Tolerancia de plantas de feijoa (Acca sellowiana [Berg] Burret a la salinidad por NaCl

Directory of Open Access Journals (Sweden)

Casierra-Posada Fánor Ernesto

2006-12-01

Full Text Available

Los efectos de la salinidad por NaCl sobre la producción y la distribución de la biomasa, la toma de agua y el área foliar total fueron investigados en plantas de feijoa (Acca sellowiana [Berg] Burret cultivadas en materas con suelo bajo condiciones de invernadero, durante ocho meses. Los tratamientos con la sal comenzaron 60 d después del transplante. El NaCl fue agregado en diferentes concentraciones: 0, 20, 40, 60, 80 mM de NaCl en el suelo. Estas concentraciones correspondieron a conductividades eléctricas de 2,8; 4,6; 6,1; 8,4 y 11,1 dS· m-1, respectivamente. Para evitar el choque osmótico, el tratamiento salino fue impuesto progresivamente, aumentando la concentración de sal cada semana hasta alcanzar la

Determinação de danos do gorgulho, Conotrachelus Psidii Marshall e captura de mosca-das-frutas, Anastrepha fFaterculus Wiedemann, com óleo de andiroba, Carapa Guianensis em goiabeira serrana Acca Sellowiana

OpenAIRE

Rosa, Joatan Machado da

2011-01-01

A goiabeira-serrana (Acca sellowiana (Berg) Burret) pertencente a família Myrtaceae, é uma espécie nativa com ampla dispersão nos planaltos meridionais do sul do Brasil. Além de espécie nativa e produzir frutos de odor e sabor diferenciado, razão pela qual seu cultivo comercial é incentivado pelo Departamento de Conservação da Biodiversidade do Ministério do Meio Ambiente. A goiabeira serrana tem sido cultivada sob os sistemas orgânico, convencional, ou ainda, os frutos coletad...

Variação fenotípica em plantas de duas famílias de meios-irmãos de goiabeira-serrana (Acca sellowiana Berg. em um pomar comercial em São Joaquim-SC Plant phenotypic variation of two half sib families of feijoa (Acca sellowiana Berg. from an orchard in São Joaquim, SC

Directory of Open Access Journals (Sweden)

Juliana Degenhardt

2005-12-01

Full Text Available A goiabeira-serrana (Acca sellowiana Berg. é uma mirtácea nativa do planalto meridional brasileiro, com dispersão secundária no Uruguai, e produz um fruto de sabor único. Plantas de um pomar comercial composto por duas famílias de meios-irmãos (FMI1 e FMI2 foram avaliadas, com o objetivo principal de analisar a variabilidade fenotípica de várias características. As médias (± desvio-padrão obtidas para as características avaliadas, no ano de 2000, foram: produtividade (29,2±35,0 e 55,1±53,4 frutos por planta; altura (2,2±0,7 m e 2,7±0,8 m; diâmetro de copa (1,9±0,7 m e 2,1±0,7 m; número de ramificações a 20 cm do solo (2,4±1,5 e 1,6±1,2 e distância entre o estigma e as anteras na flor (0,5±0,2 cm e 0,2±0,2 cm, para as plantas da FMI1 e da FMI2, respectivamente. As avaliações revelaram diferenças estatisticamente significativas entre as duas famílias para as características avaliadas, com exceção de diâmetro de copa. As correlações entre características vegetativas não foram estatisticamente significativas, com exceção da correlação entre a altura e a distância entre estigma e anteras (r=-0,53 para a FMI1, no ano de 2000. As regressões não foram significativas, com exceção da regressão entre altura e produtividade na FMI1, em 1998, e entre a produtividade e a distância entre estigma e anteras na FMI2, em 2000. Porém, todas apresentaram coeficientes de determinação inferiores a 0,15.Feijoa (Acca sellowiana Berg. is a native Myrtaceae of the Brazilian Southern plateau with secondary dispersion in Uruguay and its fruit has a unique flavor. Plants of a commercial orchard of this species originated by two half-sib families (FMI1 and FMI2 were evaluated, with the objective to characterize the phenotypic variation of several traits. The means (±standard deviation of the evaluated traits, obtained in 2000 were: productivity (29.2±35.0 and 55.1±53.4 fruits per plant; height (2.2±0.7 m and 2.7±0

Determinação de danos do gorgulho, Conotrachelus psidii Marshall e captura de mosca-das-frutas, Anastrepha fraterculus Wiedemann, com óleo de andiroba, Carapa guianensis em goiabeira serrana Acca sellowiana. Lages-SC 2011

OpenAIRE

Rosa, Joatan Machado da

2011-01-01

A goiabeira-serrana (Acca sellowiana (Berg) Burret) pertencente a família Myrtaceae, é uma espécie nativa com ampla dispersão nos planaltos meridionais do sul do Brasil. Além de espécie nativa e produzir frutos de odor e sabor diferenciado, razão pela qual seu cultivo comercial é incentivado pelo Departamento de Conservação da Biodiversidade do Ministério do Meio Ambiente. A goiabeira serrana tem sido cultivada sob os sistemas orgânico, convencional, ou ainda, os frutos coletad...

Maduración poscosecha de la feijoa (Acca sellowiana Berg tratada con CaCl2 en tres temperaturas de almacenamiento

Directory of Open Access Journals (Sweden)

Ramírez Juan Manuel

2005-06-01

Full Text Available

Con la finalidad de comprobar los efectos retardantes del calcio en la maduración de los frutos de feijoa (Acca sellowiana Berg, cultivar Quimba, se realizó un estudio sobre la aplicación poscosecha, mediante inmersiones de tres soluciones distintas de cloruro de calcio (5%, 10% y 15% y un testigo. La aplicación de CaCl2 prolongó la vida de almacenamiento de los fru­tos, ya que los tratamientos permitieron a los frutos so­portar las condiciones de almacenamiento. Se observó un efecto importante en la disminución de las pérdidas de peso; los frutos tratados con el porcentaje de calcio más alto (15% presentaron las menores pérdidas de peso en cada temperatura. En las fejioas almacenadas a temperatura ambiente (18° C, se observó que la in­cidencia de enfermedades fue más pequeña en los fru­tos tratados con CaCl2. La velocidad de pérdida de la firmeza de los frutos también se vio fortalecida por la adición de calcio. Con relación a las propiedades quí­micas de los frutos, no se presentaron diferencias sig­nificativas entre los tratamientos con cloruro de calcio para cada temperatura de almacenamiento; las feijoas tratadas con CaCl presentaron niveles superiores de sólidos solubles totales, a pesar de no ser significativos estadísticamente.

Comparative proteomic analysis of off-type and normal phenotype somatic plantlets derived from somatic embryos of Feijoa (Acca sellowiana (O. Berg) Burret).

Science.gov (United States)

Fraga, Hugo Pacheco de Freitas; Agapito-Tenfen, Sarah Zanon; Caprestano, Clarissa Alves; Nodari, Rubens Onofre; Guerra, Miguel Pedro

2013-09-01

Morphological disorders in a relevant portion of emerged somatic embryos have been a limiting factor in the true-to-type plantlet formation in Acca sellowiana. In this sense, the present study undertook a comparison between normal phenotype and off-type somatic plantlets protein profiles by means of the 2-D DIGE proteomics approach. Off-type and normal phenotype somatic plantlets obtained at 10 and 20 days conversion were evaluated. Results indicated 12 exclusive spots between normal and off-type plantlets at 10 days conversion, and 17 exclusive spots at 20 days conversion. Also at 20 days conversion, 4 spots were differentially expressed, up- or down-regulated. Two proteins related to carbohydrate metabolism were only expressed in off-types at 10 days conversion, suggesting a more active respiratory pathway. A vicilin-like storage protein was only found in off-types at 20 days conversion, indicating that plantlets may present an abnormality in the mobilization of storage compounds, causing reduced vigor in the development of derived plantlets. The presence of heat shock proteins were only observed during formation of normal phenotype somatic plantlets, indicating that these proteins may be involved in normal morphogenesis of plantlets formed. These new findings shed light on possible genetic or epigenetic mechanisms governing A. sellowiana morphogenesis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Efecto de la práctica de embolsado sobre la calidad del fruto en feijoa (Acca sellowiana Berg tander

Directory of Open Access Journals (Sweden)

Fánor Casierra-Posada

2011-11-01

Full Text Available El  cultivo de  feijoa  (Acca  sellowiana Berg.  se ha  extendido  durante  los últimos  años  en  el territorio colombiano, debido a que  la  fruta es muy apetecida en el mercado por las excelentes propiedades  organolépticas.  Sin  embargo,  la cal idad  y  sanidad  exigidas  para  la comercialización  se  ven  afectadas  por  varios factores,  entre  los  que  se  encuentra  el  daño causado  por  la mosca de  la  fruta  (Anastrepha spp..  Por  tanto,  la  evaluación  del  efecto  de embolsado sobre la calidad de la fruta de feijoa es un tema de gran interés. Además, esta técnica es comúnmente usada en guayaba que pertenecea la misma familia que la feijoa (Mirtáceae. Para el estudio, se embolsaron flores en el momento de  la caída de pétalos, y cada semana después hasta  cuat ro  semanas.   Los  frutos  que  se embolsaron a la caída de pétalos detuvieron su crecimiento; aquellos embolsados una, dos y tres semanas  después  de  la  caída  de  pétalos  no reportaron diferencias significativas en cuanto los parámetros  evaluados  (peso  fresco,  peso  seco, diámetro transversal y  longitudinal, intensidad de infestación,  sólidos  solubles  totales  y  acidez titulable Los frutos embolsados cuatro semanas después de la caída de pétalos fueron de mayor peso,  tamaño y más dulces con  respecto a  los demás. La efectividad en el control de mosca de la  fruta  fue evidente. El embolsado, además de mejorar la sanidad del fruto,  influyó en su calidad y permitió obtener un producto con características adecuadas para el mercado.

Genetic characterization of natural populations of pineapple guava (Acca sellowiana, with heterologous microsatellites markers

Directory of Open Access Journals (Sweden)

Karine Louise dos Santos

2011-12-01

Full Text Available Pineapple guava (Acca sellowiana is a native species from south Brazil and northeast Uruguay, and due to the unique flavor of its fruits, it is an income-generating alternative to small farmers. Knowledge on genetic diversity is an important tool for genetic improvement and conservation. Aiming to increase the knowledge with regarde to the species genetic diversity, fi ve natural populations of A. sellowiana were analyzed through microsatellites markers developed from Eucalyptus grandis W. Hill ex Maiden x E. urophylla S.T. Blake complex. Using 10 pairs of selected markers, 122 plants were characterized. The mean values for expected and observed heterozigosity were 0.42 and 0.47, respectively. The fˆ estimates did not differ from zero to four out of the five populations evaluated, suggesting a small inbreeding effect. In addition, private alleles and high genetic divergence was observed. the average genetic divergence among the populations was st Fˆ = 0,13 e st Rˆ = 0,14, mostly due to the incidenceof rare or exclusive alleles among some populations.

Transference of microsatellite markers from Eucalyptus spp to Acca sellowiana and the successful use of this technique in genetic characterization

Directory of Open Access Journals (Sweden)

Karine Louise dos Santos

2007-01-01

Full Text Available The pineapple guava (Acca sellowiana, known in portuguese as the goiabeira-serrana or "Feijoa", is a native fruit tree from southern Brazil and northern Uruguay that has commercial potential due to the quality and unique flavor of its fruits. Knowledge of genetic variability is an important tool in various steps of a breeding program, which can be facilitated by the use of molecular markers. The conservation of repeated sequences among related species permits the transferability of microsatellite markers from Eucalyptus spp. to A. sellowiana for testing. We used primers developed for Eucalyptus to characterize A. sellowiana accessions. Out of 404 primers tested, 180 amplified visible products and 38 were polymorphic. A total of 48 alleles were detected with ten Eucalyptus primer pairs against DNA from 119 A. sellowiana accessions. The mean expected heterozygosity among accessions was 0.64 and the mean observed heterozygosity 0.55. A high level of genetic diversity was also observed in the dendrogram, where the degree of genetic dissimilarity ranged from 0 to 65% among the 119 genotypes tested. This study demonstrates the possibility of transferring microsatellite markers between species of different genera in addition to evaluating the extent of genetic variability among plant accessions.

sellowiana (Myrtaceae y Casearia lasiophylla (Flacourtiaceae

Directory of Open Access Journals (Sweden)

Héctor A. Keller

2007-01-01

Full Text Available Se citan por primera vez para la flora argentina las especies Acca sellowiana (Myrtaceae y Casearia lasiophylla (Flacourtiaceae, las cuales se destacan en otros países por sus múltiples usos. El género Acca no había sido citado anteriormente para Argentina. Se detallan los caracteres distintivos de las especies, se las ilustra mediante fotografías y se brinda información acerca de su distribución, nombres vernáculos, usos y observaciones ecológicas.

In Vitro Inhibitory Activity of Acca sellowiana Fruit Extract on End Products of Advanced Glycation.

Science.gov (United States)

Muñiz, Alethia; Garcia, Abraham H; Pérez, Rosa M; García, Efren V; González, Daphne E

2018-02-01

Hyperglycemia plays an important role in the pathogenesis of diabetic complications, as it increases protein glycation, as well as the progressive accumulation of advanced glycation end products (AGEs), which are complex structures that produce fluorescence. The glycation reaction raises the levels of protein carbonyl, N ε -(carboxymethyl)lysine (CML), and fructosamine and decreases the level of thiol groups. In the present study, the antiglycation activity was determined by fluorescence intensity using the bovine serum albumin (BSA)/glucose, CML method, and the level of fructosamine. The oxidation of proteins was determined by the carbonyl protein content and thiol groups. The results show that the hexane extract of Acca sellowiana (FOH) at different concentrations (0.30-5 mg/ml) significantly inhibited the formation of AGEs in the BSA/glucose model during the 4 weeks of the study. FOH reduced the levels of fructosamine and CML. Our results showed a significant effect of FOH in the prevention of oxidative damage of proteins, as well as an effect on the oxidation of thiol groups and carbonyl proteins. The present study indicates that FOH is effective in inhibiting the glycation of proteins in vitro, so it can prevent or ameliorate the chronic conditions of diabetes associated with the formation of AGEs.

Características de frutos e germinação de sementes de seis espécies de Myrtaceae nativas do Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Cristina Santos Magalhães Ribas dos

2004-01-01

Full Text Available Myrtaceae family is well represented in the flora of Rio Grande do Sul, in the Southern region of Brazil. The seed and the fruits from six trees species of this family were examined concerning their size, color, mass and water content. The species were the following: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr and Psidium cattleyanum Sabine. The germinative behavior of the seeds was evaluated and the substratum used was autoclaved, which was placed in gerbox (11 x 11cm, at constant temperatures 15, 20, 25 or 30°C or in alternate ones 15°C/ 30°C, with fourteen hours period, in the highest temperature. The experiments were also carried out in the dark. The seeds of Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum showed positive photoblastic behavior. All species germinated in 90 days except Campomanesia guazumifolia which took around 150 days to germinate. The water content ranged from 9% in Campomanesia guazumifolia to 68% in Myrcianthes pungens and the seeds varied from intermediate to recalcitrant ones. The eugenoid embryos had a cryptocotylar germination, however the myrciod and the pimentoid had a fanerocotylar germination.

Caracterização genética de populações naturais de goiabeira serrana (Acca sellowiana com marcadores microssatélites heterólogos

Directory of Open Access Journals (Sweden)

Karine Louise dos Santos

2011-08-01

Full Text Available http://dx.doi.org/10.5007/2175-7925.2011v24n4p75 A goiabeira serra Acca sellowiana é uma espécie nativa do sul do Brasil e nordestete do Uruguai e devido ao sabor único de seus frutos apresenta-se como alternativa de renda para pequenos agricultores. O conhecimento da diversidade genética se constitui em uma importante ferramenta para o melhoramento genético e conservação. Com intuito de ampliar o conhecimento a respeito da diversidade genética da espécie, foi caracterizada a diversidade genética de cinco populações naturais de A. sellowiana, com o uso de iniciadores microssatélites desenvolvidos para o complexo Eucalyptus grandis W. Hill ex Maiden x E. urophylla S.T. Blake. Com a utilização de 10 pares de iniciadores selecionados, 122 plantas foram caracterizadas. Os valores médios para heterozigosidade esperada e observada foram de 0,42 e 0,47, respectivamente. Os valores estimados para  não diferiram de zero para quatro das cinco populações avaliadas, sugerindo baixo efeito de endogamia. Adicionalmente, foi observada incidência de alelos raros e divergência genética, sugerindo que estratégias de conservação considerem a manutenção de diferentes populações com objetivo de conservar a espécie.

CARACTERÍSTICAS DE FRUTOS E GERMINAÇÃO DE SEMENTES DE SEIS ESPÉCIES DE MYRTACEAE NATIVAS DO RIO GRANDE DO SUL

Directory of Open Access Journals (Sweden)

Maria Estefânia Alves Áquila

2004-09-01

Full Text Available A família Myrtaceae é muito bem representada na flora do estado do Rio Grande do Sul, região sul do Brasil. Frutos e sementes de seis espécies foram examinados quanto ao tamanho, cor, massa, teor de água. As espécies são: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr. e Psidium cattleyanum Sabine. Avaliou-se o comportamento germinativo das sementes, tendo sido usada como substrato areia de rio autoclavada umedecida com água destilada, colocada em caixas gerbox (11 x 11cm nas temperaturas constantes de 15, 20, 25 ou 30°C ou na alternada de 15°C - 30°C, com 14 horas na temperatura mais alta. Os experimentos foram efetuados na presença e ausência de luz. Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum mostraram sementes fotoblásticas positivas. Todas as espécies germinaram em noventa dias, exceto Campomanesia guazumifolia, que levou cerca de cento e cinqüenta dias. O conteúdo de água das sementes variou de 9% em Campomanesia guazumifolia até 68% em Myrcianthes pungens, ocorrendo sementes de intermediárias a recalcitrantes em relação à dessecação. Os embriões tipo eugenoide mostraram germinação criptocotiledonar, enquanto os embriões tipo mircióide e pimentóide apresentaram comportamento fanerocotiledonar.

Características de frutos e germinação de sementes de seis espécies de Myrtaceae nativas do Rio Grande do Sul.

Directory of Open Access Journals (Sweden)

Cristina Magalhães Ribas dos Santos

2010-08-01

Full Text Available A família Myrtaceae é muito bem representada na flora do estado do Rio Grande do Sul, região sul do Brasil. Frutos e sementes de seis espécies foram examinados quanto ao tamanho, cor, massa, teor de água. As espécies são: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr. e Psidium cattleyanum Sabine. Avaliou-se o comportamento germinativo das sementes, tendo sido usada como substrato areia de rio autoclavada umedecida com água destilada, colocada em caixas gerbox (11 x 11cm nas temperaturas constantes de 15, 20, 25 ou 30°C ou na alternada de 15°C - 30°C, com 14 horas na temperatura mais alta. Os experimentos foram efetuados na presença e ausência de luz. Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum mostraram sementes fotoblásticas positivas. Todas as espécies germinaram em noventa dias, exceto Campomanesia guazumifolia, que levou cerca de cento e cinqüenta dias. O conteúdo de água das sementes variou de 9% em Campomanesia guazumifolia até 68% em Myrcianthes pungens, ocorrendo sementes de intermediárias a recalcitrantes em relação à dessecação. Os embriões tipo eugenoide mostraram germinação criptocotiledonar, enquanto os embriões tipo mircióide e pimentóide apresentaram comportamento fanerocotiledonar.

Propagação da goiabeira serrana Feijoa sellowiana Berg, através da mergulhia de cepa Vegetative propagation of Feijoa sellowiana Berg through stool layring

Directory of Open Access Journals (Sweden)

J.C. Fachinello

1992-01-01

Full Text Available Este trabalho teve como objetivo verificar a influência de três tipos de mergulhia de cepa na obtenção de novas plantas de Feijoa sellowiana Berg. Para isso, foi conduzido experimento na EMBRAPA-CNPFT, Pelotas-RS, durante o período de agosto de 90 a julho de 91. Foram utilizados como tratamentos: T1 -corte total da planta a l0cm do nível do solo, seguido de amontoa; T2 - Sem corte da planta, seguido de amontoa a 20 cm de altura e T3 - corte total da planta a 10 cm do nível do solo e amontoa com terra a 20 cm de altura, 2 meses depois do corte. Os parâmetros avaliados foram: número de brotos emitidos por planta; número de brotos enraizados por plantas; número de raízes por broto e vigor dos brotos, representado pelas medidas do comprimento total e diâmetro da base. De acordo com o resultados obtidos o tratamento T3 foi o que proporcionou um maior número de brotos emitidos e enraizados. Para as demais variáveis não houve diferença significativa entre os tratamentos.An experiment to evaluate the effect of stool layring of feijoa was carried out in EMBR APA/CNPFT, Pelotas-RS, from August 90 to July 91. Three treatments of layring propagation were used: T1 - plant cutting 10 cm above the ground and covered with soil; T2 - No plant cutting and covered with soil up to 10 cm above the ground; and T3 - Plant cutting 10 cm above the ground and covered with soil two months later. The results obtained showed that the number of shoots and rooted shoots were more significant in T3. There was no diference between number of roots, diameter and length of shoots among treatments.

FLORÍSTICA E ESTRUTURA DO COMPONENTE ARBÓREO E ANÁLISE AMBIENTAL DE UM FRAGMENTO DE FLORESTA OMBRÓFILA MISTA ALTO-MONTANA NO MUNICÍPIO DE PAINEL, SC

Directory of Open Access Journals (Sweden)

Pedro Higuchi

2013-01-01

Full Text Available The highland Araucaria Forest is a little-studied forest formation, occurring in altitudes above 1,000 m. The objectives of this study were to understand the structural and floristic patterns of the tree component of a remaining of this forest in the southern plateau region of Santa Catarina State and to determine the environmental variables that influence these patterns. The tree component survey and the environmental data collection were conducted in 50 plots of 200 m2. Within these plots, all living trees with circumference at breast height (CBH ≥ 15,7 cm were measured (CBH and height and identified. In each plot, environmental variables related to soils physical and chemical traits, topography and canopy cover were collected. Phytosociological parameters and the diameter structure (whole tree community and tree populations with the importance value above 5 % were calculated. The floristic-structural similarities among plots were analyzed by NMDS (Nonmetric Multidimensional Scaling and vectors of environmental variables (p < 0.05 were plotted a posteriori. A total of 50 tree species were identified, distributed in 33 genera and 20 families. The species with the highest VI were Araucaria angustifolia (Bertol. Kuntze (17.32 %, Myrceugenia euosma (O. Berg D. Legrand (15.24 % and Acca sellowiana (O. Berg Burret (7.84 % . The diameter structure of the whole community and of the study populations (except Dicksonia sellowiana Hook. showed a distribution close to the “inverted J”. The NMDS analysis showed a higher percentage of clay in the plots with the highest density of Acca sellowiana and lowest percentage in the plots with high density of Dicksonia sellowiana, Inga lentiscifolia Benth. and Ocotea pulchella Mart. Plots with higher declivity had a higher density of Drimys brasiliensis Miers and those of lower declivity, higher elevation and greater canopy closure, had a higher occurrence of Drimys angustifolia Miers, Prunus myrtifolia (L

SUBSTRATOS E TEMPERATURAS PARA TESTE DE GERMINAÇÃO EM SEMENTES DE MYRTACEAE

Directory of Open Access Journals (Sweden)

Juliano Pereira Gomes

2016-01-01

Full Text Available The Brazilian species of the Myrtaceae comprises several arborescent and shrubby plants that are used to produce fruit for fresh consumption or industrialization. Information about the seed quality evaluations for these species are scarce in the literature, mainly related to the adequacy of the germination tests. This study tests different substrates and temperatures to test the germination of Acca sellowiana (O. Berg Burret. (goiaba-serrana, Campomanesia xanthocarpa O. Berg (guabiroba, Eugenia involucrata DC. (cereja-do- mato and Eugenia pyriformis Camb. (uvaia seeds. Two seed lots were collected at different locations, one for each species, according to the requirements of the selection matrices. Sand and germitest paper towel rolls substrates were used, moistened with distilled water, and submitted to temperatures of 15 °C, 25 °C, 30 °C, 35 °C and 20-30 °C under constant light, on P.D.A. germinators. The experimental delineation was entirely randomized with four repetitions of 25 seeds/treatment/lot/specie, and treatment means were compared using the Tukey test (P < 0.01. The germination tests can be conducted at 25 °C using paper roll substrate for Eugenia pyriformis and E. involucrate . Both substrates can be used to Acca sellowiana germination test at 25 °C. The temperature of 25 °C and alternating 20-30 °C are indicated for Campomanesia xanthocarpa , as well as sand and paper roll substrates.

ANATOMICAL ASPECTS OF DEVELOPMENT OF PINEAPPLE GUAVA FRUIT [ACCA SELLOWIANA (O.BERG BURRET] ASPECTOS ANATÓMICOS DEL DESARROLLO DEL FRUTO DE FEIJOA [ACCA SELLOWIANA (O.BERG BURRET

Directory of Open Access Journals (Sweden)

Mariela Rodríguez

2010-06-01

Full Text Available An anatomical study of feijoa fruits was carried out with the purpose to describe the anatomical changes in the fruit starting from floral bud until the physiological maturity. In order to realize the description, fruit samples of different sizes from clones 41 (Quimba and 8-4 were taken and histological techniques were applied. The samples were fixed in FAA, after which it was made the inclusion process, it has stages of dehydration, infiltration and inclusion, finally, was made the cut and assembly of the samples with fast- green and safranin. The observations showed that cells of the exocarp and endocarp presented cellular multiplication until advanced stages of development. The mesocarp had an important increment in volume, mainly due to the cellular multiplication at the first and second stages of development and cellular expansion at the last stage of development. One important conclusion was that feijoa fruit is stable anatomically because the tissues observed in the floral bud maintain its identity until when the fruit reaches the physiologic maturity. From the anatomical point of view, the final size of the fruit depends on the continuous cellular multiplications that suffer these tissues and to the cellular expansion in the stage of fruit filling. By microscopic observations it was concluded that the exocarp of the fruit is composed of the outer epidermis and hypodermis, the mesocarp is composed of many layers of parenchyma, the endocarp is formed by the inner epidermis and three or four layers of subepidermal cells in both clones .Se realizó un estudio anatómico de los frutos de feijoa con el propósito de describir los cambios anatómicos desde capullo floral hasta la madurez fisiológica. Para realizar la descripción, se tomaron muestras de los frutos de diferentes tamaños de los clones 41 (Quimba y 8-4 las cuales se trataron con técnicas histológicas. Las muestras se fijaron en FAA, después de lo cual se realizó el proceso de inclusión que tiene las etapas de deshidratación, infiltración e inclusión, finalmente, se realizó el corte y montaje con safranina fast-green. Las observaciones mostraron que las células del exocarpio y el endocarpio presentaron multiplicación celular hasta avanzadas etapas del desarrollo. El mesocarpio tuvo un incremento importante en el volumen, debido principalmente a la multiplicación celular en la primera y segunda etapa del desarrollo y, a la expansión celular en la última etapa del desarrollo. Se concluyó que el fruto de feijoa es estable anatómicamente porque los tejidos observados en el capullo floral mantienen su identidad hasta cuando el fruto alcanza la madurez fisiológica. Desde el punto de vista anatómico, el tamaño final del fruto depende de las continuas divisiones celulares que sufren estos tejidos y a la expansión celular en la etapa de llenado del fruto. Con las observaciones microscópicas se concluyó que el exocarpio del fruto está conformado por la epidermis externa y la hipodermis; el mesocarpio está constituido por numerosas capas de parénquima; el endocarpio está constituido por la epidermis interna y tres o cuatro capas de células subepidérmicas en ambos clones.

Germinación in vitro de polen de feijoa (Acca sellowiana Berg

Directory of Open Access Journals (Sweden)

Mavel Hernández

2011-02-01

Full Text Available Actualmente no existen estudios de viabilidad y caracterización del grano de polen de Feijoa, ante lo cual la cantidad y calidad del polen producidos por una flor, son aspectos importantes en estudios evolutivos y de adaptación de genotipos. Así, se determinó la solución germinativa adecuada para realizar pruebas de germinación in vitro, mediante pruebas de las siguientes soluciones:agua, agar, agua + sacarosa 5%, agua + sacarosa 10%, agar +sacarosa 5% ý agar + sacarosa 10%, ante lo cual, en la solución germinativa compuesta por agar y sacarosa al 5% se registró el mayor porcentaje de germinación de granos de polen en el tiempo. Se efectuó la prueba de fertilidad del polen para los dos clones por medio del método de tinción con azul de lactofenol en tres estados de apertura floral E1 (pétalos visibles, E2 (sépalos desplegados y E3 (pétalos maduros, presentando 100% de tinción del total de granos observados por estado de apertura floral. Se realizaron pruebas de germinación para los dos clones en los tres estados de apertura floral y se observó germinación en el clon 8-4 a las 10 horas después de la siembra para el estado E3, alcanzando un alto porcentaje de germinación (80%, mientras que los otros dos estados no germinaron en el tiempo de medición establecido. En el clon 41, la germinación inició a las 10 horas después de la siembra para el estado E2 ý a las 12 horas para el E3, mientras que el E1 no germinó. Los estados E2 y E3 alcanzaron 80% de germinación aproximada 16 horas después de siembra.

The ecological footprint of Acca sellowiana domestication maintains the residual vertebrate diversity in threatened highlands of Atlantic Forest.

Science.gov (United States)

Bogoni, Juliano André; Graipel, Maurício Eduardo; Peroni, Nivaldo

2018-01-01

Past and contemporary human actions are causing numerous changes in patterns and processes at various ecosystem scales and trophic levels, including unintended downstream changes, such as species interactions. In its native range Acca sellowiana (Feijoa) combines some characteristics of human interactions: incipient domestication, restricted to subtropical Atlantic Forest highlands, associated with the threatened conifer Araucaria angustifolia (Araucaria), within a domesticated landscape with anthropogenic forest patches, and provides fruit at a time of resource shortage (Araucaria seeds-pinhão). We quantify the trophic relationships between Feijoa and vertebrates, and evaluate the influences on interactions caused by environmental variations, Feijoa domestication evidences, spatial distance and fruit availability. In four sites within protected areas, we selected 28 focal individuals of Feijoa (seven/site) and collected three temporal replicas between 2015 and 2016, when we measured productivity and frugivory via 45-second videos taken with camera traps. Using ecological network, rarefaction curves and variation partitioning analyses, we evaluate the frugivory network topology, the spatiotemporal structure of communities in relation to fruit availability and the influence of predictive variables on frugivory. We found a large spatiotemporal variation in productivity of Feijoa and that 20 species consumed Feijoa fruits, with a species degree of 2.8 (±5.7) and average Feijoa degree of 14.4 (±10.1), in a modular network with intermediary connectance. Rarefaction curves showed that richness and the independent records are congruent with the fruit amount. Variation partitioning showed that, for the focal individuals, canopy area, green coverage, patch size and distance to water influenced frugivory, and the Feijoa domestication influenced significantly the mammalian frugivory. Feijoa is an important resource that provides food during the time of year when Pinhão is

The ecological footprint of Acca sellowiana domestication maintains the residual vertebrate diversity in threatened highlands of Atlantic Forest

Science.gov (United States)

2018-01-01

Past and contemporary human actions are causing numerous changes in patterns and processes at various ecosystem scales and trophic levels, including unintended downstream changes, such as species interactions. In its native range Acca sellowiana (Feijoa) combines some characteristics of human interactions: incipient domestication, restricted to subtropical Atlantic Forest highlands, associated with the threatened conifer Araucaria angustifolia (Araucaria), within a domesticated landscape with anthropogenic forest patches, and provides fruit at a time of resource shortage (Araucaria seeds—pinhão). We quantify the trophic relationships between Feijoa and vertebrates, and evaluate the influences on interactions caused by environmental variations, Feijoa domestication evidences, spatial distance and fruit availability. In four sites within protected areas, we selected 28 focal individuals of Feijoa (seven/site) and collected three temporal replicas between 2015 and 2016, when we measured productivity and frugivory via 45-second videos taken with camera traps. Using ecological network, rarefaction curves and variation partitioning analyses, we evaluate the frugivory network topology, the spatiotemporal structure of communities in relation to fruit availability and the influence of predictive variables on frugivory. We found a large spatiotemporal variation in productivity of Feijoa and that 20 species consumed Feijoa fruits, with a species degree of 2.8 (±5.7) and average Feijoa degree of 14.4 (±10.1), in a modular network with intermediary connectance. Rarefaction curves showed that richness and the independent records are congruent with the fruit amount. Variation partitioning showed that, for the focal individuals, canopy area, green coverage, patch size and distance to water influenced frugivory, and the Feijoa domestication influenced significantly the mammalian frugivory. Feijoa is an important resource that provides food during the time of year when Pinh

Characterization of somatic embryo attached structures in Feijoa sellowiana Berg. (Myrtaceae).

Science.gov (United States)

Correia, Sandra M; Canhoto, Jorge M

2010-06-01

The presence of an attached organ to somatic embryos of angiosperms connecting the embryo to the supporting tissue has been a subject of controversy. This study shows that 67% of the morphologically normal somatic embryos of Feijoa sellowiana possess this type of organ and that its formation was not affected by culture media composition. Histological and ultrastructural analysis indicated that the attached structures of somatic embryos displayed a great morphological diversity ranging from a few cells to massive and columnar structures. This contrast with the simple suspensors observed in zygotic embryos which were only formed by five cells. As well as the suspensor of zygotic embryos, somatic embryo attached structures undergo a process of degeneration in later stages of embryo development. Other characteristic shared by zygotic suspensors and somatic embryo attached structures was the presence of thick cell walls surrounding the cells. Elongated thin filaments were often associated with the structures attached to somatic embryos, whereas in other cases, tubular cells containing starch grains connected the embryo to the supporting tissue. These characteristics associated with the presence of plasmodesmata in the cells of the attached structures seem to indicate a role on embryo nutrition. However, cell proliferation in the attached structures resulting into new somatic embryos may also suggest a more complex relationship between the embryo and the structures connecting it to the supporting tissue.

Moscas frugívoras associadas a mirtáceas e laranjeira "Céu" na região do Vale do Rio Caí, Rio Grande do Sul, Brasil Frugivorous flies in myrtaceans and orange trees 'Céu' in the region of Vale do Rio Caí, Rio Grande do Sul State, Brazil

Directory of Open Access Journals (Sweden)

Tacimara Gattelli

2008-02-01

Full Text Available Este estudo teve o objetivo de reconhecer as espécies de moscas frugívoras em mirtáceas: Eugenia uniflora L., Campomanesia xanthocarpa Berg., Psidium cattleianum Sabine, Psidium guajava L. e Acca sellowiana (Berg. Burret., bem como em Citrus sinensis (L. Osbeck (Rutaceae, na região do Vale do Caí, RS. Os frutos foram coletados no período de maturação de cada espécie frutífera, entre outubro de 2004 e julho de 2005, levados ao laboratório e acondicionados em potes com areia mantidos a 25 ± 1°C; 80 ± 10% UR e fotofase de 12 horas. Os pupários obtidos foram individualizados e suas características foram registradas. De Tephritidae foi registrada apenas Anastrepha fraterculus (Wiedemann e de Lonchaeidae Neosilba n. sp. 3, Neosilba zadolicha McAlpine & Steyskal e Neosilba certa (Walker. As duas últimas são novos registros para o Rio Grande do Sul. Apenas em P. cattleianum foram registradas todas as espécies de moscas encontradas neste trabalho. Os resultados evidenciam que A. fraterculus é a espécie de mosca-das-frutas de maior ocorrência para a região do Vale do Caí, RS, nas frutíferas estudadas.This study aimed at recognizing frugivorous flies species in Myrtaceae: Eugenia uniflora L., Campomanesia xanthocarpa Berg. Psidium cattleianum Sabine, Psidium guajava L. and Acca sellowiana (Berg. Burret., as well as in Citrus sinensis (L. Osbeck (Rutaceae, at Vale do Cai region, Rio Grande do Sul. Fruits were collected at the maturation stage of each fruit species between October 2004 and July 2005, and at the laboratory they were placed in pots with sand and were kept at 12h photoperiod, 80 ± 10% RH and 25 ± 1°C. Pupae were individualized and their characteristics were recorded. In Tephritidae only Anastrepha fraterculus (Wied. was recorded and in Lonchaeidae, Neosilba n. sp. 3, Neosilba zadolicha McAlpine & Steyskal and Neosilba certa (Walker. These last two species were recorded for the first time in Rio Grande do Sul. Only on

ACCA College English Teaching Mode

Science.gov (United States)

Ding, Renlun

2008-01-01

This paper elucidates a new college English teaching mode--"ACCA" (Autonomous Cooperative Class-teaching All-round College English Teaching Mode). Integrated theories such as autonomous learning and cooperative learning into one teaching mode, "ACCA", which is being developed and advanced in practice as well, is the achievement…

Abnormal centromere-chromatid apposition (ACCA) and Peters' anomaly.

Science.gov (United States)

Wertelecki, W; Dev, V G; Superneau, D W

1985-08-01

Abnormal centromere-chromatid apposition (ACCA) was noted in a patient with Peters' anomaly. Previous reports of ACCA emphasized its association with tetraphocomelia and other congenital malformations (Roberts, SC Phocomelia, Pseudothalidomide Syndromes). This report expands the array of congenital malformations associated with ACCA and emphasizes the diagnostic importance of ocular defects for the ascertainment of additional cases of ACCA and its possible relationship with abnormal cell division.

Inventory of Dicksonia sellowiana Hook. in Santa Catarina

OpenAIRE

Gasper, André Luís de; Sevegnani, Lucia; Vibrans, Alexander Christian; Uhlmann, Alexandre; Lingner, Débora Vanessa; Verdi, Marcio; Dreveck, Susana; Stival-Santos, Anita; Brogni, Eduardo; Schmitt, Ronnie; Klemz, Guilherme

2011-01-01

A intensa exploração comercial de Dicksonia sellowiana a deixaram na categoria de ameaçada de extinção, sendo incluída na lista brasileira de espécies da flora ameaçada de extinção. Por isso, o presente trabalho visa apresentar o estudo da distribuição das populações de D. sellowiana para apontar os locais de maior ocorrência da espécie em Santa Catarina, e avaliar a relação da densidade populacional com fatores ambientais, como altitude e clima. Foram instaladas 225 unidades amostrais, com 4...

Inventário de Dicksonia sellowiana Hook. em Santa Catarina Inventory of Dicksonia sellowiana Hook. in Santa Catarina

Directory of Open Access Journals (Sweden)

André Luís de Gasper

2011-12-01

Full Text Available A intensa exploração comercial de Dicksonia sellowiana a deixaram na categoria de ameaçada de extinção, sendo incluída na lista brasileira de espécies da flora ameaçada de extinção. Por isso, o presente trabalho visa apresentar o estudo da distribuição das populações de D. sellowiana para apontar os locais de maior ocorrência da espécie em Santa Catarina, e avaliar a relação da densidade populacional com fatores ambientais, como altitude e clima. Foram instaladas 225 unidades amostrais, com 4.000 m² nas regiões do planalto e oeste catarinense, baseadas na grade de 10 km x 10 km conforme procedimento do Inventário Florístico Florestal de Santa Catarina. Nestas 225 unidades amostrais, D. sellowiana foi encontrada em 94, com variação de um a 391 indivíduos. A grande densidade da espécie em áreas mais elevadas (superiores a 1.000 m está relacionada com os dados climáticos que influenciam a população diretamente, apontados pelo Critério de Informação de Akaike corrigido, ou seja, a altitude e a variação de temperatura que ela provoca. Observou-se também, que a espécie apresenta maior concentração da população nos menores intervalos de altura e diâmetro, chegando a elevadas densidades com até 977 indivíduos/ha em algumas áreas. As informações obtidas pelo inventário sobre esta espécie possibilitam indicar medidas de conservação para a espécie, como área a serem conservadas e apoio a produtores rurais.The intense exploitation of Dicksonia sellowiana has led this species to become endangered and to be included on the red list of threatened species. Therefore, this paper presents a study of D. sellowiana populations in Santa Catarina State, and points out the places where it occurs the most, the status of these populations and also evaluates the relationship between density, climatic variables and elevation. Two hundred and twenty-five sample plots, which were 4.000 m² each, were located within the

PersPectives du Programme acca

International Development Research Centre (IDRC) Digital Library (Canada)

à acca@crdi.ca. À propos du programme ACCA. Lancé en 2006, le programme Adaptation aux changements ... Nous pourrions y ajouter, par soucis d'équilibre, les « connus inconnus », c'est- à-dire les connaissances que nous ne ...... marocain m'a déjà dit ceci : « Je comprends vos préoccupations, mais mes questions ...

Estrutura populacional de Dicksonia Sellowiana Hook (Dicksoniaceae) no Brasil

OpenAIRE

Santos, Jaqueline dos

2011-01-01

Resumo: Dicksonia sellowiana é uma pteridófita característica de Floresta Ombrófila Mista, ameaçada de extinção devido à exploração excessiva pela indústria extrativa e artesanal. Desta forma, os objetivos deste trabalho foram: determinar se há estruturação populacional de D. sellowiana Hook. no Brasil; avaliar o impacto de fragmentações para a manutenção da variabilidade genética das populações estudadas; e gerar subsídios para conservação da espécie. Análises moleculares foram baseadas em m...

Chemical composition of essential oil from Psidium cattleianum var.

African Journals Online (AJOL)

rajuc

2012-04-24

Apr 24, 2012 ... accounting for 61% of the essential oil. The major component was ... recently been increased because of great economic costs of deterioration and ..... Identification of isoflavones in Acca sellowiana and two Psidium species ...

Inventário de Dicksonia sellowiana Hook. em Santa Catarina

OpenAIRE

Gasper,André Luís de; Sevegnani,Lucia; Vibrans,Alexander Christian; Uhlmann,Alexandre; Lingner,Débora Vanessa; Verdi,Marcio; Dreveck,Susana; Stival-Santos,Anita; Brogni,Eduardo; Schmitt,Ronnie; Klemz,Guilherme

2011-01-01

A intensa exploração comercial de Dicksonia sellowiana a deixaram na categoria de ameaçada de extinção, sendo incluída na lista brasileira de espécies da flora ameaçada de extinção. Por isso, o presente trabalho visa apresentar o estudo da distribuição das populações de D. sellowiana para apontar os locais de maior ocorrência da espécie em Santa Catarina, e avaliar a relação da densidade populacional com fatores ambientais, como altitude e clima. Foram instaladas 225 unidades amostrais, com 4...

Teste de tetrazólio para avaliação da qualidade fisiológica em sementes de Goiabeira-serrana (Acca sellowiana O. Berg Burret Tetrazolium test to evaluate physiological quality of Brazilian Guava seeds (Acca sellowiana O. Berg Burret

Directory of Open Access Journals (Sweden)

Marcelo Benevenga Sarmento

2013-03-01

Full Text Available A goiabeira-serrana, espécie frutífera nativa do Sul do Brasil, vem mostrando- se promissora em termos ecológicos e comerciais. O trabalho objetivou avaliar a qualidade fisiológica de dois lotes de sementes de goiabeira-serrana por meio do teste de tetrazólio. O experimento foi dividido em duas etapas. Na primeira, os lotes foram submetidos aos testes de germinação, índice de velocidade de germinação, tempo médio de germinação, emergência em casa de vegetação, índice de velocidade de emergência de plântulas em casa de vegetação, tempo médio de emergência e comprimento de parte aérea. Na segunda, foi realizado o teste de tetrazólio nas concentrações de 0,5 e 1,0, e tempos de embebição (2 h e 4 h. O tratamento 0,5 TZ 4h obteve 73% de sementes viáveis (lote 2007. Para o lote 2008, não houve diferenças entre os tratamentos. O teste de germinação apresentou correlação positiva para os tratamentos 0,5 TZ 2 h e 1 TZ 2 h. Para a emergência de plântulas em casa de vegetação, houve correlação positiva para o tratamento 0,5 TZ 2 h. O teste de tetrazólio permitiu a classificação dos lotes em quatro níveis de viabilidade, confirmando a eficiência do teste na avaliação da viabilidade de sementes de goiabeira-serrana.Brazilian guava, native fruit tree from Southern Brazil, has become relevant due to its potencial use as ecological and comercial. This article aims evaluate the physiological quality of Brazilian guava seeds by tetrazolium test. The work was divided in two parts. In the first, both lots were submitted to the germination test, index of speed germination, mean time of germination, emergency of seedlings in greenhouse, mean time of emergency and shoot length of seedlings. In the second part it was performed the tetrazolium test. Two concentrations of tetrazolium were used (0,5 e 1,0 and two times of imbibition (2 h e 4 h. To the lot 2007, the treatment 0,5 TZ 4 h obtained 73% of viable seeds, otherwise, to the lot 2008, the was no significant differences among treatments. For the germination test there has been positive correlation for 0,5 TZ 2 h and 1 TZ 2 h treatments. Emergency of seedlings in greenhouse was correlated only to 0,5 TZ 2 h. The Tetrazolium Test has allowed to rank the lots in four classes of viability, confirming the eficiency of the test to evaluate the viability of Brazilian Guava seeds.

ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.

Science.gov (United States)

Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla

2006-06-16

The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.

Anti-Toxoplasma Effects of Methanol Extracts of Feijoa sellowiana, Quercus castaneifolia, and Allium paradoxum

Directory of Open Access Journals (Sweden)

Mohammad Ali Ebrahimzadeh

2017-09-01

Full Text Available Objectives: The currently available agents for use against toxoplasmosis have serious limitations. Thus, the aim of the present study was to investigate the anti-Toxoplasma gondii (T. gondii activities of methanol extracts of Feijoa sellowiana (F. sellowiana (leaves and fruits, Quercus castaneifolia (Q. castaneifolia (fruits, and Allium paradoxum (A. paradoxum (leaves in vitro and in vivo. Methods: Vero cells were treated with different concentrations (from 0 to 400 μg/mL of the above extracts or with pyrimethamine at a dose of 50 mg/mL (positive control. Then, the viabilities of the T. gondii-infected cells were measured by using colorimetric MTT (3-(4, 5-dimethylthiazol-2-yl 2, 5-diphenyltetrazolium bromide assays. In addition, the survival rates of mice acutely infected with 2 × 104 RH strain tachyzoites of T. gondii were examined in vivo after intraperitoneal injection of the extracts at doses of 100 and 200 mg/kg/day for 5 days. Results: In the in vitro anti- T. gondii assay, the IC50 values were 12.77, 180.2, 74.73, 213.2 and 163.8 μg/mL, and the selectivity indices were 6.05, 1.31, 0.35, 0.69 and 1.30 for the F. sellowiana (leaves and fruits, Q. castaneifolia, and A. paradoxum extracts and pyrimethamine, respectively. Moreover, the mice treated with F. sellowiana (leaves and fruits achieved better results in terms of survival than the others (P < 0.05. Conclusion: The results of the current study indicate that methanol extract of F. sellowiana has significant anti-Toxoplasma activity. Further study should be conducted to investigate the potential bioactivity of this extract through bioactivity-guided fractionation.

Caudex growth and fenology of Dicksonia sellowiana Hook. (Dicksoniaceae) in Southern Brazil

OpenAIRE

Schmitt, Jairo Lizandro; Schneider, Paulo Henrique; Windisch, Paulo Günter

2009-01-01

No sul e sudeste do Brasil, a samambaia arborescente Dicksonia sellowiana Hook. é ainda extraída ilegalmente de remanescentes florestais para uso da capa fibrosa do seu cáudice, bem como para cultivo como planta ornamental. No presente trabalho, o crescimento do cáudice, a produção, expansão e senescência de frondes, bem como a formação e liberação de esporos de D. sellowiana foram estudados com base na observação de 37 plantas. Durante um período de um ano de observação, os cáudices crescera...

Morphology Of The Dispersion Unit And Germination Of Cordia Sellowiana Cham. And Cordia Myxa L. [morfologia Da Unidade De Dispersão E Germinação De Cordia Sellowiana Cham. E Cordia Myxa L.

OpenAIRE

Barroso I.C.E.; De Oliveira F.; Ciarelli D.M.

2009-01-01

Cordia sellowiana Cham, and Cordia myxa L. (Boraginaceae Jussieu) had their dispersion units studied, with emphasis on their morphology and seed germination process. The fruits from both Cordia sellowiana and Cordia myxa are of the drupoid nuculanium type. The protrusion of the primary root in the former species occurs through a pyrene longitudinal fissure; in the latter it is one through an opening in the operculum. In both species, seed germination is of the epigel phanerocotylar type. The ...

Florística e estrutura do componente arbóreo e análise ambiental de um fragmento de Floresta Ombrófila Mista Alto-Montana no município de Painel, SC

Directory of Open Access Journals (Sweden)

Pedro Higuchi

2013-03-01

Full Text Available http://dx.doi.org/10.5902/198050988449A Floresta Ombrófila Mista Alto-Montana é uma formação pouco estudada que ocorre em altitudes acima de 1.000 m. Os objetivos deste estudo foram conhecer os padrões florísticos e estruturais do componente arbóreo de um fragmento desta floresta na região do Planalto Sul Catarinense e determinar as variáveis ambientais que influenciam esses padrões. O levantamento da composição florística e estrutural e a coleta das variáveis ambientais foram conduzidos em 50 parcelas de 200 m2. Nelas, todos os indivíduos arbóreos com CAP (circunferência medida a altura do peito ≥ 15,7 cm foram medidos (CAP e altura e identificados. Foram coletadas, em cada parcela, variáveis ambientais relacionadas às características químicas e físicas dos solos, topográficas e de cobertura do dossel. Foram calculados os parâmetros fitossociológicos e a estrutura diamétrica da comunidade e das populações com valor de importância (VI acima de 5 %. A similaridade florístico-estrutural entre as parcelas foi analisada pela NMDS (Nonmetric Multidimensional Scaling e os vetores das variáveis ambientais significativas (p < 0,05 foram plotados a posteriori. Foram identificadas 50 espécies arbóreas distribuídas em 33 gêneros e 20 famílias botânicas. As espécies com maior VI foram: Araucaria angustifolia (Bertol. Kuntze (17,32 %, Myrceugenia euosma (O.Berg D.Legrand (15,24 % e Acca sellowiana (O.Berg Burret (7,84 %. A estrutura diamétrica de toda a comunidade e das populações estudadas (exceto Dicksonia sellowiana Hook. teve distribuição próxima ao “J invertido”. A análise NMDS demonstrou maior porcentagem de argila nas parcelas com maior densidade de Araucaria angustifolia e menor porcentagem, nas parcelas com maior densidade de Dicksonia sellowiana, Inga lentiscifolia Benth. e Ocotea pulchella Mart. As parcelas de maior declividade tiveram maior densidade de Drimys brasiliensis Miers e aquelas de

Antimicrobial activity of Aegiphila sellowiana Cham., Lamiaceae, against oral pathogens

Directory of Open Access Journals (Sweden)

Marcele A. Ferreira

Full Text Available The antimicrobial activity of Aegiphila sellowiana Cham., Lamiaceae, against oral pathogens is reported. The Minimal Inhibitory Concentrations (MICs for inhibiting the microorganisms growth were determined using the broth microdilution method from the CLSI M7-A7 protocol. Chlorhexidine was used as the positive control. The ethanol crude extract of the aerial parts of A. sellowiana exhibited activity against the microorganisms tested in this work; however, the activity decreased after partition with n-hexane, dichloromethane, and ethyl acetate. Among the tested fractions, the n-hexane fraction was found to be the most effective against the evaluated oral pathogens. GC-MS analysis of this latter fraction revealed that fatty acids esters, steroids, and aliphatic sesquiterpene hydrocarbons are its major constituents. These compounds may be responsible for the activity of the n-hexane fraction, but other chemical constituents of the dichloromethane, ethyl acetate, and hydroalcoholic fraction may potentialize their activities in the crude extract.

Caracterización fisicoquímica del crecimiento y desarrollo de los frutos de feijoa (Acca sellowiana Berg en los clones 41 (Quimba y 8-4

Directory of Open Access Journals (Sweden)

Rodríguez Mariela

2006-06-01

Hidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" />

La feijoa (Acca sellowiana Berg se cultiva en la region andina colombiana, sin embargo, no se tiene reportes del crecimiento y desarrollo de los frutos de clones importantes como el clon 41 (Quimba y el clon 8-4. En este estudio se evaluaron los cambios fisicos desde la antesis hasta la madurez fisiologica, mientras que los cambios bioquimicos se evaluaron en la ultima etapa

Phasenübergänge

Science.gov (United States)

Heintze, Joachim

Bisher haben wir nur das thermische Verhalten von Stoffen einheitlicher Konsistenz diskutiert. Eines der auffälligsten Phänomene in der Physik der Wärme ist aber, dass ein Stoff in verschiedenen Aggregatzuständen vorliegen kann: fest, flüssig oder gasförmig, und dass durch Wärmezufuhr und -abfuhr Übergänge zwischen diesen verschiedenen Phasen bewirkt werden. Zunächst werden wir die Phasenübergänge flüssig-gasförmig und fest-gasförmig ausführlich diskutieren. Dann zeigen wir, dass der Phasenübergang fest-flüssig auf ganz ähnliche Weise beschrieben werden kann. Eine zusammenfassende Darstellung der Phasenübergänge ist in der Form von Zustandsdiagrammen möglich. Die Untersuchung solcher Diagramme führt auf das interessante Phänomen des kritischen Punktes. Am Schluss des Kapitels betrachten wir Phasenübergänge in Zweistoffsystemen. Sie weisen einige Eigenschaften auf, die nicht nur merkwürdig und physikalisch interessant, sondern vor allem auch technisch von Bedeutung sind.

Morfologia da unidade de dispersão e germinação de Cordia sellowiana cham. e Cordia myxa l Morphology of the dispersion unit nd germination of Cordia sellowiana cham. and Cordia myxa l

OpenAIRE

Isabel Cristina Ercolini Barroso; Fernando de Oliveira; Deborah Maria Ciarelli

2009-01-01

As unidades de dispersão das espécies Cordia sellowiana Cham. e Cordia myxa L. (Boraginaceae Jussieu) foram estudadas com ênfase em sua morfologia e no processo de germinação. Os frutos de Cordia sellowiana e de Cordia myxa são do tipo drupóide nuculânio. A protrusão da raiz primária, na primeira espécie, ocorre através de fenda longitudinal do pirênio, e na segunda, através de abertura do opérculo. A germinação, nas duas espécies, é do tipo fanerocotiledonar epígea. As plântulas apresentam c...

Efecto del nitrato de potasio, fosfato de potasio y ethephon en la inducción floral de la feijoa o goiabeira serrana (Acca sellowiana [O. Berg] Burret Effect of potassium nitrate, potassium phosphate and ethephon in floral induction of pineapple guava (Acca sellowiana [O. Berg] Burret

Directory of Open Access Journals (Sweden)

Oskar Javier Garcia

2008-09-01

Full Text Available El ensayo se llevó a cabo en la finca El Cortijo (La Vega, Cundinamarca, Colombia [04°55'N y 74°18'W], 2350 m altitud, 17°C temperatura media, 1423 mm precipitación anual, 85% humedad relativa, 1377 horas brillo solar/año. Se utilizaron árboles de feijoa o goiabeira serrana de seis años, Clon 41 ('Quimba', evaluando fertilizantes foliares KNO3 (Nitrato de Potasio 13-0-46® 1%, 1,5% y 2% y KH2PO4 (fosfato de potasio; Cosmofoliar 0-32-43®; 0,5%, 0,75% y 1,0% y la fitohormona ethephon (Ethrel® 48 SL; 100, 150 y 200 mg L-1. Se determinaron el número de botones florales inducidos, flores formadas, además, el porcentaje de flores formadas y nivel de eficacia de los productos inductores. El KH2PO4 al 0,5% obtuvo resultados favorables en cada una de las variables evaluadas, comparado con el 0,75% y 1% del mismo producto y, sin embargo hubo un alto número de flores inducidas y formadas, no se presentaron diferencias significativas con el testigo. Ethephon a 150 mg L-1 en la inducción de botones florales y a 100 mg L-1 en la de formación de flores mostró resultados favorables, pero tampoco pudo superar el testigo por falta de significancia. La respuesta generada por KNO3 mostró una baja inducción de botones florales, y una eficacia negativa en la proporción de flores formadas; asimismo fitotoxicidad, cuando se emplearon concentraciones al 2% de este producto.The experiment was carried out in El Cortijo farm (La Vega, Cundinamarca, Colombia [ 04° 55' N and 74° 18' W ], 2350 m above sea level, 17° C average temperature, 1423 mm of annual precipitation, 85% of relative humidity, and 1.377 of sunshine hours/year. In the study, evaluation of foliar fertilizers KNO3 (potassium nitrate 13-0-46® 1%, 1.5%, and 2%, KH2PO4 (potassium phosphate; Cosmofoliar 0-32-43®; 0.5%, 0.75%, and 1.0%, and ethephon phytohormone (Ethrel® 48 SL; 100, 150, and 200 mg L-1 was done on six year old pineapple guava trees of Clone 41 ('Quimba'. The number of induced floral buds and formed flowers were evaluated, as well as the percentage of formed flowers, and the efficacy levels of inducting products. Application of KH2PO4 at 0.5% produced favorable results in each of the proposed variables; compared to 0,75% and 1% of the same product and, however there were a high number of induced and formed flowers, no significant differences with the control were found. With ethephon at 150 mg L-1 in floral induction and at 100 mg L-1 in flower formation good responses was obtained, but no differences with the control. The plant response to KNO3 was a low induction of floral buds and a negative efficacy in the proportion of flowers formed, and also phytotoxicity when KNO3 concentration was 2%.

Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

Science.gov (United States)

Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

2013-09-01

It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

Subtribo Myrciinae O. Berg (Myrtaceae na Restinga da Marambaia, RJ, Brasil Subtribe Myrciinae O. Berg (Myrtaceae at Marambaia Restinga, Rio de Janeiro State, Brazil

Directory of Open Access Journals (Sweden)

Marcelo da Costa Souza

2007-03-01

Full Text Available A família Myrtaceae é uma das famílias com maior riqueza de espécies nas Restingas. O principal objetivo deste trabalho foi o levantamento da subtribo Myrciinae (Myrtaceae nas diferentes formações vegetais da Restinga da Marambaia, no Estado do Rio de Janeiro (43º32' e 44º01'W; 23º01' e 23º06'S. Foram registradas as ocorrências dos seguintes táxons: Calyptranthes brasiliensis Spreng., Gomidesia fenzliana O. Berg, G. martiana O. Berg, Marlierea tomentosa Cambess., Myrcia acuminatissima O. Berg, M. lundiana Kiaersk., M. multiflora (Lam. DC., M. recurvata O. Berg e M. richardiana (O. Berg Kiaersk. Dois novos sinônimos são propostos para esta última espécie: Aulomyrcia lúcida O.Berg e Myrcia grandiglandulosa Kiaersk. Apresenta-se uma chave de identificação para as espécies, bem como descrições, ilustrações, dados relativos às épocas de floração e frutificação e distribuição geográfica.The family Myrtaceae is one of the most species-rich families in restinga vegetation. The main objective of this paper was to survey the subtribe Myrciinae (Myrtaceae in the different vegetation types of Marambaia Restinga, Rio de Janeiro, Brazil (43º32' - 44º01'W; 23º01' - 23º06'S. The following taxa were found: Calyptranthes brasiliensis Spreng., Gomidesia fenzliana O.Berg, G. martiana O. Berg, Marlierea tomentosa Cambess., Myrcia acuminatissima O. Berg, M. lundiana Kiaersk., M. multiflora (Lam. DC., M. recurvata O. Berg, and M. richardiana (O. Berg Kiaersk. Two new synonyms are proposed for the last specie: Aulomyrcia lucida O. Berg and Myrcia grandiglandulosa Kiaersk. A species key is given, as well as descriptions, illustrations, data on flowering and fruiting periods, and geographic distributions of the species.

Morfoanatomia de órgãos vegetativos de plantas juvenis de Aegiphila sellowiana Cham. (Lamiaceae submetidas ao alagamento do substrato Morpho-anatomy of vegetative organs in seedlings of Aegiphila sellowiana Cham. (Lamiaceae subject to flooding

Directory of Open Access Journals (Sweden)

Cristiano Medri

2011-06-01

Full Text Available Visando contribuir para o conhecimento das respostas morfoanatômicas de espécies arbóreas à hipoxia, efeitos do alagamento em órgãos vegetativos de Aegiphila sellowiana foram estudados. Indivíduos jovens foram mantidos em substrato drenado e alagado por 50 e 80 dias. Houve mortalidade de 40% das plantas alagadas. As sobreviventes produziram fissuras peridérmicas na base do hipocótilo, raízes diageotrópicas e lenticelas hipertrofiadas em hipocótilos e raízes. Em plantas alagadas: (1 as raízes secundárias apresentaram maior diâmetro, córtex mais espesso, células corticais maiores, espaços intercelulares maiores, cilindro vascular e elementos de vaso menores; (2 as raízes primárias em estrutura secundária e hipocótilos apresentaram súber e feloderme mais espessos; (3 as folhas apresentaram nervura mediana e mesofilo mais espesso, tricomas mais abundantes e estômatos menores. Constatou-se que A. sellowiana é intolerante ao alagamento do solo, fato evidenciado pela morte de parte das plantas. Entretanto, as sobreviventes apresentaram modificações morfoanatômicas que conferem tolerância. Sugere-se que a capacidade diferencial de tolerância apresentada entre os indivíduos pode ser resultado da presença de diferentes genótipos dentro do conjunto de plantas utilizado neste estudo.In order to uncover the morpho-anatomical responses of tree species to hypoxia, we studied the effects of flooding on vegetative organs of Aegiphila sellowiana. Young individuals were kept in drained and flooded soil for 50 and 80 days. Under flooding, there was a mortality rate of 40%. The surviving plants produced peridermic fissures, superficial roots and hypertrophied lenticels. Secondary roots of flooded plants presented greater diameter, thicker cortex, greater diameter of the cortical cells, larger intercellular spaces, and thinner vessel elements and vascular tissues. In the main roots under secondary growth and hypocotyls, cork and

Marketingová strategie orchestru Berg

OpenAIRE

Kašpráková, Soňa

2014-01-01

The main goal of this diploma thesis is to create a base of marketing strategy of Berg Orchestra, because of focusing on new target group of younger audience. Theoretical part describes marketing of orchestras and specifics of marketing mix, then issues of segmentation, targeting and positioning. This part also focuses on marketing research, especially on quality research, which is used in practical part of this thesis. Practical part introduces Berg Orchestra, its aims, marketing and analysi...

Standardized extract of Dicksonia sellowiana Presl. Hook (Dicksoniaceae) decreases oxidative damage in cultured endothelial cells and in rats.

Science.gov (United States)

Rattmann, Yanna D; Mendéz-Sánchez, Stelia C; Furian, Ana F; Paludo, Katia S; de Souza, Lauro Mera; Dartora, Nessana; Oliveira, Mauro S; Costa, Elisangela Martins da S; Miguel, Obdúlio G; Sassaki, Guilherme Lanzi; Iacomini, Marcello; Mello, Carlos F; Franco, Célia R C; da Silva-Santos, José Eduardo; Cadena, Silvia M S C; Marques, Maria C A; Santos, Adair R S

2011-02-16

Aging and a variety of pathologies, including cancer, diabetes, cardiovascular and inflammatory diseases have been associated with reactive oxygen species (ROS), such as superoxide anion (O₂·⁻), hydroxyl radical (·OH) and hydrogen peroxide (H₂O₂) generation. Plant polyphenols bear radical scavenging/antioxidant activity. A phytomedicinal preparation obtained from aerial parts of Dicksonia sellowiana (Dicksoniaceae), a native plant from Central and South America, has been widely used in Brazil against asthma and presents beneficial effects in several other diseases, including cardiovascular disturbance. In this work, we investigated whether Dicksonia sellowiana, which is also known to contain high levels of polyphenols, presents antioxidant activity. The antioxidant activity of the hydroalcoholic extract obtained from Dicksonia sellowiana leaves (HEDS) was investigated by in vitro and in vivo tests. HEDS (0.1-100 μg/mL) exhibited a strong scavenging activity against all reactive species tested (DPPH, O₂·⁻,·OH and H₂O₂; IC₅₀=6.83±2.05, 11.6±5.4, 2.03±0.4, and 4.8±0.4 μg/mL, respectively). HEDS strongly protected endothelial cells against H₂O₂-induced oxidative stress by mechanisms other than increasing catalase activity. In addition, HEDS protected cell membrane from oxidative damage. HEDS, (20 and 40 mg/kg) inhibited lipid peroxidation in vivo (29.8% and 24.5%, respectively). According to our results, we can speculate that the traditional uses of Dicksonia sellowiana for cardiovascular diseases, asthma and skin diseases could be, at least in part, related to the potent antioxidant and endothelial protective activities of the plant. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Caracterização dendrométrica de Dicksonia sellowiana Hook. em povoamento de Araucaria angustifolia (Bertol. Kuntze

Directory of Open Access Journals (Sweden)

Daniela Biondi

2009-12-01

Full Text Available Due to its history of exploitation and intensive use in landscaping, the Dicksonia sellowiana Hook. (Dicksoniaceae is currently one of the Brazilian flora endangered species. The Paraná State laws prohibit its extraction; however, there is no research to support future management plans. This work characterized the natural occurrence of D. Sellowiana in an Araucaria angustifolia stand in the municipality of Rio Negro, Paraná State, using dendrometric variables after silvicultural intervention (clipping. D. sellowiana individuals (714 taller than the commercial height of 0.50 m were randomly sampled and assigned to the following treatments: plots with unclipped plants (T0, plots with plants clipped in the measurement (T1, and plots with plants clipped two years before in the measurement (T2. The variables analyzed were: density of the individuals/ha and plots, total and commercial caudex height (m, crown height (m, base diameter, crown (cm and frond (m, diameters, individual and total commercial volume. It was found significant difference between T1 and T2 for total height; between T2 and T0 and between T2 of T1 for crown and from diameters, individual commercial volume; between T0 and T1 and between TO and T2 for total commercial volume. The variables that characterized better the silvicultural interventions were the density of individuals and the total height. The occurred interventions revealed its importance for the management of the D. sellowiana because it favors the regeneration of the young plants for the conservation of the species, and benefits the development of the adult plants for its commercial exploitation.

An Automated Cropland Classification Algorithm (ACCA) for Tajikistan by combining Landsat, MODIS, and secondary data

Science.gov (United States)

Thenkabail, Prasad S.; Wu, Zhuoting

2012-01-01

The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA) that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed) over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan using mega file data cubes (MFDCs) involving data from Landsat Global Land Survey (GLS), Landsat Enhanced Thematic Mapper Plus (ETM+) 30 m, Moderate Resolution Imaging Spectroradiometer (MODIS) 250 m time-series, a suite of secondary data (e.g., elevation, slope, precipitation, temperature), and in situ data. First, the process involved producing an accurate reference (or truth) cropland layer (TCL), consisting of cropland extent, areas, and irrigated vs. rainfed cropland areas, for the entire country of Tajikistan based on MFDC of year 2005 (MFDC2005). The methods involved in producing TCL included using ISOCLASS clustering, Tasseled Cap bi-spectral plots, spectro-temporal characteristics from MODIS 250 m monthly normalized difference vegetation index (NDVI) maximum value composites (MVC) time-series, and textural characteristics of higher resolution imagery. The TCL statistics accurately matched with the national statistics of Tajikistan for irrigated and rainfed croplands, where about 70% of croplands were irrigated and the rest rainfed. Second, a rule-based ACCA was developed to replicate the TCL accurately (~80% producer’s and user’s accuracies or within 20% quantity disagreement involving about 10 million Landsat 30 m sized cropland pixels of Tajikistan). Development of ACCA was an iterative process involving series of rules that are coded, refined, tweaked, and re-coded till ACCA derived croplands (ACLs) match accurately with TCLs. Third, the ACCA derived cropland

An Automated Cropland Classification Algorithm (ACCA for Tajikistan by Combining Landsat, MODIS, and Secondary Data

Directory of Open Access Journals (Sweden)

Prasad S. Thenkabail

2012-09-01

Full Text Available The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan using mega file data cubes (MFDCs involving data from Landsat Global Land Survey (GLS, Landsat Enhanced Thematic Mapper Plus (ETM+ 30 m, Moderate Resolution Imaging Spectroradiometer (MODIS 250 m time-series, a suite of secondary data (e.g., elevation, slope, precipitation, temperature, and in situ data. First, the process involved producing an accurate reference (or truth cropland layer (TCL, consisting of cropland extent, areas, and irrigated vs. rainfed cropland areas, for the entire country of Tajikistan based on MFDC of year 2005 (MFDC2005. The methods involved in producing TCL included using ISOCLASS clustering, Tasseled Cap bi-spectral plots, spectro-temporal characteristics from MODIS 250 m monthly normalized difference vegetation index (NDVI maximum value composites (MVC time-series, and textural characteristics of higher resolution imagery. The TCL statistics accurately matched with the national statistics of Tajikistan for irrigated and rainfed croplands, where about 70% of croplands were irrigated and the rest rainfed. Second, a rule-based ACCA was developed to replicate the TCL accurately (~80% producer’s and user’s accuracies or within 20% quantity disagreement involving about 10 million Landsat 30 m sized cropland pixels of Tajikistan. Development of ACCA was an iterative process involving series of rules that are coded, refined, tweaked, and re-coded till ACCA derived croplands (ACLs match accurately with TCLs. Third, the ACCA derived

Biocatalytic Asymmetric Synthesis of (1R, 2S)-N-Boc-vinyl-ACCA Ethyl Ester with a Newly Isolated Sphingomonas aquatilis.

Science.gov (United States)

Zhu, Shaozhou; Shi, Ying; Zhang, Xinyu; Zheng, Guojun

2018-02-01

1-amino cyclopropane-1-carboxylic acid (ACCA) and its derivatives are essential pharmacophoric unit that widely used in drug research and development. Specifically, (1R, 2S)-N-Boc-vinyl-ACCA ethyl ester (vinyl-ACCA) is a key chiral intermediate in the synthesis of highly potent hepatitis C virus (HCV) NS3/4A protease inhibitors such as asunaprevir and simeprevir. Developing strategies for the asymmetric synthesis of vinyl-ACCA is thus extremely high demand. In this study, 378 bacterial strains were isolated from soil samples using N-Boc-vinyl-ACCA ethyl ester as the sole carbon source and were screened for esterase activity. Fourteen of which worked effectively for the asymmetric synthesis of (1R, 2S)-N-Boc-1-vinyl ACCA ethyl ester. The strain CY-2, identified as Sphingomonas aquatilis, which showed the highest stability and enantioselectivity was selected as whole cell biocatalyst for further study. A systematic study of all factors influencing the enzymatic hydrolysis was performed. Under optimized conditions, resolution of rac-vinyl-ACCA to (1R, 2S)-N-Boc-1-vinyl ACCA ethyl ester with 88.2% ee and 62.4% conversion (E = 9) was achieved. Besides, S. aquatilis was also used to transform other 10 different substrates. Notably, it was found that 7 of them could be stereoselectively hydrolyzed, especially for (1R,2S)-1-amino-vinyl-ACCA ethyl ester hydrochloride (99.6% ee, E>200). Our investigations provide a new efficient whole cell biocatalyst for resolution of ACCA and might be developed for industry application.

Antibody class capture assay (ACCA) for rubella-specific IgM antibody.

Science.gov (United States)

Isaac, M; Payne, R A

1982-01-01

Enzyme-linked immunosorbent assays for IgM antirubella were carried out on 1,546 sera, using an IgM capture method with a F (ab')2 conjugate (ACCA). Under the conditions described, sera containing IgM antirubella bound up to 15 times as much enzyme activity as negative specimens. Paired serum specimens from 27 patients, serial serum specimens from 6 patients, and single serum specimens from 15 patients who had had recent rubella were examined by the haemagglutination inhibition test (HAI) in the presence and absence of 2-mercaptoethanol following sucrose density gradient centrifugation (SDGC). ACCA confirmed all the results found with HAI following SDGC. Specimens were examined from ten patients with congenital rubella; ACCA confirmed the results found with both immunofluorescence following SDGC and radioimmunoassay. Pre- and post-vaccination specimens from 123 patients who had been vaccinated against rubella were examined. An IgM response could only be demonstrated in the 57 cases when IgG was absent in the first specimen. The specificity of the assay was confirmed by testing 31 serum specimens from rubella immune patients that also contained rheumatoid factor, 163 serum specimens from patients with acute infections other than rubella, and 12 serum specimens from infants with miscellaneous neonatal abnormalities other than congenital rubella. The ACCA proved a simple, sensitive, and specific test for IgM antirubella and the results compared favourably with those obtained by the SDGC technique.

Maduración del fruto de feijoa (Acca sellowiana Berg en los clones 41 (Quimba y 8-4 a temperatura ambiente en condiciones de la Sabana de Bogotá

Directory of Open Access Journals (Sweden)

Rodríguez Mariela

2006-06-01

Hidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" />

Con el propósito de seleccionar los mejores frutos de feijoa (Acca sellowiana Berg para exportación, se realizó un estudio de maduración con los frutos de los clones 41 (Quimba y 8-4, mantenidos a temperatura promedio de 16,3 oC y HR promedio de 65,1%. El clon 8-4 fue evaluado por 14 d y el clon 41 (Quimba por 18 d. Diariamente se registraron las variables intensidad

[Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

Science.gov (United States)

Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

2003-02-01

Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

Cryopreservation of spores of Dicksonia sellowiana: an endangered tree fern indigenous to South and Central America.

Science.gov (United States)

Rogge, G D; Viana, A M; Randi, A M

2000-01-01

Spores of Dicksonia sellowiana (Presl.) Hook., an endangered tree fern, were stored in liquid nitrogen. Surface sterilized spores were placed in 1 ml sterile polypropylene cryotubes and were plunged into liquid nitrogen cryo-cans for 15 minutes, 15 days, 1 month and 3 months. In all, of the treatments the percentage of germination was higher than the control (fresh spores). Germination in Dyer and MS media supplement with 10 (-7) M and 5 x 10(-7) M BA was also promoted as comparing to control. There was no difference between the germination of spores thawed rapidly in a water bath at 45 degree C during 5 minutes or slowly at room temperature. Cryopreservation seems to promote germination of some dormant spores of D. sellowiana. The pre-treatment in cryoprotective solution of dimethyl sulphoxide 15%(v/v) in 1 M glycerol inhibited the germination of cryopreserved spores

Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

Science.gov (United States)

Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

2008-08-15

The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

Morfologia da unidade de dispersão e germinação de Cordia sellowiana cham. e Cordia myxa l

OpenAIRE

Barroso,Isabel Cristina Ercolini; Oliveira,Fernando de; Ciarelli,Deborah Maria

2009-01-01

As unidades de dispersão das espécies Cordia sellowiana Cham. e Cordia myxa L. (Boraginaceae Jussieu) foram estudadas com ênfase em sua morfologia e no processo de germinação. Os frutos de Cordia sellowiana e de Cordia myxa são do tipo drupóide nuculânio. A protrusão da raiz primária, na primeira espécie, ocorre através de fenda longitudinal do pirênio, e na segunda, através de abertura do opérculo. A germinação, nas duas espécies, é do tipo fanerocotiledonar epígea. As plântulas apresentam c...

Activation of muscarinic receptors by a hydroalcoholic extract of Dicksonia sellowiana Presl. HooK (Dicksoniaceae) induces vascular relaxation and hypotension in rats.

Science.gov (United States)

Rattmann, Yanna D; Crestani, Sandra; Lapa, Fernanda R; Miguel, Obdúlio G; Marques, Maria C A; da Silva-Santos, J Eduardo; Santos, Adair R S

2009-01-01

Dicksonia sellowiana (Presl.) Hook is a native plant from the Central and South Americas that contain high levels of polyphenols, antioxidant compounds involved in protection against inflammation, cancer and cardiovascular risk. A phytomedicinal preparation obtained from aerial parts of D. sellowiana is currently under clinical evaluation in Brazil against asthma, and has been associated with several other beneficial effects. This study demonstrates that a hydroalcoholic extract obtained from D. sellowiana leaves (HEDS) fully relax, in a concentration-dependent manner, rat aortic rings precontracted with phenylephrine. Moreover, administration of HEDS (10, 20 and 40 mg/kg, i.v.) in anaesthetized rats resulted in a strong but reversible hypotension. Aortic relaxation induced by HEDS was abolished by endothelium removal, by incubation of the nitric oxide synthase inhibitor L-NAME, or the soluble guanylate cyclase inhibitor ODQ. In addition, this effect was partially inhibited by indomethacin (a cyclooxygenase inhibitor) and KT 5730 (a PKA inhibitor). The potassium channels blockade by either tetraethylammonium or charybdotoxin also resulted in a potent inhibition of HEDS-induced aortic relaxation, whereas apamine only slightly reduced it. In addition HEDS-induced relaxation was unchanged by 4-amynopiridine and glibenclamide. The selective muscarinic receptor antagonist atropine counteracted both aortic relaxation and blood pressure reduction generated by HEDS. Experiments using HPLC revealed the presence of high amounts of phenolic compounds in this extract. Taken together, our results reveal that the D. sellowiana possess substances with both in vivo and in vitro activities and that the vascular effect of HEDS involves activation of muscarinic receptors, stimulation of the nitric oxide pathway and opening of calcium-activated potassium channels.

An Automated Cropland Classification Algorithm (ACCA) for Tajikistan by Combining Landsat, MODIS, and Secondary Data

OpenAIRE

Thenkabail, Prasad S.; Wu, Zhuoting

2012-01-01

The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA) that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed) over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan u...

Crescimento do cáudice e fenologia de Dicksonia sellowiana Hook. (Dicksoniaceae no sul do Brasil Caudex growth and fenology of Dicksonia sellowiana Hook. (Dicksoniaceae in Southern Brazil

Directory of Open Access Journals (Sweden)

Jairo Lizandro Schmitt

2009-03-01

Full Text Available No sul e sudeste do Brasil, a samambaia arborescente Dicksonia sellowiana Hook. é ainda extraída ilegalmente de remanescentes florestais para uso da capa fibrosa do seu cáudice, bem como para cultivo como planta ornamental. No presente trabalho, o crescimento do cáudice, a produção, expansão e senescência de frondes, bem como a formação e liberação de esporos de D. sellowiana foram estudados com base na observação de 37 plantas. Durante um período de um ano de observação, os cáudices cresceram, em média, 5,65 cm ano-1, sendo que a taxa de crescimento se correlacionou fortemente com a altura das plantas. As taxas de produção de frondes novas (10,86 frondes ano-1 e de senescência (10,54 frondes ano-1, similares, evidenciaram capacidade de manter um número de frondes estável, no ano. Apenas 14 indivíduos desenvolveram frondes férteis, sendo que a maioria das plantas produziu esporos no verão, liberando-os no inverno. A produção e liberação de esporos foram mais influenciadas pela temperatura e fotoperíodo do que pela precipitação.In Southern and Southeastern Brazil, the tree fern Dicksonia sellowiana Hook. still is illegally extracted from remnants forests for the use of its fibrous caudex cover, as well as for cultivation as an ornamental plant. In the present study the caudex growth, frond production, expansion and senescence as well as the formation and release of spores have been studied based on the observation of 37 plants. During an observation period of one year, the caudexes grew at an average of 5.65 cm year-1 and the growth rate presented a strong correlation with the height of the plants. Similar frond production rate (10.86 fronds year-1 and senescence (10.54 fronds year-1 evidenced the capacity of maintaining a stable number of fronds throughout the year. Only 14 individuals developed fertile fronds, most of them producing spores during the summer and liberating them during the winter. Production and

Model of pre-harvest quality of pineapple guava fruits (Acca sellowiana (O. berg burret as a function of weather conditions of the crops

Directory of Open Access Journals (Sweden)

Alfonso Parra-Coronado

Full Text Available ABSTRACT Weather conditions influence the quality parameters of pineapple guava fruit during growth and development. The aim of this study was to propose a model of pre-harvest fruit quality as a function of weather conditions in the cultivation area. Twenty trees were flagged per farm in 2 localities of the Department of Cundinamarca, Colombia: Tenjo (2,580 m.a.s.l.; 12.5 °C; relative humidity between 74 and 86%; mean annual precipitation 765 mm and San Francisco de Sales (1,800 m.a.s.l.; 20.6 °C; relative humidity between 63 and 97%; mean annual precipitation 1,493 mm. Measurements were performed every 7 days during 2 harvest periods starting on days 96 (Tenjo and 99 (San Francisco de Sales after anthesis and until harvest. The models were obtained using Excel® Solver, and a set of data was obtained for the 2 different cultivar periods and each study site. The results showed that altitude, growing degree days, and accumulated precipitation are the weather variables with the highest influence on the physicochemical characteristics of the fruit during growth. The models of fresh weight, total titratable acidity, and skin firmness better predict the development of fruit quality during growth and development. Equations were obtained for increases of length and diameter as a function of fruit weight and for days from anthesis as a function of growing degree days and altitude. The regression analysis parameters showed that the models adequately predicted the fruit characteristics during growth for both localities, and a cross-validation analysis showed a good statistical fit between the estimated and observed values.

Maipäevad Dessaus / Maimu Berg

Index Scriptorium Estoniae

Berg, Maimu, 1945-

1989-01-01

Moekunstnike loomingulisest seminarist, mida juhendas professor ja vabakutseline kunstnik Bodo Müller, Dessaus Bauhausi hoones (Tallinnast osalesid Maimu Berg ja kunstnik Kristel Leedjärv); Bauhausi ajaloost

Berg adder ( Bitis atropos ): An unusual case of acute poisoning ...

African Journals Online (AJOL)

After various unsuccessful treatment options were followed, the Tygerberg Poison Information Centre was contacted and a diagnosis of berg adder bite was made. Berg adder bites are uncommon and therefore not usually considered in the differential diagnosis of a patient presenting with an unexplained clinical picture.

Programme ACCA : Rapport annuel 2009-2010 | CRDI - Centre de ...

International Development Research Centre (IDRC) Digital Library (Canada)

À la lumière d'études de cas locales et ciblées consacrées à l'adaptation en Afrique, le présent rapport montre en quoi la participation des décideurs au processus de recherche les aide à mieux cerner ce processus et contribue à les mobiliser. Le programme ACCA est financé conjointement par le Centre de recherches ...

Average correlation clustering algorithm (ACCA) for grouping of co-regulated genes with similar pattern of variation in their expression values.

Science.gov (United States)

Bhattacharya, Anindya; De, Rajat K

2010-08-01

Distance based clustering algorithms can group genes that show similar expression values under multiple experimental conditions. They are unable to identify a group of genes that have similar pattern of variation in their expression values. Previously we developed an algorithm called divisive correlation clustering algorithm (DCCA) to tackle this situation, which is based on the concept of correlation clustering. But this algorithm may also fail for certain cases. In order to overcome these situations, we propose a new clustering algorithm, called average correlation clustering algorithm (ACCA), which is able to produce better clustering solution than that produced by some others. ACCA is able to find groups of genes having more common transcription factors and similar pattern of variation in their expression values. Moreover, ACCA is more efficient than DCCA with respect to the time of execution. Like DCCA, we use the concept of correlation clustering concept introduced by Bansal et al. ACCA uses the correlation matrix in such a way that all genes in a cluster have the highest average correlation values with the genes in that cluster. We have applied ACCA and some well-known conventional methods including DCCA to two artificial and nine gene expression datasets, and compared the performance of the algorithms. The clustering results of ACCA are found to be more significantly relevant to the biological annotations than those of the other methods. Analysis of the results show the superiority of ACCA over some others in determining a group of genes having more common transcription factors and with similar pattern of variation in their expression profiles. Availability of the software: The software has been developed using C and Visual Basic languages, and can be executed on the Microsoft Windows platforms. The software may be downloaded as a zip file from http://www.isical.ac.in/~rajat. Then it needs to be installed. Two word files (included in the zip file) need to

El cuajamiento de frutos de feijoa (Acca sellowiana [O. Berg] Burret en respuesta a nitrato de potasio, fosfato de potasio y ethephon

Directory of Open Access Journals (Sweden)

García Oskar Javier

2008-08-01

Full Text Available

En la finca El Cortijo, municipio La Vega (Cundinamarca, ubicada a 2.350 msnm de altitud, con temperatura de 17 °C, humedad relativa de 85%, precipitación de 1.423 mm·año^-1, se estudió el efecto de tres productos químicos en árboles de feijoa, Clon 41 ('Quimba', de 6 años de edad, sobre el cuajamiento de los frutos. Los productos fueron los fertilizantes foliares KNO₃ (nitrato de potasio 13-0-46® al 1,0%, 1,5% y 2,0% y KH2PO₄ (fosfato de potasio; Cosmofoliar al 0-32-43®; 0,5%, 0,75% y 1,0% y la fitohormona ethephon (Ethrel® 48SL, a 100, 150 y 200 mg·L^-1, aplicados 4 veces, cada 15 días, a partir de 50 días después de la poda. Se evaluaron el número de flores formadas, el número y el porcentaje de frutos cuajados y el nivel de eficacia de los productos aplicados. El KH₂PO₄ al 0,5% presentó los valores significativamente más altos (P≤0,05 en las cuatro variables evaluadas y obtuvo, en su diferencia frente al testigo (0 aplicaciones, aumentos de 447,6% en el número de las flores formadas y de 465,4% en el número de frutos cuajados, destacando la importancia del P en el proceso reproductivo de la feijoa. El segundo mejor tratamiento, con una eficacia positiva (96,55% en el cuajamiento de frutos, fue el ethephon a 100 mg·L^-1. El número de frutos cuajados en las diferentes concentraciones de KNO₃ no pudo superar el del testigo, presentándose una eficacia negativa y así mismo, fitotoxicidad cuando se emplearon concentraciones al 2%. El porcentaje de cuajamiento en feijoa (66% del testigo fue relativamente alto comparado con el de otros frutales.

Growth, mineral composition, fruit yield, and mycorrhizal colonization of feijoa in response to lime and phosphorus application

OpenAIRE

Nava, Gilberto; Santos, Karine Louise dos; Costa, Murilo Dalla; Ciotta, Marlise Nara

2016-01-01

Abstract: The objective of this work was to investigate the effect of liming and phosphorus fertilization on the growth, mineral composition of the leaves, fruit yield, and mycorrhizal colonization of young feijoa (Acca sellowiana) plants. Treatments consisted of four liming levels - 0, 25, 50, and 100% of the dose required to raise the soil pH to 6.5 - and of five levels of P - 0, 60, 120, 180, and 240 kg ha-1 P2O5 -, placed in a randomized complete block design, in a split-plot arrangement,...

Graph Theory in Paris : Conference in Memory of Claude Berge

CERN Document Server

Fonlupt, Jean; Fouquet, Jean-Luc; Fournier, Jean-Claude; Alfonsín, Jorge

2007-01-01

In July 2004, a conference on graph theory was held in Paris in memory of Claude Berge, one of the pioneers of the field. The event brought together many prominent specialists on topics, such as perfect graphs and matching theory, upon which Claude Berge's work has had a major impact. This volume includes contributions to these and other topics from many of the participants.

Teste de tetrazólio para avaliação da qualidade fisiológica em sementes de Goiabeira-serrana (Acca sellowiana O. Berg Burret

Directory of Open Access Journals (Sweden)

Marcelo Benevenga Sarmento

2013-03-01

Full Text Available A goiabeira-serrana, espécie frutífera nativa do Sul do Brasil, vem mostrando- se promissora em termos ecológicos e comerciais. O trabalho objetivou avaliar a qualidade fisiológica de dois lotes de sementes de goiabeira-serrana por meio do teste de tetrazólio. O experimento foi dividido em duas etapas. Na primeira, os lotes foram submetidos aos testes de germinação, índice de velocidade de germinação, tempo médio de germinação, emergência em casa de vegetação, índice de velocidade de emergência de plântulas em casa de vegetação, tempo médio de emergência e comprimento de parte aérea. Na segunda, foi realizado o teste de tetrazólio nas concentrações de 0,5 e 1,0, e tempos de embebição (2 h e 4 h. O tratamento 0,5 TZ 4h obteve 73% de sementes viáveis (lote 2007. Para o lote 2008, não houve diferenças entre os tratamentos. O teste de germinação apresentou correlação positiva para os tratamentos 0,5 TZ 2 h e 1 TZ 2 h. Para a emergência de plântulas em casa de vegetação, houve correlação positiva para o tratamento 0,5 TZ 2 h. O teste de tetrazólio permitiu a classificação dos lotes em quatro níveis de viabilidade, confirmando a eficiência do teste na avaliação da viabilidade de sementes de goiabeira-serrana.

Fisiología poscosecha en frutos de dos cultivares de feijoa (Acca sellowiana O. Berg Burret sometidos a un tratamiento cuarentenario de frío

Directory of Open Access Journals (Sweden)

Valderrama J. Katerine

2005-12-01

Full Text Available

Se evaluó el tratamiento cuarentenario T-107-b (1,67 ºC por 22 d sobre la calidad y vida poscosecha de dos cultivares de feijoa. Se utilizaron los cultivares ‘Cenaf 41’ y ‘Cenaf 8-4’. Los frutos sometidos al tratamiento se compararon con frutos almacenados a 19,0 ºC, simulando transporte y comercialización. Durante el tratamiento se registró la temperatura interna de frutos. Se evaluó el comportamiento fisiológico y químico antes y después del tratamiento. La tasa respiratoria mostró la tendencia de un fruto climatérico. El contenido de sólidos solubles y el pH aumentaron y la acidez titulable disminuyó a través del tiempo. Los frutos con y sin el tratamiento tuvieron un comportamiento poscosecha muy similar en el proceso de comercialización y vida de anaquel.

Determinação da atividade antifúngica de Acca sellowiana

OpenAIRE

Gabriella da Rosa Monte Machado

2015-01-01

Infecções fúngicas causadas por leveduras oportunistas de Candida não – albicans (CNA) têm aumentado drasticamente nas últimas décadas, podendo estar relacionadas com o elevado número de pacientes imunocomprometidos, mais susceptíveis a essas infecções. CNA possuem maior resistência aos antifúngicos tradicionais como o fluconazol (FLZ), fármaco de escolha para o tratamento de infecções por Candida spp. A resistência antifúngica conduz a falhas na terapia clínica podendo levar ao aumento das t...

Vztah profesní organizace a vysoké školy na příkladu ACCA/ICAEW a VŠE

OpenAIRE

Váňová, Adéla

2015-01-01

The thesis aims to explore the relationship of international professional organization ACCA, respectively ICAEW and Faculty of Finance and Accounting (VŠE), and the knowledge to confront each other. The introduction emphasized the importance of professional organizations in connection with the voluntary and compulsory established organizations. The main part of this thesis is focused on the organization ACCA, which deals with her qualifications. The final part closer describes the cooperation...

The effect of different growth regimes on the endophytic bacterial communities of the fern, Dicksonia sellowiana hook (Dicksoniaceae)

OpenAIRE

Irene de Araújo Barros; Welington Luiz Araújo; João Lúcio Azevedo

2010-01-01

Endophytic bacteria associated with the fern Dicksonia sellowiana were investigated. The bacterial communities from the surface-sterilized pinnae and rachis segments of the plants from the Brazilian Atlantic Rainforest that grew in native field conditions were compared with the bacterial communities from plants grown in greenhouses and plants that were initially grown in greenhouses and then transferred to the forest. From 540 pinnae and 540 rachis segments, 163 (30.2%) and 346 (64.2%) were c...

Normative scores on the Berg Balance Scale decline after age 70 years in healthy community-dwelling people: a systematic review.

Science.gov (United States)

Downs, Stephen; Marquez, Jodie; Chiarelli, Pauline

2014-06-01

What is the mean Berg Balance Scale score of healthy elderly people living in the community and how does it vary with age? How much variability in Berg Balance Scale scores is present in groups of healthy elderly people and how does this vary with age? Systematic review with meta-analysis. Any group of healthy community-dwelling people with a mean age of 70 years or greater that has undergone assessment using the Berg Balance Scale. Mean and standard deviations of Berg Balance Scale scores within cohorts of elderly people of known mean age. The search yielded 17 relevant studies contributing data from a total of 1363 participants. The mean Berg Balance Scale scores ranged from 37 to 55 out of a possible maximum score of 56. The standard deviation of Berg Balance Scale scores varied from 1.0 to 9.2. Although participants aged around 70 years had very close to normal Berg Balance Scale scores, there was a significant decline in balance with age at a rate of 0.7 points on the 56-point Berg Balance Scale per year. There was also a strong association between increasing age and increasing variability in balance (R(2) = 0.56, p balance deficits, as measured by the Berg Balance Scale, although balance scores deteriorate and become more variable with age. Copyright © 2014. Published by Elsevier B.V.

The Berg Balance Scale has high intra- and inter-rater reliability but absolute reliability varies across the scale: a systematic review.

Science.gov (United States)

Downs, Stephen; Marquez, Jodie; Chiarelli, Pauline

2013-06-01

What is the intra-rater and inter-rater relative reliability of the Berg Balance Scale? What is the absolute reliability of the Berg Balance Scale? Does the absolute reliability of the Berg Balance Scale vary across the scale? Systematic review with meta-analysis of reliability studies. Any clinical population that has undergone assessment with the Berg Balance Scale. Relative intra-rater reliability, relative inter-rater reliability, and absolute reliability. Eleven studies involving 668 participants were included in the review. The relative intrarater reliability of the Berg Balance Scale was high, with a pooled estimate of 0.98 (95% CI 0.97 to 0.99). Relative inter-rater reliability was also high, with a pooled estimate of 0.97 (95% CI 0.96 to 0.98). A ceiling effect of the Berg Balance Scale was evident for some participants. In the analysis of absolute reliability, all of the relevant studies had an average score of 20 or above on the 0 to 56 point Berg Balance Scale. The absolute reliability across this part of the scale, as measured by the minimal detectable change with 95% confidence, varied between 2.8 points and 6.6 points. The Berg Balance Scale has a higher absolute reliability when close to 56 points due to the ceiling effect. We identified no data that estimated the absolute reliability of the Berg Balance Scale among participants with a mean score below 20 out of 56. The Berg Balance Scale has acceptable reliability, although it might not detect modest, clinically important changes in balance in individual subjects. The review was only able to comment on the absolute reliability of the Berg Balance Scale among people with moderately poor to normal balance. Copyright © 2013 Australian Physiotherapy Association. Published by .. All rights reserved.

The effect of different growth regimes on the endophytic bacterial communities of the fern, Dicksonia sellowiana hook (Dicksoniaceae

Directory of Open Access Journals (Sweden)

Irene de Araújo Barros

2010-12-01

Full Text Available Endophytic bacteria associated with the fern Dicksonia sellowiana were investigated. The bacterial communities from the surface-sterilized pinnae and rachis segments of the plants from the Brazilian Atlantic Rainforest that grew in native field conditions were compared with the bacterial communities from plants grown in greenhouses and plants that were initially grown in greenhouses and then transferred to the forest. From 540 pinnae and 540 rachis segments, 163 (30.2% and 346 (64.2% were colonized by bacteria, respectively. The main bacterial genera and species that were isolated included Bacillus spp. (B. cereus, B. megaterium, B. pumilus and B. subtilis, Paenibacillus sp., Amphibacillus sp., Gracilibacillus sp., Micrococcus sp. and Stenotrophomonas spp. (S. maltophilia and S. nitroreducens. B. pumilus was the most frequently isolated bacterial species. Amphibacillus and Gracilibacillus were reported as endophytes for the first time. Other commonly found bacterial genera were not observed in D. sellowiana, which may reflect preferences of specific bacterial communities inside this fern or detection limitations due to the isolation procedures. Plants that were grown in greenhouses and plants that were reintroduced into the forest displayed more bacterial genera and species diversity than native field plants, suggesting that reintroduction shifts the bacterial diversity. Endophytic bacteria that displayed antagonistic properties against different microorganisms were detected, but no obvious correlation was found between their frequencies with plant tissues or with plants from different growth regimes. This paper reports the first isolation of endophytic bacteria from a fern.

The effect of different growth regimes on the endophytic bacterial communities of the fern, Dicksonia sellowiana hook (Dicksoniaceae).

Science.gov (United States)

de Araújo Barros, Irene; Luiz Araújo, Welington; Lúcio Azevedo, João

2010-10-01

Endophytic bacteria associated with the fern Dicksonia sellowiana were investigated. The bacterial communities from the surface-sterilized pinnae and rachis segments of the plants from the Brazilian Atlantic Rainforest that grew in native field conditions were compared with the bacterial communities from plants grown in greenhouses and plants that were initially grown in greenhouses and then transferred to the forest. From 540 pinnae and 540 rachis segments, 163 (30.2%) and 346 (64.2%) were colonized by bacteria, respectively. The main bacterial genera and species that were isolated included Bacillus spp. ( B. cereus, B. megaterium, B. pumilus and B. subtilis ) , Paenibacillus sp. , Amphibacillus sp. , Gracilibacillus sp. , Micrococcus sp. and Stenotrophomonas spp. ( S. maltophilia and S. nitroreducens ). B. pumilus was the most frequently isolated bacterial species . Amphibacillus and Gracilibacillus were reported as endophytes for the first time. Other commonly found bacterial genera were not observed in D. sellowiana , which may reflect preferences of specific bacterial communities inside this fern or detection limitations due to the isolation procedures. Plants that were grown in greenhouses and plants that were reintroduced into the forest displayed more bacterial genera and species diversity than native field plants, suggesting that reintroduction shifts the bacterial diversity. Endophytic bacteria that displayed antagonistic properties against different microorganisms were detected, but no obvious correlation was found between their frequencies with plant tissues or with plants from different growth regimes. This paper reports the first isolation of endophytic bacteria from a fern.

Manlighet, mod och moral: Amanda Kerfstedts Carl Bergs skoltid

Directory of Open Access Journals (Sweden)

Andersson, Maria

2011-03-01

Full Text Available Amanda Kerfstedt’s ”Carl Bergs skoltid” describes a boy’s journey to manhood in late 19th century Sweden. This article pertains that the text contrasts an ideal of masculinity based on physical strength with an ideal emphasizing morality. Although a true man, as described in the story, is expected to be strong as well as righteous, the moral component is the most important. The text shows that courage and force, which are not checked by a sense of ethics, may turn into brutality and abuse of power. Different types of masculinity are compared in ”Carl Bergs skoltid” but masculinity is also defined in relation to ideas about femininity. The association with women is utilized to stress a lack of courage in men as well as to redefine a masculine ideal that has focused too much on physical prowess instead of strength of character.

O ARMAZENAMENTO REFRIGERADO PROLONGA A VIABILIDADE DE SEMENTES DE GOIABEIRA-SERRANA

Directory of Open Access Journals (Sweden)

JOEL DONAZZOLO

2015-09-01

Full Text Available RESUMO Este trabalho teve como objetivo avaliar a viabilidade e o vigor das sementes de dois genótipos de Acca sellowiana sob diferentes condições e tempos de armazenamento. As sementes foram obtidas a partir de duas plantas (G1 e G2 localizadas em quintais da área urbana de Vacaria-RS. O experimento foi realizado em esquema trifatorial (2 x 3 x 2, sendo duas condições de armazenamento (temperatura ambiente: 20-25ºC; e refrigerado: 4-8ºC, três períodos de armazenamento (zero, um e dois anos, e dois genótipos (G1 e G2, conduzidos em blocos casualizados, com quatro repetições de 50 sementes. As sementes foram postas para germinar sobre papel absorvente umedecido em caixas tipo “gerbox”, mantidas em câmara de crescimento com temperatura de 25 ± 2 °C e fotoperíodo de 16 h. Avaliaram-se o índice de velocidade de germinação, a porcentagem de germinação e o tempo médio de germinação, por meio da contagem de sementes germinadas a cada dois dias, por 44 dias após o início da germinação. Os genótipos apresentaram desempenhos significativamente diferentes na taxa germinativa e no vigor das sementes. Quando armazenadas em temperatura ambiente, as sementes perderam o poder germinativo drasticamente no primeiro ano e completamente no segundo ano. Conclui-se que é possível manter 80% de poder germinativo das sementes de Acca sellowiana por dois anos em armazenamento refrigerado (4 a 8 ºC.

Res Publica Euroopas / Eiki Berg, Marko Mihkelson ; interv. Lauri Lugna

Index Scriptorium Estoniae

Berg, Eiki, 1970-

2003-01-01

Res Publica välispoliitika eksperdid Eiki Berg ja Marko Mihkelson vastavad küsimustele, mis käsitlevad Res Publica saamist Euroopa Rahvapartei (ERP) liikmeks, koostööd ERP-ga, EL-i põhiseaduslikku lepet

Investigation into metal contamination of the Berg River, Western ...

African Journals Online (AJOL)

The nitric acid digestion technique was used to extract metals from water, sediment and biofilm samples collected at various points (Site A . agricultural area, Site B . informal settlement and Site C . Newton pumping station) along the Berg River. Metal concentrations were determined using inductively coupled plasma atomic ...

A Dual Coding Theoretical Model of Decoding in Reading: Subsuming the LaBerge and Samuels Model

Science.gov (United States)

Sadoski, Mark; McTigue, Erin M.; Paivio, Allan

2012-01-01

In this article we present a detailed Dual Coding Theory (DCT) model of decoding. The DCT model reinterprets and subsumes The LaBerge and Samuels (1974) model of the reading process which has served well to account for decoding behaviors and the processes that underlie them. However, the LaBerge and Samuels model has had little to say about…

Avaliação fenotípica de características de frutos em duas famílias de meios-irmãos de goiabeira-serrana (Acca sellowiana Berg. de um pomar comercial em São Joaquim, SC Phenotypic evaluation of fruit traits of two half sib families of feijoa (Acca sellowiana Berg. from an orchard in São Joaquim, Santa Catarina

Directory of Open Access Journals (Sweden)

Juliana Degenhardt

2003-12-01

Full Text Available Frutos de um pomar comercial composto por progênies de duas plantas matrizes foram avaliados, com o objetivo de caracterizar a variabilidade fenotípica. As características peso de fruto, diâmetro e sólidos solúveis totais apresentaram diferenças estatísticas significativas entre as médias de famílias em pelo menos dois dos anos avaliados, enquanto para comprimento e rendimento de polpa a diferença não foi significativa. Houve diferença significativa entre médias de anos, dentro de cada família, para todas as características, com exceção das médias de peso de fruto entre 1998 e 1999 nas duas famílias e as médias de sólidos solúveis totais entre 1998 e 1999 em uma família e entre 1999 e 2000 na outra família. As correlações e regressões entre características produtivas mais relevantes foram obtidas entre peso de fruto e peso de casca, peso de fruto e comprimento, peso de fruto e diâmetro, peso de casca e comprimento, peso de casca e diâmetro e comprimento e diâmetro.Fruits of a commercial orchard originated by seedlings from two plants were evaluated, with the objective to characterize the phenotypic variation. Statistical differences were found among family means in at least two years for fruit diameter and solids soluble contents, but not for fruit length and pulp revenue. There were statistically significant differences in means among year means, within each family, for all the fruits traits, except for fruit weight between 1998 and 1999 in both families, and for soluble solids contents between 1998 and 1999 for family 1 and between 1999 and 2000 for the other family. The most important correlations and regressions among productive traits were obtained among fruit weight and peel weight, fruit weight and length, fruit weight and diameter, peel weight and length, peel weight and diameter and length and diameter.

Comparison of the Berg Balance Scale and Fullerton Advanced Balance Scale to predict falls in community-dwelling adults.

Science.gov (United States)

Jeon, Yong-Jin; Kim, Gyoung-Mo

2017-02-01

[Purpose] The purpose of this study was to investigate and compare the predictive properties of Berg Balance Scale and Fullerton Advanced Balance Scales, in a group of independently-functioning community dwelling older adults. [Subjects and Methods] Ninety-seven community-dwelling older adults (male=39, female=58) who were capable of walking independently on assessment were included in this study. A binary logistic regression analysis of the Berg Balance Scale and Fullerton Advanced Balance Scale scores was used to investigate a predictive model for fall risk. A receiver operating characteristic analysis was conducted for each, to determine the cut-off for optimal levels of sensitivity and specificity. [Results] The overall prediction success rate was 89.7%; the total Berg Balance Scale and Fullerton Advanced Balance Scale scores were significant in predicting fall risk. Receiver operating characteristic analysis determined that a cut-off score of 40 out of 56 on the Berg Balance Scale produced the highest sensitivity (0.82) and specificity (0.67), and a cut-off score of 22 out of 40 on the Fullerton Advanced Balance Scale produced the highest sensitivity (0.85) and specificity (0.65) in predicting faller status. [Conclusion] The Berg Balance Scale and Fullerton Advanced Balance Scales can predict fall risk, when used for independently-functioning community-dwelling older adults.

Caracterização farmacognóstica dos frutos de Cordia sellowiana Cham. e de Cordia myxa L. (Boraginaceae Jussieu)

OpenAIRE

Barroso,Isabel Cristina Ercolini; Oliveira,Fernando de

2009-01-01

Os frutos de Cordia sellowiana Cham. e Cordia myxa L. utilizados como emolientes demulcentes, béquicos e expectorantes foram estudados morfológico-anatomicamente, visando sua caracterização farmacognóstica. Foram fornecidos subsídios à identificação destes órgãos vegetais no estado natural e quando transformados em droga. A abordagem fitoquímica realizada permitiu por em evidência a presença de alcalóides, flavonóides, taninos e mucilagens. Em decorrência da presença de mucilagens, foi determ...

Germination of Aechmea nudicaulis (L.) Griseb. (Bromeliaceae) in different substracts as alternatives to Dicksonia sellowiana Hook - DOI: 10.4025/actasciagron.v30i1.1134

OpenAIRE

Anacleto, Adilson; UFPR; Negrelle, Raquel Rejane Bonato; UFPR; Koehler, Henrique Soares; UFPR

2008-01-01

For this study, the germination of Aechmea nudicaulis (L.) Griseb. (Bromeliaceae) was evaluated. Production attempts from seeds for this species have taken place in an empirical form, using substrate based on xaxim (Dicksonia sellowiana Hook.) powder, the use of which is currently restricted, as it is an endangered species. Five easily accessible alternative substratum were tested: worm humus, sand, coconut shell fiber, forest litter, and Plantmax®. The experiment was conducted using a comple...

Comparação do risco de queda em idosos sedentários e ativos por meio da escala de equilíbrio de Berg Comparison of fall risk between sedentary and active aged by means of the Berg balance scale

Directory of Open Access Journals (Sweden)

Renata Martins Pimentel

2009-03-01

Full Text Available O envelhecimento da população é um fenômeno mundial, do qual o Brasil apresenta um dos mais agudos processos. A prática regular de exercícios por idosos pode melhorar a capacidade física, proporcionar ganho de auto-estima e confiança, contribuindo para diminuição do risco de quedas, comuns em idosos. Este estudo visou comparar o risco de quedas entre idosos sedentários e ativos, verificando como a prática de exercício físico se reflete no desempenho dos sujeitos na escala de Berg. Foram avaliados por esse instrumento 70 idosos, divididos em 2 grupos: sedentários (n=35 e ativos (n=35. Os escores médios na escala de Berg dos grupos sedentário e ativo foram 47,7±5,6 pontos e 53,6±3,7, respectivamente (pPopulation aging is a worldwide phenomenon which is particularly acute in Brazil. Regular physical exercise by the aged may improve physical capacity, provide gains in self-esteem and confidence, and contribute to reducing the number of falls, which are common among the elderly. This study aimed at comparing fall risk between sedentary and active elderly subjects, by assessing how the regular practice of physical exercises is reflected by subjects' performance at the Berg balance scale. Seventy elderly subjects were divided into 2 groups, sedentary (n=35 and active (n=35, and submitted to the Berg test. The sedentary group mean score at the Berg scale was 47.7±5.6, and the active groups', 53.6±3.7 (p<0.0001. The odds ratio analysis showed that fall risk was 15.6 times higher for the sedentary group as compared to the active group (p=0.002. Since the performance of the sedentary group at the Berg scale was worse than the active group's, it may be said that regular practice of physical activities affects such performance, and that physically active subjects present less fall risk than sedentary ones.

Comparison of the Berg Balance Scale and Fullerton Advanced Balance Scale to predict falls in community-dwelling adults

OpenAIRE

Jeon, Yong-Jin; Kim, Gyoung-Mo

2017-01-01

[Purpose] The purpose of this study was to investigate and compare the predictive properties of Berg Balance Scale and Fullerton Advanced Balance Scales, in a group of independently-functioning community dwelling older adults. [Subjects and Methods] Ninety-seven community-dwelling older adults (male=39, female=58) who were capable of walking independently on assessment were included in this study. A binary logistic regression analysis of the Berg Balance Scale and Fullerton Advanced Balance S...

Johannes van den Berg, Constrained by Jesus' Love. An Inquiry into ...

African Journals Online (AJOL)

Johannes van den Berg, Constrained by Jesus' Love. An Inquiry into the Motives of the missionary Awakening in Qreat Britain in the Period between 1698 and 1815, J. H. Kok, N.V., Kampen, 1956. P.S Dreyer. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT ...

The fish community of the Berg River estuary and an assessment of ...

African Journals Online (AJOL)

Zoology Department and Marine Biology Research Institute, University of Cape Town, Rondebosch, 7700. Republic of South Africa. Received I May 1993; accepted 6 October /993. Data concerning the species composition, abundance and distribution of fishes inhab~ing the Berg River estuary are presented and used to ...

Tam tam in de polder: uitbreiding Afrikamuseum Berg en Dal door Rijksgebouwdienst

NARCIS (Netherlands)

Voorthuis, J.C.T.

2006-01-01

Op 27 mei dit jaar is in het glooiende boslandschap van Berg en Dal, vlak bij Nijmegen, de nieuwe uitbreiding van het Afrika Museum geopend. Het ontwerp is in vele opzichten voorbeeldig. Het stelt zich terughoudend op ten aanzien van zowel de schitterende omgeving als het doel - het tentoonstellen

Path analysis for selection of feijoa with greater pulp weight

Directory of Open Access Journals (Sweden)

Joel Donazzolo

Full Text Available ABSTRACT: The objective of this paper was to identify the direct and indirect effects of feijoa fruits (Acca sellowiana traitson pulp weight, in order to use these traits in indirect genotypes selection. Fruits of five feijoa plants were collected in Rio Grande do Sul, in the years of 2009, 2010 and 2011. Six traits were evaluated: diameter, length, total weight, pulp weight, peel thickness and number of seeds per fruit. In the path analysis, with or without ridge regression, pulp weight was considered as the basic variable, and the other traits were considered as explanatory variables. Total weight and fruit diameter had high direct effect, and are the main traits associated with pulp weight. These traits may serve as criteria for indirect selection to increase feijoa pulp weight, since they are easy to be measured.

The type-material of Arctiinae (Lepidoptera, Erebidae) described by Burmeister and Berg in the collection of the Museo Argentino de Ciencias Naturales Bernardino Rivadavia (Buenos Aires, Argentina)

Science.gov (United States)

Beccacece, Hernán M.; Vincent, Benoit; Navarro, Fernando R.

2014-01-01

Abstract Carlos G. Burmeister and Carlos Berg were among the most important and influential naturalists and zoologists in Argentina and South America and described 241 species and 34 genera of Lepidoptera. The Museo Argentino de Ciencias Naturales Bernardino Rivadavia (MACN) housed some of the Lepidoptera type specimens of these authors. In this study we present a catalogue with complete information and photographs of 11 Burmeister type specimens and 10 Berg type specimens of Phaegopterina, Arctiina and Pericopina (Lepidoptera, Erebidae, Arctiinae, Arctiini) housed in the MACN. Lectotypes or holotypes were designated where primary type specimens could be recognized; in some cases we were not able to recognize types. The catalogue also proposes nomenclatural changes and new synonymies: Opharus picturata (Burmeister, 1878), comb. n.; Opharus brunnea Gaede, 1923: 7, syn. n.; Hypocrisias jonesi (Schaus, 1894), syn. n.; Leucanopsis infucata (Berg, 1882), stat. rev.; Paracles argentina (Berg, 1877), sp. rev.; Paracles uruguayensis (Berg, 1886), sp. rev. PMID:25061380

The type-material of Arctiinae (Lepidoptera, Erebidae) described by Burmeister and Berg in the collection of the Museo Argentino de Ciencias Naturales Bernardino Rivadavia (Buenos Aires, Argentina).

Science.gov (United States)

Beccacece, Hernán M; Vincent, Benoit; Navarro, Fernando R

2014-01-01

Carlos G. Burmeister and Carlos Berg were among the most important and influential naturalists and zoologists in Argentina and South America and described 241 species and 34 genera of Lepidoptera. The Museo Argentino de Ciencias Naturales Bernardino Rivadavia (MACN) housed some of the Lepidoptera type specimens of these authors. In this study we present a catalogue with complete information and photographs of 11 Burmeister type specimens and 10 Berg type specimens of Phaegopterina, Arctiina and Pericopina (Lepidoptera, Erebidae, Arctiinae, Arctiini) housed in the MACN. Lectotypes or holotypes were designated where primary type specimens could be recognized; in some cases we were not able to recognize types. The catalogue also proposes nomenclatural changes and new synonymies: Opharus picturata (Burmeister, 1878), comb. n.; Opharus brunnea Gaede, 1923: 7, syn. n.; Hypocrisias jonesi (Schaus, 1894), syn. n.; Leucanopsis infucata (Berg, 1882), stat. rev.; Paracles argentina (Berg, 1877), sp. rev.; Paracles uruguayensis (Berg, 1886), sp. rev.

'Welzijnsvloer verdient zich op den duur terug'; van den Berg beproeft de groene vlag roostervloer

NARCIS (Netherlands)

Anoniem,

2010-01-01

Het onderzoek van Wageningen UR naar de welzijnsvloeren is nog in volle gang. Maar vleeskalverhouder Wijnand van den Berg uit Kootwijkerbroek heeft op eigen initiatief al een welzijnsrooster in zijn stal op proef

Spectral matching techniques (SMTs) and automated cropland classification algorithms (ACCAs) for mapping croplands of Australia using MODIS 250-m time-series (2000–2015) data

Science.gov (United States)

Teluguntla, Pardhasaradhi G.; Thenkabail, Prasad S.; Xiong, Jun N.; Gumma, Murali Krishna; Congalton, Russell G.; Oliphant, Adam; Poehnelt, Justin; Yadav, Kamini; Rao, Mahesh N.; Massey, Richard

2017-01-01

Mapping croplands, including fallow areas, are an important measure to determine the quantity of food that is produced, where they are produced, and when they are produced (e.g. seasonality). Furthermore, croplands are known as water guzzlers by consuming anywhere between 70% and 90% of all human water use globally. Given these facts and the increase in global population to nearly 10 billion by the year 2050, the need for routine, rapid, and automated cropland mapping year-after-year and/or season-after-season is of great importance. The overarching goal of this study was to generate standard and routine cropland products, year-after-year, over very large areas through the use of two novel methods: (a) quantitative spectral matching techniques (QSMTs) applied at continental level and (b) rule-based Automated Cropland Classification Algorithm (ACCA) with the ability to hind-cast, now-cast, and future-cast. Australia was chosen for the study given its extensive croplands, rich history of agriculture, and yet nonexistent routine yearly generated cropland products using multi-temporal remote sensing. This research produced three distinct cropland products using Moderate Resolution Imaging Spectroradiometer (MODIS) 250-m normalized difference vegetation index 16-day composite time-series data for 16 years: 2000 through 2015. The products consisted of: (1) cropland extent/areas versus cropland fallow areas, (2) irrigated versus rainfed croplands, and (3) cropping intensities: single, double, and continuous cropping. An accurate reference cropland product (RCP) for the year 2014 (RCP2014) produced using QSMT was used as a knowledge base to train and develop the ACCA algorithm that was then applied to the MODIS time-series data for the years 2000–2015. A comparison between the ACCA-derived cropland products (ACPs) for the year 2014 (ACP2014) versus RCP2014 provided an overall agreement of 89.4% (kappa = 0.814) with six classes: (a) producer’s accuracies varying

The Influence of Fluctuating Temperature on Megamelus scutellaris Berg (Hemiptera: Delphacidae)

Science.gov (United States)

2017-07-01

scutellaris Berg (waterhyacinth planthopper), a biological control agent released for the management of Eichhornia crassipes (Mart. Solms). This...2004). Four insect biological control agents have been released in the U.S. for the management of waterhyacinth (Tipping et al. 2014a; Center et al...leads to a lowered predicted canopy temperature of 26° C. In contrast , early season releases of planthoppers should be timed so that they are not

Synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid vinyl-ACCA) derivatives: key intermediates for the preparation of inhibitors of the hepatitis C virus NS3 protease.

Science.gov (United States)

Beaulieu, Pierre L; Gillard, James; Bailey, Murray D; Boucher, Colette; Duceppe, Jean-Simon; Simoneau, Bruno; Wang, Xiao-Jun; Zhang, Li; Grozinger, Karl; Houpis, Ioannis; Farina, Vittorio; Heimroth, Heidi; Krueger, Thomas; Schnaubelt, Jürgen

2005-07-22

(1R,2S)-1-Amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is a key building block in the synthesis of potent inhibitors of the hepatitis C virus NS3 protease such as BILN 2061, which was recently shown to dramatically reduce viral load after administration to patients infected with HCV genotype 1. We have developed a scalable process that delivers derivatives of this unusual amino acid in >99% ee. The strategy was based on the dialkylation of a glycine Schiff base using trans-1,4-dibromo-2-butene as an electrophile to produce racemic vinyl-ACCA, which was subsequently resolved using a readily available, inexpensive esterase enzyme (Alcalase 2.4L). Factors that affect diastereoselection in the initial dialkylation steps were examined and the conditions optimized to deliver the desired diastereomer selectively. Product inhibition, which was encountered during the enzymatic resolution step, initially resulted in prolonged cycle times. Enrichment of racemic vinyl-ACCA through a chemical resolution via diastereomeric salt formation or the use of forcing conditions in the enzymatic reaction both led to improvements in throughput and the development of a viable process. The chemistry described herein was scaled up to produce multikilogram quantities of this building block.

FIRST RECORD OF Alburnusatropatenae (BERG,1925) (CYPRINIDAE) IN NAMAK BASIN, CENTRAL IRAN

OpenAIRE

Khataminejad, Somaye; Mousavi-Sabet, Hamed; Sattari, Masud; Vatandoust, Saber

2013-01-01

AlburnusatropatenaeBerg, 1925 is reported for the first time from the River Ghareh-Chay in the Namak basin, central Iran. Previously, this species has onlybeen reported from the LakeOrumiyeh basin, in northwest Iran. In this report twenty-nine specimens were caught on 8 August 2012. Morphometric and meristic characteristics of the specimens were similar to those reported elsewhere for the species.

Validity of the modified Berg Balance Scale in adults with intellectual and visual disabilities

NARCIS (Netherlands)

Dijkhuizen, Annemarie; Krijnen, Wim P; van der Schans, Cees; Waninge, Aly

BACKGROUND: A modified version of the Berg Balance Scale (mBBS) was developed for individuals with intellectual and visual disabilities (IVD). However, the concurrent and predictive validity has not yet been determined. AIM: The purpose of the current study was to evaluate the concurrent and

Validity of the modified Berg Balance Scale in adults with intellectual and visual disabilities

NARCIS (Netherlands)

Dijkhuizen, Annemarie; Krijnen, Wim P.; van der Schans, Cees P.; Waninge, Aly

Background: A modified version of the Berg Balance Scale (mBBS) was developed for individuals with intellectual and visual disabilities (IVD). However, the concurrent and predictive validity has not yet been determined. Aim: The purpose of the current study was to evaluate the concurrent and

Moscas frugívoras e seus parasitoides nos municípios de Pelotas e Capão do Leão, Rio Grande do Sul, Brasil Frugivorous flies and their parasitoids in the cities of Pelotas and Capão do Leão, Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Adrise Medeiros Nunes

2012-01-01

Full Text Available As moscas frugívoras (Tephritoidea são as principais pragas da fruticultura de clima temperado no Brasil. O objetivo do presente trabalho foi avaliar a infestação desses dípteros e a ocorrência de seus parasitoides em frutíferas nos municípios de Pelotas e Capão do Leão, localizados na região Sul, nas safras agrícolas de 2007/08 e 2008/09. Foram coletados frutos de araçazeiro-amarelo e vermelho (Psidium cattleianum Sabine, 1821, butiazeiro [Butia capitata (Mart. Becc., 1916], caquizeiro (Diospyros kaki Linnaeus, 1753, cerejeira-do-mato (Eugenia involucrata DC., 1828, goiabeira [Psidium guajava (Linnaeus, 1753], goiabeira-serrana [Acca sellowiana (Berg. Burret, 1941], nespereira [Eriobotrya japonica (Thunb. Lindley, 1822], pessegueiro [Prunus persicae (L. Batsch, 1801], pitangueira (Eugenia uniflora Linnaeus,1753 e uvalheira (Eugenia pyriformis Cambessèdes, 1832. Os frutos foram coletados e transportados para o laboratório, onde foram individualizados e determinados os seguintes parâmetros: índice de infestação das moscas, índice de parasitismo e frequência de indivíduos por espécie de parasitoide. Foram constatadas duas espécies de Tephritidae, Anastrepha fraterculus (Wiedemann, 1830 (90,5% e Ceratitis capitata (Wiedemann, 1824 (9,5% e duas de Lonchaeidae, Neosilba zadolicha McAlpine & Steyskal, 1982 (87,8% e uma espécie ainda não descrita, referida como Neosilba n. sp. 3 (12,2%. Anastrepha fraterculus é a espécie mais abundante nos dois municípios, sendo constatada na maioria das frutíferas coletadas. Caquizeiro e goiabeira foram os hospedeiros que apresentaram o maior índice de infestação por C. capitata. Quanto às espécies de Neosilba, a maior infestação ocorreu em frutos de goiabeira-serrana. Dos parasitoides emergidos, foram identificadas três espécies, sendo duas de Braconidae, Doryctobracon areolatus (Szépligeti, 1911 (52,6% e Opius bellus (Gahan, 1930 (27,5% e uma espécie de Figitidae, Aganaspis

Feasibility and outcomes of the Berg Balance Scale in older adults with intellectual disabilities

NARCIS (Netherlands)

Oppewal, Alyt; Hilgenkamp, Thessa I. M.; van Wijck, Ruud; Evenhuis, Heleen M.

High incidence of falls and increased risk of fall-related injuries are seen in individuals with intellectual disabilities (ID). The Berg Balance Scale (BBS) is a reliable instrument for balance assessment in the population of (older) adults with ID. The aims of this study were to assess the balance

Best Value Acquisition Symposium and Continuous Acquisition and Life Cycle Support (CALS) Update Held in Eatontown, New Jersey on November 17-18, 1993

Science.gov (United States)

1993-11-18

Satellite Commications/Milstar AMSEL- ACCA -A-AE Fort Mcimicth, New Jersey 07703 (908) 532-5486 MR. ROGER S. BERGE HQ, US Amy Ccauunicaticns-Electranics...o 0 0m IL W 0 0 2o Z 0 x0 0~LI 0i- 1 0 F8 20 (A ZI-m 0. WO 0 L 0>11 Z 0 0 A ’o m0J X I-z 4wE 0z. z 0OOL~( WZZ c Wx1>- MiAi Oz OMOXzO ILCl) 0>M CO)( 0

Desenvolvimento gametofítico e estudo de diferentes níveis de luz no crescimento de plântulas de Dicksonia sellowiana (PRESL) Hook. (pteridófita-dicksoniaceae)

OpenAIRE

Suzuki, Cláudia Cristina Leite Fiori

2003-01-01

Dissertação ( mestrado) - Universidade Federal de Santa Catarina, Centro de Ciências Biológicas. Programa de Pós-Graduação em Biologia Vegetal. Dicksonia sellowiana (Presl.) Hook (Dicksoniaceae), popularmente conhecida como xaxim, é uma importante espécie de pteridófita arbórea que pode ser encontrada na Floresta Ombrófila Densa e que há anos vem sendo explorada para fins comerciais. A exploração aliada a seu desenvolvimento lento tem sido um agravante para esta espécie

New natural products from Siphoneugena densiflora Berg (Myrtaceae) and their chemotaxonomic significance

Energy Technology Data Exchange (ETDEWEB)

Gallo, Margareth B.C.; Silva, Fernando C. da; Vieira, Paulo C.; Fernandes, Joao B.; Silva, Maria Fatima das G.F. da [Sao Carlos Univ., SP (Brazil). Dept. de Quimica]. E-mail: marejor@uol.com.br

2006-03-15

Siphoneugena Berg (Myrtaceae) is a small eugenioid genus segregated from Eugenia by Berg. The phytochemical survey of Siphoneugena densiflora was carried out in order to find secondary metabolites which may be considered as chemotaxonomic characters and help to distinguish between the two genera. Five novel hydrolyzable tannins were isolated from the methanolic extract of root bark and were characterized as ellagic acid 4-O-{alpha}-L-2-O- and its isomer 4-O-{alpha}-L-3-O-acetylrhamnopyranoside, siphoneugenin, that supports a new aglycone with a dibenzo-1,4-dioxin structure, 3,4'-di-O-methylellagic acid 4-O-{beta}-D-6-O- and 4-O-{beta}- D-3,6-diacetyl glucopyranoside, accompanied by ellagic acid 4-O-{alpha}-L-4-O-acetylrhamnopyranoside, eschweilenol C, sitosterol, daucosterol, rhamnose, casuarinin, castalagin, ellagic, gallic and syringic acids. From methanolic extract of leaves, in addition to the well known compounds quercetin, quercitrin, guiajaverin, reynoutrin, chebuloside II, terminolic, madecassic and asiatic acids, lupeol, {alpha}- and {beta}-amyrin, a new pentacyclic triterpene was isolated and named as {beta}-D-glucopyranosyl-2{alpha},3{beta},6{beta}-trihydroxyolean-12-en-28-ate. Structures were established on the basis of spectroscopic and chemical evidence, along with the comparison of the data reported in the literature. (author)

Water sampling at the Berge Helene FPSO at Chinguetti field in Mauritania using passive samplers

NARCIS (Netherlands)

Korytar, P.; Galien, van der W.

2007-01-01

Three rounds of water sampling were performed at the Berge Helene FPSO at the Chinguetti field in Mauritania using passive samplers attached to the FPSO to determine the levels of contamination that could potentially accumulate in organisms. Two rounds were carried out prior to the commencement of

FIRST RECORD OF Alburnus atropatenae (BERG, 1925 (CYPRINIDAE IN NAMAK BASIN, CENTRAL IRAN

Directory of Open Access Journals (Sweden)

Somaye Khataminejad

2013-01-01

Full Text Available Alburnus atropatenae Berg, 1925 is reported for the first time from the River Ghareh-Chay in the Namak basin, central Iran. Previously, this species has only been reported from the Lake Orumiyeh basin, in northwest Iran. In this report twenty-nine specimens were caught on 8 August 2012. Morphometric and meristic characteristics of the specimens were similar to those reported elsewhere for the species.

FIRST RECORD OF Alburnus atropatenae (BERG, 1925) (CYPRINIDAE) IN NAMAK BASIN, CENTRAL IRAN

OpenAIRE

Somaye Khataminejad; Hamed Mousavi-Sabet; Masud Sattari; Saber Vatandoust

2013-01-01

Alburnus atropatenae Berg, 1925 is reported for the first time from the River Ghareh-Chay in the Namak basin, central Iran. Previously, this species has only been reported from the Lake Orumiyeh basin, in northwest Iran. In this report twenty-nine specimens were caught on 8 August 2012. Morphometric and meristic characteristics of the specimens were similar to those reported elsewhere for the species.

POSTHARVEST QUALITY OF FEIJOA FLOWERS TREATED WITH DIFFERENT PRESERVATIVE SOLUTIONS AND 1-METHYLCYCLOPROPENE

Directory of Open Access Journals (Sweden)

ALEXANDRA GOEDE DE SOUZA

Full Text Available ABSTRACT This study was carried out to assess the postharvest quality preservation of feijoa(Acca sellowiana Berg flowers in response to treatments with different preservative solutions and 1-methylcyclopropene (1-MCP. Recently opened feijoa flowers were harvested in the morning (between 8h and 10h and immediately after pulsed with preservative solutions of salicylic acid, ascorbic acid and sucrose, all at doses of 0 (control, 2, 5 or 10%, and treated with 1-MCP at doses of 0 (control, 250, 500 or 1,000 nL L-1. Each trial with preservative solutions or 1-MCP treatment was a distinct experiment conducted in a completely randomized design with four replicates, each replicate with four flowers. After the treatment, the flowers were stored for 12 days at 10±1 oC and 85±5% RH. At every two-days intervals the flower petals were visually evaluated for wilting and darkening according to a hedonic scale varying from 1 (less intense to 5 (more intense. Petal color was ranked from 1 (intense pink to 5 (white. The 1-MCP at 500 nL L-1 and the salicylic acid (regardless of the dose delayed the changes of petal color for up to eight and six days of storage, respectively. Flowers treated with salicylic acid, 1-MCP or ascorbic acid had a more substantial delay in petal wilting. Flowers treated with salicylic acid had wilting rank of 2 after six days of storage when treated with doses of 5% or 10%, and after eight days when treated with the dose of 2%, while flowers treated with 1-MCP at 500 and 1,000 nL L-1 and ascorbic acid at 2% and 5% had wilting rank of 2 after four days of storage. The most substantial delay of petal darkening (until the fourth day of storage was achieved with 1-MCP at 500 nL L-1.

Variability in the germination of spores among and within natural populations of the endangered tree fern Dicksonia sellowiana Hook. (Xaxim

Directory of Open Access Journals (Sweden)

Gabriela Schmitz Gomes

2006-01-01

Full Text Available The objective of this study was to analyze the existing variability in the germination of individuals' spores collected from two natural populations of Dicksonia sellowiana in southern Brazil. The largest intrapopulational variation was observed for the spores germination. These results suggested the existence of adaptative strategies that favored the gradual and continuous entrance of new individuals into the gametophytic population. The behavior of the individuals of the species within each population followed a similar pattern of initial development, in spite of conspicuous differences in the population structure. This showed a low differentiation between the populations and the existence of adaptative strategies which were common to both communities.O Xaxim (Dicksonia sellowiana Hook. (Dicksoniaceae é uma samambaia arborescente que se encontra principalmente sob o domínio da Floresta Ombrófila Mista. A exploração intensiva de seus indivíduos para retirada do caule, empregado na fabricação de vasos e substrato para o cultivo de plantas ornamentais, e a crescente antropização das áreas florestadas, tem degradado suas populações naturais. Este estudo teve como objetivo analisar a variabilidade existente na germinação de esporos de Xaxim. Os esporos foram coletados das frondes de indivíduos de Xaxim procedentes de duas populações naturais do Sul do Brasil. Foi observada uma maior variação intrapopulacional para a germinação e porcentagem de esporos inviáveis. Estes resultados sugerem a existência de estratégias adaptativas que favorecem a entrada gradual e contínua de novos indivíduos na população de gametófitos. O comportamento dos indivíduos da espécie dentro de cada população segue padrão semelhante de velocidade de desenvolvimento inicial, a despeito das diferenças conspícuas na estrutura populacional, sugerindo baixa diferenciação entre as populações e a existência de estratégias adaptativas comuns

Management of human-induced salinization in the Berg River catchment (South Africa)

CSIR Research Space (South Africa)

Jovanovic, Nebojsa

2010-09-01

Full Text Available Impacts on Salinity in Western Cape Waters. Water Research Commission Report No. K5/1503, Pretoria, South Africa. In press. Figure 1: Location and 20 m Digital Elevation Model of the Berg River basin. The red square indicates the approximate position..., and German Federal Ministry for Education and Research (BMBF) for funding, SA Rock Drill, Caren Jarmain (University of KwaZulu Natal), University of the Western Cape, farmers, United States Geological Survey Historic land uses: ?Pre-1700 savanna, nomadic...

Efeito de anos e determinação do coeficiente de repetibilidade de características de frutos de goiabeira-serrana

Directory of Open Access Journals (Sweden)

Degenhardt Juliana

2002-01-01

Full Text Available A variância ambiental costuma ser bastante significativa em características de produção e de frutos, a maioria de herança quantitativa. Este estudo teve por objetivo avaliar o efeito de anos e determinar o número de anos necessários para avaliação precisa do peso do fruto, peso de casca, comprimento, diâmetro, relação comprimento/diâmetro, rendimento de polpa e sólidos solúveis totais dos frutos de goiabeira-serrana (Acca sellowiana, em três anos de avaliação. Com exceção de sólidos solúveis totais, o efeito de anos representou grande parte da variância total. A partir do coeficiente de repetibilidade, determinou-se que seriam necessários no mínimo de quatro a seis anos de avaliação para seleção das plantas, com precisão de 80%.

[Abundances of ammonia-oxidizing archaeal accA and amoA genes in response to NO2 - and NO3 - of hot springs in Yunnan province].

Science.gov (United States)

Song, Zhaoqi; Wang, Li; Zhou, Enmin; Wang, Fengping; Xiao, Xiang; Zhang, Chuanlun; Li, Wenjun

2014-12-04

Yunnan hot springs have highly diverseammonia-oxidizing archaea (AOA), which are autotrophic and can fix CO2 using the 3-hydroxypropionate/ 4-hydroxybutyrate (HP/HD) pathway. In this study, we investigated the abundances of prokaryotic 16S rRNA gene and archaeal accA and amoA genes in the sediments of hot springs of Yunnan Province, and analysed the correlations between the above gene abundances and environmental factors. We selected the sediments of twenty representative hot springs, and detected the gene abundances by quantitative polymerase chain reaction (qPCR). The principal component analysis (PCA) and the Mantel test in the R software package were performed for the correlations of gene abundance and environmental variables. The bacterial and archaeal 16S rRNA gene abundances were from 6.6 x 10(7) to 4.19 x 10(11) and from 1.27 x 10(6) to 1.51 x 10(11) copies/g sediment, respectively; Archaeal accA and amoA genes were from 8.89 x 10(3) to 6.49 x 10(5) and from 7.64 x 10(3) to 4.36 x 10(5) copies/g sediment, respectively. The results of mantel test showed that accA gene was significantly (R = 0.98, P < 0.001) correlated with amoA gene; Both of them also were correlated significantly with NO2- and NO3 -, but not with pH. The abundances of bacterial and archaeal 16S rRNA genes and the ratio between them varied significantly among Yunnan hot springs. The archaealaccA and amoA genes showed significant correlation with each other, validating our previous finding that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

Feasibility and reliability of the modified berg balance scale in persons with severe intellectual and visual disabilities

NARCIS (Netherlands)

Waninge, Aly; van Wijck, R.; Steenbergen, B.; van der Schans, Cees

2011-01-01

Background: The purpose of this study was to determine the feasibility and reliability of the modified Berg Balance Scale (mBBS) in persons with severe intellectual and visual disabilities (severe multiple disabilities, SMD) assigned Gross Motor Function Classification System (GMFCS) grades I and

A man from Bendery: L.S. Berg as geographer and loess scholar

OpenAIRE

Smalley, Ian; Markovic, Slobodan; O’Hara-Dhand, Ken; Wynn, Peter

2010-01-01

Lev Semenovich Berg was born in Bendery, in Moldova. He had great success as an ichthyologist and geographer; he also proposed, in 1916, an interesting theory of loess formation. As a biologist he was persecuted by Lysenko and the Soviet state in the time of pseudo-science in the 1930s and 1940s. Despite his being persecuted, the loess theory became, in effect, the official Soviet theory of loess formation. This theory had to be compatible with his ‘landscape’ theory which did not...

Feasibility and reliability of the modified Berg Balance Scale in persons with severe intellectual and visual disabilities

NARCIS (Netherlands)

Waninge, A.; van Wijck, R.; Steenbergen, B.; van der Schans, C. P.

Background The purpose of this study was to determine the feasibility and reliability of the modified Berg Balance Scale (mBBS) in persons with severe intellectual and visual disabilities (severe multiple disabilities, SMD) assigned Gross Motor Function Classification System (GMFCS) grades I and II.

Walking ability in patients with glioblastoma: prognostic value of the Berg Balance Scale and the 10 meter walk test.

Science.gov (United States)

Liljehult, Monique Mesot; Buus, Lise; Liljehult, Jacob; Rasmussen, Birthe Krogh

2017-11-01

Primary brain tumors frequently cause considerable functional impairments and the survival time when diagnosed with glioblastoma is 14.6 months. The aim of this study was to examine if baseline postural control and walking ability in patients with glioblastoma could predict long term walking ability and 1 year mortality. Data were gathered from prospective recordings in a brain cancer database supplemented by retrospective review of electronic patient records. We included 109 patients with glioblastoma, 47 women and 62 men with mean age 65 years. At admission 84 patients were tested with Berg Balance Scale and 57 were tested with 10 meter walk test. Binary logistic regression analysis showed no statistical significance in favour of the 10 meter walk test. Berg Balance Scale showed an ability to predict walking ability 4-8 months after admission. The risk of dying within a year was 6.9 times higher in patients who lost their ability to walk within 4-8 months of the first admission. This study showed that Berg Balance Scale has some ability to predict the loss of walking ability 4-8 months after admission. This could be an important indicator pin pointing patients most in need of more intensive specialized neurorehabilitation efforts early in the disease course.

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

Science.gov (United States)

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

Evaluation of the detachment energy of hydrated phosphate anion over a wide range of cluster size and revisiting solvent-berg model: a theoretical study

Science.gov (United States)

Pathak, Arup Kumar

2014-12-01

An explicit analytical expression has been obtained for vertical detachment energy (VDE) that can be used to calculate the same over a wide range (both stable and unstable regions) of cluster sizes including the bulk from the knowledge of VDE for a finite number of stable clusters (n = 16-23). The calculated VDE for the bulk is found to be very good in agreement (within 1%) with the available experimental result and the domain of instability lies between n = 0 and n = 15 for the hydrated clusters, PO3 -4 . nH2O. The minimum number (n0) of water molecules needed to stabilise the phosphate anion is 16. We are able to explain the origin of solvent-berg model and anomalous conductivity from the knowledge of first stable cluster. We have also provided a scheme to calculate the radius of the solvent-berg for phosphate anion. The calculated conductivity using Stokes-Einstein relation and the radius of solvent-berg is found to be very good in agreement (within 4%) with the available experimental results.

Heterologous co-expression of accA, fabD, and thioesterase genes for improving long-chain fatty acid production in Pseudomonas aeruginosa and Escherichia coli.

Science.gov (United States)

Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon

2012-05-01

The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.

Raissa L. Berg's contributions to the study of phenotypic integration, with a professional biographical sketch.

Science.gov (United States)

Conner, Jeffrey K; Lande, Russell

2014-08-19

Raissa L. Berg had a remarkable career in many respects and an impact on the study of phenotypic integration that continues to increase over 50 years after the publication of her seminal paper in that area. She was born and lived most of her life in Russia, with most of her research focused on measuring spontaneous mutation rates in Drosophila. She was forced to abandon this work during the height of Lysenko's power in Russia, so she turned temporarily to the study of correlation patterns in plants; ironically, this work has had a more enduring impact than her main body of research. She showed that floral and vegetative traits become decoupled into separate correlation 'pleiades' in plants with specialized pollinators, but floral and vegetative traits remain correlated in plants that have less specialized pollination. Unfortunately, her plant work is often mis-cited as providing evidence for increased correlations among floral traits due to selection by pollinators for functional integration, a point she never made and one that is not supported by her data. Still, many studies of correlation pleiades have been conducted in plants, with the results mostly supporting Berg's hypothesis, although more studies on species with generalized pollination are needed. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Black workers, typhoid fever and the construction of the Berg River – Saldanha military water pipeline, 1942 – 1943

Directory of Open Access Journals (Sweden)

Lieutenant Colonel GE (Deon Visser

2008-04-01

Full Text Available War creates a huge need for labour to support the war efforts of the belligerent parties. In South Africa tens of thousands of ‘non-white’ workers were mobilised during the Second World War to satisfy the Union Defence Force’s (UDF’s labour needs at home and abroad. This article, firstly, outlines the role of ‘non-white people’, particularly black Africans, in the UDF with special reference to those employed within the Union of South Africa. Secondly, it briefly delineates typhoid fever as an historical thorn in the flesh of military forces up to the early 20th century. It then looks briefly into the incidence of and perceptions on typhoid fever as a killer disease in South Africa on the eve of the Second World War. Against that background, the article investigates the employment of black workers on the construction of the Berg River-Saldanha Bay military water pipeline and the UDF’s response to the threat and subsequent outbreak of typhoid fever amongst the workers at the Berg River intake site in 1943. The article concludes that the public health authorities and UDF were aware of the threat of typhoid fever with regard to the Berg River water scheme, but did not take sufficient precautionary measures, which could have had serious repercussions for the Allied war effort. This incident should serve as a warning to the South African National Defence Force when deploying on peace support operations on the African continent where typhoid fever remains a serious threat next to Hiv/Aids.

Relationship between the Berg Balance Scale and Static Balance Test in Hemiplegic Patients with Stroke

OpenAIRE

Suzuki, Makoto; Fujisawa, Hiroyuki; Machida, Yooichiro; Minakata, Shin

2013-01-01

[Purpose] The purpose of this study was to analyze the relationship between results of the Berg Balance Scale (BBS) and Static Balance Test (SBT) in hemiplegic patients with stroke. [Subjects] The subjects were 39 hemiplegic patients (25 men, 14 women; mean age, 69.4 ? 11.0?years) with stroke that had occurred within the preceding 6 months and who had good understanding of verbal instructions. [Methods] The SBT consists of five posture-holding tasks (sitting, stride standing, close standing, ...

Avaliação do potencial antioxidante frente à oxidação lipídica e da toxicidade preliminar do extrato e frações obtidas das frondes de Dicksonia sellowiana (Presl.) Hook

OpenAIRE

OLIVEIRA,V. B.; ZUCHETTO,M.; PAULA,C. S.; VERDAM,M. C. S.; CAMPOS,R.; DUARTE,A. F. S.; MIGUEL,M. D.; MIGUEL,O. G.

2015-01-01

RESUMOA espécie Dicksonia sellowiana, conhecida popularmente como xaxim, é uma samambaia natural do continente americano e encontrada no Brasil na Mata Atlântica. Em 2001 foi inserida na lista do IBAMA como espécie ameaçada de extinção em decorrência da exploração para a confecção de vasos para a jardinagem. O presente trabalho descreve o potencial antioxidante lipídico (TBARS e Sistema β-caroteno/ácido linoleico) do extrato bruto e frações obtidos através de aparato de Soxhlet de fronde...

Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

Science.gov (United States)

Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

2002-07-01

The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

Estudo morfométrico do gênero Panstrongylus Berg, 1879 (Hemiptera, Reduviidae, Triatominae Morphometric study of the genus Panstrongylus Berg, 1879 (Hemiptera, Reduviidae, Triatominae

Directory of Open Access Journals (Sweden)

Carolina Magalhães dos Santos

2003-10-01

Full Text Available The subfamily Triatominae is actually represented by 137 species distributed among 6 tribes and 19 genera. Within this subfamily, the genus Panstrongylus, Berg 1879, is composed by 13 species widespread in sylvatic, peridomestic, and domestic habitats of Neotropical regions. These species are vectors of Chagas disease and consequently are found associated with its main hosts, such as birds and mammals. Interest in species of this genus has been increasing in the last few years. Reports of several authors indicate these Triatominae to invade and colonize houses, increasing their epidemiological significance. Morphometry was used in this study to investigate correlations among possible closely related species. We measured 224 specimens among 13 species through a set of metric variables of the head. The results indicated that the genus Panstrongylus seems to be homogeneous since 10 of the 14 species were shown to be closely related.

Anti-diabetic effects of Campomanesia xanthocarpa (Berg leaf decoction

Directory of Open Access Journals (Sweden)

Anapaula Sommer Vinagre

2010-06-01

Full Text Available The objective of this research was to identify the effects of 3-week treatment of normal and streptozotocin-induced diabetic rats using a leaf decoction of Campomanesia xanthocarpa Berg. (20 g/L on physiological, biochemical and histological parameters. Streptozotocin (STZ, 70 mg/kg in citrate buffer, pH 4.5 was administered IP to induce experimental diabetes one week prior to the treatment. STZ caused typical diabetic symptoms: polydypsia, polyuria, polyphagia, hyperglycemia, hypertriglyceridemia and histopathological modifications in the pancreas, liver and kidney. The treatment of diabetic rats using the decoction decreased blood glucose levels, inhibited hepatic glycogen loss, and prevented potential histopathological alterations in the pancreas and kidneys. No differences were found between the control rats treated with the decoction and the control rats maintained on water only. In conclusion, these results suggest that C. xanthocarpa leaf decoction (20g/L might be useful for diabetes mellitus management, but further pharmacological and toxicological studies are needed.O objetivo deste trabalho foi identificar os efeitos do tratamento com o decocto das folhas de Campomanesia xanthocarpa Berg. (20 g/L, durante 3 semanas, sobre parâmetros fisiológicos, bioquímicos e histológicos de ratos normais e diabéticos induzidos por estreptozotocina. O diabete melito foi induzido uma semana antes de iniciar o tratamento experimental, pela administração IP de estreptozotocina (STZ, 70 mg/kg em tampão citrato, pH 4.5. Os ratos tratados com STZ apresentaram sintomas típicos de diabete: polifagia, polidipsia, hiperglicemia, hipertrigliceridemia e alterações histopatológicas no pâncreas, fígado e rim. O tratamento dos ratos diabéticos com o decocto diminuiu os níveis de glicose sanguínea, inibiu a degradação do glicogênio hepático e preveniu possíveis alterações histopatológicas no pâncreas e no rim. Nos ratos controles tratados

A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

Science.gov (United States)

Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

2009-05-01

The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

Avaliação do potencial antioxidante frente à oxidação lipídica e da toxicidade preliminar do extrato e frações obtidas das frondes de Dicksonia sellowiana (Presl. Hook

Directory of Open Access Journals (Sweden)

V. B. OLIVEIRA

2015-12-01

Full Text Available RESUMOA espécie Dicksonia sellowiana, conhecida popularmente como xaxim, é uma samambaia natural do continente americano e encontrada no Brasil na Mata Atlântica. Em 2001 foi inserida na lista do IBAMA como espécie ameaçada de extinção em decorrência da exploração para a confecção de vasos para a jardinagem. O presente trabalho descreve o potencial antioxidante lipídico (TBARS e Sistema β-caroteno/ácido linoleico do extrato bruto e frações obtidos através de aparato de Soxhlet de frondes de Dicksonia sellowiana, além da atividade citotóxica e hemolítica in vitro. Pelo método TBARS, todas as amostras testadas apresentaram atividade, destacando a fração acetato de etila e extrato bruto cuja atividade foi comparável ao padrão ácido ascórbico. No sistema β-caroteno/ácido linoleico, a fração acetato de etila e extrato bruto apresentaram inibição da oxidação do ácido linoleico, destaque para a fração acetato de etila que não se diferenciou estatisticamente do padrão BHT. Na avaliação da toxicidade preliminar, não fora observado atividade citotóxica e hemolítica do extrato bruto e frações nos modelos testados. Os resultados demonstram o potencial antioxidante da espécie vegetal nos modelos de inibição da oxidação lipídica sem apresentar toxicidade.

Centro parroquial Harksheide-Stüberg Alemania Federal

Directory of Open Access Journals (Sweden)

von Bassewitz, Horst

1976-12-01

Full Text Available The Centre of the Evangelic Lutheran Community in Harksheide-Stüberg, situated in the midst of spacious green lawns, consists of two independent constructions with a central open patio in between, where the entrances to the social gathering premises are located. The smallest building, one storey only, is designed for the kindergarten. It comprises: three meeting rooms for groups, play room, office for the director, and housing for the person in charge of the kindergarten, washrooms and kitchen. The other two-storeyed building is entirely planned for the grown-up community, containing on the ground-floor: chapel, club for retired people, meeting room and a room for games, administration department and the dúplex housing for the parson. On the top floor are distributed: library, room for religious teaching, offices and two houses - one for the sacristan and the other one for the deaconess. In the construction traditional systems and materials have been used, and whenever possible the natural surfaces have been maintained. In this manner, a pleasant contrast of textures and colours has been achieved, as well as great simplicity in the lines, in perfect harmony with the country side setting.El Centro de la Comunidad Evangélica Luterana de Harkseide-Stüberg, ubicado en un lugar rodeado de amplias praderas, está constituido por dos construcciones independientes que crean entre sí un patio central abierto, en donde se sitúan las entradas a los locales sociales. El edificio más pequeño, de una sola planta, se dedica a jardín de infancia. Consta de: tres locales para reunión de grupos, sala de juegos, un despacho para la directora y una vivienda para la encargada de la guardería, además de los servicios de cocina y aseos correspondientes. La otra edificación, desarrollada en dos alturas, se destina en su totalidad a la comunidad adulta. Se compone, en la planta baja de: capilla, club de ancianos, sala de reunión y otra de juegos

ACTIVIDAD ANTIOXIDANTE Y PERFIL DE ÁCIDOS GRASOS DE LAS SEMILLAS DE JABUTICABA (Myrciaria cauliflora BERG)

OpenAIRE

NEUZA JORGE; BRUNA JORGE BERTANHA; DÉBORA MARIA MORENO LUZIA

2011-01-01

Múltiples compuestos naturales encontrados en frutas, cereales y vegetales presentan actividad antioxidante. Este trabajo tuvo como objetivo caracterizar las semillas de jabuticaba ( Myrciaria cauliflora Berg) en cuanto a su composición proximal y potencial antioxidante, y evaluar el perfil de ácidos grasos en el aceite extraído de las mismas. Para la obtención del extracto, las semillas deshidratadas y trituradas fueron extraídas con alcohol etílico por 30 minutos, en la proporción de 1:3 de...

Actividad antioxidante y perfil de ácidos grasos de las semillas de jabuticaba (Myrciaria cauliflora Berg)

OpenAIRE

Neuza Jorge

2011-01-01

Este trabajo tuvo como objetivo caracterizar las semillas de jabuticaba (Myrciaria cauliflora Berg) en cuanto a su composición proximal y potencial antioxidante y evaluar el perfil de ácidos grasos en el aceite extraído de las mismas. Para la obtención del extracto, las semillas deshidratadas y trituradas fueron extraídas con alcohol etílico por 30 minutos, en la proporción de 1:3 de semillas:alcohol etílico, bajo agitación continua, a temperatura ambiente. Seguidamente, la mezcla fue filtrad...

Actividad antioxidante y perfil de ácidos grasos de las semillas de jabuticaba (myrciaria cauliflora berg)

OpenAIRE

Jorge, Neuza

2011-01-01

Este trabajo tuvo como objetivo caracterizar las semillas de jabuticaba (Myrciaria cauliflora Berg) en cuanto a su composición proximal y potencial antioxidante y evaluar el perfil de ácidos grasos en el aceite extraído de las mismas. Para la obtención del extracto, las semillas deshidratadas y trituradas fueron extraídas con alcohol etílico por 30 minutos, en la proporción de 1:3 de semillas:alcohol etílico, bajo agitación continua, a temperatura ambiente. Seguidamente, la mezcla fue filtrad...

Vínculos entre teatro y cine en La señorita Julia. De August Strindberg a Alf Sjöberg y Liv Ullmann

Directory of Open Access Journals (Sweden)

Daniela Oulego

2016-03-01

Full Text Available El propósito del presente artículo es abordar comparativamente el texto dramático La señorita Julia, escrito por el dramaturgo August Strindberg, con las versiones fílmicas dirigidas por los cineastas Alf Sjöberg y Liv Ullmann. Si bien la obra responde al naturalismo, consideramos que Strindberg debatió con el carácter determinista de la herencia. En este sentido, elementos de la mitología cristiana, como el festejo de la Noche de San Juan, y la presencia de lo dionisíaco formarán parte del análisis. Asimismo, las divisiones jerárquicas ancestrales entre los sexos, por un lado, y amos y esclavos, por otro, serán vinculadas con la religión desde una mirada crítica del cristianismo. En su película Sjöberg se distanció de Strindberg acentuando en el factor determinista al indagar en la prehistoria de los personajes mediante el recurso técnico del flashback y apelando a metáforas audiovisuales en consonancia con el cine sueco experimental de su tiempo. Del mismo modo, Liv Ullmann, continuó examinando la influencia del determinismo y profundizó la construcción de los personajes desde la animalización planteada por Sjöberg. Por último, las referencias metateatrales del texto original retomadas en esta transposición permitirán enriquecer el estudio interdisciplinario entre teatro y cine.

Antioxidant activity and profile fatty acids of jabuticaba seeds (Myrciaria cauliflora berg)

International Nuclear Information System (INIS)

Jorge, Neuza; Bruna Jorge Bertanha; Moreno Luzia, Debora Maria

2011-01-01

Numerous natural compounds found in fruits, grains and vegetables have antioxidant activity. This work aimed to characterize jabuticaba seeds (Myrciaria cauliflora berg) by proximate composition, antioxidant activity and fatty acids profile of their extracted oil. To obtain the extract, the dehydrated and triturated seeds were extracted with ethyl alcohol for 30 min, at a proportion of 1:3 of seeds: ethyl alcohol, under continuous agitation, at room temperature. Afterwards, the mixture was filtered and the supernatant dehydrated at 40 Celsius degrade aiming to determine, by direct weighing, the extracts dry matter yield. According to the results, the jabuticaba seeds are an important source of total carbohydrates, and also presented relevant antioxidant activity. In the jabuticaba seeds oil, a significant percentage of polyunsaturated fatty acids stood out, with linoleic and α-linolenic being the main component, essentials fatty acids.

Covariance and decoupling of floral and vegetative traits in nine Neotropical plants: a re-evaluation of Berg's correlation-pleiades concept.

Science.gov (United States)

Armbruster, W S; Di Stilio, V S; Tuxill, J D; Flores, T C; Velásquez Runk, J L

1999-01-01

Nearly forty years ago R. L. Berg proposed that plants with specialized pollination ecology evolve genetic and developmental systems that decouple floral morphology from phenotypic variation in vegetative traits. These species evolve separate floral and vegetative trait clusters, or as she termed them, "correlation pleiades." The predictions of this hypothesis have been generally supported, but only a small sample of temperate-zone herb and grass species has been tested. To further evaluate this hypothesis, especially its applicability to plants of other growth forms, we examined the patterns of phenotypic variation and covariation of floral and vegetative traits in nine species of Neotropical plants. We recognized seven specific predictions of Berg's hypothesis. Our results supported some predictions but not others. Species with specialized pollination systems usually had floral traits decoupled (weak correlation; Canna and Eichornia) or buffered (relationship with shallow proportional slope; Calathea and Canna) from variation in vegetative traits. However, the same trend was also observed in three species with unspecialized pollination systems (Echinodorus, Muntingia, and Wedelia). One species with unspecialized pollination (Croton) and one wind-pollinated species (Cyperus) showed no decoupling or buffering, as predicted. While species with specialized pollination usually showed lower coefficients of variation for floral traits than vegetative traits (as predicted), the same was also true of species with unspecialized or wind pollination (unlike our prediction). Species with specialized pollination showed less variation in floral traits than did species with unspecialized or wind pollination, as predicted. However, the same was true of the corresponding vegetative traits, which was unexpected. Also in contrast to our prediction, plants with specialized pollination systems did not exhibit tighter phenotypic integration of floral characters than did species with

Fruit and seed biometry of cambuí (Myrciaria tenella O. Berg = Biometria de fruto e semente de cambuí (Myrciaria tenella O. Berg

Directory of Open Access Journals (Sweden)

Ana Veruska Cruz da Silva

2012-12-01

Full Text Available The cambuí tree (Myrciaria tenella O. Berg is native to Brazil and its fruits are harvested by extraction for fresh consumption in the state of Sergipe (Brazil. Because of the regional importance of the species, this work aims to characterize the cambuí fruits and seeds. The fruits were harvested mature from native trees in the Reserva do Caju Experimental Field, on Itaporanga d’Ajuda (Sergipe, Brazil, belonging to Embrapa Tabuleiros Costeiros. Two hundred fruits and seeds were biometrically analyzed. In addition, we evaluated the fruit, pulp, and seed color based on RHS Color Chart. Two different skin colors were found: 1. yellow [orange - red (group 32A] with yellow pulp [yellow - orange (group 17A]; and 2. purple [violet -blue (group 93A] with red pulp [red - purple (group 60A]. The seeds have only one color, green [yellow-green (group 152A] with dark stripes [Brown (group 200C]. The fruits mean diameter was 9.23 mm.fruit-1, and average width 8.50 mm.fruit-1. The seeds mean diameter was 5.34 mm.seed-1, mean width 6.52 mm.seed-1 and thickness 5.08 mm.seed-1. The cambuí is a little red fruit. The biometry had a high variability as expected, because it is a native species without any type of management.=Resumo - O cambuí (Myrciaria tenella O. Berg é nativo do Brasil e os frutos são colhidos por extrativismo para consumo in natura no estado de Sergipe (Brasil. Por causa da importância regional da espécie, objetivou-se com este trabalho caracterizar os frutos e sementes de cambuí. Os frutos foram colhidos maduros provenientes de plantas nativas do Campo Experimental Reserva do Caju, no município de Itaporanga d’Ajuda (Sergipe, Brasil pertencente a Embrapa Tabuleiros Costeiros. Foram analisados 200 frutos e sementes biometricamente. Além disso, caracterizou-se a cor da fruta, da polpa, e da semente com base na cartela de cores RHS. Foram identificados duas cores diferentes para a fruta: 1. de cor amarela [laranja - vermelho (grupo32A

Pentatomids associated with different forest species in Itaara, RS, Brazil

Directory of Open Access Journals (Sweden)

Ervandil Corrêa Costa

2010-03-01

Full Text Available The objective of this study was to determine qualitatively and quantitatively the pentatomid fauna associated with the canopy of different native species during the period from September 2005 to September 2006. Insects were collected from among nine botanical species: Gochnatia polymorpha (Less. (cambará, Eugenia uniflora Berg. (pitangueira, Acca selowiana (Berg Burret (goiaba-da-serra, Psidium cattleianum Sabine (araçá, Baccharis spp., Solanaum mauritianum Scop. (fumo-bravo, Micanea cinerascens Miq. (passiquinho, Calliandra brevipes Bhent. (caliandra, and Schinus molle L. (aroeira located at Rodolfo da Costa Dam in Itaara, RS, Brazil. Samples were taken every two weeks with a conical funnel made of tin plate (2mm, 70cm in diameter at the rim and 63cm in height. One sample per botanical species for each sampling date was taken, by shaking the branches, ten times over the funnel. Samples were sent to the Entomology Laboratory of the Crop Protection Department of the Federal University of Santa Maria, where the material was analyzed. A total of nine Pentatomidae species were identified. Edessa rufomarginata (De Geer, 1773 was the species of highest ocurrence followed by Thyanta humilis (Bergroth, 1891. The botanical species S. mauritianum presented the greatest number of Pentatomidae species, with an occurrence of 26.9%.

Group- and Individual-Level Responsiveness of the 3-Point Berg Balance Scale and 3-Point Postural Assessment Scale for Stroke Patients.

Science.gov (United States)

Huang, Yi-Jing; Lin, Gong-Hong; Lee, Shih-Chieh; Chen, Yi-Miau; Huang, Sheau-Ling; Hsieh, Ching-Lin

2018-03-01

To examine both group- and individual-level responsiveness of the 3-point Berg Balance Scale (BBS-3P) and 3-point Postural Assessment Scale for Stroke Patients (PASS-3P) in patients with stroke, and to compare the responsiveness of both 3-point measures versus their original measures (Berg Balance Scale [BBS] and Postural Assessment Scale for Stroke Patients [PASS]) and their short forms (short-form Berg Balance Scale [SFBBS] and short-form Postural Assessment Scale for Stroke Patients [SFPASS]) and between the BBS-3P and PASS-3P. Data were retrieved from a previous study wherein 212 patients were assessed at 14 and 30 days after stroke with the BBS and PASS. Medical center. Patients (N=212) with first onset of stroke within 14 days before hospitalization. Not applicable. Group-level responsiveness was examined by the standardized response mean (SRM), and individual-level responsiveness was examined by the proportion of patients whose change scores exceeded the minimal detectable change of each measure. The responsiveness was compared using the bootstrap approach. The BBS-3P and PASS-3P had good group-level (SRM, .60 and SRM, .56, respectively) and individual-level (48.1% and 44.8% of the patients with significant improvement, respectively) responsiveness. Bootstrap analyses showed that the BBS-3P generally had superior responsiveness to the BBS and SFBBS, and the PASS-3P had similar responsiveness to the PASS and SFPASS. The BBS-3P and PASS-3P were equally responsive to both group and individual change. The responsiveness of the BBS-3P and PASS-3P was comparable or superior to those of the original and short-form measures. We recommend the BBS-3P and PASS-3P as responsive outcome measures of balance for individuals with stroke. Copyright © 2017 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Post-stroke motor and functional evaluations: a clinical correlation using Fugl-Meyer assessment scale, Berg balance scale and Barthel index Avaliações motoras e funcionais pós-AVC: correlação clínica usando a escala de desempenho físico de Fugl-Meyer, a escala de equilíbrio de Berg e o índice de Barthel

Directory of Open Access Journals (Sweden)

Roberta de Oliveira

2006-09-01

Full Text Available Stroke is one of the major causes of morbidity and mortality. Sequels deriving from this event may lead to motor disability and from mild to severe deficits. In order to better classify sensory-motor dysfunction, balance and ability to perform activities of daily living, quantitative and qualitative evaluation scales have been used. OBJECTIVE: To correlate the scales Fugl-Meyer assessment scale, Berg balance scale and Barthel index. Twenty subjects with sequel after a single, unilateral stroke in chronic phase (>6 months post ictus were evaluated for about one hour. RESULTS: Barthel scale was statistically related to the total motor score of Fugl-Meyer assessment (r=0.597, p=0.005. The lower limb section at Fugl-Meyer had positive correlation with Berg scale (r=0.653, p=0.002 and with the balance section of Fugl-Meyer own scale (r=0.449, p=0.047. Both balance scales were correlated one with other (r=0.555, p=0.011. Statistical divergence appeared when Barthel's Index was correlated with Berg's Scale (r=0.425, p=0.062, and it is not statistically significant. CONCLUSION: The use of both quantitative and qualitative scales was shown to be a good measuring instrument for the classification of the general clinical performance of the patient, especially when positively related joint evaluations are applied.O acidente vascular cerebral (AVC é reconhecido como uma das maiores causas de morbidade e mortalidade. Seqüelas decorrentes deste evento podem levar a inabilidade motora e déficits leves a graves. Para classificar melhor a disfunção sensitivo-motora, o equilíbrio e as habilidades para as atividades de vida diária, escalas de avaliações quantitativas e qualitativas estão sendo utilizadas. OBJETIVO: Correlacionar a escala de desempenho físico de Fugl-Meyer, a escala de equilíbrio de Berg e o índice de Barthel. MÉTODO: Foram selecionados 20 sujeitos com sequela de um único e unilateral AVC em fase crônica (>6 meses pós ictal, que

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

Science.gov (United States)

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Dust abatement in mining and tunnelling - status report; Stand der Technik bei der Staubbekaempfung im Berg- und Tunnelbau

Energy Technology Data Exchange (ETDEWEB)

Mikki, P. [CFT GmbH, Compact-Filtertechnik, Gladbeck (Germany)

2005-02-01

Health and safety have priority in underground mining, especially dust and silicosis prevention in mining and tunnelling. While silicosis is not considered as an occupational disease in the strict sense, it is well known that most silicosis cases occur in these industries. (orig.) [German] Im Untertagebau sind die Probleme des Gesundheitsschutzes von vorrangiger Bedeutung, insbesondere im Bereich der Staub- und Silikosebekaempfung im Berg- und Tunnelbau. Wenn auch bei der Silikose nicht ausschliesslich von einer unter Tagespezifischen Berufskrankheit gesprochen werden kann, so entfaellt doch der ueberwiegende Teil der auftretenden Krankheitsfaelle auf diese Industriezweige. (orig.)

Chemical Characterization and in Vitro Antibacterial Activity of Myrcianthes hallii (O. Berg) McVaugh (Myrtaceae), a Traditional Plant Growing in Ecuador

OpenAIRE

Patricia Chavez Carvajal; Erika Coppo; Arianna Di Lorenzo; Davide Gozzini; Francesco Bracco; Giuseppe Zanoni; Seyed Mohammad Nabavi; Anna Marchese; Carla Renata Arciola; Maria Daglia

2016-01-01

Myrcianthes hallii (O. Berg) McVaugh (Myrtaceae) is a plant native to Ecuador, traditionally used for its antiseptic properties. The composition of the hydro-methanolic extract of this plant was determined by submitting it to ultra-high performance liquid chromatography (UHPLC) hyphenated to heated-electrospray ionization mass spectrometry and UV detection. The presence of antimicrobial components prompted us to test the extract against methicillin-resistant and methicillin-susceptible Staphy...

Germinação de Aechmea nudicaulis (L. Griseb. (Bromeliaceae em diferentes substratos alternativos ao pó de xaxim = Germination of Aechmea nudicaulis (L. Griseb. (Bromeliaceae in different substracts as alternatives to Dicksonia sellowiana Hook

Directory of Open Access Journals (Sweden)

Adilson Anacleto

2008-01-01

Full Text Available Avaliou-se a germinação das sementes de Aechmea nudicaulis (L. Griseb. (Bromeliaceae. As tentativas de produção desta espécie, a partir de sementes, têm ocorrido de forma empírica, utilizando-se substrato à base de pó de xaxim (Dicksonia sellowiana Hook., que tem restrições de uso, por estar ameaçada de extinção. Foram testados cinco tipos alternativos de substratos de fácil acessibilidade: húmus de minhoca, areia, fibra de casca de coco, serapilheira e Plantmax®. O experimento foi realizado em delineamento inteiramente casualizado, com quatro repetições e 50 sementes por unidade experimental, àtemperatura ambiente, em viveiro rústico, coberto com sombrite (70%. Leituras semanais foram efetuadas, durante 70 dias. A melhor performance, como substituto alternativo, foi a da serapilheira, que apresentou valores de germinação de 79,5% e sobrevivência de 97%,estatisticamente similares aos obtidos com xaxim (78%; 94,75%; Tukey, p For this study, the germination of Aechmea nudicaulis (L. Griseb. (Bromeliaceae was evaluated. Production attempts from seeds for this species have taken place in an empirical form, using substratebased on xaxim (Dicksonia sellowiana Hook. powder, the use of which is currently restricted, as it is an endangered species. Five easily accessible alternative substratum were tested: worm humus, sand, coconut shell fiber, forest litter, and Plantmax®. The experiment wasconducted using a completely randomized design, with four replications and 50 seeds per experimental unit, at room temperature in a rustic nursery covered with 70% shade cloth. Weekly readings were performed during 70 days. The best alternative as a substitute toxaxim was forest litter, due to its germinability of 79.5% and survival rates of 97%, significantly similar to xaxim (78%; 94.75%; Tukey p < 0,05. Additionally, this product features positive characteristics such as high availability, low cost, and easy recycling.

Evaluation and physiotherapeutic intervention in older with deficit balance through the Scale of Berg and Wii Balance Board platform

Directory of Open Access Journals (Sweden)

Juliana Secchi Batista

Full Text Available Introduction The aging process causes structural and functional changes in the organism. Among these changes, the systems responsible for controlling the balance are also affected, especially in women. This study aims to perform an assessment and physiotherapy intervention in elderly with balance deficits through Berg scale and platform Wii Balance Board. Materials and methods The study was longitudinal quasi-experimental intervention. Held in the city of Passo Fundo, RS - Brazil. Participants were 38 elderly women who had a deficit balance. The instruments used to collect data was a questionnaire to identify, assess balance across the Berg Balance Scale and an intervention program with six games via the Wii Balance Board™ platform. To statistically analyze the effects before and after the intervention were used Wilcoxon and Pearson correlation, with a significance level of p = 0.05. Results In the present study, we observed a statistically significant improvement in the balance of elderly compared before and after intervention, moreover, the six games played also showed statistical significance when comparing the first and twentieth session, highlighting the games Tightrope Walk Table Tilt, Deep Breathing and Soccer Heading. Conclusion The evaluation and balance training with the platform Wii Balance Board were able to provide significant results for the elderly, besides, the game has the potential to treat the health, well-being and functional capacity of older people through the visual representation the game in real time.

Balance Assessment in Deaf Children and Teenagers Prior to and Post Capoeira Practice through the Berg Balance Scale.

Science.gov (United States)

Lima, Rubianne

2017-12-01

Hearing loss changes the functionality and body structure a disability that limits activity and restricts the participation of the individual in situations of daily life. It is believed that capoeira can help people with visual disabilities to minimize these deficits. BSE is a low specificity scale that evaluates objectively and functionally aspects of balance and risk of falls in the elderly and children, including the effect of environment on balance function. The objective of the research is to analyze deaf children and adolescents prior to and post-practice of capoeira using the Berg Balance Scale (BBS). Quantitative, clinical and observational studies. Twenty five deaf children between 10 and 16 years old of both genders were assessed. BBS was applied in two stages: before starting capoeira and after 6 months of training. The one-hour classes were held once a week for quantitative evaluation purposes. The subjects were divided and evaluated in two groups (10-13 years old and 14-16 years old). There was a significant statistical difference in BBS scores. The general group and the group of 10-13 years old (p = 0.0251) showed an increase in scores after practicing capoeira (p = 0.0039). There were no statistically significant differences in the group from 14 to 16 years of age (p = 0.0504). Using the Berg Balance Scale, it was possible to observe an improvement in the balance of the group of children and adolescents who practiced capoeira, and consequently, a decrease in the risk of falling.

Fungos associados às sementes de Acca sellowiana: efeitos na qualidade fisiológica das sementes e transmissão

Directory of Open Access Journals (Sweden)

Vinícius Spolaor Fantinel

2017-12-01

Full Text Available Objetivou-se analisar o efeito de fungos na qualidade fisiológica de sementes de goiaba-serrana, e determinar os possíveis prejuízos no desenvolvimento inicial de mudas dessa espécie. Para análise fisiológica das sementes, foi realizado teste de germinação, a 25 ºC e fotoperíodo de 12 h, por 30 dias; sendo avaliadas a porcentagem e a velocidade de germinação. Inicialmente, as sementes foram subdivididas, sendo uma parte submetida à assepsia superficial com álcool 70%, hipoclorito de sódio 1% com posterior lavagem em água destilada e outra não. Para a avaliação das plântulas foi realizado teste de emergência de plântulas em viveiro, por 60 dias. Foram avaliadas a porcentagem de emergência, a massa verde e a massa seca de plântulas, e identificados os fungos. Os fungos interferiram na porcentagem de plântulas normais. Aspergillus sp., Colletotrichum gloeosporioides, Fusarium sp., Penicillium sp. e Phomopsis sp. associam-se com sementes não germinadas de goiaba-serrana, sendo prejudiciais à sua qualidade fisiológica. C. gloeosporioides e Fusarium sp. são transmitidos de sementes para plântulas, causando lesões necróticas nos cotilédones e má formação de raízes respectivamente.

Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora

Directory of Open Access Journals (Sweden)

Maria Eguiluz

2017-11-01

Full Text Available Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC and 18,587 bp (SSC. The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes. Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.

Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora

Science.gov (United States)

Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio

2017-01-01

Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization. PMID:29111566

Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora.

Science.gov (United States)

Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio

2017-01-01

Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.

Evaluation of the productive behavior of Psidium salutare (H.B.K. Berg in plantations

Directory of Open Access Journals (Sweden)

Nelson Valdes Rodriguez

2018-05-01

Full Text Available The present work was carried out in the productive ecosystem of Psidiumsalutare (H.B.K. Berg (Guayabita del pinar, in the well-known productive area La Lechuza, Los Palacios municipality, having as objectives to value the productive behavior of indicators of the ecosystem, aspect of great importance to maintain the productive levels of the ecosystem, at the same time the species that is an autochthonous species of the western area of Cuba is conserved. For their realization field visits and the collection of all information of production of last 27 years were made, and it shows the productive increment of species, the conservation levels, as well as the first floor employment of external inputs, for that you can conclude that the integral application of the evaluated indicators can bring as results new productive increments and bigger conservation levels for the species and the landscape.

ANATOMIA ECOLÓGICA DA MADEIRA DE Blepharocalyx salicifolius (H. B. K. Berg

Directory of Open Access Journals (Sweden)

José Newton Cardoso Marchiori

2005-06-01

Full Text Available RESUMO O presente trabalho visa à comparação anatômica da madeira da murta Blepharocalyx salicifolius (H. B. K. Berg (Myrtaceae, em duas regiões do Rio Grande do Sul. Foram coletados seis exemplares da espécie; três na região da Serra do Sudeste e os demais nos Campos de Cima da Serra. Qualitativamente, a madeira não revelou diferenças expressivas entre as procedências, exceto pela presença de máculas medulares. Sob o ponto de vista de suas características quantitativas, foram encontradas diferenças importantes na estrutura de vasos, parênquima axial, raios e fibras. As amostras da “Serra do Sudeste” mostraram características xéricas no lenho: poros numerosos e pequenos, além de elementos vasculares e fibras de comprimento menor, diferentemente das amostras dos “Campos de Cima da Serra”. Quanto ao índice de vulnerabilidade, não foi encontrada diferença significativa entre as procedências. As alterações verificadas no lenho podem ser interpretadas como resposta adaptativa da espécie aos respectivos ambientes.

Reliability and validity of the Turkish version of the Berg Balance Scale.

Science.gov (United States)

Sahin, Fusun; Yilmaz, Figen; Ozmaden, Asli; Kotevolu, Nurdan; Sahin, Tulay; Kuran, Banu

2008-01-01

The purpose of this study was to develop a Turkish version of the Berg Balance Scale (BBS) and assess its reliability and validity. Sixty healthy volunteers older than 65 years were included in to the study. Subjects who had lower extremity amputation, or were armchair or bedridden were excluded. After translation process, the Turkish version of the scale was administered to each participant twice with an interval of 2 weeks. The intraclass correlation coefficient (ICC) was calculated to assess intra- and inter-observer reliability. Chronbach alpha was calculated to evaluate internal consistency of the total BBS score. Interclass correlation coefficient was calcuated to examine test-retest reliability. Convergent validity was assessed by correlating the scale with Modified Barthel Index (MBI) and Timed Up and Go Test (TUG). Construct validity was assessed with factor analysis. The mean age in years of the participants were 77.00+/-5.67 (range: 67-92 yrs). The ICC for intra- and inter- observer reliability was 0.98 (pr=0.67 pr=-0.75 p<0.0001, respectively). The Turkish version of the BBS is a reliable and valid scale to be used in balance assessment of Turkish older adults.

22 February 2011 - German Ambassador to Switzerland A. Berg signing the guest book with CERN Director-General R. Heuer and visiting the LHC superconducting magnet test hall with Technology Department Head F. Bordry.

CERN Multimedia

Maximilien Brice

2011-01-01

22 February 2011 - German Ambassador to Switzerland A. Berg signing the guest book with CERN Director-General R. Heuer and visiting the LHC superconducting magnet test hall with Technology Department Head F. Bordry.

ANATOMIA DO LENHO DE MURTA – Blepharocalyx salicifolius (H.B.K. Berg

Directory of Open Access Journals (Sweden)

José Newton Cardoso Marchiori

2005-08-01

Full Text Available O presente trabalho teve por objetivo a descrição da estrutura anatômica da madeira de murta – Blepharocalyx salicifolius (H.B.K. Berg (Myrtaceae. Foram coletados seis exemplares da espécie, sendo três na região da Serra do Sudeste e três nos Campos de Cima da Serra, RS. Para confecção de lâminas histológicas, seguiu-se a técnica padrão, utilizada no Laboratório de Anatomia da Madeira da Universidade Federal do Paraná. A maceração da madeira foi realizada pelo método de Jeffrey. A estrutura anatômica da madeira coincide, em linhas gerais, com o padrão típico da família, reunindo um grande número de poros estreitos e solitários, com placas de perfuração simples, além de parênquima apotraqueal difuso, raios heterogêneos e fibras com pontoações areoladas. A presença de monocristais rombóides, bem como a ausência de traqueídeos vasicêntricos permite distinguir a espécie de outras Mirtáceas sul-rio-grandenses anteriormente descritas.

Breyten Breytenbach in een zijspiegel: Het vizier van H.C. ten Berge Transnationale laterale beweging en particuliere “hetero-images” van een literaire actor/ Breyten Breytenbach Through H.C. ten Berge’s Looking-Glass: Transnational Lateral Movement and Particular “Hetero-Images” of a Writer

Directory of Open Access Journals (Sweden)

T’Sjoen Yves

2015-06-01

Full Text Available At the end of the 1960s and in the beginning of the 1970s the South African poet Breyten Breytenbach had poetry and drawings published in the leading literary magazine Raster. The editor in charge at the time, H.C. ten Berge, gave the experimental writer and socially engaged Sestiger (the literary modernizing movement in South Africa in the sixties pride of place in the line-ups of the Dutch modernist periodical. In the seventies, Ten Berge contributed to Vingermaan (1980, a collection of poems by Dutch writers (Lucebert, Kopland, Kouwenaar, Schierbeek in support of the anti-apartheid activist. From 1975 Breytenbach was imprisoned in South Africa for political reasons. He served seven years of a nine year sentence. At that time, in the eighties, the Netherlands organized a cultural and economical boycott against the racist regime in Pretoria. Later on, Ten Berge presented his own poems dedicated to Breytenbach in his book of poetry Nieuwe gedichten (1981 and in the collection Materia prima: Gedichten 1963-1993 (1993. Before and during the imprisonment of Breytenbach Ten Berge played an important role in the introduction of the writer in the Low Countries. From a cultural-sociological point of view Breytenbach’s presence in the Dutch language area can be described, in the terminology of Francoise Lionnet and Shu-mei Shih and later on used by Louise Viljoen, as a transnational lateral movement in his writing career. This paper deals with the cultural transmission of an important political and experimental author in the literary system of Afrikaans and English in South Africa into the Dutch system. From a bibliographical viewpoint this paper affords special attention to the publication of Breytenbach’s volume of poetry in Skryt: Om ’n sinkende skip blou te verf ([1972] 1976, Vingermaan (1980 and Nieuwe gedichten ([1981] 1987. Ten Berge played an important role in the introduction of Breytenbach to the Low Countries in the way he presented the

The functional assessment Berg Balance Scale is better capable of estimating fall risk in the elderly than the posturographic Balance Stability System A avaliação funcional Berg Balance Scale é capaz de estimar melhor o risco de quedas em idosos do que a posturografia Balance Stability System

Directory of Open Access Journals (Sweden)

Vanessa Vieira Pereira

2013-01-01

Full Text Available The purpose of this study was to verify which instrument better identifies recurrent falls in the elderly. Ninety-eight old people, with an average age of 80±4 years, were submitted to an assessment of balance and fall risk by means of the Berg Balance Scale (BBS and the posturographic Balance Stability System (BSS. The BBS was correlated with the BSS (r=-0.27; p=0.008, age (r=-0.38; pA proposta do estudo foi verificar o instrumento que melhor identifica o risco de quedas recorrentes em idosos. O estudo incluiu 98 idosos, com média de idade de 80±4 anos, submetidos à avaliação do equilíbrio e risco de quedas por meio da Berg Balance Scale (BBS e da posturografia Balance Stability System (BSS. A BBS foi correlacionada com a BSS (r=-0,27; p=0,008, com a idade (r=-0,38; p<0,001 e com o número de quedas (r=-0,25; p=0,013. A análise de regressão logística mostrou que idosos classificados com risco de quedas na BBS apresentaram 2,5 (95%IC 1,08-5,78 mais chances de identificar quem teve duas quedas ou mais no último ano. A BBS identificou que quanto maior a idade pior é o equilíbrio funcional e demonstrou maior capacidade de identificar o risco de quedas sofridas no último ano quando comparada a BSS.

Évaluation de la réussite de l'ouvrage de protection de berges de la Romanche au barrage de Livet, réalisé à l'aide de techniques de génie végétal

Directory of Open Access Journals (Sweden)

DELAGE, Camille

2017-05-01

Full Text Available À l’interface entre les écosystèmes aquatiques et terrestres, le génie végétal sur les berges de cours d’eau s’inspire et utilise les capacités naturelles des végétaux comme matériel de base à la reconstruction de berges. Cette alternative au génie civil, confère aux écosystèmes une meilleure capacité de retour vers des systèmes plus naturels et surtout plus diversifiés. Toutefois, la restauration écologique et particulièrement les techniques de génie végétal souffrent de l’absence généralisée d’évaluation du succès et de retours d’expérience sur le développement des espèces et la tenue des différentes techniques. Cet article présente la démarche adoptée ainsi que les principaux résultats du suivi du réaménagement des berges de la Romanche au barrage de Livet, réalisé avec des techniques mixtes associant enrochements et différentes techniques de génie végétal.

Phytotoxic potential of young leaves from Blepharocalyx salicifolius (Kunth O. Berg (Myrtaceae

Directory of Open Access Journals (Sweden)

E. Habermann

Full Text Available Abstract The loss of leaves by plant species found in the Cerrado (Brazilian savanna is an energetically expensive process due to adverse environmental conditions and predation by herbivory. The mature leaves have adaptations which minimize these events. However, the young individuals lack these structures and produce high leaf concentrations of secondary metabolites as a form of protection. These compounds can be used in bioprospection of natural herbicides. Thus, this study aimed to evaluate the phytotoxicity of hexane, ethyl acetate and aqueous extracts of young leaves from Blepharocalyx salicifolius (Kunth O. Berg on the elongation of wheat coleoptiles (Triticum aestivum L. and evaluate the potential phytotoxic of ethyl acetate extract on germination, growth and cell size of metaxylem of sesame (Sesamum indicum L. seedlings. The hexane and ethyl acetate extracts inhibited the elongation of wheat coleoptiles at all concentrations; however, the most promising results were observed in coleoptile fragments treated with the ethyl acetate extract. This treatment changed the mean germination time and the synchrony of sesame seeds, inhibited the growth of shoots and roots, reduced the dry weight of seedlings, led to abnormalities in the seedlings and reduced the length of the metaxylem cells in the sesame seedlings. These results demonstrated the phytotoxic potential of young leaf extracts of B. salicifolius and the high phytotoxicity of the ethyl acetate extract in the initial development of S. indicum.

Polissacarídeos extraídos da gabiroba (Campomanesia xanthocarpa Berg: propriedades químicas e perfil reológico Polysaccharide isolated from gabiroba (Campomanesia xanthocarpa Berg: chemical properties and rheology profile

Directory of Open Access Journals (Sweden)

Marli da S. Santos

2010-01-01

Full Text Available A Campomanesia xanthocarpa Berg (Myrtaceae é uma frutífera nativa brasileira, com ampla distribuição natural na região Sul. Embora apresente frutificação abundante, produza frutos com características sensoriais e nutricionais atrativas, esses não são coletados e se perdem nos campos. Neste trabalho, a polpa do fruto sem semente (1500 g foi triturada em etanol / água na proporção de 1:4 (v/v, refluxada por 15 minutos em temperatura de ebulição. O resíduo obtido foi submetido a extrações sequenciais. As extrações foram otimizadas utilizando um planejamento fatorial 2², tendo como variáveis a concentração do ácido cítrico (0,5 e 5% e a temperatura (50 e 100 ºC. Os polissacarídeos provenientes de diferentes extrações foram caracterizados quanto à composição química e perfil reológico. Os altos teores de ácidos urônicos, arabinose e galactose detectados em todas as frações, indicam que estas são constituídas por polissacarídeos pécticos. Os polissacarídeos extraídos da polpa da gabiroba apresentaram um comportamento pseudoplástico. Todas as frações apresentaram como característica resistência frente às variações de temperatura. Quando submetidas a ciclos de aquecimento e posterior resfriamento estes géis retornam à sua estrutura original.The Campomanesia xanthocarpa Berg (Myrtaceae is a Brazilian native fruit, widely abundant in the Southern region. Despite their large fructification, in addition to nutritional and attractive sensory characteristics, these fruits are not collected, being lost in the fields. In this work, the fruit pulp without seed (1500 g was crushed in ethanol/water at a ratio of 1:4 (v/v, refluxed for 15 minutes at boiling temperature. The residue obtained was subjected to sequential extractions. The extractions were optimized using a factorial design 2², with the concentration of citric acid (0.5 and 5% and temperature (50 and 100 ºC as variables. The polysaccharides were

Vínculos entre teatro y cine en La señorita Julia. De August Strindberg a Alf Sjöberg y Liv Ullmann

OpenAIRE

Daniela Oulego

2016-01-01

El propósito del presente artículo es abordar comparativamente el texto dramático La señorita Julia, escrito por el dramaturgo August Strindberg, con las versiones fílmicas dirigidas por los cineastas Alf Sjöberg y Liv Ullmann. Si bien la obra responde al naturalismo, consideramos que Strindberg debatió con el carácter determinista de la herencia. En este sentido, elementos de la mitología cristiana, como el festejo de la Noche de San Juan, y la presencia de lo dionisíaco formarán parte del a...

Prospect of Milicia excelsa (Welw. C. Berg for Multi-Tree Species Agroforestry

Directory of Open Access Journals (Sweden)

Alfred Ossai Onefeli

2015-11-01

Full Text Available Background and Purpose: The population of most of our economically indigenous tree species in Nigeria is declining. Human activities and agricultural practices have been the ultimate contributors to this decrease. In order to ameliorate the conflict between agriculture and forestry, agroforestry was introduced. However, most of the practiced agroforestry is based on single tree species. Agroforestry practiced using single tree species have been reported to be ecologically staggered and therefore it is pertinent that phytosociology of trees with agroforestry potential is studied in order to improve the sustainability of human livelihood. Materials and Methods: This study was carried out in the University of Ibadan’s campus forest. The data were collected on Milicia excelsa (Welw. C. Berg by enumerating the tree species and also by identifying and enumerating the tree species associated with the subject tree (Milicia excelsa. Statistical analysis was done using percentages, Chi-square and charts. Results: A total of 49 individual Milicia excelsa were encountered in the study area. The results show 31 woody tree species associated with Milicia excelsa. Of all the associates Azadirachta indica A.Juss. happened to be the best one, having an average distance of 5.4 m to the subject tree. The sex ratio of Milicia excelsa was discovered to be approximately 1:1. Conclusions: Based on the obtained results of this research it may be concluded that Milicia excelsa has the prospect of being used in agroforestry in multi-tree species systems.

Redução de incertezas em análise de vulnerabilidade às mudanças climáticas para Dicksonia sellowiana

Directory of Open Access Journals (Sweden)

Marcelo Brilhante de Medeiros

2013-09-01

Full Text Available Este estudo teve por objetivo estabelecer predições do impacto das mudanças climáticas em cenários futuros sobre Dicksonia sellowiana (Pres. Hook, por meio de modelos de distribuição de espécies e uso de técnicas que diminuam o grau de incerteza nesse tipo de modelagem. Para a geração dos modelos foram utilizados cinco algoritmos disponíveis no programa Openmodeller. A modelagem incluiu o modelo climático HadCM3, com projeções para o ano 2050, em dois cenários de emissão de CO2: pessimista (A2 e otimista (B2. Todos os algoritmos apresentaram eficiência nas projeções para o clima atual, o que foi validado pelos valores da área sobre a curva ROC e pelo índice de Kappa. Considerando os remanescentes de habitats disponíveis para a espécie, os resultados apresentaram diferenças significativas entre as projeções de área com o clima atual e em relação às áreas em cenários climáticos futuros. Esses modelos indicaram reduções de área potencial superiores a 50% para a espécie. Mesmo considerando os valores bons e excelentes de acurácia com os dados de clima atual, a variabilidade das projeções de distribuição para o clima no futuro indica a necessidade do uso de técnicas de consenso para a redução das incertezas associadas a este tipo de modelagem.

Actividad antioxidante y perfil de ácidos grasos de las semillas de jabuticaba (Myrciaria cauliflora Berg

Directory of Open Access Journals (Sweden)

Neuza Jorge

2011-05-01

Full Text Available Este trabajo tuvo como objetivo caracterizar las semillas de jabuticaba (Myrciaria cauliflora Berg en cuanto a su composición proximal y potencial antioxidante y evaluar el perfil de ácidos grasos en el aceite extraído de las mismas. Para la obtención del extracto, las semillas deshidratadas y trituradas fueron extraídas con alcohol etílico por 30 minutos, en la proporción de 1:3 de semillas:alcohol etílico, bajo agitación continua, a temperatura ambiente. Seguidamente, la mezcla fue filtrada y el sobrenadante fue deshidratado a 40oC con la finalidad de determinar, por pesaje directo, el rendimiento en materia seca del extracto. De acuerdo con los resultados obtenidos, las semillas de jabuticaba mostraron ser una importante fuente de carbohidratos totales, además presentaron una relevante actividad antioxidante. El aceite de jabuticaba presentó porcentaje significativa de ácidos grasos poliinsaturados, con predominancia del ácido linoleico y α-linolénico, ácidos grasos esenciales.

Influence of drying temperature on the chemical constituents of jaboticaba (Plinia Jaboticaba (Vell. Berg skin

Directory of Open Access Journals (Sweden)

Ana Paula de C. Alves

2014-09-01

Full Text Available Jaboticaba is a fruit native to Brazil. Its skin represents up to 43% of the fruit and contains high levels of fiber, minerals and phenolic compounds. The use of the skin waste adds value to the fruit. However, one of the drawbacks of skin storage is the high water content, which requires drying processes to preserve the skin without leading to the loss of nutrients and antioxidants. The influence of different drying temperatures on the levels of nutrients and antioxidants was investigated. Jaboticaba (Plinia jaboticaba (Vell. Berg, genotype Sabará skins were lyophilized or dried at three temperatures (30, 45, and 60ºC, using food dryers. The skins were then ground, stored (protected from light and subjected to analysis of proximate composition, vitamin C, phytate, polyphenols, anthocyanins and antioxidant activity. The drying process had little effect on the proximate composition of the flour, presenting significant difference only for crude protein, fiber and non-nitrogenous extract. The greatest preservation of chemical constituents occurs in the lyophilized jaboticaba skins. Among the drying temperatures tested, however, the skins dried at 45 and60°C had more highly preserved nutritional substances and antioxidants.

Descriptions of the immature stages and new host plant records of Notozulia entreriana (Berg) (Hemiptera: Cercopidae) pests of grasses in subtropical areas of the Americas.

Science.gov (United States)

Foieri, Alvaro; Lenicov, Ana M Marino De Remes; Virla, Eduardo G

2016-04-11

Notozulia entreriana (Berg) (Hemiptera: Cercopidae) is one of the most common spittlebugs inhabiting the subtropical region of the America, inflicting important economic damage to grass crops. The immature stages are described and illustrated; the main characteristics that distinguish instars are the body size, color, number of flagellomeres, and number of tibial and metatarsomere spines. A key for identification of nymphs is provided as a tool to develop field studies.  Nine host plants, all belonging to Poaceae, are recorded as breeding and feeding host plants from different localities in northern Argentina.

Estudo fitoquímico e avaliação da toxicidade frente a Artemia salina e da atividade antimicrobiana de Calycorectes psidiiflorus (O. Berg) Sobral, Myrtaceae

OpenAIRE

Domingues, Elaine A.; Nakamura, Celso V.; de Souza, Maria C.; Teixeira, Tatiane S.; Peixoto, Juliana L. B.; Sarragiotto, Maria H.; Vidotti, Gentil J.

2010-01-01

O estudo fitoquímico das folhas de Calycorectes psidiiflorus (O. Berg) Sobral, Myrtaceae, resultou no isolamento e identificação de: sesquiterpeno [8-hidroxicalameneno (1)], triterpenos [α-amirina (2a) e β-amirina (2b)], flavonóide [3-O-α-ramnopiranosil-7-O-bglucopiranosil canferol (3)], e alcalóide [1,2,3,4-tetraidro-1-metil-β-carbolina (4)]. As estruturas das substâncias isoladas foram elucidadas com base nos seus dados de RMN em comparação com os da literatura. A substância 8-hydroxicalame...

Efeito do fósforo no desenvolvimento inicial de mudas de goiabeira serrana Effect of phosphorus on the initial development of feijoa seedlings

Directory of Open Access Journals (Sweden)

J.C. Nachtigal

1994-08-01

Full Text Available Foi estudado o efeito da adubação fosfatada no desenvolvimento inicial de mudas de goiabeira serrana (Feijoa sellowiana Berg. num experimento em vasos, com solo Podzólico Vermelho Amarelo, apresentando 4 ppm de P extraível pelo método de Mehlich. Os níveis de fósforo utilizados foram 0, 50, 100 e 150 ppm de P, aplicados antes da instalação do experimento, juntamente com 150 ppm de K. Em cobertura, foram aplicados 150 ppm de N, em três parcelas iguais aos 7, 27 e 47 dias após a repicagem das mudas. Plântulas oriundas de sementes de plantas nativas, com aproximadamente 30 dias, foram transplantadas para os vasos e cultivadas durante 89 dias. Houve efeito significativo do P sobre todas as variáveis analisadas. A altura das plantas mostrou um comportamento similar à curva clássica do crescimento, mas os incrementos obtidos a cada avaliação aumentaram com os níveis de P. A matéria seca das raízes e da parte aérea, bem como as quantidades extraídas de N, P e K aumentaram linearmente com os níveis de P. O teor de P no tecido aumentou até o nível de 50 ppm de P aplicado, permanecendo estável nos níveis maiores, enquanto os de N e K diminuiram nos níveis acima de 50 ppm de P. Os resultados obtidos permitem verificar a elevada exigência de fósforo desta espécie no período inicial de crescimento.The effect of phosphate fertilization on the initial development of feijoa (Feyoa sellowiana Berg. seedlings was studied in a pot experiment with a Red Yellow Podzolk soil having 4 ppm of extractable phosporous by the Mehlich method. Levels of phosphorous of 0, 50, 100 and 150 ppm together with 150 ppm of K were applied as a basal dressing. In three equal portions 150 ppm of N were applied at 7, 27 and 42 days after the transplant of the seedlings. Seedlings of native plants, with 30 days approximately, were transplanted to pots and cultivated during 89 days. There was a significant effect of phosphorous on all analised variables

In vitro effects of Blepharocalyx salicifolius (H.B.K.) O. Berg on the viability of Echinococcus ortleppi protoscoleces.

Science.gov (United States)

Noal, Charlise Bolson; Monteiro, Danieli Urach; Brum, Thiele Faccim de; Emmanouilidis, Jessica; Zanette, Regis Adriel; Morel, Ademir Farias; Stefanon, Eliza Beti de Cassia; Frosi, Marina; la Rue, Mario Luiz de

2017-01-01

Scolicidal agents are important in the treatment of cystic echinococcosis. This study evaluated the scolicidal activity of the plant Blepharocalyx salicifolius (H.B.K.) Berg against Echinococcus ortleppi protoscoleces. The parasite species was identified by amplifying a fragment of the gene cytochrome c oxidase subunit 1 (COX 1). B. salicifolius crude extract at concentrations of 100, 200, 300 and 400 mg/mL was analyzed at different times (5, 10, 15, 30, 45 and 60 min). N-butanol and ethyl acetate fractions (100 and 200 mg/ mL) were also analyzed at 5, 10, 15 and 30 min. Both fractions showed 100% scolicidal activity at the concentration of 200 mg/mL at 5 min. Gallic acid, identified as the major compound of the ethyl acetate fraction- was responsible for the observed scolicidal activity. The results showed that crude extract and fractions of B. salicifolius have scolicidal effect against E. ortleppi protoscoleces.

Bioactivity-Guided Metabolite Profiling of Feijoa ( Acca sellowiana) Cultivars Identifies 4-Cyclopentene-1,3-dione as a Potent Antifungal Inhibitor of Chitin Synthesis.

Science.gov (United States)

Mokhtari, Mona; Jackson, Michael D; Brown, Alistair S; Ackerley, David F; Ritson, Nigel J; Keyzers, Robert A; Munkacsi, Andrew B

2018-06-06

Pathogenic fungi continue to develop resistance against current antifungal drugs. To explore the potential of agricultural waste products as a source of novel antifungal compounds, we obtained an unbiased GC-MS profile of 151 compounds from 16 commercial and experimental cultivars of feijoa peels. Multivariate analysis correlated 93% of the compound profiles with antifungal bioactivities. Of the 18 compounds that significantly correlated with antifungal activity, 5 had not previously been described from feijoa. Two novel cultivars were the most bioactive, and the compound 4-cyclopentene-1,3-dione, detected in these cultivars, was potently antifungal (IC 50 = 1-2 μM) against human-pathogenic Candida species. Haploinsufficiency and fluorescence microscopy analyses determined that the synthesis of chitin, a fungal-cell-wall polysaccharide, was the target of 4-cyclopentene-1,3-dione. This fungal-specific mechanism was consistent with a 22-70-fold reduction in antibacterial activity. Overall, we identified the agricultural waste product of specific cultivars of feijoa peels as a source of potential high-value antifungal compounds.

Vínculos entre teatro y cine en La señorita Julia : De August Strindberg a Alf Sjöberg y Liv Ullmann

OpenAIRE

Oulego, Daniela

2016-01-01

El propósito del presente artículo es abordar comparativamente el texto dramático La señorita Julia, escrito por el dramaturgo August Strindberg, con las versiones fílmicas dirigidas por los cineastas Alf Sjöberg y Liv Ullmann. Si bien la obra responde al naturalismo, consideramos que Strindberg debatió con el carácter determinista de la herencia. En este sentido, elementos de la mitología cristiana, como el festejo de la Noche de San Juan, y la presencia de lo dionisíaco formarán parte del a...

Identification of 5-hydroxy-tryptamine (bufotenine) in takini (Brosimumacutifolium Huber subsp. acutifolium C.C. Berg, Moraceae), a shamanic potion used in the Guiana Plateau.

Science.gov (United States)

Moretti, Christian; Gaillard, Yvan; Grenand, Pierre; Bévalot, Fabien; Prévosto, Jean-Michel

2006-06-30

This paper is the first thorough analysis of takini, a hallucinogen used by the shamans of several peoples in Suriname, French Guiana, and the region east of the Para in Brazil. The drug is contained in the latex of the Brosimum acutifolium tree, and until now, its psychotropic properties appeared inconsistent with the more general medicinal uses of the tree in the surrounding region. Our chemical and botanical studies reveal that the active ingredient of takini is bufotenine; and that this compound is only contained in the subspecies Brosimum acutifolium Huber subsp. acutifolium C.C. Berg that is found in the same area of the eastern Guianas.

Investigation of the relationship between venticular fibrillation duration and cardiac/neurological damage in a rabbit model of electrically induced arrhythmia.

Science.gov (United States)

Hu, Chun-Lin; Wei, Hong-Yan; Liu, Zi-You; Li, Xing; Liao, Xiao-Xing; Li, Yu-Jie; Zhan, Hong; Jing, Xiao-Li; Xiong, Yan; Liu, Yan-Yan; Wu, Gui-Fu

2010-12-01

To establish a simple, economic, and reliable alternating current (AC)-induced cardiac arrest (ACCA) model in rabbits for cardiopulmonary cerebral resuscitation research. Ventricular fibrillation was induced in 27 New Zealand rabbits by external transthoracic AC, which were randomly divided into three groups according to the duration of untreated ACCA (ACCA-3 minutes, ACCA-5 minutes, and ACCA-8 minutes). After ACCA, all animals received cardiopulmonary resuscitation for 2 minutes and subsequent defibrillation until return of spontaneous circulation (ROSC). The troponin I levels were measured at 4 hours after ROSC. Animals died spontaneously or were killed at 72 hours after ROSC. The hippocampus were removed and fixed in 3% formalin. TdT-mediated dUTP-biotin nick end labeling and Nissl stainings were performed in 10-μm thickness coronal sections. Furthermore, two rabbits (without induction of ventricular fibrillation, cardiopulmonary resuscitation, and defibrillation) served as normal control group. Mean survival times after ROSC were 48.57 hours ± 24.70 hours, 18.0 hours ± 15.13 hours, and 3.88 hours ± 2.39 hours for groups ACCA-3 minutes, ACCA-5 minutes, and ACCA-8 minutes, respectively. Survival was significantly different between ACCA-3 minutes and other two groups (p = 0.002 and p = 0.01). Neuronal necrosis and apoptosis were found in the hippocampus CA1, CA2, and CA3 areas of group ACCA-3 minutes. In contrast, neuronal necrosis and TdT-mediated dUTP-biotin nick end labeling positive cells were fewer in control animals. The rabbits in group ACCA-3 minutes had significant neuronal damage with apoptosis in hippocampus CA1, CA2, and CA3 areas at 72 hours after ROSC and survived longer than those in other groups. The model we describe may be a simple, economic, and reliable model for experimental investigation on cardiopulmonary cerebral resuscitation.

Validation of the Brazilian version of the Clinical Gait and Balance Scale and comparison with the Berg Balance Scale

Directory of Open Access Journals (Sweden)

Jussara Almeida Oliveira Baggio

2013-09-01

Full Text Available Objective To validate the Clinical Gait and Balance Scale (GABS for a Brazilian population of patients with Parkinson's disease (PD and to compare it to the Berg Balance Scale (BBS. Methods One hundred and seven PD patients were evaluated by shortened UPDRS motor scale (sUPDRSm, Hoehn and Yahr (HY, Schwab and England scale (SE, Falls Efficacy Scale International (FES-I, Freezing of Gait Questionnaire (FOG-Q, BBS and GABS. Results The internal consistency of the GABS was 0.94, the intra-rater and inter-rater reliability were 0.94 and 0.98 respectively. The area under the receiver operating characteristic (ROC curve was 0.72, with a sensitivity of 0.75 and specificity of 0.6, to discriminate patients with a history of falls in the last twelve months, for a cut-off score of 13 points. Conclusions Our study shows that the Brazilian version of the GABS is a reliable and valid instrument to assess gait and balance in PD.

Conservation of Campomanesia adamantium (CAMB. O. berg seeds in different packaging and at varied temperatures Conservação de sementes de Campomanesia adamantium (CAMB. O. berg em diferentes embalagens e temperaturas

Directory of Open Access Journals (Sweden)

Silvana de Paula Quintão Scalon

2013-03-01

Full Text Available This article aims at evaluating the effects of different packaging and varied storage temperatures on the germination potential of seeds of Campomanesia adamantium Camb. O. Berg. The seeds were packaged in glass, aluminum foil and plastic containers, or maintained inside intact fruits at 5, 10 and 15 ºC during 0, 7, 14 and 21 days. After these periods the seeds were sown in Germitest® germination paper and maintained in incubation chambers at 25 ºC under constant white light for 42 days. Seed moisture contents were evaluated both before and after storage, as well as germination percentages, germination speed index, root and aerial portion of seedlings lengths, and total dry weights. All possible combinations of packing materials, temperatures and storage times were tested, with four repetitions of 25 seeds for each treatment. C. adamantium seeds showed initial water contents of 31.5%. Glass and aluminum packaging were efficient at maintaining the water content of the seeds, and provided greater germination speed index than the other packaging materials. Germination percentages, seedlings lengths and dry weights did not vary among the different temperatures tested. C. adamantium seeds can be stored for up to 21 days at temperatures between 5 and 15 ºC without altering their physiological quality. In terms of cost-benefit efficiencies, these seeds can be stored without significant damage for 21 days while still inside the fruits at temperatures of 5, 10 or 15 ºC.Objetivou-se com este trabalho avaliar o efeito de diferentes embalagens e temperaturas durante o armazenamento sobre o potencial de germinação das sementes de Campomanesia adamantium Camb. O. Berg. As sementes foram mantidas em embalagens de vidro, papel de alumínio, plástico e no interior do fruto, nas temperaturas de 5, 10 e 15 ºC, durante zero, sete, quatorze e 21 dias. Após esse período, as sementes foram semeadas em rolo de papel Germitest® e mantidas em B.O.D. a 25 º

Cell cycle regulation of the BRCA1/acetyl-CoA-carboxylase complex.

Science.gov (United States)

Ray, H; Suau, F; Vincent, A; Dalla Venezia, N

2009-01-16

Germ-line alterations in BRCA1 are associated with an increased susceptibility to breast and ovarian cancer. The BRCA1 protein has been implicated in multiple cellular functions. We have recently demonstrated that BRCA1 reduces acetyl-CoA-carboxylase alpha (ACCA) activity through its phospho-dependent binding to ACCA, and further established that the phosphorylation of the Ser1263 of ACCA is required for this interaction. Here, to gain more insight into the cellular conditions that trigger the BRCA1/ACCA interaction, we designed an anti-pSer1263 antibody and demonstrated that the Ser1263 of ACCA is phosphorylated in vivo, in a cell cycle-dependent manner. We further showed that the interaction between BRCA1 and ACCA is regulated during cell cycle progression. Taken together, our findings reveal a novel mechanism of regulation of ACCA distinct from the previously described phosphorylation of Ser79, and provide new insights into the control of lipogenesis through the cell cycle.

Pentatomídeos (Hemiptera associados a espécies nativas em Itaara, RS, Brasil

Directory of Open Access Journals (Sweden)

Juliana Garlet

2010-04-01

Full Text Available http://dx.doi.org/10.5007/2175-7925.2010v23n1p91 Com o objetivo de determinar qualitativamente e quantitativamente os pentatomídeos associados a diferentes espécies botânicas nativas, no período de setembro de 2005 a setembro de 2006, foram coletados insetos em nove espécies: Gochnatia polymorpha (Less. (cambará, Eugenia uniflora Berg. (pitangueira, Acca selowiana (Berg Burret (goiaba-da-serra, Psidium cattleianum Sabine (araçá, Baccharis spp., Solanaum mauritianum Scop. (fumo-bravo, Micanea cinerascens Miq. (passiquinho, Calliandra brevipes Bhent. (caliandra, Schinus molle L. (aroeira, localizadas na barragem Rodolfo da Costa e Silva, município de Itaara, RS. Foram realizadas coletas quinzenais, com o auxílio de um funil cônico confeccionado com folha de flandres (2mm, com 70cm de diâmetro na maior abertura e 63cm de altura. Retirou-se uma amostra por espécie botânica por data de coleta, obtida através de dez sacudidas dos ramos sobre o funil. Realizadas as coletas, o material foi levado ao Laboratório de Entomologia do Departamento de Defesa Fitossanitária da Universidade Federal de Santa Maria, onde foi realizada a triagem e identificação do material. Foram identificadas nove espécies de Pentatomidae. Edessa rufomarginata (De Geer, 1773 foi à espécie com maior ocorrência, seguida de Thyanta humilis Bergroth, 1891. A espécie botânica S. mauritianum foi a que apresentou o maior número de espécies de Pentatomidae coletados, representando 26,9% do total.

Seedling emergence of an array of Campomanesia adamantium (Cambess. O. Berg, under different conditions

Directory of Open Access Journals (Sweden)

Kaila Ressel

2014-12-01

Full Text Available Seedling emergence of an array of Campomanesia adamantium (Cambess. O. Berg, under different conditions. Campomanesia adamantium are shrubs with berries that are yellow when ripe, with sweet, aromatic and juicy pulp. The fruits are very appreciated by the Midwestern Brazilian population because, beyond the economic potential, gabirobeiras have important ecological and medicinal applications. The few reports concerning methods of C. adamantium propagation demonstrate varied responses of the germination process, and variation sometimes occurs for seeds planted under similar conditions. The objective of this study was to evaluate the inluence of different substrates and seed pulp extraction methods on seedling emergence of C. adamantium. Seeds were collected from a single individual. The experiment tested four methods of seed pulp extraction: a Control: seeds sown with pulp, b seeds whose pulp was mechanically removed by friction using fine sawdust, c seeds whose pulp was removed by washing in running water; d seeds with pulp soaked for 24 h. Four different substrates per pulp extraction type were then used for planting: 1 Vermiculite; 2 Plantmax ®; 3 Tri-Mix ®, 4 washed medium-grain sand. Sand was the substrate that produced the best result for seedling emergence, however there were no significant differences in seedling emergence between seed processing methods. The presence of seed pulp did not impact percent seedling emergence, nor did it affect average time or speed of seedling emergence.

MORFOLOGIA FLORAL DA GOIABEIRA SERRANA (Feijoa sellowiana E SUAS IMPLICAÇÕES NA POLINIZAÇÃO FLOWER MORPHOLOGY OF FEIJOA (Feijoa sellowiana AND IT'S IMPLICATIONS ON POLLINATION

Directory of Open Access Journals (Sweden)

JULIANA DEGENHARDT

2001-12-01

Full Text Available Esse estudo teve por objetivo caracterizar variações na arquitetura floral da Feijoa sellowiana e determinar sua influência sobre a polinização. Foram avaliados o comprimento do pistilo, a distância entre estigma e estames, o diâmetro de abertura e a distribuição dos estames na flor, com base em 7 flores de 15 acessos do Banco de Germoplasma da espécie. Distinguiram-se 3 classes de distâncias médias entre estigma e estames: 0,2 (C1, 0,7 (C2 e 1,2 cm (C3, e duas classes de distribuição de estames na flor (radial e aleatória. Sorteou-se uma planta por classe de distância entre estigma e estames, a qual teve 50 flores marcadas para cada um dos seguintes tratamentos: T1-polinização aberta; T2-tela contra pássaros e T3-tela contra pássaros e insetos. A frutificação foi de 47% em T1 para C2 e de 22% para C3, diferença que pode ser devida ao genótipo e/ou alternância de produção. No T2, a frutificação foi 31% em C2, 15,4% em C1 e 3% em C3. A superioridade de T1 sobre T2 pode ser devida à polinização por pássaros. Essa superioridade foi mais expressiva em C3 do que em C2, o que sugere que C3 é mais dependente de pássaros. A frutificação em T2 pode ainda evidenciar a polinização por insetos e foi menor para C3, o que pode estar sendo causado pelo maior afastamento do estigma. A frutificação em T3 para C1 (7% e C2 (15% sugere que o vento ou a autopolinização também possam efetuar a polinização.The objective of our research was to evaluate distance between the stigma and the stamens, opening diameter and stamens distribution on the flower. We evaluated these variables on 7 flowers of each one of the 15 plant accessions from the Germplasm Bank. The flowers were classified according to distance between the stigma and the stamens into three classes: 0.2 (C1, 0.7 (C2 and 1,2 (C3 cm, in which 2, 9, and 4 accessions were included, respectively. The radial and random stamens distributions were verified in 6 and 9

SENSITIVITY AND SPECIFICITY OF INDIVIDUAL BERG BALANCE ITEMS COMPARED WITH THE TOTAL SCORE TO PREDICT FALLS IN COMMUNITY DWELLING ELDERLY INDIVIDUALS

Directory of Open Access Journals (Sweden)

Hazel Denzil Dias

2014-09-01

Full Text Available Background: Falls are a major problem in the elderly leading to increased morbidity and mortality in this population. Scores from objective clinical measures of balance have frequently been associated with falls in older adults. The Berg Balance Score (BBS which is a frequently used scale to test balance impairments in the elderly ,takes time to perform and has been found to have scoring inconsistencies. The purpose was to determine if individual items or a group of BBS items would have better accuracy than the total BBS in classifying community dwelling elderly individuals according to fall history. Method: 60 community dwelling elderly individuals were chosen based on a history of falls in this cross sectional study. Each BBS item was dichotomized at three points along the scoring scale of 0 – 4: between scores of 1 and 2, 2 and 3, and 3 and 4. Sensitivity (Sn, specificity (Sp, and positive (+LR and negative (-LR likelihood ratios were calculated for all items for each scoring dichotomy based on their accuracy in classifying subjects with a history of multiple falls. These findings were compared with the total BBS score where the cut-off score was derived from receiver operating characteristic curve analysis. Results: On analysing a combination of BBS items, B9 and B11 were found to have the best sensitivity and specificity when considered together. However the area under the curve of these items was 0.799 which did not match that of the total score (AUC= 0.837. A, combination of 4 BBS items - B9 B11 B12 and B13 also had good Sn and Sp but the AUC was 0.815. The combination with the AUC closest to that of the total score was a combination items B11 and B13. (AUC= 0.824. hence these two items can be used as the best predictor of falls with a cut off of 6.5 The ROC curve of the Total Berg balance Scale scores revealed a cut off score of 48.5. Conclusion: This study showed that combination of items B11 and B13 may be best predictors of falls in

SENSITIVITY AND SPECIFICITY OF INDIVIDUAL BERG BALANCE ITEMS COMPARED WITH THE TOTAL SCORE TO PREDICT FALLS IN COMMUNITY DWELLING ELDERLY INDIVIDUALS

Directory of Open Access Journals (Sweden)

Hazel Denzil Dias

2014-06-01

Full Text Available Background: Falls are a major problem in the elderly leading to increased morbidity and mortality in this population. Scores from objective clinical measures of balance have frequently been associated with falls in older adults. The Berg Balance Score (BBS which is a frequently used scale to test balance impairments in the elderly ,takes time to perform and has been found to have scoring inconsistencies. The purpose was to determine if individual items or a group of BBS items would have better accuracy than the total BBS in classifying community dwelling elderly individuals according to fall history. Method: 60 community dwelling elderly individuals were chosen based on a history of falls in this cross sectional study. Each BBS item was dichotomized at three points along the scoring scale of 0 – 4: between scores of 1 and 2, 2 and 3, and 3 and 4. Sensitivity (Sn, specificity (Sp, and positive (+LR and negative (-LR likelihood ratios were calculated for all items for each scoring dichotomy based on their accuracy in classifying subjects with a history of multiple falls. These findings were compared with the total BBS score where the cut-off score was derived from receiver operating characteristic curve analysis. Results: On analysing a combination of BBS items, B9 and B11 were found to have the best sensitivity and specificity when considered together. However the area under the curve of these items was 0.799 which did not match that of the total score (AUC= 0.837. A, combination of 4 BBS items - B9 B11 B12 and B13 also had good Sn and Sp but the AUC was 0.815. The combination with the AUC closest to that of the total score was a combination items B11 and B13. (AUC= 0.824. hence these two items can be used as the best predictor of falls with a cut off of 6.5 The ROC curve of the Total Berg balance Scale scores revealed a cut off score of 48.5. Conclusion: This study showed that combination of items B11 and B13 may be best predictors of falls in

Efeito de diferentes técnicas extrativas no rendimento, atividade antioxidante, doseamentos totais e no perfil por clae-dad de dicksonia sellowiana (presl.. Hook, dicksoniaceae

Directory of Open Access Journals (Sweden)

V.B. OLIVEIRA

2016-01-01

Full Text Available RESUMO A espécie Dicksonia sellowiana, conhecida popularmente como xaxim, é uma samambaia natural do continente americano e encontrada no Brasil na Mata Atlântica. Em 2001 sua utilização para confecção de vasos para jardinagem foi proibida, e a mesma foi inserida na lista do IBAMA como espécie ameaçada de extinção. O presente trabalho descreve o efeito de diferentes técnicas de extração, incluindo ultra-som, turbólise, maceração, infusão, decocto e soxhlet utilizando etanol e solvente hidroalcoólico 70%, sob aspectos físicos e químicos. Foi avaliado o rendimento de cada extração, o perfil por CLAE-DAD, o conteúdo de polifenóis, flavonoides, proantocianidinas e esteroides além das atividades antioxidantes pelos métodos DPPH e redução do complexo fosfomolibdênio. Os dados foram avaliados estatisticamente através de desvio padrão, Tuckey e PCA. Os resultados demonstraram que a extração por Soxhlet utilizando ambos os solventes é a que possui maior rendimento final, porém o rendimento não está diretamente relacionado com o aumento nos teores de bioativos totais e atividades antioxidantes. As extrações por decocção e turbólise utilizando solvente hidroalcoólico foram as que apresentaram melhores resultados nos teores totais e na atividade antioxidante, resultados que ficam evidentes quando avaliados por PCA, demonstrando que este solvente e estas extrações são mais seletivas no estudo proposto.

Chemical and biological evaluation of essential oils from two species of Myrtaceae - Eugenia uniflora L. and Plinia trunciflora (O. Berg) Kausel.

Science.gov (United States)

Lago, João Henrique G; Souza, Elisângela Dutra; Mariane, Bruna; Pascon, Renata; Vallim, Marcelo A; Martins, Roberto Carlos C; Baroli, Adriana A; Carvalho, Bianca A; Soares, Marisi G; dos Santos, Roberta T; Sartorelli, Patricia

2011-11-25

The chemical composition and antimicrobial activity of essential oils obtained from leaves of two Myrtaceae species-Eugenia uniflora L. and Plinia trunciflora (O. Berg) Kausel-were determined. Analysis by GC/MS as well as determination of Kovatz indexes indicated atractylone (26.78%) and curzerene (17.96%) as major constituents of E. uniflora oil and α-cadinol (19.15%), apiole (11.15%) and cubenol (5.43%) as main components in P. trunciflora oil. Both essential oils were tested for antimicrobial activity against yeasts and bacteria. E. uniflora and P. trunciflora essential oils were active towards two Gram-positive bacteria, Streptococcus equi and Staphylococcus epidermis. In addition, biological activity of both essential oils was detected for pathogenic yeasts of the genus Candida and Cryptococcus. E. uniflora was active towards all yeast tested and exhibited interesting minimal inhibitory concentrations (0.11 to 3.75 mg/mL) across a broad spectrum of activity.

Alpha cyano-4-hydroxy-3-methoxycinnamic acid inhibits proliferation and induces apoptosis in human breast cancer cells.

Science.gov (United States)

Hamdan, Lamia; Arrar, Zoheir; Al Muataz, Yacoub; Suleiman, Lutfi; Négrier, Claude; Mulengi, Joseph Kajima; Boukerche, Habib

2013-01-01

This study investigated the underlying mechanism of 4-hydroxy-3-methoxycinnamic acid (ACCA), on the growth of breast cancer cells and normal immortal epithelial cells, and compared their cytotoxic effects responses. Treatment of breast cancer cells (MCF-7, T47D, and MDA-231) with ACCA resulted in dose- and time-dependent decrease of cell proliferation, viability in colony formation assay, and programmed cell death (apoptosis) with minimal effects on non-tumoral cells. The ability of ACCA to suppress growth in cancer cells not expressing or containing defects in p53 gene indicates a lack of involvement of this critical tumor suppressor element in mediating ACCA-induced growth inhibition. Induction of apoptosis correlated with an increase in Bax protein, an established inducer of programmed cell death, and the ratio of Bax to Bcl-2, an established inhibitor of apoptosis. We also documented the ability of ACCA to inhibit the migration and invasion of MDA-231 cells with ACCA in vitro. Additionally, tumor growth of MDA-231 breast cancer cells in vivo was dramatically affected with ACCA. On the basis of its selective anticancer inhibitory activity on tumor cells, ACCA may represent a promising therapeutic drug that should be further evaluated as a chemotherapeutic agent for human breast cancer.

Alpha cyano-4-hydroxy-3-methoxycinnamic acid inhibits proliferation and induces apoptosis in human breast cancer cells.

Directory of Open Access Journals (Sweden)

Lamia Hamdan

Full Text Available This study investigated the underlying mechanism of 4-hydroxy-3-methoxycinnamic acid (ACCA, on the growth of breast cancer cells and normal immortal epithelial cells, and compared their cytotoxic effects responses. Treatment of breast cancer cells (MCF-7, T47D, and MDA-231 with ACCA resulted in dose- and time-dependent decrease of cell proliferation, viability in colony formation assay, and programmed cell death (apoptosis with minimal effects on non-tumoral cells. The ability of ACCA to suppress growth in cancer cells not expressing or containing defects in p53 gene indicates a lack of involvement of this critical tumor suppressor element in mediating ACCA-induced growth inhibition. Induction of apoptosis correlated with an increase in Bax protein, an established inducer of programmed cell death, and the ratio of Bax to Bcl-2, an established inhibitor of apoptosis. We also documented the ability of ACCA to inhibit the migration and invasion of MDA-231 cells with ACCA in vitro. Additionally, tumor growth of MDA-231 breast cancer cells in vivo was dramatically affected with ACCA. On the basis of its selective anticancer inhibitory activity on tumor cells, ACCA may represent a promising therapeutic drug that should be further evaluated as a chemotherapeutic agent for human breast cancer.

Antilaminaribioside and antichitobioside antibodies in inflammatory bowel disease.

Science.gov (United States)

Rejchrt, S; Drahosová, M; Kopácová, M; Cyrany, J; Douda, T; Pintér, M; Bures, J

2008-01-01

Testing antilaminaribioside (ALCA) and antichitobioside (ACCA) antibodies in 89 Crohn's disease (CD), 31 ulcerative colitis (UC) and 50 controls, mean values were 38.6 and 53.0 ELISA units for CD, 34.0 and 32.6 for UC, 34.5 and 36.4 for controls, respectively. There was no significant difference of ALCA values between CD and UC (p = 0.401), CD and control subjects (p = 0.698) or UC and controls (p = 0.898). ACCA were significantly higher in CD compared with UC (p = 0.011) but not with the controls (p = 0.095). No significant difference of ACCA values between UC and controls (p = 0.107) was found. ALCA and ACCA values significantly correlated in CD (r = 0.548, p ACCA), the negative ones (to exclude CD) 25 (ALCA) and 86 % (ACCA). Small and/or large bowel involvement or disease type (i.e. stenosing, perforating or inflammatory) of CD did not differ in the two values. The idea that ALCA and ACCA may be useful either to differentiate between CD, UC and healthy subjects or to stratify CD was not confirmed.

Estudo fitoquímico e avaliação da toxicidade frente a Artemia salina e da atividade antimicrobiana de Calycorectes psidiiflorus (O. Berg Sobral, Myrtaceae

Directory of Open Access Journals (Sweden)

Elaine A. Domingues

Full Text Available O estudo fitoquímico das folhas de Calycorectes psidiiflorus (O. Berg Sobral, Myrtaceae, resultou no isolamento e identificação de: sesquiterpeno [8-hidroxicalameneno (1], triterpenos [α-amirina (2a e β-amirina (2b], flavonóide [3-O-α-ramnopiranosil-7-O-bglucopiranosil canferol (3], e alcalóide [1,2,3,4-tetraidro-1-metil-β-carbolina (4]. As estruturas das substâncias isoladas foram elucidadas com base nos seus dados de RMN em comparação com os da literatura. A substância 8-hydroxicalameneno apresentou atividade antibacteriana (MIC = 7,8 µg/mL e antifúngica (MIC = 15,6 µg/mL.

Conservation of Campomanesia adamantium (CAMB. O. berg seeds in different packaging and at varied temperatures

Directory of Open Access Journals (Sweden)

Silvana de Paula Quintão Scalon

2013-03-01

Full Text Available This article aims at evaluating the effects of different packaging and varied storage temperatures on the germination potential of seeds of Campomanesia adamantium Camb. O. Berg. The seeds were packaged in glass, aluminum foil and plastic containers, or maintained inside intact fruits at 5, 10 and 15 ºC during 0, 7, 14 and 21 days. After these periods the seeds were sown in Germitest® germination paper and maintained in incubation chambers at 25 ºC under constant white light for 42 days. Seed moisture contents were evaluated both before and after storage, as well as germination percentages, germination speed index, root and aerial portion of seedlings lengths, and total dry weights. All possible combinations of packing materials, temperatures and storage times were tested, with four repetitions of 25 seeds for each treatment. C. adamantium seeds showed initial water contents of 31.5%. Glass and aluminum packaging were efficient at maintaining the water content of the seeds, and provided greater germination speed index than the other packaging materials. Germination percentages, seedlings lengths and dry weights did not vary among the different temperatures tested. C. adamantium seeds can be stored for up to 21 days at temperatures between 5 and 15 ºC without altering their physiological quality. In terms of cost-benefit efficiencies, these seeds can be stored without significant damage for 21 days while still inside the fruits at temperatures of 5, 10 or 15 ºC.

BRCA1 affects lipid synthesis through its interaction with acetyl-CoA carboxylase.

Science.gov (United States)

Moreau, Karen; Dizin, Eva; Ray, Hind; Luquain, Céline; Lefai, Etienne; Foufelle, Fabienne; Billaud, Marc; Lenoir, Gilbert M; Venezia, Nicole Dalla

2006-02-10

Germ line alterations in BRCA1 (breast cancer susceptibility gene 1) are associated with an increased susceptibility to breast and ovarian cancer. BRCA1 acts as a scaffold protein implicated in multiple cellular functions, such as transcription, DNA repair, and ubiquitination. However, the molecular mechanisms responsible for tumorigenesis are not yet fully understood. We have recently demonstrated that BRCA1 interacts in vivo with acetyl coenzyme A carboxylase alpha (ACCA) through its tandem of BRCA1 C terminus (BRCT) domains. To understand the biological function of the BRCA1.ACCA complex, we sought to determine whether BRCA1 is a regulator of lipogenesis through its interaction with ACCA. We showed here that RNA inhibition-mediated down-regulation of BRCA1 expression induced a marked increase in the fatty acid synthesis. We then delineated the biochemical characteristics of the complex and found that BRCA1 interacts solely with the phosphorylated and inactive form of ACCA (P-ACCA). Finally, we demonstrated that BRCA1 affects lipid synthesis by preventing P-ACCA dephosphorylation. These results suggest that BRCA1 affects lipogenesis through binding to P-ACCA, providing a new mechanism by which BRCA1 may exert a tumor suppressor function.

The functional assessment Berg Balance Scale is better capable of estimating fall risk in the elderly than the posturographic Balance Stability System.

Science.gov (United States)

Pereira, Vanessa Vieira; Maia, Roberto Alcantara; Silva, Sonia Maria Cesar de Azevedo

2013-01-01

The purpose of this study was to verify which instrument better identifies recurrent falls in the elderly. Ninety-eight old people, with an average age of 80 ± 4 years, were submitted to an assessment of balance and fall risk by means of the Berg Balance Scale (BBS) and the posturographic Balance Stability System (BSS). The BBS was correlated with the BSS (r=-0.27; p=0.008), age (r=-0.38; pfalls (r=-0.25; p=0.013) and the analysis of logistical regression showed that the elderly classified with fall risk on the BBS presented 2.5 (95%CI 1.08-5.78) more chance of identifying who had two falls or more over the last year. The BBS identified that the greater the age the worse the functional balance and demonstrated a greater capacity to identify falls risk suffered over the last year when compared with the BSS.

The functional assessment Berg Balance Scale is better capable of estimating fall risk in the elderly than the posturographic Balance Stability System

Directory of Open Access Journals (Sweden)

Vanessa Vieira Pereira

2013-01-01

Full Text Available The purpose of this study was to verify which instrument better identifies recurrent falls in the elderly. Ninety-eight old people, with an average age of 80±4 years, were submitted to an assessment of balance and fall risk by means of the Berg Balance Scale (BBS and the posturographic Balance Stability System (BSS. The BBS was correlated with the BSS (r=-0.27; p=0.008, age (r=-0.38; p<0.001 and number of falls (r=-0.25; p=0.013 and the analysis of logistical regression showed that the elderly classified with fall risk on the BBS presented 2.5 (95%CI 1.08-5.78 more chance of identifying who had two falls or more over the last year. The BBS identified that the greater the age the worse the functional balance and demonstrated a greater capacity to identify falls risk suffered over the last year when compared with the BSS.

Chemical and Biological Evaluation of Essential Oils from Two Species of Myrtaceae — Eugenia uniflora L. and Plinia trunciflora (O. Berg Kausel

Directory of Open Access Journals (Sweden)

Marisi G. Soares

2011-11-01

Full Text Available The chemical composition and antimicrobial activity of essential oils obtained from leaves of two Myrtaceae species–Eugenia uniflora L. and Plinia trunciflora (O. Berg Kausel–were determined. Analysis by GC/MS as well as determination of Kovatz indexes indicated atractylone (26.78% and curzerene (17.96% as major constituents of E. uniflora oil and α-cadinol (19.15%, apiole (11.15% and cubenol (5.43% as main components in P. trunciflora oil. Both essential oils were tested for antimicrobial activity against yeasts and bacteria. E. uniflora and P. trunciflora essential oils were active towards two Gram-positive bacteria, Streptococcus equi and Staphylococcus epidermis. In addition, biological activity of both essential oils was detected for pathogenic yeasts of the genus Candida and Cryptococcus. E. uniflora was active towards all yeast tested and exhibited interesting minimal inhibitory concentrations (0.11 to 3.75 mg/mL across a broad spectrum of activity.

BRCA1 and acetyl-CoA carboxylase: the metabolic syndrome of breast cancer.

Science.gov (United States)

Brunet, Joan; Vazquez-Martin, Alejandro; Colomer, Ramon; Graña-Suarez, Begoña; Martin-Castillo, Begoña; Menendez, Javier A

2008-02-01

Breast cancer-associated mutations affecting the highly-conserved C-terminal BRCT domains of the tumor suppressor gene breast cancer susceptibility gene 1 (BRCA1) fully disrupt the ability of BRCA1 to interact with acetyl coenzyme A carboxylase alpha (ACCA), the rate-limiting enzyme catalyzing de novo fatty acid biogenesis. Specifically, BRCA1 interacts solely with the phosphorylated (inactive) form of ACCA (P-ACCA), and the formation of the BRCA1/P-ACCA complex interferes with ACCA activity by preventing P-ACCA dephosphorylation. One of the hallmarks of aggressive cancer cells is a high rate of energy-consuming anabolic processes driving the synthesis of lipids, proteins, and DNA (all of which are regulated by the energy status of the cell). The ability of BRCA1 to stabilize the phosphorylated/inactive form of ACCA strongly suggests that the tumor suppressive function of BRCA1 closely depends on its ability to mimic a cellular-low-energy status, which is known to block tumor cell anabolism and suppress the malignant phenotype. Interestingly, physical exercise and lack of obesity in adolescence have been associated with significantly delayed breast cancer onset for Ashkenazi Jewish women carrying BRCA1 gene mutations. Further clinical work may explore a chemopreventative role of "low-energy-mimickers" deactivating the ACCA-driven "lipogenic phenotype" in women with inherited mutations in BRCA1. This goal might be obtained with current therapeutic approaches useful in treating the metabolic syndrome and associated disorders in humans (e.g., type 2 diabetes and obesity), including metformin, thiazolidinediones (TZDs), calorie deprivation, and exercise. Alternatively, new forthcoming ACCA inhibitors may be relevant in the management of BRCA1-dependent breast cancer susceptibility and development. (c) 2007 Wiley-Liss, Inc.

Usefulness of two clinical chorioamnionitis definitions in predicting neonatal infectious outcomes: a systematic review.

Science.gov (United States)

Avila, Cecilia; Willins, Jennifer L; Jackson, Matthew; Mathai, Jacob; Jabsky, Marina; Kong, Alex; Callaghan, Fiona; Ishkin, Selda; Shroyer, A Laurie W

2015-09-01

To assess the usefulness of two definitions of acute clinical chorioamnionitis (ACCA) in predicting risk of neonatal infectious outcomes (NIO) and mortality, the first definition requiring maternal fever alone (Fever), and the second requiring ≥ 1 Gibbs criterion besides fever (Fever + 1). PubMed, Web of Science, and the Cochrane Database of Systematic Reviews were searched from January 1, 1979 to April 9, 2013. Twelve studies were reviewed (of 316 articles identified): three studies with term patients, four with preterm premature rupture of membranes (PPROM) patients, and five mixed studies with mixed gestational ages and/or membrane status (intact and/or ruptured). Both definitions demonstrated an increased NIO risk for ACCA versus non-ACCA patients, with an odds ratio increase for the Fever + 1 definition that was about twofold larger than the Fever definition. As the Fever definition demonstrated increased NIO risk for ACCA versus non-ACCA patients, the Fever alone ACCA definition should be used to trigger future clinical treatment in many clinical situations. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Chemical composition, antioxidant and antibacterial activities of essential oils from leaves and flowers of Eugenia klotzschiana Berg (Myrtaceae).

Science.gov (United States)

Carneiro, Nárgella S; Alves, Cassia C F; Alves, José M; Egea, Mariana B; Martins, Carlos H G; Silva, Thayná S; Bretanha, Lizandra C; Balleste, Maira P; Micke, Gustavo A; Silveira, Eduardo V; Miranda, Mayker L D

2017-01-01

Many essential oils (EOs) of different plant species possess interesting antimicrobial effects on buccal bacteria and antioxidant properties. Eugenia klotzschiana Berg (pêra-do-cerrado, in Portuguese) is a species of Myrtaceae with restricted distribution in the Cerrado. The essential oils were extracted through the hydrodistillation technique using a modified Clevenger apparatus (2 hours) and chemically characterized by GC-MS. The major compounds were α-copaene (10.6 %) found in oil from leaves in natura, β-bisabolene (17.4 %) in the essential oil from dry leaves and α-(E)-bergamotene (29.9 %) in oil from flowers. The antioxidant activity of essential oils showed similarities in both methods under analysis (DPPH and ABTS˙+) and the results suggested moderate to high antioxidant activity. The antibacterial activity was evaluated by determining minimum inhibitory concentrations (MICs), using the microdilution method. MIC values below 400 µg/mL were obtained against Streptococcus salivarius (200 µg/mL), S. mutans (50 µg/mL), S. mitis (200 µg/mL) and Prevotella nigrescens (50 µg/mL). This is the first report of the chemical composition and antibacterial and antioxidant activities of the essential oils of E. klotzschiana. These results suggest that E. klotzschiana, a Brazilian plant, provide initial evidence of a new and alternative source of substances with medicinal interest.

Report on Sensor Technology for Battlefield and Physical Security Applications.

Science.gov (United States)

1977-07-01

Identification, measurable while others must be estimated. The access authorization and auditing may be satis- number of users, terminals and computers...by the Alarm Classification and Command Assembly ( ACCA ). The ACCA is comprised of visual classification and command status indicators dnd a command... ACCA . All of the subassemblies in the monitoring location are physically configured into a console as depicted in Figure 2. CENTRAL MASTER CONTROL (CMC

Balance ability measured with the Berg balance scale: a determinant of fall history in community-dwelling adults with leg amputation.

Science.gov (United States)

Wong, Christopher Kevin; Chen, Christine C; Blackwell, Wren M; Rahal, Rana T; Benoy, Stephany A

2015-01-01

Falls are common among adults with leg amputations and associated with balance confidence. But subjective confidence is not equivalent with physical ability. This multivariate analyses of community-dwelling adults with leg amputations examined relationships among individual characteristics, falls, balance ability and balance confidence. Cross-sectional study. Community-dwelling adults with leg amputations recruited from a support group and prosthetic clinic. Subjects provided self-reported medical/fall history, prosthetic functional use, and Activities-specific Balance Confidence (ABC) questionnaire data. Balance ability was assessed with the Berg Balance Scale (BBS). Fall incidence was categorized as any fall (one or more) and recurrent falls (more than one). Multivariate logistic regression analyzed relationships within the two fall categories. Cross tabulations and ANOVA analyzed differences among subcategories. Fifty-four subjects (mean age 56.8) with various etiologies, amputation levels, and balance abilities participated. 53.7% had any fall; 25.9% had recurrent falls. Models for both fall categories correctly classified fall history in > 70% of subjects with combinations of the variables ABC, BBS, body-mass-index, and amputation level. Falls occurred regardless of clinical characteristics. Total BBS and select item scores were independent determinants of fall history. Unlike other balance-impaired populations, adults with leg amputation and better balance ability had greater odds of falling.

Composição e variação sazonal do óleo essencial de Myrcia obtecta (O. Berg Kiaersk. var. obtecta, Myrtaceae

Directory of Open Access Journals (Sweden)

Maria Élida Alves Stefanello

Full Text Available Os óleos essenciais, isolados por hidrodestilação de folhas e flores de Myrcia obtecta (O. Berg Kiaersk. var. obtecta, Myrtaceae, coletadas a cada dois meses em Curitiba, Paraná, durante o período de outubro/2005 a agosto/2006, foram analisados por CG e CG/EM. Os óleos das folhas foram caracterizados pelo elevado conteúdo de sesquiterpenos cíclicos (cerca de 70% e quantidades variáveis de monoterpenos (5,6-16,7%, compostos alifáticos (0,4-5,5% e salicilato de metila (0,1-1,5%. Foram identificados 55 componentes, sendo que trans-calameneno (17,029,3% foi o componente majoritário em todas as amostras. Não houve mudanças significativas na composição, excepto em outubro (floração quando α-terpineol e trans-calameneno atingiram os maiores níveis (11,2% e 29,3%, respectivamente. O óleo das flores contém salicilato de metila (89% como constituinte majoritário.

Toxicity of the phenolic extract from jabuticabeira (Myrciaria cauliflora (Mart. O. Berg fruit skins on Spodoptera frugiperda

Directory of Open Access Journals (Sweden)

Ana Paula C Alves

2014-04-01

Full Text Available Fall armyworm, Spodoptera frugiperda J.E. Smith, 1797 (Lepidoptera: Noctuidae is the main pest of maize, besides attacking sorghum and cotton crops. The control of this pest has been accomplished mainly with the use of synthetic insecticides but, due to the growing concern about the environment and food quality, phenolic compounds have shown their potential for the biological control of this insect. Thus, the objective of the present study was to evaluate the efficiency of the extract of jabuticabeira, Myrciaria cauliflora [Mart.] O. Berg (Myrtaceae fruit skin flour in the control of S. frugiperda. Skins of M. cauliflora Sabará genotype were dried at 45 °C in a forced air oven. In order to obtain the extract, 1.0 g flour was mixed with 10 mL acetone: water solution (7:3 v/v. Forty-eight-hour-old S. frugiperda caterpillars were placed in glass tubes with an artificial diet containing the extract at concentrations of 0, 250, 500, 1000, and 2000 mg L-1. The extract, in which the phenolic compounds gallic acid, gallocatechin, catechin, epicatechin, ellagic acid, and salicylic acid were identified at a concentration of 2000 mg L-1, in average, increased mortality rates by 150% in the larval stage, duration of larval stages by 60%, and pupal by 17%, and decreased amount of females by 55%. On the other hand, the extract at 1000 mg L-1 only increased duration of larval period by 24%. It was concluded that the extract is harmful to this insect, probably due to the presence of phenolic compounds.

Dodecafonismo y sociedad de entreguerras. El reflejo del conflicto social en el Wozzeck de Alban berg

Directory of Open Access Journals (Sweden)

BLANCA MUÑOZ

1998-01-01

Full Text Available Si se puede afirmar que la creación artística manifiesta no sólo la situación histórico-espiritual de cada época sino, a la par, sus procesos de conflicto y de cambio, así será precisamente en el período de entreguerras cuando se desarrolle una peculiar y característica correspondencia entre los cambios económicos y políticos y la nueva creación musical formal y temática. El Dodecafonismo al romper con el modelo tonal tradicional e introducir la disonancia no va a representar simplemente una transformación estética cuanto que, por primera vez, las tensiones de la Sociedad de Masas van a cobrar una dimensión artística en la temática operística del siglo XX. En este sentido, la nueva sensibilidad estético-musical expresará el "asalto a la razón" que se está paulatinamente llevando a cabo en la Alemania de Weimar y, especialmente, será la ópera Wozzeck, de Alban Berg, la que mejor refleje la pérdida de identidad de una sociedad que se está relacionando instrumentalmente en la forma de lo que Weber definió como "jaula de hierro". De este modo, las nuevas Sociologías del Arte y de la Cultura contemporáneas vuelven a la crítica cultural desde una perspectiva en la que el análisis de las estructuras estéticas, tanto literarias como musicales, deben ser investigadas como procesos en los que se revelan las contradicciones y antagonismos de cada etapa histórica.

Investigating the host-range of the rust fungus Puccinia psidii sensu lato across tribes of the family Myrtaceae present in Australia.

Directory of Open Access Journals (Sweden)

Louise Morin

Full Text Available The exotic rust fungus Puccinia psidii sensu lato was first detected in Australia in April 2010. This study aimed to determine the host-range potential of this accession of the rust by testing its pathogenicity on plants of 122 taxa, representative of the 15 tribes of the subfamily Myrtoideae in the family Myrtaceae. Each taxon was tested in two separate trials (unless indicated otherwise that comprised up to five replicates per taxon and six replicates of a positive control (Syzygium jambos. No visible symptoms were observed on the following four taxa in either trial: Eucalyptus grandis×camaldulensis, E. moluccana, Lophostemon confertus and Sannantha angusta. Only small chlorotic or necrotic flecks without any uredinia (rust fruiting bodies were observed on inoculated leaves of seven other taxa (Acca sellowiana, Corymbia calophylla 'Rosea', Lophostemon suaveolens, Psidium cattleyanum, P. guajava 'Hawaiian' and 'Indian', Syzygium unipunctatum. Fully-developed uredinia were observed on all replicates across both trials of 28 taxa from 8 tribes belonging to the following 17 genera: Agonis, Austromyrtus, Beaufortia, Callistemon, Calothamnus, Chamelaucium, Darwinia, Eucalyptus, Gossia, Kunzea, Leptospermum, Melaleuca, Metrosideros, Syzygium, Thryptomene, Tristania, Verticordia. In contrast, the remaining 83 taxa inoculated, including the majority of Corymbia and Eucalyptus species, developed a broad range of symptoms, often across the full spectrum, from fully-developed uredinia to no visible symptoms. These results were encouraging as they indicate that some levels of genetic resistance to the rust possibly exist in these taxa. Overall, our results indicated no apparent association between the presence or absence of disease symptoms and the phylogenetic relatedness of taxa. It is most likely that the majority of the thousands of Myrtaceae species found in Australia have the potential to become infected to some degree by the rust, although this

Investigating the Host-Range of the Rust Fungus Puccinia psidii sensu lato across Tribes of the Family Myrtaceae Present in Australia

Science.gov (United States)

Morin, Louise; Aveyard, Ruth; Lidbetter, Jonathan R.; Wilson, Peter G.

2012-01-01

The exotic rust fungus Puccinia psidii sensu lato was first detected in Australia in April 2010. This study aimed to determine the host-range potential of this accession of the rust by testing its pathogenicity on plants of 122 taxa, representative of the 15 tribes of the subfamily Myrtoideae in the family Myrtaceae. Each taxon was tested in two separate trials (unless indicated otherwise) that comprised up to five replicates per taxon and six replicates of a positive control (Syzygium jambos). No visible symptoms were observed on the following four taxa in either trial: Eucalyptus grandis×camaldulensis, E. moluccana, Lophostemon confertus and Sannantha angusta. Only small chlorotic or necrotic flecks without any uredinia (rust fruiting bodies) were observed on inoculated leaves of seven other taxa (Acca sellowiana, Corymbia calophylla ‘Rosea’, Lophostemon suaveolens, Psidium cattleyanum, P. guajava ‘Hawaiian’ and ‘Indian’, Syzygium unipunctatum). Fully-developed uredinia were observed on all replicates across both trials of 28 taxa from 8 tribes belonging to the following 17 genera: Agonis, Austromyrtus, Beaufortia, Callistemon, Calothamnus, Chamelaucium, Darwinia, Eucalyptus, Gossia, Kunzea, Leptospermum, Melaleuca, Metrosideros, Syzygium, Thryptomene, Tristania, Verticordia. In contrast, the remaining 83 taxa inoculated, including the majority of Corymbia and Eucalyptus species, developed a broad range of symptoms, often across the full spectrum, from fully-developed uredinia to no visible symptoms. These results were encouraging as they indicate that some levels of genetic resistance to the rust possibly exist in these taxa. Overall, our results indicated no apparent association between the presence or absence of disease symptoms and the phylogenetic relatedness of taxa. It is most likely that the majority of the thousands of Myrtaceae species found in Australia have the potential to become infected to some degree by the rust, although this wide

Effect of Pulse Polarity on Thresholds and on Non-monotonic Loudness Growth in Cochlear Implant Users.

Science.gov (United States)

Macherey, Olivier; Carlyon, Robert P; Chatron, Jacques; Roman, Stéphane

2017-06-01

Most cochlear implants (CIs) activate their electrodes non-simultaneously in order to eliminate electrical field interactions. However, the membrane of auditory nerve fibers needs time to return to its resting state, causing the probability of firing to a pulse to be affected by previous pulses. Here, we provide new evidence on the effect of pulse polarity and current level on these interactions. In experiment 1, detection thresholds and most comfortable levels (MCLs) were measured in CI users for 100-Hz pulse trains consisting of two consecutive biphasic pulses of the same or of opposite polarity. All combinations of polarities were studied: anodic-cathodic-anodic-cathodic (ACAC), CACA, ACCA, and CAAC. Thresholds were lower when the adjacent phases of the two pulses had the same polarity (ACCA and CAAC) than when they were different (ACAC and CACA). Some subjects showed a lower threshold for ACCA than for CAAC while others showed the opposite trend demonstrating that polarity sensitivity at threshold is genuine and subject- or electrode-dependent. In contrast, anodic (CAAC) pulses always showed a lower MCL than cathodic (ACCA) pulses, confirming previous reports. In experiments 2 and 3, the subjects compared the loudness of several pulse trains differing in current level separately for ACCA and CAAC. For 40 % of the electrodes tested, loudness grew non-monotonically as a function of current level for ACCA but never for CAAC. This finding may relate to a conduction block of the action potentials along the fibers induced by a strong hyperpolarization of their central processes. Further analysis showed that the electrodes showing a lower threshold for ACCA than for CAAC were more likely to yield a non-monotonic loudness growth. It is proposed that polarity sensitivity at threshold reflects the local neural health and that anodic asymmetric pulses should preferably be used to convey sound information while avoiding abnormal loudness percepts.

Straightforward rapid spectrophotometric quantification of total cyanogenic glycosides in fresh and processed cassava products.

Science.gov (United States)

Tivana, Lucas Daniel; Da Cruz Francisco, Jose; Zelder, Felix; Bergenståhl, Bjorn; Dejmek, Petr

2014-09-01

In this study, we extend pioneering studies and demonstrate straightforward applicability of the corrin-based chemosensor, aquacyanocobyrinic acid (ACCA), for the instantaneous detection and rapid quantification of endogenous cyanide in fresh and processed cassava roots. Hydrolytically liberated endogenous cyanide from cyanogenic glycosides (CNp) reacts with ACCA to form dicyanocobyrinic acid (DCCA), accompanied by a change of colour from orange to violet. The method was successfully tested on various cassava samples containing between 6 and 200 mg equiv. HCN/kg as verified with isonicotinate/1,3-dimethylbarbiturate as an independent method. The affinity of ACCA sensor to cyanide is high, coordination occurs fast and the colorimetric response can therefore be instantaneously monitored with spectrophotometric methods. Direct applications of the sensor without need of extensive and laborious extraction processes are demonstrated in water-extracted samples, in acid-extracted samples, and directly on juice drops. ACCA showed high precision with a standard deviation (STDV) between 0.03 and 0.06 and high accuracy (93-96%). Overall, the ACCA procedure is straightforward, safe and easily performed. In a proof-of-concept study, rapid screening of ten samples within 20 min has been tested. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular Cloning and Characterization of Two Genes for the Biotin Carboxylase and Carboxyltransferase Subunits of Acetyl Coenzyme A Carboxylase in Myxococcus xanthus

OpenAIRE

Kimura, Yoshio; Miyake, Rina; Tokumasu, Yushi; Sato, Masayuki

2000-01-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar t...

Occupational Health Screenings of U.S. Air Force Remotely Piloted Aircraft (Drone) Operators

Science.gov (United States)

2014-04-01

Worsened by Their Unit Assignment and Occupational Stress, Proportion Comparisons Medical Condition ACCa ANGb AFSOCc % ACC/ANG p...Proportion Comparisons Self-Reported Reasons (per coded category) ACCa ANGb AFSOCc % ACC/ANG p % AFSOC/ANG p % AFSOC/ACC p n % n % n

Decomposition and nutrient release in leaves of Atlantic Rainforest tree species used in agroforestry systems

NARCIS (Netherlands)

Duarte, E.M.G.; Cardoso, I.M.; Stijnen, T.; Mendonça, M.A.F.C.; Coelho, M.S.; Cantarutti, R.B.; Kuyper, T.W.; Villani, E.M.A.; Mendonça, E.S.

2013-01-01

Aiming to support the use of native species from the Atlantic Rainforest in local agroforestry systems, we analysed chemical and biochemical components related to leaf decomposition of Inga subnuda, Senna macranthera, Erythrina verna, Luehea grandiflora, Zeyheria tuberculosa, Aegiphila sellowiana,

Chemical Characterization and in Vitro Antibacterial Activity of Myrcianthes hallii (O. Berg McVaugh (Myrtaceae, a Traditional Plant Growing in Ecuador

Directory of Open Access Journals (Sweden)

Patricia Chavez Carvajal

2016-06-01

Full Text Available Myrcianthes hallii (O. Berg McVaugh (Myrtaceae is a plant native to Ecuador, traditionally used for its antiseptic properties. The composition of the hydro-methanolic extract of this plant was determined by submitting it to ultra-high performance liquid chromatography (UHPLC hyphenated to heated-electrospray ionization mass spectrometry and UV detection. The presence of antimicrobial components prompted us to test the extract against methicillin-resistant and methicillin-susceptible Staphylococcus aureus, multidrug-resistant and susceptible Escherichia coli, Pseudomonas aeruginosa, Enterococcus spp. and Streptococcus pyogenes strains. The chromatographic analysis led to the identification of 38 compounds, including polyphenols and organic acids, and represents the first chemical characterization of this plant. The extract showed modest antibacterial activity against all tested bacteria, with the exception of E. coli which was found to be less sensitive. Whilst methicillin-resistant strains usually display resistance to several drugs, no relevant differences were observed between methicillin-susceptible and resistant strains. Considering its long-standing use in folk medicine, which suggests the relative safety of the plant, and the presence of many known antibacterial polyphenolic compounds responsible for its antibacterial activity, the results show that M. hallii extract could be used as a potential new antiseptic agent. Moreover, new anti-infective biomaterials and nanomaterials could be designed through the incorporation of M. hallii polyphenols. This prospective biomedical application is also discussed.

APPLICATION OF THE SPECTRUM ANALYSIS WITH USING BERG METHOD TO DEVELOPED SPECIAL SOFTWARE TOOLS FOR OPTICAL VIBRATION DIAGNOSTICS SYSTEM

Directory of Open Access Journals (Sweden)

E. O. Zaitsev

2016-01-01

Full Text Available The objective of this paper is development and experimental verification special software of spectral analysis. Spectral analysis use of controlled vibrations objects. Spectral analysis of vibration based on use maximum-entropy autoregressive method of spectral analysis by the Berg algorithm. For measured signals use preliminary analysis based on regression analysis. This analysis of the signal enables to eliminate uninformative parameters such as – the noise and the trend. For preliminary analysis developed special software tools. Non-contact measurement of mechanical vibrations parameters rotating diffusely-reflecting surfaces used in circumstances where the use of contact sensors difficult or impossible for a number of reasons, including lack of access to the object, the small size of the controlled area controlled portion has a high temperature or is affected by strong electromagnetic fields. For control use offered laser measuring system. This measuring system overcomes the shortcomings interference or Doppler optical measuring systems. Such as measure the large amplitude and inharmonious vibration. On the basis of the proposed methods developed special software tools for use measuring laser system. LabVIEW using for developed special software. Experimental research of the proposed method of vibration signals processing is checked in the analysis of the diagnostic information obtained by measuring the vibration system grinding diamond wheel cold solid tungsten-containing alloy TK8. A result of work special software tools was complex spectrum obtained «purified» from non-informative parameters. Spectrum of the signal corresponding to the vibration process observed object. 

Relationships among the Y balance test, Berg Balance Scale, and lower limb strength in middle-aged and older females

Directory of Open Access Journals (Sweden)

Dong-Kyu Lee

2015-06-01

Full Text Available Background: Older females have less dynamic postural control and muscle strength than do middle-aged females. Aging-related strength losses may limit balancing performance. Objective: The purpose of this study was to investigate the ability of the Y Balance Test (YBT and lower limb strength to discriminate between females in 2 age groups, the relationship between YBT distance and the Berg Balance Scale (BBS, and the degree to which performance on YBT distance is related to lower limb strength in middle-aged and older females. Method: The 40 healthy, independently active females were divided into 2 groups: older and middle-aged. The participants underwent measurements of YBT distance using the YBT, maximal muscular strength of the lower limbs using a handheld dynamometer, and the BBS. Results: The YBT distance in 3 directions and lower limb muscle strength for both lower limbs were significantly lower in the older adults than in the middle-aged group. A moderate correlation but insignificant correlation was found between the YBT composite distance and the BBS score. In the older females, YBT distance was significantly positively correlated with strength of the knee flexor and hip abductor. In the middle-aged group, YBT distance was significantly positively correlated with strength of the knee flexor and hip extensor. Conclusions: Performance on the YBT was influenced by the strength of lower limb. We suggested that YBT can be used to alternative as a measurement of dynamic balance. Proper training programs for older people could include not only strengthening exercises but also YBT performance to improve balance.

Going for Gold: A Path Toward Petroleum-Independence in the 2030 Air Force

Science.gov (United States)

2011-02-16

the X- 55A/Advanced Composite Cargo Aircraft ( ACCA ) and Initial Flight Test Results‖ (paper presented at 54 th SETP Symposium & Banquet, Anaheim, CA... ACCA ) and Initial Flight Test Results.‖ Paper presented at 54 th SETP Symposium & Banquet. Anaheim, CA, September 2010. Sloan, Jeff. ―Skinning

Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

Directory of Open Access Journals (Sweden)

María Poggio

2011-05-01

Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

Studies on the flora of the Guianas 20. The Dorstenia species (Moraceae) of south-eastern tropical America

NARCIS (Netherlands)

Berg, C.C.

1983-01-01

One new species of Dorstenia from Brazil is described: D. carautae C.C. Berg, and four new combinations are made: D. cayapia Vellozo subsp. asaroides (Hooker) C.C. Berg, D. cayapia Vellozo subsp. paraguariensis (Hassler) C.C. Berg, D. cayapia Vellozo subsp. vitifolia (Gardner) C.C. Berg, and D.

Lantana montevidensis Essential Oil: Chemical Composition and Mosquito Repellent Activity against Aedes aegypti

Science.gov (United States)

The essential oil (EO) of Lantana montevidensis (Spreng.) Briq. (L. sellowiana Link & Otto) was investigated for its chemical composition and mosquito repellent activity. The essential oil obtained by hydrodistillation of aerial plant parts was analyzed by GC-FID and GC-MS. The major constituents we...

Locais e período de alimentação da cigarrinha vetora de Xylella fastidiosa, Bucephalogonia xanthophis (Berg (Hemiptera: Cicadellidae, em mudas cítricas Feeding sites and food intake of Bucephalogonia xanthophis (Berg (Hemiptera: Cicadellidae, a sharpshooter vector of Xylella fastidiosa, on citrus plants

Directory of Open Access Journals (Sweden)

Marcelo Pedreira de Miranda

2008-12-01

Full Text Available A cigarrinha Bucephalogonia xanthophis (Berg (Hemiptera: Cicadellidae é um importante vetor da bactéria Xylella fastidiosa, agente causal da clorose variegada dos citros. Este trabalho teve como objetivo identificar o local preferido de alimentação e o período de maior atividade alimentar desta cigarrinha em citros, no sentido de elucidar o comportamento alimentar relacionado à transmissão da bactéria. O local de alimentação foi estudado em ensaio de escolha, no qual 30 insetos adultos foram liberados em gaiolas de observação (n = 10 contendo uma muda de laranja-doce [Citrus sinensis (L. Osbeck]. Após 1; 15; 21; 25; 39; 45 e 49 h da liberação, contaram-se os insetos na parte superior (ramos com brotações e inferior (haste principal, até H"40 cm de altura da muda. Nos ramos da parte superior, avaliou-se a preferência entre a haste, o pecíolo e o limbo foliar. Em um segundo ensaio, 20 machos e 20 fêmeas de B. xanthophis foram confinados individualmente sobre a haste de 'seedlings' de laranja-doce para determinar os períodos de alimentação, quantificando-se a excreção de 'honeydew' (medida indireta da ingestão em períodos sucessivos de dia e noite, durante 48 h. A maioria dos indivíduos de B. xanthophis preferiu a haste dos ramos novos (62%, na parte superior da muda cítrica (91%. Nos 'seedlings', observou-se maior volume de excreção e proporção de indivíduos excretando durante a fotofase, independentemente do sexo. Portanto, em estudos de transmissão de X. fastidiosa, deve-se considerar a preferência de B. xanthophis pela haste de brotações cítricas e sua maior atividade alimentar durante a fotofase.The sharpshooter Bucephalogonia xanthophis (Berg (Hemiptera: Cicadellidae is an important vector of Xylella fastidiosa, a bacterium that causes citrus variegated chlorosis. This study aimed to identify the preferred feeding sites and periods of this vector on citrus, in order to improve our understanding of the

Columbia River wildlife mitigation habitat evaluation procedures report: Scotch Creek Wildlife Area, Berg Brothers, and Douglas County pygmy rabbit projects

International Nuclear Information System (INIS)

Ashley, P.R.; Ratassepp, J.; Berger, M.; Judd, S.L.

1997-01-01

This Habitat Evaluation Procedure study was conducted to determine baseline habitat units (HUs) on the Scotch Creek, Mineral Hill, Pogue Mountain, Chesaw and Tunk Valley Habitat Areas (collectively known as the Scotch Creek Wildlife Area) in Okanogan County, Sagebrush Flat and the Dormaler property in Douglas County, and the Berg Brothers ranch located in Okanogan County within the Colville Reservation. A HEP team comprised of individuals from the Washington Department of Fish and Wildlife, the Confederated Tribes of the Colville Reservation, and the Natural Resources Conservation Service (Appendix A) conducted baseline habitat surveys using the following HEP evaluation species: mule deer (Odocoileus hemionus), sharp-tailed grouse (Tympanuchus phasianellus), pygmy rabbit (Brachylagus idahoensis), white-tailed deer (Odocoileus virginiana), mink (Mustela vison), Canada goose (Branta canadensis), downy woodpecker (Picoides pubescens), Lewis woodpecker (Melanerpes lewis), and Yellow warbler (Dendroica petechia). Results of the HEP analysis are listed below. General ratings (poor, marginal, fair, etc.,) are described in Appendix B. Mule deer habitat was marginal lacking diversity and quantify of suitable browse species. Sharp-tailed grouse habitat was marginal lacking residual nesting cover and suitable winter habitat Pygmy rabbit habitat was in fair condition except for the Dormaier property which was rated marginal due to excessive shrub canopy closure at some sites. This report is an analysis of baseline habitat conditions on mitigation project lands and provides estimated habitat units for mitigation crediting purposes. In addition, information from this document could be used by wildlife habitat managers to develop management strategies for specific project sites

Columbia River Wildlife Mitigation Habitat Evaluation Procedures Report / Scotch Creek Wildlife Area, Berg Brothers, and Douglas County Pygmy Rabbit Projects.

Energy Technology Data Exchange (ETDEWEB)

Ashley, Paul R.

1997-01-01

This Habitat Evaluation Procedure study was conducted to determine baseline habitat units (HUs) on the Scotch Creek, Mineral Hill, Pogue Mountain, Chesaw and Tunk Valley Habitat Areas (collectively known as the Scotch Creek Wildlife Area) in Okanogan County, Sagebrush Flat and the Dormaler property in Douglas County, and the Berg Brothers ranch located in Okanogan County within the Colville Reservation. A HEP team comprised of individuals from the Washington Department of Fish and Wildlife, the Confederated Tribes of the Colville Reservation, and the Natural Resources Conservation Service (Appendix A) conducted baseline habitat surveys using the following HEP evaluation species: mule deer (Odocoileus hemionus), sharp-tailed grouse (Tympanuchus phasianellus), pygmy rabbit (Brachylagus idahoensis), white-tailed deer (Odocoileus virginiana), mink (Mustela vison), Canada goose (Branta canadensis), downy woodpecker (Picoides pubescens), Lewis woodpecker (Melanerpes lewis), and Yellow warbler (Dendroica petechia). Results of the HEP analysis are listed below. General ratings (poor, marginal, fair, etc.,) are described in Appendix B. Mule deer habitat was marginal lacking diversity and quantify of suitable browse species. Sharp-tailed grouse habitat was marginal lacking residual nesting cover and suitable winter habitat Pygmy rabbit habitat was in fair condition except for the Dormaier property which was rated marginal due to excessive shrub canopy closure at some sites. This report is an analysis of baseline habitat conditions on mitigation project lands and provides estimated habitat units for mitigation crediting purposes. In addition, information from this document could be used by wildlife habitat managers to develop management strategies for specific project sites.

The Dorstenia species (Moraceae) of north-western tropical America

NARCIS (Netherlands)

Berg, C.C.; Leeuwen, van R.W.J.

1982-01-01

Four new species of Dorstenia are described: D. panamensis C.C. Berg, D. boliviana C.C. Berg, D. peruviana C.C. Berg, and D. belizensis C.C. Berg. A list of and a key to the 21 Dorstenia species distinguished in north-western tropical America are presented, together with synonyms and distributions.

A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

Science.gov (United States)

Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

2015-09-01

Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

Avaliação da atividade tóxica em Artemia salina e Biomphalaria glabrata de extratos de quatro espécies do gênero Eleocharis (Cyperaceae

Directory of Open Access Journals (Sweden)

A.L.T.G. Ruiz

Full Text Available O gênero Eleocharis R. Br. compreende cerca de 200 espécies, ocorrendo em ambientes úmidos tais como brejos e margens de rios e lagos. Procurando novos agentes moluscicidas, os extratos de Eleocharis acutangula (Roxb. Schult., Eleocharis interstincta (Vahl Roem. & Schult., Eleocharis maculosa (Vahl Roem. & Schult. e Eleocharis sellowiana Kunth foram testados para atividade moluscicida, contra caramujos adultos e desovas, e toxicidade (ensaio de letalidade com Artemia salina. O extrato hexânico de Eleocharis acutangula (parte subterrânea fresca foi ativo contra Artemia salina (CL50 = 476,00 mg/mL, enquanto os demais extratos apresentaram CL50 >> 10³ mg/mL, sugerindo baixa toxicidade. O extrato hidro-etanólico de Eleocharis sellowiana (parte subterrânea fresca foi ativo contra desovas de Biomphalaria glabrata (CL50 = 24,27 mg/mL mas inativo contra indivíduos adultos. Os demais extratos testados não apresentaram atividade moluscicida.

POLA REPRODUKSI PADA SALAK BALI (SA/ACCA ZA/ACCA VAR. AMBOINENSIS (BECC. MOGEA

Directory of Open Access Journals (Sweden)

ENIEK KRISWIYANTI

2008-12-01

Full Text Available Research on reproduction patterns of Balinese snake skin fruits (Salak Bali has been conducted by identifying the availability of pollens on anthers of male and hermaphrodite flowers, the viability of pollens in the pistillum and the present of embryo(s in the ovulum. Flower samples were collected from Sibetan and Muncan Villages, Karangasem regency. Sample preparations and identifications were conducted in "Stuktur dan Perkembangan Tumbuhan Laboratory" Department of Bilogy, FMIPA Udayana University. The results showed that the pollen has a single apperture, unisulcus, minuta, oblat sferoidal type. The length of polar axis was 15-24 jam (P and equatorial diameter of 16-24 |im (E. Therefore, the P/E index was 0.99-1.0. The pollen viability before and after anthesis of hermaphrodite flowers was low (71.4% and 50.6% respectively, with very low pollen tube germinations (0.08% of before and 0.48% after anthesis. Similarly, on the anthers of male flowers, the viability of pollens before anthesis was low (75.7% with pollen germination of 0.18%, and event lower in after anthesis flowers (28.8% with 0.29% pollen tube germination. Squashed stigma before and after anthesis and 2 days after flowers were opened showed that there was no germination occurred. Therefore, there was no germination in the pistillum, but the embryo developed before flower anthesis, indicates that the reproduction pattern of Salak Bali occurred without fertilizations (agamospermy.

Advanced Composite Air Frame Life Cycle Cost Estimating

Science.gov (United States)

2014-06-19

the ACCA based on the cost . This cost analysis takes into account the increased performance parameters of the new airframe structure. This research...20 Advanced Composite Cargo Aircraft ( ACCA ) ..........................................................23 viii Cost Estimation...establishing the procurement strategies and life cycle cost (LCC) model cost estimations. The current LCC models do not take into account the potential cost

Comparison of the Fullerton Advanced Balance Scale, Mini-BESTest, and Berg Balance Scale to Predict Falls in Parkinson Disease.

Science.gov (United States)

Schlenstedt, Christian; Brombacher, Stephanie; Hartwigsen, Gesa; Weisser, Burkhard; Möller, Bettina; Deuschl, Günther

2016-04-01

The correct identification of patients with Parkinson disease (PD) at risk for falling is important to initiate appropriate treatment early. This study compared the Fullerton Advanced Balance (FAB) scale with the Mini-Balance Evaluation Systems Test (Mini-BESTest) and Berg Balance Scale (BBS) to identify individuals with PD at risk for falls and to analyze which of the items of the scales best predict future falls. This was a prospective study to assess predictive criterion-related validity. The study was conducted at a university hospital in an urban community. Eighty-five patients with idiopathic PD (Hoehn and Yahr stages: 1-4) participated in the study. Measures were number of falls (assessed prospectively over 6 months), FAB scale, Mini-BESTest, BBS, and Unified Parkinson's Disease Rating Scale. The FAB scale, Mini-BESTest, and BBS showed similar accuracy to predict future falls, with values for area under the curve (AUC) of the receiver operating characteristic (ROC) curve of 0.68, 0.65, and 0.69, respectively. A model combining the items "tandem stance," "rise to toes," "one-leg stance," "compensatory stepping backward," "turning," and "placing alternate foot on stool" had an AUC of 0.84 of the ROC curve. There was a dropout rate of 19/85 participants. The FAB scale, Mini-BESTest, and BBS provide moderate capacity to predict "fallers" (people with one or more falls) from "nonfallers." Only some items of the 3 scales contribute to the detection of future falls. Clinicians should particularly focus on the item "tandem stance" along with the items "one-leg stance," "rise to toes," "compensatory stepping backward," "turning 360°," