maximum likelihood models of raw navigation. Second, both grid constraints and spatial consensus checks on all predictive results and current measurements are required to have removal of outliers. Navigation data that satisfy stationary stochastic process are further fused to achieve accurate localization results. Third, the standard deviation of multimodal data fusion can be pre-specified by grid size. Finally, we perform a lot of field tests on a diversity of real urban scenarios. The experimental results demonstrate that the method can significantly smooth small jumps in bias and considerably reduce accumulated position errors due to DR. With low computational complexity, the position accuracy of our method surpasses existing state-of-the-arts on the same dataset and the new data fusion method is practically applied in our driverless car.

  4. New analytical model for the ozone electronic ground state potential surface and accurate ab initio vibrational predictions at high energy range.

    Science.gov (United States)

    Tyuterev, Vladimir G; Kochanov, Roman V; Tashkun, Sergey A; Holka, Filip; Szalay, Péter G

    2013-10-07

    An accurate description of the complicated shape of the potential energy surface (PES) and that of the highly excited vibration states is of crucial importance for various unsolved issues in the spectroscopy and dynamics of ozone and remains a challenge for the theory. In this work a new analytical representation is proposed for the PES of the ground electronic state of the ozone molecule in the range covering the main potential well and the transition state towards the dissociation. This model accounts for particular features specific to the ozone PES for large variations of nuclear displacements along the minimum energy path. The impact of the shape of the PES near the transition state (existence of the "reef structure") on vibration energy levels was studied for the first time. The major purpose of this work was to provide accurate theoretical predictions for ozone vibrational band centres at the energy range near the dissociation threshold, which would be helpful for understanding the very complicated high-resolution spectra and its analyses currently in progress. Extended ab initio electronic structure calculations were carried out enabling the determination of the parameters of a minimum energy path PES model resulting in a new set of theoretical vibrational levels of ozone. A comparison with recent high-resolution spectroscopic data on the vibrational levels gives the root-mean-square deviations below 1 cm(-1) for ozone band centres up to 90% of the dissociation energy. New ab initio vibrational predictions represent a significant improvement with respect to all previously available calculations.

  5. Metabolite signal identification in accurate mass metabolomics data with MZedDB, an interactive m/z annotation tool utilising predicted ionisation behaviour 'rules'.

    Science.gov (United States)

    Draper, John; Enot, David P; Parker, David; Beckmann, Manfred; Snowdon, Stuart; Lin, Wanchang; Zubair, Hassan

    2009-07-21

    Metabolomics experiments using Mass Spectrometry (MS) technology measure the mass to charge ratio (m/z) and intensity of ionised molecules in crude extracts of complex biological samples to generate high dimensional metabolite 'fingerprint' or metabolite 'profile' data. High resolution MS instruments perform routinely with a mass accuracy of ionised. In reality the annotation process is confounded by the fact that many ionisation products will be not only molecular isotopes but also salt/solvent adducts and neutral loss fragments of original metabolites. This report describes an annotation strategy that will allow searching based on all potential ionisation products predicted to form during electrospray ionisation (ESI). Metabolite 'structures' harvested from publicly accessible databases were converted into a common format to generate a comprehensive archive in MZedDB. 'Rules' were derived from chemical information that allowed MZedDB to generate a list of adducts and neutral loss fragments putatively able to form for each structure and calculate, on the fly, the exact molecular weight of every potential ionisation product to provide targets for annotation searches based on accurate mass. We demonstrate that data matrices representing populations of ionisation products generated from different biological matrices contain a large proportion (sometimes > 50%) of molecular isotopes, salt adducts and neutral loss fragments. Correlation analysis of ESI-MS data features confirmed the predicted relationships of m/z signals. An integrated isotope enumerator in MZedDB allowed verification of exact isotopic pattern distributions to corroborate experimental data. We conclude that although ultra-high accurate mass instruments provide major insight into the chemical diversity of biological extracts, the facile annotation of a large proportion of signals is not possible by simple, automated query of current databases using computed molecular formulae. Parameterising MZedDB to

  6. Can Kohn-Sham density functional theory predict accurate charge distributions for both single-reference and multi-reference molecules?

    Science.gov (United States)

    Verma, Pragya; Truhlar, Donald G

    2017-05-24

    Dipole moments are the first moment of electron density and are fundamental quantities that are often available from experiments. An exchange-correlation functional that leads to an accurate representation of the charge distribution of a molecule should accurately predict the dipole moments of the molecule. It is well known that Kohn-Sham density functional theory (DFT) is more accurate for the energetics of single-reference systems than for the energetics of multi-reference ones, but there has been less study of charge distributions. In this work, we benchmark 48 density functionals chosen with various combinations of ingredients, against accurate experimental data for dipole moments of 78 molecules, in particular 55 single-reference molecules and 23 multi-reference ones. We chose both organic and inorganic molecules, and within the category of inorganic molecules there are both main-group and transition-metal-containing molecules, with some of them being multi-reference. As one would expect, the multi-reference molecules are not as well described by single-reference DFT, and the functionals tested in this work do show larger mean unsigned errors (MUEs) for the 23 multi-reference molecules than the single-reference ones. Five of the 78 molecules have relatively large experimental error bars and were therefore not included in calculating the overall MUEs. For the 73 molecules not excluded, we find that three of the hybrid functionals, B97-1, PBE0, and TPSSh (each with less than or equal to 25% Hartree-Fock (HF) exchange), the range-separated hybrid functional, HSE06 (with HF exchange decreasing from 25% to 0 as interelectronic distance increases), and the hybrid functional, PW6B95 (with 28% HF exchange) are the best performing functionals with each yielding an MUE of 0.18 D. Perhaps the most significant finding of this study is that there exists great similarity among the success rate of various functionals in predicting dipole moments. In particular, of 39

  7. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  8. Regulation of Bacillus subtilis bacillithiol biosynthesis operons by Spx.

    Science.gov (United States)

    Gaballa, Ahmed; Antelmann, Haike; Hamilton, Chris J; Helmann, John D

    2013-10-01

    Bacillithiol is the major low molecular mass thiol produced by many firmicutes bacteria, including the model organism Bacillus subtilis and pathogens such as Bacillus anthracis and Staphylococcus aureus. We have previously shown that four genes (bshA, bshB1, bshB2 and bshC) are involved in bacillithiol biosynthesis. Here, we report that these four genes are encoded within three, unlinked operons all expressed from canonical σ(A)-dependent promoters as determined by 5'RACE (rapid amplification of cDNA ends). The bshA and bshB1 genes are embedded within a seven-gene operon additionally including mgsA, encoding methylglyoxal synthase, and the essential genes cca and birA, encoding tRNA nucleotidyltransferase (CCA transferase) and biotin-protein ligase, respectively. The bshB2 gene is co-transcribed with unknown function genes, while bshC is expressed both as part of a two-gene operon (with the upstream putative pantothenate biosynthesis gene ylbQ) and from its own promoter. All three operons are expressed at a reduced level in an spx null mutant, consistent with a direct role of Spx as a transcriptional activator for these operons, and all three operons are induced by the thiol oxidant diamide. In contrast with other Spx-regulated genes characterized to date, the effects of Spx on basal expression and diamide-stimulated expression appear to be independent of Cys10 in the redox centre of Spx. Consistent with the role of Spx as an activator of bacillithiol biosynthetic genes, cellular levels of bacillithiol are reduced several-fold in an spx null mutant.

  9. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  10. Discovery of a general method of solving the Schrödinger and dirac equations that opens a way to accurately predictive quantum chemistry.

    Science.gov (United States)

    Nakatsuji, Hiroshi

    2012-09-18

    Just as Newtonian law governs classical physics, the Schrödinger equation (SE) and the relativistic Dirac equation (DE) rule the world of chemistry. So, if we can solve these equations accurately, we can use computation to predict chemistry precisely. However, for approximately 80 years after the discovery of these equations, chemists believed that they could not solve SE and DE for atoms and molecules that included many electrons. This Account reviews ideas developed over the past decade to further the goal of predictive quantum chemistry. Between 2000 and 2005, I discovered a general method of solving the SE and DE accurately. As a first inspiration, I formulated the structure of the exact wave function of the SE in a compact mathematical form. The explicit inclusion of the exact wave function's structure within the variational space allows for the calculation of the exact wave function as a solution of the variational method. Although this process sounds almost impossible, it is indeed possible, and I have published several formulations and applied them to solve the full configuration interaction (CI) with a very small number of variables. However, when I examined analytical solutions for atoms and molecules, the Hamiltonian integrals in their secular equations diverged. This singularity problem occurred in all atoms and molecules because it originates from the singularity of the Coulomb potential in their Hamiltonians. To overcome this problem, I first introduced the inverse SE and then the scaled SE. The latter simpler idea led to immediate and surprisingly accurate solution for the SEs of the hydrogen atom, helium atom, and hydrogen molecule. The free complement (FC) method, also called the free iterative CI (free ICI) method, was efficient for solving the SEs. In the FC method, the basis functions that span the exact wave function are produced by the Hamiltonian of the system and the zeroth-order wave function. These basis functions are called complement

  11. Functional analysis of an intergenic non-coding sequence within mce1 operon of M.tuberculosis

    Directory of Open Access Journals (Sweden)

    Bose Mridula

    2010-04-01

    Full Text Available Abstract Background The mce operons play an important role in the entry of M. tuberculosis into macrophages and non-phagocytic cells. Their non-redundant function as well as complex regulation is implied by the phenotype of mce mutants. Recently, mce1 operon was found to extend over 13 genes, fadD5 (Rv0166 being the first gene of the operon. The presence of a non-coding sequence of 200 base pairs between Rv0166 and Rv0167 is peculiar to mce1 among the four mce operons of M.tuberculosis. We have examined the function of this region. Results We predicted putative promoter activity of the 200 base pairs of non-coding, intergenic region between Rv0166 and Rv0167 in silico using MEME software and designate it as intergenic promoter, IGPr. We demonstrate both promoter activity and a putative negative regulatory function of this fragment by reporter assays carried out in the surrogate host M.smegmatis. We find that the repressive elements not only control the native promoter but also repress a heterologous promoter of M.smegmatis. The higher activity of the intergenic promoter in a clinical isolate in comparison with the wild type sequence from M.tuberculosis H37Rv could be correlated with a point mutation within the negative element. We have mapped two transcription start sites for mce1 operon both of which are utilized in M.tuberculosis H37Rv as well as the clinical isolate VPCI591. Our studies show that the promoter activity in the non-coding region is relevant not only in reporter gene expression but also in the expression of mce1 operon in M. tuberculosis cells grown in synthetic medium. Conclusion The mce operon of M.tuberculosis H37Rv potentially can be transcribed from two promoters P1 and P2, former mapping upstream of Rv0166 and the latter in the non-coding intergenic region between Rv0166 and Rv0167. The transcription initiation from P1 results in a transcript with Rv0166 while that from P2 will be without it. The sequences between the

  12. The Need for Accurate Risk Prediction Models for Road Mapping, Shared Decision Making and Care Planning for the Elderly with Advanced Chronic Kidney Disease.

    Science.gov (United States)

    Stryckers, Marijke; Nagler, Evi V; Van Biesen, Wim

    2016-11-01

    As people age, chronic kidney disease becomes more common, but it rarely leads to end-stage kidney disease. When it does, the choice between dialysis and conservative care can be daunting, as much depends on life expectancy and personal expectations of medical care. Shared decision making implies adequately informing patients about their options, and facilitating deliberation of the available information, such that decisions are tailored to the individual's values and preferences. Accurate estimations of one's risk of progression to end-stage kidney disease and death with or without dialysis are essential for shared decision making to be effective. Formal risk prediction models can help, provided they are externally validated, well-calibrated and discriminative; include unambiguous and measureable variables; and come with readily applicable equations or scores. Reliable, externally validated risk prediction models for progression of chronic kidney disease to end-stage kidney disease or mortality in frail elderly with or without chronic kidney disease are scant. Within this paper, we discuss a number of promising models, highlighting both the strengths and limitations physicians should understand for using them judiciously, and emphasize the need for external validation over new development for further advancing the field.

  13. Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions1

    Science.gov (United States)

    Zuñiga, Cristal; Li, Chien-Ting; Zielinski, Daniel C.; Guarnieri, Michael T.; Antoniewicz, Maciek R.; Zengler, Karsten

    2016-01-01

    The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. PMID:27372244

  14. Genome-Scale Metabolic Model for the Green Alga Chlorella vulgaris UTEX 395 Accurately Predicts Phenotypes under Autotrophic, Heterotrophic, and Mixotrophic Growth Conditions.

    Science.gov (United States)

    Zuñiga, Cristal; Li, Chien-Ting; Huelsman, Tyler; Levering, Jennifer; Zielinski, Daniel C; McConnell, Brian O; Long, Christopher P; Knoshaug, Eric P; Guarnieri, Michael T; Antoniewicz, Maciek R; Betenbaugh, Michael J; Zengler, Karsten

    2016-09-01

    The green microalga Chlorella vulgaris has been widely recognized as a promising candidate for biofuel production due to its ability to store high lipid content and its natural metabolic versatility. Compartmentalized genome-scale metabolic models constructed from genome sequences enable quantitative insight into the transport and metabolism of compounds within a target organism. These metabolic models have long been utilized to generate optimized design strategies for an improved production process. Here, we describe the reconstruction, validation, and application of a genome-scale metabolic model for C. vulgaris UTEX 395, iCZ843. The reconstruction represents the most comprehensive model for any eukaryotic photosynthetic organism to date, based on the genome size and number of genes in the reconstruction. The highly curated model accurately predicts phenotypes under photoautotrophic, heterotrophic, and mixotrophic conditions. The model was validated against experimental data and lays the foundation for model-driven strain design and medium alteration to improve yield. Calculated flux distributions under different trophic conditions show that a number of key pathways are affected by nitrogen starvation conditions, including central carbon metabolism and amino acid, nucleotide, and pigment biosynthetic pathways. Furthermore, model prediction of growth rates under various medium compositions and subsequent experimental validation showed an increased growth rate with the addition of tryptophan and methionine. © 2016 American Society of Plant Biologists. All rights reserved.

  15. Genomic arrangement of bacterial operons is constrained by biological pathways encoded in the genome

    OpenAIRE

    Yin, Yanbin; Zhang, Han; Olman, Victor; Ying XU

    2010-01-01

    It is generally known that bacterial genes working in the same biological pathways tend to group into operons, possibly to facilitate cotranscription and to provide stoichiometry. However, very little is understood about what may determine the global arrangement of bacterial genes in a genome beyond the operon level. Here we present evidence that the global arrangement of operons in a bacterial genome is largely influenced by the tendency that a bacterium keeps its operons encoding the same b...

  16. Jacques Monod and the Advent of the Age of Operons

    Indian Academy of Sciences (India)

    In this article, I will focus on the first, more because of personal competence than any other reason. Monod himself considered his contributions on allostery to be more significant than the operon model. He is reported to have surprised his colleagues one day by saying that he had discovered the “second secret of life”.

  17. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  18. Jacques Monod and the Advent of the Age of Operons

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 12. Jacques Monod and the Advent of the Age of Operons. R Jayaraman. General Article Volume 15 Issue 12 December 2010 pp 1084-1096. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  20. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  1. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised...

  2. Characterization of the Cobalamin and Fep Operons in Methylobium petrolphilum PM1

    Energy Technology Data Exchange (ETDEWEB)

    Ewing, J

    2005-09-06

    The bacterium Methylobium petroleophilum PM1 is economically important due to its ability to degrade methyl tert-butyl ether (MTBE), a fuel additive. Because PM1 is a representative of all MTBE degraders, it is important to understand the transport pathways critical for the organism to survive in its particular environment. In this study, the cobalamin pathway and select iron transport genes will be characterized to help further understand all metabolic pathways in PM1. PM1 contains a total of four cobalamin operons. A single operon is located on the chromosome. Located on the megaplasmid are two tandem repeats of cob operons and a very close representative of the cob operon located on the chromosome. The fep operon, an iron transport mechanism, lies within the multiple copies of the cob operon. The cob operon and the fep operon appear to be unrelated except for a shared need for the T-on-B-dependent energy transduction complex to assist the operons in moving large molecules across the outer membrane of the cell. A genomic study of the cob and the fep operons with that of phylogenetically related organisms helped to confirm the identity of the cob and fep operons and to represent the pathways. More study of the pathways should be done to find the relationship that positions the two seemingly unrelated cob and fep genes together in what appears to be one operon.

  3. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  4. TIMI Risk Score accurately predicts risk of death in 30-day and one-year follow-up in STEMI patients treated with primary percutaneous coronary interventions.

    Science.gov (United States)

    Kozieradzka, Anna; Kamiński, Karol; Dobrzycki, Sławomir; Nowak, Konrad; Musiał, Włodzimierz

    2007-07-01

    TIMI Risk Score for ST-elevation myocardial infarction (STEMI) was developed in a cohort of patients treated with fibrinolysis. It was though to predict in-hospital and short-term prognosis. Later studies validated this approach in large cohorts of patients, regardless of the applied treatment and presented its good power to predict 30-day mortality. We applied the TIMI Risk Score to our registry of STEMI patients treated with primary percutaneous intervention (pPCI) to validate the possibility to predict one-year survival. Our registry comprised 494 consecutive patients (mean age 58.5+/-11.3 years) with STEMI treated with pPCI who were followed for approximately one year. STEMI was diagnosed based on typical criteria: chest pain, ECG changes and rise in myocardial necrosis markers. In all patients TIMI Risk Score for STEMI was calculated and they were divided into three groups: low risk (0-5 points), medium risk (6-7) and high risk (>7 points). Multivariate logistic regression analysis, Kaplan-Meier survival analysis with Cox and log-rank tests as well as c statistics from receiver-operator curves (ROC) were used for statistical analysis. TIMI 3 flow was obtained in 95.5% of patients. Median TIMI risk score was 4 (ranging from 0 to 10). During follow-up there were 47 deaths (9.5%). There was a statistically significant difference in survival between all risk groups both in 30-day and one-year follow-up (p TIMI Risk Score had good power to predict 30-day (c statistic 0.834, 95% CI 0.757-0.91, p TIMI Risk score maintained its very good prognostic value. All analysed risk groups significantly differed between each other with respect to mortality (p TIMI Risk Score was one of the independent risk factors of death during one-year follow-up (OR 1.59, p TIMI Risk Score accurately defines the population of STEMI patients who are at high risk of death not only during the first 30 days, but also during a long-term follow-up. This simple score should be included in the

  5. bSiteFinder, an improved protein-binding sites prediction server based on structural alignment: more accurate and less time-consuming.

    Science.gov (United States)

    Gao, Jun; Zhang, Qingchen; Liu, Min; Zhu, Lixin; Wu, Dingfeng; Cao, Zhiwei; Zhu, Ruixin

    2016-01-01

    Protein-binding sites prediction lays a foundation for functional annotation of protein and structure-based drug design. As the number of available protein structures increases, structural alignment based algorithm becomes the dominant approach for protein-binding sites prediction. However, the present algorithms underutilize the ever increasing numbers of three-dimensional protein-ligand complex structures (bound protein), and it could be improved on the process of alignment, selection of templates and clustering of template. Herein, we built so far the largest database of bound templates with stringent quality control. And on this basis, bSiteFinder as a protein-binding sites prediction server was developed. By introducing Homology Indexing, Chain Length Indexing, Stability of Complex and Optimized Multiple-Templates Clustering into our algorithm, the efficiency of our server has been significantly improved. Further, the accuracy was approximately 2-10 % higher than that of other algorithms for the test with either bound dataset or unbound dataset. For 210 bound dataset, bSiteFinder achieved high accuracies up to 94.8 % (MCC 0.95). For another 48 bound/unbound dataset, bSiteFinder achieved high accuracies up to 93.8 % for bound proteins (MCC 0.95) and 85.4 % for unbound proteins (MCC 0.72). Our bSiteFinder server is freely available at http://binfo.shmtu.edu.cn/bsitefinder/, and the source code is provided at the methods page. An online bSiteFinder server is freely available at http://binfo.shmtu.edu.cn/bsitefinder/. Our work lays a foundation for functional annotation of protein and structure-based drug design. With ever increasing numbers of three-dimensional protein-ligand complex structures, our server should be more accurate and less time-consuming.Graphical Abstract bSiteFinder (http://binfo.shmtu.edu.cn/bsitefinder/) as a protein-binding sites prediction server was developed based on the largest database of bound templates so far with stringent quality

  6. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  7. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  8. IMPre: an accurate and efficient software for prediction of T- and B-cell receptor germline genes and alleles from rearranged repertoire data

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2016-11-01

    Full Text Available Large-scale study of the properties of T-cell receptor (TCR and B-cell receptor (BCR repertoires through next-generation sequencing is providing excellent insights into the understanding of adaptive immune responses. Variable(DiversityJoining V(DJ germline genes and alleles must be characterized in detail to facilitate repertoire analyses. However, most species do not have well-characterized TCR/BCR germline genes because of their high homology. Also, more germline alleles are required for humans and other species, which limits the capacity for studying immune repertoires. Herein, we developed Immune Germline Prediction (IMPre, a tool for predicting germline V/J genes and alleles using deep-sequencing data derived from TCR/BCR repertoires. We developed a new algorithm, Seed_Clust, for clustering, produced a multiway tree for assembly and optimized the sequence according to the characteristics of rearrangement. We trained IMPre on human samples of T-cell receptor beta (TRB and immunoglobulin heavy chain (IGH, and then tested it on additional human samples. Accuracy of 97.7%, 100%, 92.9% and 100% was obtained for TRBV, TRBJ, IGHV and IGHJ, respectively. Analyses of subsampling performance for these samples showed IMPre to be robust using different data quantities. Subsequently, IMPre was tested on samples from rhesus monkeys and human long sequences: the highly accurate results demonstrated IMPre to be stable with animal and multiple data types. With rapid accumulation of high-throughput sequence data for TCR and BCR repertoires, IMPre can be applied broadly for obtaining novel genes and a large number of novel alleles. IMPre is available at https://github.com/zhangwei2015/IMPre.

  9. Fibrotic focus: An important parameter for accurate prediction of a high level of tumor-associated macrophage infiltration in invasive ductal carcinoma of the breast.

    Science.gov (United States)

    Shimada, Hiroko; Hasebe, Takahiro; Sugiyama, Michiko; Shibasaki, Satomi; Sugitani, Ikuko; Ueda, Shigeto; Gotoh, Yoshiya; Yasuda, Masanori; Arai, Eiichi; Osaki, Akihiko; Saeki, Toshiaki

    2017-07-01

    Our group and others have previously reported that a fibrotic focus is a very useful histological factor for the accurate prediction of the outcome of patients with invasive ductal carcinoma of the breast. We classified 258 cases of invasive ductal carcinoma into those with and those without a fibrotic focus to investigate whether the presence of a fibrotic focus was significantly associated with the degree of tumor-associated macrophage (CD68, CD163 or CD204-positive) infiltration or whether the presence of tumor-associated macrophage infiltration heightened the malignant potential of invasive ductal carcinoma with a fibrotic focus. Multiple regression analyses demonstrated that a fibrotic focus was the only factor that was significantly associated with a high level of CD68-, CD163- or CD204-positive tumor-associated macrophage infiltration. The combined assessment of the presence or absence of a fibrotic focus and a high or a low level of CD204-positive tumor-associated macrophage infiltration clearly demonstrated that CD204-positive tumor-associated macrophage infiltration had a significant prognostic power only for patients with invasive ductal carcinoma with a fibrotic focus in multivariate analyses; CD204-positive tumor-associated macrophages might only exert a significant effect on tumor progression when a fibrotic focus is present within the invasive ductal carcinoma of the breast. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  10. Integrating trans-abdominal ultrasonography with fecal steroid metabolite monitoring to accurately diagnose pregnancy and predict the timing of parturition in the red panda (Ailurus fulgens styani).

    Science.gov (United States)

    Curry, Erin; Browning, Lissa J; Reinhart, Paul; Roth, Terri L

    2017-05-01

    Red pandas (Ailurus fulgens styani) exhibit a variable gestation length and may experience a pseudopregnancy indistinguishable from true pregnancy; therefore, it is not possible to deduce an individual's true pregnancy status and parturition date based on breeding dates or fecal progesterone excretion patterns alone. The goal of this study was to evaluate the use of transabdominal ultrasonography for pregnancy diagnosis in red pandas. Two to three females were monitored over 4 consecutive years, generating a total of seven profiles (four pregnancies, two pseudopregnancies, and one lost pregnancy). Fecal samples were collected and assayed for progesterone (P4) and estrogen conjugate (EC) to characterize patterns associated with breeding activity and parturition events. Animals were trained for voluntary transabdominal ultrasound and examinations were performed weekly. Breeding behaviors and fecal EC data suggest that the estrus cycle of this species is 11-12 days in length. Fecal steroid metabolite analyses also revealed that neither P4 nor EC concentrations were suitable indicators of pregnancy in this species; however, a secondary increase in P4 occurred 69-71 days prior to parturition in all pregnant females, presumably coinciding with embryo implantation. Using ultrasonography, embryos were detected as early as 62 days post-breeding/50 days pre-partum and serial measurements of uterine lumen diameter were documented throughout four pregnancies. Advances in reproductive diagnostics, such as the implementation of ultrasonography, may facilitate improved husbandry of pregnant females and allow for the accurate prediction of parturition. © 2017 Wiley Periodicals, Inc.

  11. Expression of the glycolytic gapA operon in Bacillus subtilis: differential syntheses of proteins encoded by the operon.

    Science.gov (United States)

    Meinken, Christoph; Blencke, Hans-Matti; Ludwig, Holger; Stülke, Jörg

    2003-03-01

    Glycolysis is one of the central routes of carbon catabolism in Bacillus subtilis. Several glycolytic enzymes, including the key enzyme glyceraldehyde-3-phosphate dehydrogenase, are encoded in the hexacistronic gapA operon. Expression of this operon is induced by a variety of sugars and amino acids. Under non-inducing conditions, expression is repressed by the CggR repressor protein, the product of the promoter-proximal gene of the operon. Here, it is shown that the amount of glyceraldehyde-3-phosphate dehydrogenase encoded by the second gene of the operon exceeds that of the CggR repressor by about 100-fold. This differential synthesis was attributed to an mRNA processing event that takes place at the 3' end of the cggR open reading frame and to differential segmental stabilities of the resulting cleavage products. The mRNA specifying the truncated cggR gene is quickly degraded, whereas the downstream processing products encompassing gapA are quite stable. This increased stability is conferred by the presence of a stem-loop structure at the 5' end of the processed mRNAs. Mutations were introduced in the region of the cleavage site. A mutation affecting the stability of the stem-loop structure immediately downstream of the processing site had two effects. First, the steady-state transcript pattern was drastically shifted towards the primary transcripts; second, the stability of the processed mRNA containing the destabilized stem-loop structure was strongly decreased. This results in a reduction of the amount of glyceraldehyde-3-phosphate dehydrogenase in the cell. It is concluded that mRNA processing is involved in differential syntheses of the proteins encoded by the gapA operon.

  12. Trans-splicing and operons in C. elegans.

    Science.gov (United States)

    Blumenthal, Thomas

    2012-11-20

    About 70% of C. elegans mRNAs are trans-spliced to one of two 22 nucleotide spliced leaders. SL1 is used to trim off the 5' ends of pre-mRNAs and replace them with the SL1 sequence. This processing event is very closely related to cis-splicing, or intron removal. The SL1 sequence is donated by a 100 nt small nuclear ribonucleoprotein particle (snRNP), the SL1 snRNP. This snRNP is structurally and functionally similar to the U snRNAs (U1, U2, U4, U5 and U6) that play key roles in intron removal and trans-splicing, except that the SL1 snRNP is consumed in the process. More than half of C. elegans pre-mRNAs are subject to SL1 trans-splicing, whereas ~30% are not trans-spliced. The remaining genes are trans-spliced by SL2, which is donated by a similar snRNP, the SL2 snRNP. SL2 recipients are all downstream genes in closely spaced gene clusters similar to bacterial operons. They are transcribed from a promoter at the 5' end of the cluster of between 2 and 8 genes. This transcription makes a polycistronic pre-mRNA that is co-transcriptionally processed by cleavage and polyadenylation at the 3' end of each gene, and this event is closely coupled to the SL2 trans-splicing event that occurs only ~100 nt further downstream. SL2 trans-splicing requires a sequence between the genes, the Ur element, that likely base pairs with the 5' splice site on the SL2 snRNP, in a manner analogous to the interaction between the 5' splice site in cis-splicing with the U1 snRNP. The key difference is that in trans-splicing, the snRNP contains the 5' splice site, whereas in cis-splicing the pre-mRNA does. Some operons, termed "hybrid operons", contain an additional promoter between two genes that can express the downstream gene or genes with a developmental profile that is different from that of the entire operon. The operons contain primarily genes required for rapid growth, including genes whose products are needed for mitochondrial function and the basic machinery of gene expression

  13. Differential regulation of the mcb and emr operons of Escherichia coli: role of mcb in multidrug resistance.

    Science.gov (United States)

    Lomovskaya, O; Kawai, F; Matin, A

    1996-04-01

    The mcb operon (which is responsible for microcin B17 production) and the emr operon (which encodes a multidrug resistance pump) share a common negative regulator, EmrR. Nevertheless, compounds that induce the emr operon repress the mcb operon. The pump dedicated to microcin B17 extrusion can also protect the calls against sparfloxacin and other toxic compounds.

  14. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  15. Design and characterisation of synthetic operons for biohydrogen technology.

    Science.gov (United States)

    Lamont, Ciaran M; Sargent, Frank

    2017-04-01

    Biohydrogen is produced by a number of microbial systems and the commonly used host bacterium Escherichia coli naturally produces hydrogen under fermentation conditions. One approach to engineering additional hydrogen production pathways is to introduce non-native hydrogenases into E. coli. An attractive candidate is the soluble [NiFe]-hydrogenase from Ralstonia eutropha, which has been shown to link NADH/NAD+ biochemistry directly to hydrogen metabolism, an activity that E. coli does not perform. In this work, three synthetic operons were designed that code for the soluble hydrogenase and two different enzyme maturase systems. Interestingly, using this system, the recombinant soluble hydrogenase was found to be assembled by the native E. coli [NiFe]-hydrogenase assembly machinery, and, vice versa, the synthetic maturase operons were able to complement E. coli mutants defective in hydrogenase biosynthesis. The heterologously expressed soluble hydrogenase was found to be active and was shown to produce biohydrogen in vivo.

  16. Cosmological constraints from the CFHTLenS shear measurements using a new, accurate, and flexible way of predicting non-linear mass clustering

    Science.gov (United States)

    Angulo, Raul E.; Hilbert, Stefan

    2015-03-01

    We explore the cosmological constraints from cosmic shear using a new way of modelling the non-linear matter correlation functions. The new formalism extends the method of Angulo & White, which manipulates outputs of N-body simulations to represent the 3D non-linear mass distribution in different cosmological scenarios. We show that predictions from our approach for shear two-point correlations at 1-300 arcmin separations are accurate at the ˜10 per cent level, even for extreme changes in cosmology. For moderate changes, with target cosmologies similar to that preferred by analyses of recent Planck data, the accuracy is close to ˜5 per cent. We combine this approach with a Monte Carlo Markov chain sampler to explore constraints on a Λ cold dark matter model from the shear correlation functions measured in the Canada-France-Hawaii Telescope Lensing Survey (CFHTLenS). We obtain constraints on the parameter combination σ8(Ωm/0.27)0.6 = 0.801 ± 0.028. Combined with results from cosmic microwave background data, we obtain marginalized constraints on σ8 = 0.81 ± 0.01 and Ωm = 0.29 ± 0.01. These results are statistically compatible with previous analyses, which supports the validity of our approach. We discuss the advantages of our method and the potential it offers, including a path to model in detail (i) the effects of baryons, (ii) high-order shear correlation functions, and (iii) galaxy-galaxy lensing, among others, in future high-precision cosmological analyses.

  17. Albumin-Bilirubin and Platelet-Albumin-Bilirubin Grades Accurately Predict Overall Survival in High-Risk Patients Undergoing Conventional Transarterial Chemoembolization for Hepatocellular Carcinoma.

    Science.gov (United States)

    Hansmann, Jan; Evers, Maximilian J; Bui, James T; Lokken, R Peter; Lipnik, Andrew J; Gaba, Ron C; Ray, Charles E

    2017-09-01

    To evaluate albumin-bilirubin (ALBI) and platelet-albumin-bilirubin (PALBI) grades in predicting overall survival in high-risk patients undergoing conventional transarterial chemoembolization for hepatocellular carcinoma (HCC). This single-center retrospective study included 180 high-risk patients (142 men, 59 y ± 9) between April 2007 and January 2015. Patients were considered high-risk based on laboratory abnormalities before the procedure (bilirubin > 2.0 mg/dL, albumin 1.2 mg/dL); presence of ascites, encephalopathy, portal vein thrombus, or transjugular intrahepatic portosystemic shunt; or Model for End-Stage Liver Disease score > 15. Serum albumin, bilirubin, and platelet values were used to determine ALBI and PALBI grades. Overall survival was stratified by ALBI and PALBI grades with substratification by Child-Pugh class (CPC) and Barcelona Liver Clinic Cancer (BCLC) stage using Kaplan-Meier analysis. C-index was used to determine discriminatory ability and survival prediction accuracy. Median survival for 79 ALBI grade 2 patients and 101 ALBI grade 3 patients was 20.3 and 10.7 months, respectively (P grade 2 and 144 PALBI grade 3 patients was 20.3 and 12.9 months, respectively (P = .0667). Substratification yielded distinct ALBI grade survival curves for CPC B (P = .0022, C-index 0.892), BCLC A (P = .0308, C-index 0.887), and BCLC C (P = .0287, C-index 0.839). PALBI grade demonstrated distinct survival curves for BCLC A (P = 0.0229, C-index 0.869). CPC yielded distinct survival curves for the entire cohort (P = .0019) but not when substratified by BCLC stage (all P > .05). ALBI and PALBI grades are accurate survival metrics in high-risk patients undergoing conventional transarterial chemoembolization for HCC. Use of these scores allows for more refined survival stratification within CPC and BCLC stage. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  18. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  19. Identification and Characterization of the fis Operon in Enteric Bacteria

    OpenAIRE

    Beach, Michael B.; Osuna, Robert

    1998-01-01

    The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage λ genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Ha...

  20. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  1. Genomic arrangement of bacterial operons is constrained by biological pathways encoded in the genome.

    Science.gov (United States)

    Yin, Yanbin; Zhang, Han; Olman, Victor; Xu, Ying

    2010-04-06

    It is generally known that bacterial genes working in the same biological pathways tend to group into operons, possibly to facilitate cotranscription and to provide stoichiometry. However, very little is understood about what may determine the global arrangement of bacterial genes in a genome beyond the operon level. Here we present evidence that the global arrangement of operons in a bacterial genome is largely influenced by the tendency that a bacterium keeps its operons encoding the same biological pathway in nearby genomic locations, and by the tendency to keep operons involved in multiple pathways in locations close to the other members of their participating pathways. We also observed that the activation frequencies of pathways also influence the genomic locations of their encoding operons, tending to have operons of the more frequently activated pathways more tightly clustered together. We have quantitatively assessed the influences on the global genomic arrangement of operons by different factors. We found that the current arrangements of operons in most of the bacterial genomes we studied tend to minimize the overall distance between consecutive operons of a same pathway across all pathways encoded in the genome.

  2. Insights into arsenic multi-operons expression and arsenic resistance mechanisms in Rhodopseudomonas palustris CGA009

    Directory of Open Access Journals (Sweden)

    Chungui eZhao

    2015-09-01

    Full Text Available Arsenic (As is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2 and ars3 in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III concentrations (up to 1.0 mM while transcript of ars1 operon was not detected in the middle log-phase (55 h. ars2 operon was actively expressed even at the low concentration of As(III (0.01 μM, whereas the ars3 operon was expressed at 1.0 µM of As(III, indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase. Arsenic speciation analysis demonstrated that R. palustris could reduce As(V to As(III.

  3. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    Science.gov (United States)

    Tadmor, Arbel

    2009-03-01

    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  4. Evolution of mosaic operons by horizontal gene transfer and gene displacement in situ

    OpenAIRE

    Omelchenko, Marina V.; Makarova, Kira S.; Wolf, Yuri I.; Rogozin, Igor B.; Koonin, Eugene V.

    2003-01-01

    Background Shuffling and disruption of operons and horizontal gene transfer are major contributions to the new, dynamic view of prokaryotic evolution. Under the 'selfish operon' hypothesis, operons are viewed as mobile genetic entities that are constantly disseminated via horizontal gene transfer, although their retention could be favored by the advantage of coregulation of functionally linked genes. Here we apply comparative genomics and phylogenetic analysis to examine horizontal transfer o...

  5. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Operon conservation and the evolution of trans-splicing in the phylum Nematoda.

    Science.gov (United States)

    Guiliano, David B; Blaxter, Mark L

    2006-11-24

    The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage.

  7. Operon conservation and the evolution of trans-splicing in the phylum Nematoda.

    Directory of Open Access Journals (Sweden)

    David B Guiliano

    2006-11-01

    Full Text Available The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution of polycistronic pre-mRNAs. Conserved operons were found in Pristionchus pacificus, Nippostrongylus brasiliensis, Strongyloides ratti, Brugia malayi, and Ascaris suum. In nematodes closely related to the rhabditine C. elegans, a related family of SL2-like spliced leaders is used for operonic transcript resolution. However, in the tylenchine S. ratti operonic transcripts are resolved using a family of spliced leaders related to SL1. Non-operonic genes in S. ratti may also receive these SL1 variants. In the spirurine nematodes B. malayi and A. suum operonic transcripts are resolved using SL1. Mapping these phenotypes onto the robust molecular phylogeny for the Nematoda suggests that operons evolved before SL2-like spliced leaders, which are an evolutionary invention of the rhabditine lineage.

  8. Regulation of the L-arabinose operon of Escherichia coli.

    Science.gov (United States)

    Schleif, R

    2000-12-01

    Over forty years of research on the L-arabinose operon of Escherichia coli have provided insights into the mechanism of positive regulation of gene activity. This research also discovered DNA looping and the mechanism by which the regulatory protein changes its DNA-binding properties in response to the presence of arabinose. As is frequently seen in focused research on biological subjects, the initial studies were primarily genetic. Subsequently, the genetic approaches were augmented by physiological and then biochemical studies. Now biophysical studies are being conducted at the atomic level, but genetics still has a crucial role in the study of this system.

  9. NetMHC-3.0: accurate web accessible predictions of human, mouse and monkey MHC class I affinities for peptides of length 8-11

    DEFF Research Database (Denmark)

    Lundegaard, Claus; Lamberth, K; Harndahl, M

    2008-01-01

    NetMHC-3.0 is trained on a large number of quantitative peptide data using both affinity data from the Immune Epitope Database and Analysis Resource (IEDB) and elution data from SYFPEITHI. The method generates high-accuracy predictions of major histocompatibility complex (MHC): peptide binding....... The predictions are based on artificial neural networks trained on data from 55 MHC alleles (43 Human and 12 non-human), and position-specific scoring matrices (PSSMs) for additional 67 HLA alleles. As only the MHC class I prediction server is available, predictions are possible for peptides of length 8......–11 for all 122 alleles. artificial neural network predictions are given as actual IC50 values whereas PSSM predictions are given as a log-odds likelihood scores. The output is optionally available as download for easy post-processing. The training method underlying the server is the best available, and has...

  10. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  11. Relationship between operon preference and functional properties of persistent genes in bacterial genomes.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Drabløs, Finn

    2010-01-28

    Genes in bacteria may be organised into operons, leading to strict co-expression of the genes that participate in the same operon. However, comparisons between different bacterial genomes have shown that much of the operon structure is dynamic on an evolutionary time scale. This indicates that there are opposing effects influencing the tendency for operon formation, and these effects may be reflected in properties like evolutionary rate, complex formation, metabolic pathways and gene fusion. We have used multi-species protein-protein comparisons to generate a high-quality set of genes that are persistent in bacterial genomes (i.e. they have close to universal distribution). We have analysed these genes with respect to operon participation and important functional properties, including evolutionary rate and protein-protein interactions. Genes for ribosomal proteins show a very slow rate of evolution. This is consistent with a strong tendency for the genes to participate in operons and for their proteins to be involved in essential and well defined complexes. Persistent genes for non-ribosomal proteins can be separated into two classes according to tendency to participate in operons. Those with a strong tendency for operon participation make proteins with fewer interaction partners that seem to participate in relatively static complexes and possibly linear pathways. Genes with a weak tendency for operon participation tend to produce proteins with more interaction partners, but possibly in more dynamic complexes and convergent pathways. Genes that are not regulated through operons are therefore more evolutionary constrained than the corresponding operon-associated genes and will on average evolve more slowly.

  12. Evolution of the hyaluronic acid synthesis (has) operon in Streptococcus zooepidemicus and other pathogenic streptococci.

    Science.gov (United States)

    Blank, Lars M; Hugenholtz, Philip; Nielsen, Lars K

    2008-07-01

    Hyaluronic acid (HA) is a ubiquitous linear polysaccharide in vertebrates and also is the capsule material of some pathogenic bacteria including group A and C streptococci. In bacteria, the HA synthase occurs in an operon (has) coding for enzymes involved in the production of HA precursors. We report two new members of the has operon family from Streptococcus equi subsp. zooepidemicus (S. zooepidemicus) and Streptococcus equi subsp. equi (S. equi). The has operon of S. zooepidemicus contains, in order, hasA, hasB, hasC, glum, and pgi, whereas these genes are separated on two operons in S. equi (hasA, hasB, hasC and hasC, glmU, pgi). The transcription start site and a sigma(70) promoter were experimentally identified 50 bp upstream of hasA in S. zooepidemicus. We performed a phylogenetic analysis of each of the has operon genes to determine the evolutionary origin(s) of the streptococcal has operon. In contrast to other capsular and exopolysaccharide operons, has operons have undergone no detectable interspecies lateral gene transfers in their construction, instead relying on intragenome gene duplication for their assembly. Specifically, hasC and glmU appear to have been duplicated into the S. zooepidemicus has operon from remotely located but near-identical paralogues most likely to improve HA productivity by gene dosage in this streptococcus. The intragene rearrangements appear to be ongoing events and the two has operons of the S. equi subspecies represent two alternatives of the same gene arrangement. A scenario for the evolution of streptococcal has operons is proposed.

  13. Expression of the entire polyhydroxybutyrate operon ofRalstonia eutrophain plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  14. Accurate prediction of explicit solvent atom distribution in HIV-1 protease and F-ATP synthase by statistical theory of liquids

    Science.gov (United States)

    Sindhikara, Daniel; Yoshida, Norio; Hirata, Fumio

    2012-02-01

    We have created a simple algorithm for automatically predicting the explicit solvent atom distribution of biomolecules. The explicit distribution is coerced from the 3D continuous distribution resulting from a 3D-RISM calculation. This procedure predicts optimal location of solvent molecules and ions given a rigid biomolecular structure. We show examples of predicting water molecules near KNI-275 bound form of HIV-1 protease and predicting both sodium ions and water molecules near the rotor ring of F-ATP synthase. Our results give excellent agreement with experimental structure with an average prediction error of 0.45-0.65 angstroms. Further, unlike experimental methods, this method does not suffer from the partial occupancy limit. Our method can be performed directly on 3D-RISM output within minutes. It is useful not only as a location predictor but also as a convenient method for generating initial structures for MD calculations.

  15. PSSP-RFE: accurate prediction of protein structural class by recursive feature extraction from PSI-BLAST profile, physical-chemical property and functional annotations

    National Research Council Canada - National Science Library

    Li, Liqi; Cui, Xiang; Yu, Sanjiu; Zhang, Yuan; Luo, Zhong; Yang, Hua; Zhou, Yue; Zheng, Xiaoqi

    2014-01-01

    .... Amongst most homological-based approaches, the accuracies of protein structural class prediction are sufficiently high for high similarity datasets, but still far from being satisfactory for low similarity datasets, i.e., below 40...

  16. The pseudogenes of Mycobacterium leprae reveal the functional relevance of gene order within operons.

    Science.gov (United States)

    Muro, Enrique M; Mah, Nancy; Moreno-Hagelsieb, Gabriel; Andrade-Navarro, Miguel A

    2011-03-01

    Almost 50 years following the discovery of the prokaryotic operon, the functional relevance of gene order within operons remains unclear. In this work, we take advantage of the eroded genome of Mycobacterium leprae to add evidence supporting the notion that functionally less important genes have a tendency to be located at the end of its operons. M. leprae's genome includes 1133 pseudogenes and 1614 protein-coding genes and can be compared with the close genome of M. tuberculosis. Assuming M. leprae's pseudogenes to represent dispensable genes, we have studied the position of these pseudogenes in the operons of M. leprae and of their orthologs in M. tuberculosis. We observed that both tend to be located in the 3' (downstream) half of the operon (P-values of 0.03 and 0.18, respectively). Analysis of pseudogenes in all available prokaryotic genomes confirms this trend (P-value of 7.1 × 10(-7)). In a complementary analysis, we found a significant tendency for essential genes to be located at the 5' (upstream) half of the operon (P-value of 0.006). Our work provides an indication that, in prokarya, functionally less important genes have a tendency to be located at the end of operons, while more relevant genes tend to be located toward operon starts.

  17. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Directory of Open Access Journals (Sweden)

    Ling Cao

    Full Text Available During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  18. Vulnerabilities in Yersinia pestis caf Operon Are Unveiled by a Salmonella Vector

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host. PMID:22558420

  19. Cloning and biochemical analysis of β-glucoside utilization (bgl) operon without phosphotransferase system in Pectobacterium carotovorum subsp. carotovorum LY34.

    Science.gov (United States)

    An, Chang Long; Kim, Min Keun; Kang, Tae Ho; Kim, Jungho; Kim, Hoon; Yun, Han Dae

    2012-09-06

    β-Glucosidases are widespread in bacteria and involved in the metabolism of various carbohydrate substrates. Studying of β-glucoside utilization (bgl) operons on operon of Pectobacterium carotovorum subsp. carotovorum LY34 (Pcc LY34) will help us understanding how β-glucoside utilization (bgl) operon can cooperate with other systems in bacterium caused soft-rot disease. Pcc LY34 causes soft-rot disease in plants and expresses multiple enzymatic forms of β-glucosidases. To fully explore the β-glucoside utilization system in Pcc LY34, we have isolated a bgl operon from a genomic library for screening of β-glucosidase activities. Sequence analysis of a 3050bp cloned DNA fragment (accession number AY870655) shows two open reading frames (bglY and bglK) that are predicted to encode proteins of 474 and 278 amino acid residues, respectively. Pair wise similarity analysis suggests BglY is a beta-glucosidase (a member of glycosyl hydrolase family 1) and BglK is a transcriptional antiterminator protein. bglY promoter region contains an inverted repeat sequence similar to transcriptional terminator. Different from other four β-glucoside utilization operons of Pcc LY34 strain, BglY contains signal peptide sequences as extracellular β-glucosidase. Comparisons of five β-glucoside utilization operons of Pcc LY34 strain showed that bglYK operon does not have phosphotransferase system domain which are responsible for sugar transportation. BglY shares 33-44% identity with other four β-glucosidases of Pcc LY34 strain. Enzyme assay showed that purified BglY enzyme hydrolyzed salicin, arbutin, pNPG, and MUG, and exhibited maximal activity at pH 7.0 and 40°C. This activity was enhanced Mg(2+). Site-directed mutagenesis revealed E166 and E371 are critical of BglY's β-glucosidase activity. Copyright © 2012 Elsevier GmbH. All rights reserved.

  20. Combined measurement of fetal lung volume and pulmonary artery resistance index is more accurate for prediction of neonatal respiratory distress syndrome in preterm fetuses: a pilot study.

    Science.gov (United States)

    Laban, Mohamed; Mansour, Ghada M; El-Kotb, Ahmed; Hassanin, Alaa; Laban, Zina; Saleh, Abdelrahman

    2017-10-12

    The objective of this study is to estimate optimal cut-off values for mean fetal lung volume (FLV) and pulmonary artery resistance index (PA-RI) as non-invasive measures to predict neonatal respiratory distress syndrome (RDS) in preterm fetuses. A prospective study conducted at Ain Shams University Maternity Hospital, Egypt from May 2015 to July 2017: 80 eligible women diagnosed with preterm labor were recruited at 32-36 weeks' gestation. Before delivery, three-dimensional ultrasound was used to estimate FLV using virtual organ computer-aided analysis (VOCAL), while PA-RI was measured by Doppler ultrasonography. A total of 80 women were examined. Thirty-seven (46%) of the newborns developed neonatal RDS. FLV was significantly lower in neonates who developed RDS (p = .04), whereas PARI was significantly higher in those who did not (p = .02). Cut-off values of FLV ≤27.2 cm3 and PARI ≥0.77 predicted the subsequent development of RDS. Combining both cut-offs generated a more sensitive and specific methodical approach for the prediction of RDS (sensitivity 100%, specificity 88.5%). Measurement of FLV or PA-RI can predict RDS in preterm fetuses. Combined use of both measures bolstered their predictive significance.

  1. [New method of construction of artificial translational-coupled operons in bacterial chromosome].

    Science.gov (United States)

    Gulevich, A Iu; Skorokhodova, A Iu; Ermishev, V Iu; Krylov, A A; Minaeva, N I; Polonskaia, Z M; Zimenkov, D V; Biriukova, I V; Mashko, S V

    2009-01-01

    The new method of translational-coupled operons construction in bacterial chromosome has been developed on the basis of recombineering approach. It includes construction in vitro of the artificial operon with efficiently translated proximal cistron followed by its insertion E. coli chromosome, modification of the operon due to Red-driven insertion of the special "Junction" with excisable selective marker in the intercistronic region of the initial operon and excising the marker. The structure of this Junction has been designed and tested in the present investigation. It consists of: 1) E. coli rplC-rplD intercistronic region for placing the TAA-codon of the proximal operon's gene in the SD-sequence (TAAGGAG) of rplD; 2) Cm(R)-gene flanked by lambdaattL/R-sites in such a fashion that after lambdaInt/Xis-driven excision of the marker the residual lambdaattB-site would not contain the termination codons in frame with ATG of rplD; 3) E. coli trpE-trpD intercistronic region for location of ATG of trpD at the position of initiation codon of the distal gene of original operon. The general design of desired construction provides the conversion of the original two-cistronic operon into three-cistronic operon with translational-coupled genes, where the coupling of the artificial ORF (rplD'-lambdaattB-'trpE) with the proximal gene is occurred due to rplC-rplD intercistronic region and the coupling of this ORF with the distal gene--due to trpE-trpD. The experimental implementation of the described strategy was showed by construction of artificial operon P(tac-aroG4-serA5, where expression optimization of the distal serA5 gene was achieved via construction of three-cistronic operon with translational-coupled genes.

  2. Insights into arsenic multi-operons expression and resistance mechanisms in Rhodopseudomonas palustris CGA009.

    Science.gov (United States)

    Zhao, Chungui; Zhang, Yi; Chan, Zhuhua; Chen, Shicheng; Yang, Suping

    2015-01-01

    Arsenic (As) is widespread in the environment and causes numerous health problems. Rhodopseudomonas palustris has been regarded as a good model organism for studying arsenic detoxification since it was first demonstrated to methylate environmental arsenic by conversion to soluble or gaseous methylated species. However, the detailed arsenic resistance mechanisms remain unknown though there are at least three arsenic-resistance operons (ars1, ars2, and ars3) in R. palustris. In this study, we investigated how arsenic multi-operons contributed to arsenic detoxification in R. palustris. The expression of ars2 or ars3 operons increased with increasing environmental arsenite (As(III)) concentrations (up to 1.0 mM) while transcript of ars1 operon was not detected in the middle log-phase (55 h). ars2 operon was actively expressed even at the low concentration of As(III) (0.01 μM), whereas the ars3 operon was expressed at 1.0 μM of As(III), indicating that there was a differential regulation mechanism for the three arsenic operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of ars1 transcript was only detected at 43 h (early log-phase). Arsenic speciation analysis demonstrated that R. palustris could reduce As(V) to As(III). Collectively, strain CGA009 detoxified arsenic by using arsenic reduction and methylating arsenic mechanism, while the latter might occur with the presence of higher concentrations of arsenic.

  3. Rapid identification of sequences for orphan enzymes to power accurate protein annotation.

    Directory of Open Access Journals (Sweden)

    Kevin R Ramkissoon

    Full Text Available The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.

  4. Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation

    Science.gov (United States)

    Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.

    2013-01-01

    The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392

  5. Human glycemic response curves after intake of carbohydrate foods are accurately predicted by combining in vitro gastrointestinal digestion with in silico kinetic modeling

    Directory of Open Access Journals (Sweden)

    Susann Bellmann

    2018-02-01

    Conclusion: Based on the demonstrated accuracy and predictive quality, this in vitro–in silico technology can be used for the testing of food products on their glycemic response under standardized conditions and may stimulate the production of (slow carbs for the prevention of metabolic diseases.

  6. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales.

    Science.gov (United States)

    Noll, Kenneth M; Lapierre, Pascal; Gogarten, J Peter; Nanavati, Dhaval M

    2008-01-15

    The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. We demonstrate that the two maltose ATP binding cassette (ABC) transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively) are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to have been horizontally acquired by a Thermotoga

  7. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  8. Efficient and accurate two-scale FE-FFT-based prediction of the effective material behavior of elasto-viscoplastic polycrystals

    Science.gov (United States)

    Kochmann, Julian; Wulfinghoff, Stephan; Ehle, Lisa; Mayer, Joachim; Svendsen, Bob; Reese, Stefanie

    2017-09-01

    Recently, two-scale FE-FFT-based methods (e.g., Spahn et al. in Comput Methods Appl Mech Eng 268:871-883, 2014; Kochmann et al. in Comput Methods Appl Mech Eng 305:89-110, 2016) have been proposed to predict the microscopic and overall mechanical behavior of heterogeneous materials. The purpose of this work is the extension to elasto-viscoplastic polycrystals, efficient and robust Fourier solvers and the prediction of micromechanical fields during macroscopic deformation processes. Assuming scale separation, the macroscopic problem is solved using the finite element method. The solution of the microscopic problem, which is embedded as a periodic unit cell (UC) in each macroscopic integration point, is found by employing fast Fourier transforms, fixed-point and Newton-Krylov methods. The overall material behavior is defined by the mean UC response. In order to ensure spatially converged micromechanical fields as well as feasible overall CPU times, an efficient but simple solution strategy for two-scale simulations is proposed. As an example, the constitutive behavior of 42CrMo4 steel is predicted during macroscopic three-point bending tests.

  9. Normal Tissue Complication Probability Estimation by the Lyman-Kutcher-Burman Method Does Not Accurately Predict Spinal Cord Tolerance to Stereotactic Radiosurgery

    Energy Technology Data Exchange (ETDEWEB)

    Daly, Megan E.; Luxton, Gary [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Choi, Clara Y.H. [Department of Neurosurgery, Stanford University, Stanford, CA (United States); Gibbs, Iris C. [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Chang, Steven D.; Adler, John R. [Department of Neurosurgery, Stanford University, Stanford, CA (United States); Soltys, Scott G., E-mail: sgsoltys@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)

    2012-04-01

    Purpose: To determine whether normal tissue complication probability (NTCP) analyses of the human spinal cord by use of the Lyman-Kutcher-Burman (LKB) model, supplemented by linear-quadratic modeling to account for the effect of fractionation, predict the risk of myelopathy from stereotactic radiosurgery (SRS). Methods and Materials: From November 2001 to July 2008, 24 spinal hemangioblastomas in 17 patients were treated with SRS. Of the tumors, 17 received 1 fraction with a median dose of 20 Gy (range, 18-30 Gy) and 7 received 20 to 25 Gy in 2 or 3 sessions, with cord maximum doses of 22.7 Gy (range, 17.8-30.9 Gy) and 22.0 Gy (range, 20.2-26.6 Gy), respectively. By use of conventional values for {alpha}/{beta}, volume parameter n, 50% complication probability dose TD{sub 50}, and inverse slope parameter m, a computationally simplified implementation of the LKB model was used to calculate the biologically equivalent uniform dose and NTCP for each treatment. Exploratory calculations were performed with alternate values of {alpha}/{beta} and n. Results: In this study 1 case (4%) of myelopathy occurred. The LKB model using radiobiological parameters from Emami and the logistic model with parameters from Schultheiss overestimated complication rates, predicting 13 complications (54%) and 18 complications (75%), respectively. An increase in the volume parameter (n), to assume greater parallel organization, improved the predictive value of the models. Maximum-likelihood LKB fitting of {alpha}/{beta} and n yielded better predictions (0.7 complications), with n = 0.023 and {alpha}/{beta} = 17.8 Gy. Conclusions: The spinal cord tolerance to the dosimetry of SRS is higher than predicted by the LKB model using any set of accepted parameters. Only a high {alpha}/{beta} value in the LKB model and only a large volume effect in the logistic model with Schultheiss data could explain the low number of complications observed. This finding emphasizes that radiobiological models

  10. Impact of the deletion of the six mce operons in Mycobacterium smegmatis.

    Science.gov (United States)

    Klepp, Laura I; Forrellad, Marina A; Osella, Ana V; Blanco, Federico C; Stella, Emma J; Bianco, María Verónica; Santangelo, María de la Paz; Sassetti, Cristopher; Jackson, Mary; Cataldi, Angel A; Bigi, Fabiana; Morbidoni, Héctor R

    2012-07-01

    The Mycobacterium smegmatis genome contains six operons designated mce (mammalian cell entry). These operons, which encode membrane and exported proteins, are highly conserved in pathogenic and non-pathogenic mycobacteria. Although the function of the Mce protein family has not yet been established in Mycobacterium smegmatis, the requirement of the mce4 operon for cholesterol utilization and uptake by Mycobacterium tuberculosis has recently been demonstrated. In this study, we report the construction of an M. smegmatis knock-out mutant deficient in the expression of all six mce operons. The consequences of these mutations were studied by analyzing physiological parameters and phenotypic traits. Differences in colony morphology, biofilm formation and aggregation in liquid cultures were observed, indicating that mce operons of M. smegmatis are implicated in the maintenance of the surface properties of the cell. Importantly, the mutant strain showed reduced cholesterol uptake when compared to the parental strain. Further cholesterol uptake studies using single mce mutant strains showed that the mutation of operon mce4 was reponsible for the cholesterol uptake failure detected in the sextuple mce mutant. This finding demonstrates that mce4operon is involved in cholesterol transport in M. smegmatis. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  12. Regulation of gene expression: Cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes. PMID:25763016

  13. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  14. Stable, high-order SBP-SAT finite difference operators to enable accurate simulation of compressible turbulent flows on curvilinear grids, with application to predicting turbulent jet noise

    Science.gov (United States)

    Byun, Jaeseung; Bodony, Daniel; Pantano, Carlos

    2014-11-01

    Improved order-of-accuracy discretizations often require careful consideration of their numerical stability. We report on new high-order finite difference schemes using Summation-By-Parts (SBP) operators along with the Simultaneous-Approximation-Terms (SAT) boundary condition treatment for first and second-order spatial derivatives with variable coefficients. In particular, we present a highly accurate operator for SBP-SAT-based approximations of second-order derivatives with variable coefficients for Dirichlet and Neumann boundary conditions. These terms are responsible for approximating the physical dissipation of kinetic and thermal energy in a simulation, and contain grid metrics when the grid is curvilinear. Analysis using the Laplace transform method shows that strong stability is ensured with Dirichlet boundary conditions while weaker stability is obtained for Neumann boundary conditions. Furthermore, the benefits of the scheme is shown in the direct numerical simulation (DNS) of a Mach 1.5 compressible turbulent supersonic jet using curvilinear grids and skew-symmetric discretization. Particularly, we show that the improved methods allow minimization of the numerical filter often employed in these simulations and we discuss the qualities of the simulation.

  15. RNA-mediated reciprocal regulation between two bacterial operons is RNase III dependent.

    Science.gov (United States)

    Johnson, Christopher M; Haemig, Heather H A; Chatterjee, Anushree; Wei-Shou, Hu; Weaver, Keith E; Dunny, Gary M

    2011-01-01

    In bacteria, RNAs regulate gene expression and function via several mechanisms. An RNA may pair with complementary sequences in a target RNA to impact transcription, translation, or degradation of the target. Control of conjugation of pCF10, a pheromone response plasmid of Enterococcus faecalis, is a well-characterized system that serves as a model for the regulation of gene expression in bacteria by intercellular signaling. The prgQ operon, whose products mediate conjugation, is negatively regulated by two products of the prgX operon, Anti-Q, a small RNA, and PrgX, the transcriptional repressor of the prgQ promoter. Here we show that Qs, an RNA from the 5' end of the prgQ operon, represses expression of PrgX by targeting prgX mRNA for cleavage by RNase III. Our results demonstrate that the prgQ and prgX operons each use RNAs to negatively regulate gene expression from the opposing operon by different mechanisms. Such reciprocal regulation between two operons using RNAs has not been previously demonstrated. Furthermore, these results show that Qs is an unusually versatile RNA, serving three separate functions in the regulation of conjugation. Understanding the potential versatility of RNAs and their various roles in gene regulatory networks will allow us to better understand how cells regulate complex behavior. Bacteria use RNA to regulate gene expression by a variety of mechanisms. The prgQ and prgX operons of pCF10, a conjugative plasmid of Enterococcus faecalis, have been shown to negatively regulate one another by a variety of mechanisms. One of these mechanisms involves Anti-Q, a small RNA from the prgX operon that prevents gene expression from the prgQ operon. In this work, we find that Qs, an RNA from the prgQ operon, negatively regulates gene expression from the prgX operon. These findings have a number of implications. (i) The Anti-Q and Qs RNAs act by different mechanisms, highlighting the variety of ways in which bacteria can regulate gene expression

  16. Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon.

    Science.gov (United States)

    Ludwig, H; Homuth, G; Schmalisch, M; Dyka, F M; Hecker, M; Stülke, J

    2001-07-01

    Glycolysis is one of the main pathways of carbon catabolism in Bacillus subtilis. Although the biochemical activity of glycolytic enzymes has been studied in detail, no information about the expression of glycolytic genes has so far been available in this organism. Therefore, transcriptional analysis of all glycolytic genes was performed. The genes cggR, gapA, pgk, tpi, pgm and eno, encoding the enzymes required for the interconversion of triose phosphates, are transcribed as a hexacistronic operon as demonstrated by Northern analysis. This gapA operon is repressed by the regulator CggR. The presence of sugars and amino acids synergistically results in the induction of the gapA operon. The transcriptional start site upstream of cggR was mapped by primer extension. Transcripts originating upstream of cggR are processed near the 3' end of cggR. This endonucleolytic cleavage leads to differential stability of the resulting processing products: the monocistronic cggR message is very rapidly degraded, whereas the mRNA species encoding glycolytic enzymes exhibit much higher stability. An additional internal constitutive promoter was identified upstream of pgk. Thus, gapA is the most strongly regulated gene of this operon. The pfk pyk operon encoding phosphofructokinase and pyruvate kinase is weakly induced by glucose. In contrast, the genes pgi and fbaA, coding for phosphoglucoisomerase and fructose-1,6-bisphosphate aldolase, are constitutively expressed.

  17. Fukuoka criteria accurately predict risk for adverse outcomes during follow-up of pancreatic cysts presumed to be intraductal papillary mucinous neoplasms.

    Science.gov (United States)

    Mukewar, Saurabh; de Pretis, Nicolo; Aryal-Khanal, Anupama; Ahmed, Nazir; Sah, Raghuwansh; Enders, Felicity; Larson, Joseph J; Levy, Michael J; Takahashi, Naoki; Topazian, Mark; Pearson, Randall; Vege, Santhi S; Chari, Suresh T

    2017-10-01

    Fukuoka consensus guidelines classify pancreatic cystic lesions (PCLs) presumed to be intraductal papillary mucinous neoplasms (IPMNs) into Fukuoka positive (FP) (subgroups of high-risk (HR) and worrisome features (WFs)) and Fukuoka negative (FN) (non-HR feature/WF cysts). We retrospectively estimated 5-year risk of pancreatic cancer (PC) in FN, WF and HR cysts of patients with PCL-IPMN. From Mayo Clinic databases, we randomly selected 2000 patients reported to have a PCL; we excluded inflammatory or suspected non-IPMN cysts and those without imaging follow-up. We re-reviewed cross-sectional imaging and abstracted clinical and follow-up data on PCL-IPMNs. The study contained 802 patients with FN cysts and 358 with FP cysts. Patients with PCL-IPMN had median (IQR) follow-up of 4.2 (1.8-7.1) years. Among FN cysts, 5-year PC risk was low (2-3%) regardless of cyst size (p=0.67). After excluding events in the first 6 months, 5-year PC risk remained low (0-2%) regardless of cyst size (p=0.61). Among FP cysts, HR cysts (n=66) had greater 5-year PC risk than WF cysts (n=292) (49.7% vs 4.1%; p10 mm (79.8% vs 37.3% vs 39.4%, respectively; p=0.01). Fukuoka guidelines accurately stratify PCL-IPMNs for PC risk, with FN cysts having lowest and HR cysts having greatest risk. After 6-month follow-up, WF and FN cysts had a low 5-year PC risk. Surveillance strategies should be tailored appropriately. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  18. Identification of anthranilate and benzoate metabolic operons of Pseudomonas fluorescens and functional characterization of their promoter regions

    Directory of Open Access Journals (Sweden)

    Lee Vincent D

    2006-01-01

    Full Text Available Abstract Background In an effort to identify alternate recombinant gene expression systems in Pseudomonas fluorescens, we identified genes encoding two native metabolic pathways that were inducible with inexpensive compounds: the anthranilate operon (antABC and the benzoate operon (benABCD. Results The antABC and benABCD operons were identified by homology to the Acinetobacter sp. anthranilate operon and Pseudomonas putida benzoate operon, and were confirmed to be regulated by anthranilate or benzoate, respectively. Fusions of the putative promoter regions to the E. coli lacZ gene were constructed to confirm inducible gene expression. Each operon was found to be controlled by an AraC family transcriptional activator, located immediately upstream of the first structural gene in each respective operon (antR or benR. Conclusion We have found the anthranilate and benzoate promoters to be useful for tightly controlling recombinant gene expression at both small (

  19. Mortality Following Congenital Heart Surgery in Adults Can Be Predicted Accurately by Combining Expert-Based and Evidence-Based Pediatric Risk Scores.

    Science.gov (United States)

    Hörer, Jürgen; Kasnar-Samprec, Jelena; Cleuziou, Julie; Strbad, Martina; Wottke, Michael; Kaemmerer, Harald; Schreiber, Christian; Lange, Rüdiger

    2016-07-01

    Currently, there are few specific risk stratification models available to predict mortality following congenital heart surgery in adults. We sought to evaluate whether the predictive power of the common pediatric scores is applicable for adults. In addition, we evaluated a new grown-ups with congenital heart disease (GUCH) score specifically designed for adults undergoing congenital heart surgery. Data of all consecutive patients aged 18 years or more, who underwent surgery for congenital heart disease (CHD) between 2004 and 2013 at our institution, were collected. We evaluated the Aristotle Basic Complexity (ABC), the Aristotle Comprehensive Complexity (ACC), the Risk Adjustment in Congenital Heart Surgery (RACHS-1), and the Society of Thoracic Surgeons (STS)-European Association for Cardiothoracic Surgery (EACTS) scores. The proposed GUCH score consists of the STS-EACTS score, the procedure-dependent and -independent factors of the ACC score, and age. The discriminatory power of the scores was assessed using the area under the receiver-operating characteristics curve (c-index). A total of 830 operations were evaluated. Hospital mortality was 2.9%. C-indexes were 0.67, 0.80, 0.62, 0.78, and 0.84 for the ABC, ACC, RACHS-1, STS-EACTS, and GUCH mortality scores, respectively. The evidence-based EACTS-STS score outperforms the expert-based ABC score. The expert-based ACC score is superior to the evidence-based EACTS-STS score since comorbidities are considered. Our proposed GUCH score outperforms all other scores since it integrates the advantages of the evidence-based EACTS-STS score for procedures and the expert-based ACC score for comorbidities. Evidence-based scores for adults with CHD should include comorbidities and patient ages. © The Author(s) 2016.

  20. Skinfold Prediction Equations Fail to Provide an Accurate Estimate of Body Composition in Elite Rugby Union Athletes of Caucasian and Polynesian Ethnicity.

    Science.gov (United States)

    Zemski, Adam J; Broad, Elizabeth M; Slater, Gary J

    2018-01-01

    Body composition in elite rugby union athletes is routinely assessed using surface anthropometry, which can be utilized to provide estimates of absolute body composition using regression equations. This study aims to assess the ability of available skinfold equations to estimate body composition in elite rugby union athletes who have unique physique traits and divergent ethnicity. The development of sport-specific and ethnicity-sensitive equations was also pursued. Forty-three male international Australian rugby union athletes of Caucasian and Polynesian descent underwent surface anthropometry and dual-energy X-ray absorptiometry (DXA) assessment. Body fat percent (BF%) was estimated using five previously developed equations and compared to DXA measures. Novel sport and ethnicity-sensitive prediction equations were developed using forward selection multiple regression analysis. Existing skinfold equations provided unsatisfactory estimates of BF% in elite rugby union athletes, with all equations demonstrating a 95% prediction interval in excess of 5%. The equations tended to underestimate BF% at low levels of adiposity, whilst overestimating BF% at higher levels of adiposity, regardless of ethnicity. The novel equations created explained a similar amount of variance to those previously developed (Caucasians 75%, Polynesians 90%). The use of skinfold equations, including the created equations, cannot be supported to estimate absolute body composition. Until a population-specific equation is established that can be validated to precisely estimate body composition, it is advocated to use a proven method, such as DXA, when absolute measures of lean and fat mass are desired, and raw anthropometry data routinely to derive an estimate of body composition change.

  1. Anthropometric variables accurately predict dual energy x-ray absorptiometric-derived body composition and can be used to screen for diabetes.

    Directory of Open Access Journals (Sweden)

    Reza Yavari

    Full Text Available The current world-wide epidemic of obesity has stimulated interest in developing simple screening methods to identify individuals with undiagnosed diabetes mellitus type 2 (DM2 or metabolic syndrome (MS. Prior work utilizing body composition obtained by sophisticated technology has shown that the ratio of abdominal fat to total fat is a good predictor for DM2 or MS. The goals of this study were to determine how well simple anthropometric variables predict the fat mass distribution as determined by dual energy x-ray absorptometry (DXA, and whether these are useful to screen for DM2 or MS within a population. To accomplish this, the body composition of 341 females spanning a wide range of body mass indices and with a 23% prevalence of DM2 and MS was determined using DXA. Stepwise linear regression models incorporating age, weight, height, waistline, and hipline predicted DXA body composition (i.e., fat mass, trunk fat, fat free mass, and total mass with good accuracy. Using body composition as independent variables, nominal logistic regression was then performed to estimate the probability of DM2. The results show good discrimination with the receiver operating characteristic (ROC having an area under the curve (AUC of 0.78. The anthropometrically-derived body composition equations derived from the full DXA study group were then applied to a group of 1153 female patients selected from a general endocrinology practice. Similar to the smaller study group, the ROC from logistical regression using body composition had an AUC of 0.81 for the detection of DM2. These results are superior to screening based on questionnaires and compare favorably with published data derived from invasive testing, e.g., hemoglobin A1c. This anthropometric approach offers promise for the development of simple, inexpensive, non-invasive screening to identify individuals with metabolic dysfunction within large populations.

  2. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Science.gov (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  3. N0/N1, PNL, or LNR? The effect of lymph node number on accurate survival prediction in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Valsangkar, Nakul P; Bush, Devon M; Michaelson, James S; Ferrone, Cristina R; Wargo, Jennifer A; Lillemoe, Keith D; Fernández-del Castillo, Carlos; Warshaw, Andrew L; Thayer, Sarah P

    2013-02-01

    We evaluated the prognostic accuracy of LN variables (N0/N1), numbers of positive lymph nodes (PLN), and lymph node ratio (LNR) in the context of the total number of examined lymph nodes (ELN). Patients from SEER and a single institution (MGH) were reviewed and survival analyses performed in subgroups based on numbers of ELN to calculate excess risk of death (hazard ratio, HR). In SEER and MGH, higher numbers of ELN improved the overall survival for N0 patients. The prognostic significance (N0/N1) and PLN were too variable as the importance of a single PLN depended on the total number of LN dissected. LNR consistently correlated with survival once a certain number of lymph nodes were dissected (≥13 in SEER and ≥17 in the MGH dataset). Better survival for N0 patients with increasing ELN likely represents improved staging. PLN have some predictive value but the ELN strongly influence their impact on survival, suggesting the need for a ratio-based classification. LNR strongly correlates with outcome provided that a certain number of lymph nodes is evaluated, suggesting that the prognostic accuracy of any LN variable depends on the total number of ELN.

  4. Operon conservation and the evolution of trans-splicing in the phylum Nematoda

    National Research Council Canada - National Science Library

    Guiliano, David B; Blaxter, Mark L

    2006-01-01

    .... We surveyed five additional nematode species, representing three of the five major clades of the phylum Nematoda, for the presence of operons and the use of trans-spliced leaders in resolution...

  5. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  6. Parallel Evolution and Horizontal Gene Transfer of the pst Operon in Firmicutes from Oligotrophic Environments

    Directory of Open Access Journals (Sweden)

    Alejandra Moreno-Letelier

    2011-01-01

    Full Text Available The high affinity phosphate transport system (pst is crucial for phosphate uptake in oligotrophic environments. Cuatro Cienegas Basin (CCB has extremely low P levels and its endemic Bacillus are closely related to oligotrophic marine Firmicutes. Thus, we expected the pst operon of CCB to share the same evolutionary history and protein similarity to marine Firmicutes. Orthologs of the pst operon were searched in 55 genomes of Firmicutes and 13 outgroups. Phylogenetic reconstructions were performed for the pst operon and 14 concatenated housekeeping genes using maximum likelihood methods. Conserved domains and 3D structures of the phosphate-binding protein (PstS were also analyzed. The pst operon of Firmicutes shows two highly divergent clades with no correlation to the type of habitat nor a phylogenetic congruence, suggesting horizontal gene transfer. Despite sequence divergence, the PstS protein had a similar 3D structure, which could be due to parallel evolution after horizontal gene transfer events.

  7. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R.

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  8. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y

    2015-09-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  10. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  11. Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440.

    Science.gov (United States)

    Fernández, Matilde; Udaondo, Zulema; Niqui, José-Luis; Duque, Estrella; Ramos, Juan-Luis

    2014-10-01

    The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted ars1 and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of P(ars1) and P(ars2) to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in ars1 and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the ars1 operon appears to only occur in the KT2440 strain, suggesting that ars1 was acquired by horizontal gene transfer. The presence of ars1 in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.

  12. Intra- and intergenomic variation of ribosomal RNA operons in concurrent Alteromonas macleodii strains.

    Science.gov (United States)

    López-Pérez, Mario; Gonzaga, Aitor; Martin-Cuadrado, Ana-Belen; López-García, Purificación; Rodriguez-Valera, Francisco; Kimes, Nikole E

    2013-04-01

    Biodiversity estimates based on ribosomal operon sequence diversity rely on the premise that a sequence is characteristic of a single specific taxon or operational taxonomic unit (OTU). Here, we have studied the sequence diversity of 14 ribosomal RNA operons (rrn) contained in the genomes of two isolates (five operons in each genome) and four metagenomic fosmids, all from the same seawater sample. Complete sequencing of the isolate genomes and the fosmids establish that they represent strains of the same species, Alteromonas macleodii, with average nucleotide identity (ANI) values >97 %. Nonetheless, we observed high levels of intragenomic heterogeneity (i.e., variability between operons of a single genome) affecting multiple regions of the 16S and 23S rRNA genes as well as the internally transcribed spacer 1 (ITS-1) region. Furthermore, the ribosomal operons exhibited intergenomic heterogeneity (i.e., variability between operons located in separate genomes) in each of these regions, compounding the variability. Our data reveal the extensive heterogeneity observed in natural populations of A. macleodii at a single point in time and support the idea that distinct lineages of A. macleodii exist in the deep Mediterranean. These findings highlight the potential of rRNA fingerprinting methods to misrepresent species diversity while simultaneously failing to recognize the ecological significance of individual strains.

  13. Evolution of a tRNA operon in gamma purple bacteria.

    Science.gov (United States)

    Giroux, S; Cedergren, R

    1989-01-01

    Genomic DNA from eubacteria belonging to the gamma-3 subdivision of purple bacteria, as classified by Woese (C.R. Woese, Microbiol. Rev. 51:221-271, 1987), were probed with the argT operon of Escherichia coli encoding 5'-tRNA(Arg)-tRNA(His)-tRNA(Leu)-tRNA(Pro)-3'. The homologous operon from Vibrio harveyi was isolated and sequenced. Comparison of the five available sequences of this tRNA cluster from members of the families Enterobacteriaceae, Aeromonadaceae, and Vibrionaceae led to the conclusion that variations in different versions of this operon arose not only by point mutations but also by duplication and addition-deletion of entire tRNA genes. This data base permitted the formulation of a proposal dealing with the evolutionary history of this operon and suggested that DNA regions containing tRNA genes are active centers (hot spots) of recombination. Finally, since the operon from V. harveyi was not highly repetitive and did not contain tRNA pseudogenes, as in the Photobacterium phosphoreum operon, hybridization of genomic DNAs from different photobacterial strains with probes specific for the repeated pseudogene element was performed. We conclude that the phylogenetic distribution of the repetitive DNA is restricted to strains of P. phosphoreum. Images PMID:2687235

  14. Cloning and comparison of third beta-glucoside utilization (bglEFIA) operon with two operons of Pectobacterium carotovorum subsp. carotovorum LY34.

    Science.gov (United States)

    Hong, Su Young; An, Chang Long; Cho, Kye Man; Lee, Sun Mi; Kim, Yong Hee; Kim, Min Keun; Cho, Soo Jeong; Lim, Yong Pyo; Kim, Hoon; Yun, Han Dae

    2006-04-01

    A third bgl operon containing bglE, bglF, bglI, and bglA was isolated from Pectobacterium carotovorum subsp. carotovorum LY34 (Pcc LY34). The sequences of BglE, BglF, and Bgll were similar to those of the phosphotransferase system (PTS) components IIB, IIC, and IIA respectively. BglF contains important residues for the phosphotransferase system. The amino acid sequence of BglA showed high similarity to various 6-phospho-beta-glucosidases and to a member of glycosyl hydrolase family 1. Sequence and structural analysis also revealed that these four genes were organized in a putative operon that differed from two operons previously isolated from Pcc LY34, bglTPB (accession no. AY542524) and ascGFB (accession no. AY622309). The transcription regulator for this operon was not found, and the EII complexes for PTS were encoded separately by three genes (bglE, bglF, and bglI). The BglA enzyme had a molecular weight estimated to be 57,350 Da by SDS-PAGE. The purified beta-glucosidase hydrolyzed salicin, arbutin, rhoNPG, rhoNPbetaG6P, and MUG, exhibited maximal activity at pH 7.0 and 40 degrees C, and displayed enhanced activity in the presence of Mg2+ and Ca2+. Two glutamate residues (Glu178 and Glu378) were found to be essential for enzyme activity.

  15. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  16. Transcription analysis and small non-protein coding RNAs associated with bacterial ribosomal protein operons.

    Science.gov (United States)

    Khayrullina, G A; Raabe, C A; Hoe, C H; Becker, K; Reinhardt, R; Tang, T H; Rozhdestvensky, T S; Kopylov, A M

    2012-01-01

    For decades ribosome biogenesis and translation represent key targets in the antimicrobial drug development to combat bacterial infections. Here we report a survey of various small non-protein coding (ncRNAs) associated with ribosomal protein (r-protein) operons in the bacterial pathogens S. aureus, V. cholerae, S. Typhi and M. tuberculosis. We identified four ncRNA candidates that overlap with important structural regions involved in translational feedback regulation. Most notable are the ncRNA 55 family containing the unique recognition site of the L10-(L12)4 complex that consequently might be involved in L10 operon regulation, and ncRNA StyR 337 that resembles the pseudoknot secondary structure of the S4 regulatory region. These findings potentially implicate the candidate ncRNAs in translational regulation of the corresponding operons. In total we report 28 intergenically encoded ncRNAs that map in sense orientation to 14 ribosomal protein operons and 13 cis-antisense encoded ncRNAs transcribed complementary to nine r-protein mRNAs. All ncRNA candidates were independently validated by extensive Northern blot hybridizations to account for growth-stage specific ncRNA transcription and to check ncRNA integrity. In addition we revisited the str-operon as experimental model to monitor internal initiation of transcription in the operon throughout bacterial growth by real-time PCR. Our data indicate additional facets of ribosomal protein operons transcription, and might lead to novel insights of ribosome biogenesis, as well as exploration of strategies involving differential drug development.

  17. Can Selforganizing Maps Accurately Predict Photometric Redshifts?

    Science.gov (United States)

    Way, Michael J.; Klose, Christian

    2012-01-01

    We present an unsupervised machine-learning approach that can be employed for estimating photometric redshifts. The proposed method is based on a vector quantization called the self-organizing-map (SOM) approach. A variety of photometrically derived input values were utilized from the Sloan Digital Sky Survey's main galaxy sample, luminous red galaxy, and quasar samples, along with the PHAT0 data set from the Photo-z Accuracy Testing project. Regression results obtained with this new approach were evaluated in terms of root-mean-square error (RMSE) to estimate the accuracy of the photometric redshift estimates. The results demonstrate competitive RMSE and outlier percentages when compared with several other popular approaches, such as artificial neural networks and Gaussian process regression. SOM RMSE results (using delta(z) = z(sub phot) - z(sub spec)) are 0.023 for the main galaxy sample, 0.027 for the luminous red galaxy sample, 0.418 for quasars, and 0.022 for PHAT0 synthetic data. The results demonstrate that there are nonunique solutions for estimating SOM RMSEs. Further research is needed in order to find more robust estimation techniques using SOMs, but the results herein are a positive indication of their capabilities when compared with other well-known methods

  18. Accurate ab initio calculations of O-HO and O-H(-)O proton chemical shifts: towards elucidation of the nature of the hydrogen bond and prediction of hydrogen bond distances.

    Science.gov (United States)

    Siskos, Michael G; Tzakos, Andreas G; Gerothanassis, Ioannis P

    2015-09-07

    The inability to determine precisely the location of labile protons in X-ray molecular structures has been a key barrier to progress in many areas of molecular sciences. We report an approach for predicting hydrogen bond distances beyond the limits of X-ray crystallography based on accurate ab initio calculations of O-HO proton chemical shifts, using a combination of DFT and contactor-like polarizable continuum model (PCM). Very good linear correlation between experimental and computed (at the GIAO/B3LYP/6-311++G(2d,p) level of theory) chemical shifts were obtained with a large set of 43 compounds in CHCl3 exhibiting intramolecular O-HO and intermolecular and intramolecular ionic O-H(-)O hydrogen bonds. The calculated OH chemical shifts exhibit a strong linear dependence on the computed (O)HO hydrogen bond length, in the region of 1.24 to 1.85 Å, of -19.8 ppm Å(-1) and -20.49 ppm Å(-1) with optimization of the structures at the M06-2X/6-31+G(d) and B3LYP/6-31+G(d) level of theory, respectively. A Natural Bond Orbitals (NBO) analysis demonstrates a very good linear correlation between the calculated (1)H chemical shifts and (i) the second-order perturbation stabilization energies, corresponding to charge transfer between the oxygen lone pairs and σ antibonding orbital and (ii) Wiberg bond order of the O-HO and O-H(-)O hydrogen bond. Accurate ab initio calculations of O-HO and O-H(-)O (1)H chemical shifts can provide improved structural and electronic description of hydrogen bonding and a highly accurate measure of distances of short and strong hydrogen bonds.

  19. Multiple rRNA operons are essential for efficient cell growth and sporulation as well as outgrowth in Bacillus subtilis.

    Science.gov (United States)

    Yano, Koichi; Wada, Tetsuya; Suzuki, Shota; Tagami, Kazumi; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Kawaguchi, Yasuhiro; Masuda, Kenta; Akanuma, Genki; Nanamiya, Hideaki; Niki, Hironori; Yoshikawa, Hirofumi; Kawamura, Fujio

    2013-11-01

    The number of copies of rRNA (rrn) operons in a bacterial genome differs greatly among bacterial species. Here we examined the phenotypic effects of variations in the number of copies of rRNA genes in the genome of Bacillus subtilis by analysis of eight mutant strains constructed to carry from two to nine copies of the rrn operon. We found that a decrease in the number of copies from ten to one increased the doubling time, and decreased the sporulation frequency and motility. The maximum levels for transformation activity were similar among the strains, although the competence development was significantly delayed in the strain with a single rrn operon. Normal sporulation only occurred if more than four copies of the rrn operon were present, although ten copies were needed for vegetative growth after germination of the spores. This behaviour was seen even though the intracellular level of ribosomes was similar among strains with four to ten copies of the rrn operon. Furthermore, ten copies of the rrn operon were needed for the highest swarming activity. We also constructed 21 strains that carried all possible combinations of two copies of the rrn operons, and found that these showed a range of growth rates and sporulation frequencies that all fell between those recorded for strains with one or three copies of the rrn operon. The results suggested that the copy number of the rrn operon has a major influence on cellular processes such as growth rate and sporulation frequency.

  20. Characterization of MarR, the repressor of the multiple antibiotic resistance (mar) operon in Escherichia coli.

    OpenAIRE

    Seoane, A S; Levy, S B

    1995-01-01

    The marRAB operon is one of two operons in the mar locus of Escherichia coli that are divergently transcribed from a central regulatory region, marO. The marRAB operon, transcribed from marOII, controls intrinsic resistance or susceptibility to multiple antibiotics and is inducible by structurally unrelated compounds such as tetracycline and chloramphenicol (S. P. Cohen, H. Hachler, and S. B. Levy, J. Bacteriol. 175:1484-1492, 1993). To clarify the role of the operon in response to environmen...

  1. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  2. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  3. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes

    Directory of Open Access Journals (Sweden)

    Olga L. Voronina

    2016-01-01

    Full Text Available Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A “lacking biofilm production” (LBP strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg has a key role in biofilm formation. The relative location (i.e., by being separated by another gene of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  4. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  5. The diversity of membrane transporters encoded in bacterial arsenic-resistance operons

    Directory of Open Access Journals (Sweden)

    Yiren Yang

    2015-05-01

    Full Text Available Transporter-facilitated arsenite extrusion is the major pathway of arsenic resistance within bacteria. So far only two types of membrane-bound transporter proteins, ArsB and ArsY (ACR3, have been well studied, although the arsenic transporters in bacteria display considerable diversity. Utilizing accumulated genome sequence data, we searched arsenic resistance (ars operons in about 2,500 bacterial strains and located over 700 membrane-bound transporters which are encoded in these operons. Sequence analysis revealed at least five distinct transporter families, with ArsY being the most dominant, followed by ArsB, ArsP (a recently reported permease family, Major Facilitator protein Superfamily (MFS and Major Intrinsic Protein (MIP. In addition, other types of transporters encoded in the ars operons were found, but in much lower frequencies. The diversity and evolutionary relationships of these transporters with regard to arsenic resistance will be discussed.

  6. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...... for the regulation of the expression of the pyrimidine biosynthetic genes leading to UMP formation. The second gene encodes a membrane-bound high-affinity uracil permease, required for utilization of exogenous uracil. The last two genes in the operon, pyrB and carA, encode pyrimidine biosynthetic enzymes; aspartate...... transcarbamoylase (pyrB) is the second enzyme in the pathway, whereas carbamoyl-phosphate synthetase subunit A (carA) is the small subunit of a heterodimeric enzyme, catalyzing the formation of carbamoyl phosphate. The carA gene product is shown to be required for both pyrimidine and arginine biosynthesis...

  7. Fine-tuned transcriptional regulation of malate operons in Enterococcus faecalis.

    Science.gov (United States)

    Mortera, Pablo; Espariz, Martín; Suárez, Cristian; Repizo, Guillermo; Deutscher, Josef; Alarcón, Sergio; Blancato, Víctor; Magni, Christian

    2012-03-01

    In Enterococcus faecalis, the mae locus is constituted by two putative divergent operons, maePE and maeKR. The first operon encodes a putative H(+)/malate symporter (MaeP) and a malic enzyme (MaeE) previously shown to be essential for malate utilization in this bacterium. The maeKR operon encodes two putative proteins with significant similarity to two-component systems involved in sensing malate and activating its assimilation in bacteria. Our transcriptional and genetic assays showed that maePE and maeKR are induced in response to malate by the response regulator MaeR. In addition, we observed that both operons were partially repressed in the presence of glucose. Accordingly, the cometabolism of this sugar and malate was detected. The binding of the complex formed by CcpA and its corepressor P-Ser-HPr to a cre site located in the mae region was demonstrated in vitro and explains the carbon catabolite repression (CCR) observed for the maePE operon. However, our results also provide evidence for a CcpA-independent CCR mechanism regulating the expression of both operons. Finally, a biomass increment of 40 or 75% was observed compared to the biomass of cells grown only on glucose or malate, respectively. Cells cometabolizing both carbon sources exhibit a higher rate of glucose consumption and a lower rate of malate utilization. The growth improvement achieved by E. faecalis during glucose-malate cometabolism might explain why this microorganism employs different regulatory systems to tightly control the assimilation of both carbon sources.

  8. Transcriptional regulation of the virR operon of the intracellular pathogen Rhodococcus equi.

    Science.gov (United States)

    Byrne, Gavin A; Russell, Dean A; Chen, Xiaoxiao; Meijer, Wim G

    2007-07-01

    The virR operon, located on the virulence plasmid of the intracellular pathogen Rhodococcus equi, contains five genes, two of which (virR and orf8) encode transcriptional regulators. The first gene of the operon (virR), encoding a LysR-type transcriptional regulator, is transcribed at a constitutive low level, whereas the four downstream genes are induced by low pH and high growth temperature. Differential regulation of the virR operon genes could not be explained by differential mRNA stability, as there were no major differences in mRNA half-lives of the transcripts representing each of the five genes within the virR operon. Transcription of virR is driven by the P(virR) promoter, with a transcription start site 53 bp upstream of the virR initiation codon. The four genes downstream of virR are transcribed from P(virR) and from a second promoter, P(orf5), located 585 bp downstream of the virR initiation codon. VirR binds to a site overlapping the initiation codon of virR, resulting in negative autoregulation of the virR gene, explaining its low constitutive transcription level. The P(orf5) promoter is induced by high temperature and low pH, thus explaining the observed differential gene expression of the virR operon. VirR has a positive effect on P(orf5) activity, whereas the response regulator encoded by orf8 is not involved in regulating transcription of the virR operon. The P(virR) promoter is strikingly similar to those recognized by the principal sigma factors of Streptomyces and Mycobacterium, whereas the P(orf5) promoter does not share sequence similarity with P(virR). This suggests that P(orf5) is recognized by an alternative sigma factor.

  9. DNA sequence of the lactose operon: the lacA gene and the transcriptional termination region.

    OpenAIRE

    Hediger, M A; Johnson, D F; Nierlich, D P; Zabin, I

    1985-01-01

    The lac operon of Escherichia coli spans approximately 5300 base pairs and includes the lacZ, lacY, and lacA genes in addition to the operator, promoter, and transcription termination regions. We report here the sequence of the lacA gene and the region distal to it, confirming the sequence of thiogalactoside transacetylase and completing the sequence of the lac operon. The lacA gene is characterized by use of rare codons, suggesting an origin from a plasmid, transposon, or virus gene. UUG is ...

  10. Revamping the role of biofilm regulating operons in device-associated Staphylococci and Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Pradeep P Halebeedu

    2014-01-01

    Full Text Available Extensive use of indwelling devices in modern medicine has revoked higher incidence of device associated infections and most of these devices provide an ideal surface for microbial attachment to form strong biofilms. These obnoxious biofilms are responsible for persistent infections, longer hospitalization and high mortality rate. Gene regulations in bacteria play a significant role in survival, colonization and pathogenesis. Operons being a part of gene regulatory network favour cell colonization and biofilm formation in various pathogens. This review explains the functional role of various operons in biofilm expression and regulation observed in device-associated pathogens such as Staphylococcus aureus, Staphylococcus epidermidis and Pseudomonas aeruginosa.

  11. Operon Conservation and the Evolution of trans-Splicing in the Phylum Nematoda

    OpenAIRE

    Guiliano, David B.; Blaxter, Mark L.

    2006-01-01

    The nematode Caenorhabditis elegans is unique among model animals in that many of its genes are cotranscribed as polycistronic pre-mRNAs from operons. The mechanism by which these operonic transcripts are resolved into mature mRNAs includes trans-splicing to a family of SL2-like spliced leader exons. SL2-like spliced leaders are distinct from SL1, the major spliced leader in C. elegans and other nematode species. We surveyed five additional nematode species, representing three of the five maj...

  12. Evidence for Vertical Inheritance and Loss of the Leukotoxin Operon in Genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Christensen, Henrik

    2007-01-01

    as a commensal in the ovine rumen. We have tested the hypothesis that horizontal gene transfer of the leukotoxin operon has catalyzed pathogenic adaptation and speciation of M. haemolytica + M. glucosida, or other major subclades, by using a strategy that combines compositional and phylogenetic methods. We show....... On one hand, it opposes the hypothesis of horizontal gene transfer as a catalyst of pathogenic adaptation and speciation. On the other hand, it indicates that losses of the leukotoxin operons in the radiating lineages of M. ruminalis have catalyzed their adaptation to a commensal environment...

  13. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  14. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  15. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    (encoding CPS-A) responds to arginine availability, whereas pyrAaAb (encoding CPS-P) is part of the pyrR1BCAaAbDFE operon coding for the de novo pyrimidine pathway repressed by exogenous uracil. The pyr operon is regulated by transcription attenuation mediated by a trans-acting repressor that binds...

  16. Inhibition of Transcription of the Histidine Operon In Vitro by the First Enzyme of the Histidine Pathway

    Science.gov (United States)

    Blasi, Francesco; Bruni, Carmelo B.; Avitabile, Alessandra; Deeley, Roger G.; Goldberger, Robert F.; Meyers, Marilyn M.

    1973-01-01

    An in vitro system was developed for transcription of the histidine operon of Esherichia coli carried in the genome of a defective ϕ80 transducing phage. The messenger RNA (mRNA) of the histidine operon synthesized in the in vitro system was detected by hybridization to single strands of both ϕ80 and ϕ80dhis DNA, and by competition of this hybridization with unlabeled histidine mRNA that had been synthesized in vivo (RNA extracted from cells in which the histidine operon had been derepressed). Under the conditions used, RNA complementary to the histidine operon was about 15% of the total RNA that was synthesized in vitro from the ϕ80dhis DNA template. The RNA complementary to the histidine operon was synthesized on the “sense” strand (the R strand) of ϕ80dhis in the form of a polycistronic message with a sedimentation coefficient (about 38 S) very close to that observed for the histidine mRNA synthesized in vivo. Synthesis of the histidine operon RNA appears to be subject to control in vitro. Addition of the first enzyme of the pathway for histidine biosynthesis blocked transcription of the histidine operon specifically, strongly suggesting that this enzyme acts as a regulatory protein for the histidine operon. PMID:4582195

  17. Grading More Accurately

    Science.gov (United States)

    Rom, Mark Carl

    2011-01-01

    Grades matter. College grading systems, however, are often ad hoc and prone to mistakes. This essay focuses on one factor that contributes to high-quality grading systems: grading accuracy (or "efficiency"). I proceed in several steps. First, I discuss the elements of "efficient" (i.e., accurate) grading. Next, I present analytical results…

  18. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Vinuselvi Parisutham

    Full Text Available Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon and nonsense mutation in yebK, (an uncharacterized transcription factor. Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism.

  19. Redundant phenazine operons in Pseudomonas aeruginosa exhibit environment-dependent expression and differential roles in pathogenicity.

    Science.gov (United States)

    Recinos, David A; Sekedat, Matthew D; Hernandez, Adriana; Cohen, Taylor Sitarik; Sakhtah, Hassan; Prince, Alice S; Price-Whelan, Alexa; Dietrich, Lars E P

    2012-11-20

    Evolutionary biologists have postulated that several fitness advantages may be conferred by the maintenance of duplicate genes, including environmental adaptation resulting from differential regulation. We examined the expression and physiological contributions of two redundant operons in the adaptable bacterium Pseudomonas aeruginosa PA14. These operons, phzA1-G1 (phz1) and phzA2-G2 (phz2), encode nearly identical sets of proteins that catalyze the synthesis of phenazine-1-carboxylic acid, the precursor for several phenazine derivatives. Phenazines perform diverse roles in P. aeruginosa physiology and act as virulence factors during opportunistic infections of plant and animal hosts. Although reports have indicated that phz1 is regulated by the Pseudomonas quinolone signal, factors controlling phz2 expression have not been identified, and the relative contributions of these redundant operons to phenazine biosynthesis have not been evaluated. We found that in liquid cultures, phz1 was expressed at higher levels than phz2, although phz2 showed a greater contribution to phenazine production. In colony biofilms, phz2 was expressed at high levels, whereas phz1 expression was not detectable, and phz2 was responsible for virtually all phenazine production. Analysis of mutants defective in quinolone signal synthesis revealed a critical role for 4-hydroxy-2-heptylquinoline in phz2 induction. Finally, deletion of phz2, but not of phz1, decreased lung colonization in a murine model of infection. These results suggest that differential regulation of the redundant phz operons allows P. aeruginosa to adapt to diverse environments.

  20. Efficient metabolic pathway engineering in transgenic tobacco and tomato plastids with synthetic multigene operons.

    Science.gov (United States)

    Lu, Yinghong; Rijzaani, Habib; Karcher, Daniel; Ruf, Stephanie; Bock, Ralph

    2013-02-19

    The engineering of complex metabolic pathways requires the concerted expression of multiple genes. In plastids (chloroplasts) of plant cells, genes are organized in operons that are coexpressed as polycistronic transcripts and then often are processed further into monocistronic mRNAs. Here we have used the tocochromanol pathway (providing tocopherols and tocotrienols, collectively also referred to as "vitamin E") as an example to establish principles of successful multigene engineering by stable transformation of the chloroplast genome, a technology not afflicted with epigenetic variation and/or instability of transgene expression. Testing a series of single-gene constructs (encoding homogentisate phytyltransferase, tocopherol cyclase, and γ-tocopherol methyltransferase) and rationally designed synthetic operons in tobacco and tomato plants, we (i) confirmed previous results suggesting homogentisate phytyltransferase as the limiting enzymatic step in the pathway, (ii) comparatively characterized the bottlenecks in tocopherol biosynthesis in transplastomic leaves and tomato fruits, and (iii) achieved an up to tenfold increase in total tocochromanol accumulation. In addition, our results uncovered an unexpected light-dependent regulatory link between tocochromanol metabolism and the pathways of photosynthetic pigment biosynthesis. The synthetic operon design developed here will facilitate future synthetic biology applications in plastids, especially the design of artificial operons that introduce novel biochemical pathways into plants.

  1. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  2. Differential control of Salmonella heat shock operons by structured mRNAs.

    Science.gov (United States)

    Cimdins, Annika; Roßmanith, Johanna; Langklotz, Sina; Bandow, Julia E; Narberhaus, Franz

    2013-08-01

    DnaK-DnaJ-GrpE and GroES-GroEL are the major chaperone machineries in bacteria. In many species, dnaKJ and groESL are encoded in bicistronic operons. Quantitative proteomics revealed that DnaK and GroEL amounts in Salmonella dominate over DnaJ and GroES respectively. An imperfect transcriptional terminator in the intergenic region of dnaKJ is known to result in higher transcript levels of the first gene. Here, we examined the groESL operon and asked how the second gene in a heat shock operon can be preferentially expressed and found that an RNA structure in the 5'untranslated region of groES is responsible. The secondary structure masks the Shine-Dalgarno (SD) sequence and AUG start codon and thereby modulates translation of groES mRNA. Reporter gene assays combined with structure probing and toeprinting analysis revealed a dynamic temperature-sensitive RNA structure. Following an increase in temperature, only the second of two RNA hairpins melts and partially liberates the SD sequence, thus facilitating translation. Translation of groEL is not temperature-regulated leading to an excess of the chaperonin in the cell at low temperature. Discussion in a broader context shows how structured RNA segments can differentially control expression of temperature-affected operons in various ways. © 2013 John Wiley & Sons Ltd.

  3. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli.

    Science.gov (United States)

    Parisutham, Vinuselvi; Lee, Sung Kuk

    2015-01-01

    Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon) and nonsense mutation in yebK, (an uncharacterized transcription factor). Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism.

  4. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  5. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  6. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  7. Feedback about More Accurate versus Less Accurate Trials: Differential Effects on Self-Confidence and Activation

    Science.gov (United States)

    Badami, Rokhsareh; VaezMousavi, Mohammad; Wulf, Gabriele; Namazizadeh, Mahdi

    2012-01-01

    One purpose of the present study was to examine whether self-confidence or anxiety would be differentially affected by feedback from more accurate rather than less accurate trials. The second purpose was to determine whether arousal variations (activation) would predict performance. On Day 1, participants performed a golf putting task under one of…

  8. Functions of the duplicated hik31 operons in central metabolism and responses to light, dark, and carbon sources in Synechocystis sp. strain PCC 6803.

    Science.gov (United States)

    Nagarajan, Sowmya; Sherman, Debra M; Shaw, Isaac; Sherman, Louis A

    2012-01-01

    There are two closely related hik31 operons involved in signal transduction on the chromosome and the pSYSX plasmid in the cyanobacterium Synechocystis sp. strain PCC 6803. We studied the growth, cell morphology, and gene expression in operon and hik mutants for both copies, under different growth conditions, to examine whether the duplicated copies have the same or different functions and gene targets and whether they are similarly regulated. Phenotype analysis suggested that both operons regulated common and separate targets in the light and the dark. The chromosomal operon was involved in the negative control of autotrophic events, whereas the plasmid operon was involved in the positive control of heterotrophic events. Both the plasmid and double operon mutant cells were larger and had division defects. The growth data also showed a regulatory role for the chromosomal hik gene under high-CO(2) conditions and the plasmid operon under low-O(2) conditions. Metal stress experiments indicated a role for the chromosomal hik gene and operon in mediating Zn and Cd tolerance, the plasmid operon in Co tolerance, and the chromosomal operon and plasmid hik gene in Ni tolerance. We conclude that both operons are differentially and temporally regulated. We suggest that the chromosomal operon is the primarily expressed copy and the plasmid operon acts as a backup to maintain appropriate gene dosages. Both operons share an integrated regulatory relationship and are induced in high light, in glucose, and in active cell growth. Additionally, the plasmid operon is induced in the dark with or without glucose.

  9. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain (ccdO157) and the ccd operon from the F plasmid (ccdF), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccdF and ccdO157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence.IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple antibiotic

  10. BIOACCESSIBILITY TESTS ACCURATELY ESTIMATE ...

    Science.gov (United States)

    Hazards of soil-borne Pb to wild birds may be more accurately quantified if the bioavailability of that Pb is known. To better understand the bioavailability of Pb to birds, we measured blood Pb concentrations in Japanese quail (Coturnix japonica) fed diets containing Pb-contaminated soils. Relative bioavailabilities were expressed by comparison with blood Pb concentrations in quail fed a Pb acetate reference diet. Diets containing soil from five Pb-contaminated Superfund sites had relative bioavailabilities from 33%-63%, with a mean of about 50%. Treatment of two of the soils with P significantly reduced the bioavailability of Pb. The bioaccessibility of the Pb in the test soils was then measured in six in vitro tests and regressed on bioavailability. They were: the “Relative Bioavailability Leaching Procedure” (RBALP) at pH 1.5, the same test conducted at pH 2.5, the “Ohio State University In vitro Gastrointestinal” method (OSU IVG), the “Urban Soil Bioaccessible Lead Test”, the modified “Physiologically Based Extraction Test” and the “Waterfowl Physiologically Based Extraction Test.” All regressions had positive slopes. Based on criteria of slope and coefficient of determination, the RBALP pH 2.5 and OSU IVG tests performed very well. Speciation by X-ray absorption spectroscopy demonstrated that, on average, most of the Pb in the sampled soils was sorbed to minerals (30%), bound to organic matter 24%, or present as Pb sulfate 18%. Ad

  11. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    Energy Technology Data Exchange (ETDEWEB)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A. [Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, Apartado 127, 2781-901 Oeiras (Portugal); Enguita, Francisco J., E-mail: fenguita@fm.ul.pt [Instituto de Medicina Molecular, Avenida Professor Egas Moniz, 1649-028 Lisboa (Portugal); Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Avenida da República, Apartado 127, 2781-901 Oeiras (Portugal)

    2008-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

  12. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  13. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  14. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    restriction enzyme EcoRI at 37°C according to the in- structions of the manufacturer (New .... (b) Schematic representation of the EcoRI restriction map and the structural organization of tRNA operon I in V. cholerae El Tor/O139 and clas- ... MED/09/154/97 from the Department of Biotechnology,. New Delhi. Both AG and AM ...

  15. Functional characterization of a lipoprotein-encoding operon in Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Mayumi Oakland

    Full Text Available BACKGROUND: Bacterial lipoproteins have important functions in bacterial pathogenesis and physiology. In Campylobacter jejuni, a major foodborne pathogen causing gastroenteritis in humans, the majority of lipoproteins have not been functionally characterized. Previously, we showed by DNA microarray that CmeR, a transcriptional regulator repressing the expression of the multidrug efflux pump CmeABC, modulates the expression of a three-gene operon (cj0089, cj0090, and cj0091 encoding a cluster of lipoproteins in C. jejuni. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we characterized the function and regulation of the cj0089-cj0090-cj0091 operon. In contrast to the repression of cmeABC, CmeR activates the expression of the lipoprotein genes and the regulation is confirmed by immunoblotting using anti-Cj0089 and anti-Cj0091 antibodies. Gel mobility shift assay showed that CmeR directly binds to the promoter of the lipoprotein operon, but the binding is much weaker compared with the promoter of cmeABC. Analysis of different cellular fractions indicated that Cj0089 was associated with the inner membrane, while Cj0091 was located on the outer membrane. Inactivation of cj0091, but not cj0089, significantly reduced the adherence of C. jejuni to INT 407 cells in vitro, indicating that Cj0091 has a function in adherence. When inoculated into chickens, the Cj0091 mutant also showed a defect in early colonization of the intestinal tract, suggesting that Cj0091 contributes to Campylobacter colonization in vivo. It was also shown that Cj0091 was produced and immunogenic in chickens that were naturally infected by C. jejuni. CONCLUSION/SIGNIFICANCE: These results indicate that the lipoprotein operon is subject to direct regulation by CmeR and that Cj0091 functions as an adhesion mechanism in C. jejuni and contributes to Campylobacter colonization of the intestinal tract in animal hosts.

  16. Deterministic and stochastic simulation and analysis of biochemical reaction networks the lactose operon example.

    Science.gov (United States)

    Yildirim, Necmettin; Kazanci, Caner

    2011-01-01

    A brief introduction to mathematical modeling of biochemical regulatory reaction networks is presented. Both deterministic and stochastic modeling techniques are covered with examples from enzyme kinetics, coupled reaction networks with oscillatory dynamics and bistability. The Yildirim-Mackey model for lactose operon is used as an example to discuss and show how deterministic and stochastic methods can be used to investigate various aspects of this bacterial circuit. © 2011 Elsevier Inc. All rights reserved.

  17. Combinatorial optimization of synthetic operons for the microbial production of p-coumaryl alcohol with Escherichia coli.

    Science.gov (United States)

    van Summeren-Wesenhagen, Philana V; Voges, Raphael; Dennig, Alexander; Sokolowsky, Sascha; Noack, Stephan; Schwaneberg, Ulrich; Marienhagen, Jan

    2015-06-11

    Microbes are extensively engineered to produce compounds of biotechnological or pharmaceutical interest. However, functional integration of synthetic pathways into the respective host cell metabolism and optimization of heterologous gene expression for achieving high product titers is still a challenging task. In this manuscript, we describe the optimization of a tetracistronic operon for the microbial production of the plant-derived phenylpropanoid p-coumaryl alcohol in Escherichia coli. Basis for the construction of a p-coumaryl alcohol producing strain was the development of Operon-PLICing as method for the rapid combinatorial assembly of synthetic operons. This method is based on the chemical cleavage reaction of phosphorothioate bonds in an iodine/ethanol solution to generate complementary, single-stranded overhangs and subsequent hybridization of multiple DNA-fragments. Furthermore, during the assembly of these DNA-fragments, Operon-PLICing offers the opportunity for balancing gene expression of all pathway genes on the level of translation for maximizing product titers by varying the spacing between the Shine-Dalgarno sequence and START codon. With Operon-PLICing, 81 different clones, each one carrying a different p-coumaryl alcohol operon, were individually constructed and screened for p-coumaryl alcohol formation within a few days. The absolute product titer of the best five variants ranged from 48 to 52 mg/L p-coumaryl alcohol without any further optimization of growth and production conditions. Operon-PLICing is sequence-independent and thus does not require any specific recognition or target sequences for enzymatic activities since all hybridization sites can be arbitrarily selected. In fact, after PCR-amplification, no endonucleases or ligases, frequently used in other methods, are needed. The modularity, simplicity and robustness of Operon-PLICing would be perfectly suited for an automation of cloning in the microtiter plate format.

  18. Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity.

    Science.gov (United States)

    Godfrey, Rita E; Lee, David J; Busby, Stephen J W; Browning, Douglas F

    2017-05-01

    The Escherichia coli K-12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR-dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter -10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K-12 counterpart, exhibits substantial FNR-independent activity and is insensitive to nutrient quality, due to an improved -10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K-12 and Salmonella nrf operons. © 2017 The Authors Molecular Microbiology Published by John Wiley & Sons Ltd.

  19. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  20. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  1. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  2. The Mannitol Operon Repressor MTIR belongs to a new class of transcription regulators in bacteria.

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.; Borovilos, M.; Zhou, M; Horer, S; Clancy, S; Moy, S; Volkart, LL; Sassoon, J; Baumann, U; Joachimiak, A (Biosciences Division); (Univ. of Berne)

    2009-12-25

    Many bacteria express phosphoenolpyruvate-dependent phosphotransferase systems (PTS). The mannitol-specific PTS catalyze the uptake and phosphorylation of d-mannitol. The uptake system comprises several genes encoded in the single operon. The expression of the mannitol operon is regulated by a proposed transcriptional factor, mannitol operon repressor (MtlR) that was first studied in Escherichia coli. Here we report the first crystal structures of MtlR from Vibrio parahemeolyticus (Vp-MtlR) and its homolog YggD protein from Shigella flexneri (Sf-YggD). MtlR and YggD belong to the same protein family (Pfam05068). Although Vp-MtlR and Sf-YggD share low sequence identity (22%), their overall structures are very similar, representing a novel all {alpha}-helical fold, and indicate similar function. However, their lack of any known DNA-binding structural motifs and their unfavorable electrostatic properties imply that MtlR/YggD are unlikely to bind a specific DNA operator directly as proposed earlier. This structural observation is further corroborated by in vitro DNA-binding studies of E. coli MtlR (Ec-MtlR), which detected no interaction of Ec-MtlR with the well characterized mannitol operator/promoter region. Therefore, MtlR/YggD belongs to a new class of transcription factors in bacteria that may regulate gene expression indirectly as a part of a larger transcriptional complex.

  3. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  4. The Xis2d protein of CTnDOT binds to the intergenic region between the mob and tra operons.

    Science.gov (United States)

    Hopp, Crystal M; Gardner, Jeffrey F; Salyers, Abigail A

    2015-09-01

    CTnDOT is a 65kbp integrative and conjugative element (ICE) that carries genes encoding both tetracycline and erythromycin resistances. The excision operon of this element encodes Xis2c, Xis2d, and Exc proteins involved in the excision of CTnDOT from host chromosomes. These proteins are also required in the complex transcriptional regulation of the divergently transcribed transfer (tra) and mobilization (mob) operons of CTnDOT. Transcription of the tra operon is positively regulated by Xis2c and Xis2d, whereas, transcription of the mob operon is positively regulated by Xis2d and Exc. Xis2d is the only protein that is involved in the excision reaction, as well as the transcriptional regulation of both the mob and tra operons. This paper helps establish how Xis2d binds the DNA in the mob and tra region. Unlike other excisionase proteins, Xis2d binds a region of dyad symmetry. The binding site is located in the intergenic region between the mob and tra promoters, and once bound Xis2d induces a bend in the DNA. Xis2d binding to this region could be the preliminary step for the activation of both operons. Then the other proteins, like Exc, can interact with Xis2d and form higher order complexes. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. [Deletion of spoIVF operon affects the sporulation and the production of crystal in Bacillus thuringiensis G03].

    Science.gov (United States)

    Sun, Chang-po; Song, Fu-ping; Zhang, Jie; Huang, Da-fang

    2007-08-01

    The spoIVF operon exists in Bacillus universally. Two proteins encoded by the spoIVF operon are essential for the sporulation of Bacillus subtilis. In this study, a spoIVF operon disruption mutant G03 (spoIVF-), in which the spoIVF operon was deleted, was constructed by homologous recombination. The result showed that the mutant strain lost the ability of sporulation. At the same time, the expression of Insecticidal Crystal Protein (ICP) was severely reduced in G03 (spoIVF-) mutant strain and resulted in no crystals. The lacZ gene was fused with the promoter of the cry1Aa gene and expressed in mutant strain G03 (spoIVF-) and G03 wild strain. The activity of beta-galactosidase much lower in mutant G03 (spoIVF-) strain than in the wild-type strain. This further suggested that the activity of sigmaE and sigmaK factors was affected in mutant G03 (spoIVF-) strain. The ability of sporulation and production of Insecticide Crystal Protein was complemented by the expression of spoIVF operon through the vector of pSTK in the mutant strain. In all, The spoIVF operon is essential for the sporulation and the expression of cry gene controlled by sigmaE and sigmaK factors.

  6. Puf operon sequences and inferred structures of light-harvesting complexes of three closely related Chromatiaceae exhibiting different absorption characteristics.

    Science.gov (United States)

    Rücker, Ovidiu; Köhler, Anne; Behammer, Beate; Sichau, Katja; Overmann, Jörg

    2012-02-01

    Whole cells of the purple sulfur bacterium strain 970 exhibit an unusual absorption peak at 963 nm. Its closest relatives, Thiorhodovibrio (Trv.) winogradskyi DSM6702(T) and strain 06511 display a bacteriochlorophyll (BChl) a absorption peak at 867 nm that is characteristic for most light-harvesting complexes 1 (LHC1) of proteobacteria. The puf operons encoding the LHC1 and reaction center proteins were amplified, cloned, and sequenced, and for the Trv. winogradskyi, strains show the common pufBALMC gene arrangement, whereas strain 970 contains a second pufBA copy downstream of pufC. Only pufB(1)A(1) is transcribed, and the corresponding mRNA fragment had an increased stability. Alignments of the deduced protein sequences showed that the LHC1 polypeptides are closely related to those of Thermochromatium (Tch.) tepidum. A deletion between αHis(0) and αTrp(+11), thought to be responsible for the redshifted Q(y) absorption in Tch. tepidum, was also detected in strain 970 and Trv. winogradskyi, whereas αLys(+12) is replaced by histidine only in strain 970. Based on our structural modeling, the side chain of this αHis is predicted to be in close proximity to the BChl a, suggesting that it exerts a modulating effect on the spectral properties of the highly unusual LHC1 complex of strain 970.

  7. RegulonDB (version 4.0): transcriptional regulation, operon organization and growth conditions in Escherichia coli K-12.

    Science.gov (United States)

    Salgado, Heladia; Gama-Castro, Socorro; Martínez-Antonio, Agustino; Díaz-Peredo, Edgar; Sánchez-Solano, Fabiola; Peralta-Gil, Martín; Garcia-Alonso, Delfino; Jiménez-Jacinto, Verónica; Santos-Zavaleta, Alberto; Bonavides-Martínez, César; Collado-Vides, Julio

    2004-01-01

    RegulonDB is the primary database of the major international maintained curation of original literature with experimental knowledge about the elements and interactions of the network of transcriptional regulation in Escherichia coli K-12. This includes mechanistic information about operon organization and their decomposition into transcription units (TUs), promoters and their sigma type, binding sites of specific transcriptional regulators (TRs), their organization into 'regulatory phrases', active and inactive conformations of TRs, as well as terminators and ribosome binding sites. The database is complemented with clearly marked computational predictions of TUs, promoters and binding sites of TRs. The current version has been expanded to include information beyond specific mechanisms aimed at gathering different growth conditions and the associated induced and/or repressed genes. RegulonDB is now linked with Swiss-Prot, with microarray databases, and with a suite of programs to analyze and visualize microarray experiments. We provide a summary of the biological knowledge contained in RegulonDB and describe the major changes in the design of the database. RegulonDB can be accessed on the web at the URL: http://www.cifn.unam.mx/Computational_Biology/regulondb/.

  8. High Prevalence of Diverse Insertion Sequences within the rRNA Operons of Mycoplasma bovis.

    Science.gov (United States)

    Amram, Eytan; Borovok, Ilya; Nachum-Biala, Yaarit; Ayling, Roger; Lerner, Uri; Harrus, Shimon; Lysnyansky, Inna

    2016-11-01

    Insertion sequences (ISs) are widespread in the genome of Mycoplasma bovis strain PG45, but no ISs were identified within its two tandemly positioned rRNA operons (rrn1 and rrn2). However, characterization of the rrn locus in 70 M. bovis isolates revealed the presence of ISs related to the ISMbov1 (IS30 family) and ISMbov4 (IS4 family) isomers in 35 isolates. ISs were inserted into intergenic region 1 (IGR-1) or IGR-3, which are the putative promoter regions of rrn1 and rrn2, respectively, and into IGR-5, located downstream of the rrl2 gene. Seven different configurations (A to G) of the rrn locus with respect to ISs were identified, including those in five annotated genomes. The transcriptional start site for the single rrn operon in M. bovis strain 88127 was mapped within IGR-1, 60 bp upstream of the rrs gene. Notably, only 1 nucleotide separated the direct repeat (DR) for ISMbov1 and the promoter -35 element in configuration D, while in configuration F, the -35 motif was a part of the ISMbov1 DR. Relative quantitative real-time (qRT) PCR analysis and growth rate comparisons detected a significant increase (P operons that did not have ISs. A high prevalence of IS elements within or close to the M. bovis rrn operon-promoter region may reflect their important role in regulation of both ribosome synthesis and function. Data presented in this study show a high prevalence of diverse ISs within the M. bovis rrn locus resulting in intraspecies variability and diversity. Such abundance of IS elements near or within the rrn locus may offer a selective advantage to M. bovis Moreover, the fact that expression of the rrs genes as well as the number of viable cells increased in the group of strains with IS element insertion within a putative promoter -35 sequence (configuration F) in comparison to that in strains with one or two rrn operons that do not have ISs may serve as a basis for understanding the possible role of M. bovis IS elements in fundamental biological processes

  9. Groundwater recharge: Accurately representing evapotranspiration

    CSIR Research Space (South Africa)

    Bugan, Richard DH

    2011-09-01

    Full Text Available Groundwater recharge is the basis for accurate estimation of groundwater resources, for determining the modes of water allocation and groundwater resource susceptibility to climate change. Accurate estimations of groundwater recharge with models...

  10. Massive horizontal gene transfer, strictly vertical inheritance and ancient duplications differentially shape the evolution of Bacillus cereus enterotoxin operons hbl, cytK and nhe.

    Science.gov (United States)

    Böhm, Maria-Elisabeth; Huptas, Christopher; Krey, Viktoria Magdalena; Scherer, Siegfried

    2015-11-10

    Bacillus cereus sensu lato comprises eight closely related species including the human pathogens Bacillus anthracis and Bacillus cereus. Within B. cereus sensu lato, chromosomally and plasmid-encoded toxins exist. While plasmid-mediated horizontal gene transfer of the emetic toxin, anthrax and insecticidal toxins is known, evolution of enterotoxin genes within the group has not been studied. We report draft genome assemblies of 25 strains, a phylogenetic network of 142 strains based on ANI derived from genome sequences and a phylogeny based on whole-genome SNP analysis. The data clearly support subdivision of B. cereus sensu lato into seven phylogenetic groups. While group I, V and VII represent B. pseudomycoides, B. toyonensis and B. cytotoxicus, which are distinguishable at species level (ANI border ≥ 96 %), strains ascribed to the other five species do not match phylogenic groups. The chromosomal enterotoxin operons nheABC and hblCDAB are abundant within B. cereus both isolated from infections and from the environment. While the duplicated hbl variant hbl a is present in 22 % of all strains investigated, duplication of nheABC is extremely rare (0.02 %) and appears to be phylogenetically unstable. Distribution of toxin genes was matched to a master tree based on seven concatenated housekeeping genes, which depicts species relationships in B. cereus sensu lato as accurately as whole-genome comparisons. Comparison to the phylogeny of enterotoxin genes uncovered ample evidence for horizontal transfer of hbl, cytK and plcR, as well as frequent deletion of both toxins and duplication of hbl. No evidence for nhe deletion was found and stable horizontal transfer of nhe is rare. Therefore, evolution of B. cereus enterotoxin operons is shaped unexpectedly different for yet unknown reasons. Frequent exchange of the pathogenicity factors hbl, cytK and plcR in B. cereus sensu lato appears to be an important mechanism of B. cereus virulence evolution, including so

  11. Trans-splicing and operons in metazoans: translational control in maternally regulated development and recovery from growth arrest.

    Science.gov (United States)

    Danks, Gemma B; Raasholm, Martina; Campsteijn, Coen; Long, Abby M; Manak, J Robert; Lenhard, Boris; Thompson, Eric M

    2015-03-01

    Polycistronic mRNAs transcribed from operons are resolved via the trans-splicing of a spliced-leader (SL) RNA. Trans-splicing also occurs at monocistronic transcripts. The phlyogenetically sporadic appearance of trans-splicing and operons has made the driving force(s) for their evolution in metazoans unclear. Previous work has proposed that germline expression drives operon organization in Caenorhabditis elegans, and a recent hypothesis proposes that operons provide an evolutionary advantage via the conservation of transcriptional machinery during recovery from growth arrested states. Using a modified cap analysis of gene expression protocol we mapped sites of SL trans-splicing genome-wide in the marine chordate Oikopleura dioica. Tiled microarrays revealed the expression dynamics of trans-spliced genes across development and during recovery from growth arrest. Operons did not facilitate recovery from growth arrest in O. dioica. Instead, we found that trans-spliced transcripts were predominantly maternal. We then analyzed data from C. elegans and Ciona intestinalis and found that an enrichment of trans-splicing and operon gene expression in maternal mRNA is shared between all three species, suggesting that this may be a driving force for operon evolution in metazoans. Furthermore, we found that the majority of known terminal oligopyrimidine (TOP) mRNAs are trans-spliced in O. dioica and that the SL contains a TOP-like motif. This suggests that the SL in O. dioica confers nutrient-dependent translational control to trans-spliced mRNAs via the TOR-signaling pathway. We hypothesize that SL-trans-splicing provides an evolutionary advantage in species that depend on translational control for regulating early embryogenesis, growth and oocyte production in response to nutrient levels. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. AraC protein, regulation of the L-arabinose operon in Escherichia coli, and the light switch mechanism of AraC action

    OpenAIRE

    Schleif, Robert

    2010-01-01

    This review covers the physiological aspects of regulation of the arabinose operon in Escherichia coli and the physical and regulatory properties of the operon's controlling gene, araC. It also describes the light switch mechanism as an explanation for many of the protein's properties. Although many thousands of homologs of AraC exist and regulate many diverse operons in response to many different inducers or physiological states, homologs that regulate arabinose-catabolizing genes in respons...

  13. Accurate Calculation of Electric Fields Inside Enzymes.

    Science.gov (United States)

    Wang, X; He, X; Zhang, J Z H

    2016-01-01

    The specific electric field generated by a protease at its active site is considered as an important source of the catalytic power. Accurate calculation of electric field at the active site of an enzyme has both fundamental and practical importance. Measuring site-specific changes of electric field at internal sites of proteins due to, eg, mutation, has been realized by using molecular probes with CO or CN groups in the context of vibrational Stark effect. However, theoretical prediction of change in electric field inside a protein based on a conventional force field, such as AMBER or OPLS, is often inadequate. For such calculation, quantum chemical approach or quantum-based polarizable or polarized force field is highly preferable. Compared with the result from conventional force field, significant improvement is found in predicting experimentally measured mutation-induced electric field change using quantum-based methods, indicating that quantum effect such as polarization plays an important role in accurate description of electric field inside proteins. In comparison, the best theoretical prediction comes from fully quantum mechanical calculation in which both polarization and inter-residue charge transfer effects are included for accurate prediction of electrostatics in proteins. © 2016 Elsevier Inc. All rights reserved.

  14. Prediction

    CERN Document Server

    Sornette, Didier

    2010-01-01

    This chapter first presents a rather personal view of some different aspects of predictability, going in crescendo from simple linear systems to high-dimensional nonlinear systems with stochastic forcing, which exhibit emergent properties such as phase transitions and regime shifts. Then, a detailed correspondence between the phenomenology of earthquakes, financial crashes and epileptic seizures is offered. The presented statistical evidence provides the substance of a general phase diagram for understanding the many facets of the spatio-temporal organization of these systems. A key insight is to organize the evidence and mechanisms in terms of two summarizing measures: (i) amplitude of disorder or heterogeneity in the system and (ii) level of coupling or interaction strength among the system's components. On the basis of the recently identified remarkable correspondence between earthquakes and seizures, we present detailed information on a class of stochastic point processes that has been found to be particu...

  15. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  16. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  17. Expression of the ompATb operon accelerates ammonia secretion and adaptation of Mycobacterium tuberculosis to acidic environments.

    Science.gov (United States)

    Song, Houhui; Huff, Jason; Janik, Katharine; Walter, Kerstin; Keller, Christine; Ehlers, Stefan; Bossmann, Stefan H; Niederweis, Michael

    2011-05-01

    Homeostasis of intracellular pH is a trait critical for survival of Mycobacterium tuberculosis in macrophages. However, mechanisms by which M. tuberculosis adapts to acidic environments are poorly understood. In this study, we analysed the physiological functions of OmpATb, a surface-accessible protein of M. tuberculosis. OmpATb did not complement the permeability defects of a Mycobacterium smegmatis porin mutant to glucose, serine and glycerol, in contrast to the porin MspA. Uptake rates of these solutes were unchanged in an ompATb operon mutant of M. tuberculosis indicating that OmpATb is not a general porin. Chemical analysis of low-pH culture filtrates showed that the proteins encoded by the ompATb operon are involved in generating a rapid ammonia burst, which neutralized medium pH and preceded exponential growth of M. tuberculosis. Addition of ammonia accelerated growth of the ompATb operon mutant demonstrating that ammonia secretion is indeed a mechanism by which M. tuberculosis neutralizes acidic environments. Infection experiments revealed that the ompATb operon was not required for full virulence in mice suggesting that M. tuberculosis has multiple mechanisms of resisting phagosomal acidification. Taken together, these results show that the ompATb operon is necessary for rapid ammonia secretion and adaptation of M. tuberculosis to acidic environments in vitro but not in mice. © 2011 Blackwell Publishing Ltd.

  18. Genetic characterization of the hdrRM operon: a novel high-cell-density-responsive regulator in Streptococcus mutans.

    Science.gov (United States)

    Merritt, Justin; Zheng, Lanyan; Shi, Wenyuan; Qi, Fengxia

    2007-08-01

    Many species of bacteria can adhere to surfaces and grow as sessile communities. The continued accumulation of bacteria can eventually lead to the extremely high-cell-density environment characteristic of many biofilms or cell colonies. This is the normal habitat of the cariogenic species Streptococcus mutans, which normally resides in the high-cell-density, multispecies community commonly referred to as dental plaque. Previous work has demonstrated that the transcription of two separate bacteriocins can be activated by the high-cell-density conditions created through the centrifugation and incubation of cell pellets. In this study, we identified an uncharacterized two-gene operon that was induced >10-fold by conditions of high cell density. The genes of the operon encode a putative transcription regulator and a membrane protein, which were renamed as hdrR and hdrM, respectively. A transcription fusion to the hdrRM operon confirmed its induction by high cell density. Mutation of hdrM abolished bacteriocin production, greatly increased natural competence, reduced the growth rate, and severely affected biofilm formation. Interestingly, no obvious phenotypes were observed from a non-polar mutation of hdrR or mutations affecting the entire operon. These data suggest that the hdrRM operon may constitute a novel regulatory system responsible for mediating a cellular response to a high-cell-density environment.

  19. Loss of the lac operon contributes to Salmonella invasion of epithelial cells through derepression of flagellar synthesis.

    Science.gov (United States)

    Jiang, Lingyan; Ni, Zhiwei; Wang, Lei; Feng, Lu; Liu, Bin

    2015-03-01

    Salmonella, a genus that is closely related to Escherichia coli, includes many pathogens of humans and other animals. A notable feature that distinguishes Salmonella from E. coli is lactose negativity, because the lac operon is lost in most Salmonella genomes. Here, we expressed the lac operon in Salmonella enterica serovar Typhimurium and compared the virulence of the Lac(+) strain to that of the wild-type strain in a murine model, invasion assays, and macrophage replication assays. We showed that the Lac(+) strain is attenuated in vivo and the attenuation of virulence is caused by its defect in epithelial cell invasion. However, the invasion-defective phenotype is unrelated to lactose utilization. Through sequencing and the comparison of the transcriptome profile between the Lac(+) and wild-type strains during invasion, we found that most flagellar genes were markedly downregulated in the Lac(+) strain, while other genes associated with invasion, such as the majority of genes encoded in Salmonella pathogenicity island 1, were not differentially expressed. Moreover, we discovered that lacA is the major repressor of flagellar gene expression in the lac operon. In conclusion, these data demonstrate that the lac operon decreases Salmonella invasion of epithelial cells through repression of flagellar biosynthesis. As the ability to invade epithelial cells is a critical virulence determinant of Salmonella, our results provide important evidence that the loss of the lac operon contributes to the evolution of Salmonella pathogenicity.

  20. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  1. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.

    Science.gov (United States)

    Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-08-15

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  3. Characterization of the Proteasome Accessory Factor (paf) Operon in Mycobacterium tuberculosis▿

    OpenAIRE

    Festa, Richard A.; Pearce, Michael J.; Darwin, K. Heran

    2007-01-01

    In a previous screen for Mycobacterium tuberculosis mutants that are hypersusceptible to reactive nitrogen intermediates (RNI), two genes associated with the M. tuberculosis proteasome were identified. One of these genes, pafA (proteasome accessory factor A), encodes a protein of unknown function. In this work, we determined that pafA is in an operon with two additional genes, pafB and pafC. In order to assess the contribution of these genes to RNI resistance, we isolated mutants with transpo...

  4. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  5. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  6. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  7. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  8. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  9. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  10. DNA sequence of the lactose operon: the lacA gene and the transcriptional termination region.

    Science.gov (United States)

    Hediger, M A; Johnson, D F; Nierlich, D P; Zabin, I

    1985-10-01

    The lac operon of Escherichia coli spans approximately 5300 base pairs and includes the lacZ, lacY, and lacA genes in addition to the operator, promoter, and transcription termination regions. We report here the sequence of the lacA gene and the region distal to it, confirming the sequence of thiogalactoside transacetylase and completing the sequence of the lac operon. The lacA gene is characterized by use of rare codons, suggesting an origin from a plasmid, transposon, or virus gene. UUG is the translation initiation codon. A preliminary examination of 3' end of the lac messenger in the region distal to the lacA gene indicates several endpoints. A predominant one is located at the 3' end of a G + C-rich hairpin structure, which may be involved in termination of transcription or in post-transcriptional processing. An open reading frame of 702 base pairs is present on the complementary strand downstream from lacA.

  11. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  12. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci.

    Science.gov (United States)

    Agarwal, Astha; Jain, Amita

    2013-01-01

    All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic) and high concentration of glucose, irrespective of presence or absence of ica operon. Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose). All isolates were tested for the presence of ica ADBC genes by PCR. Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose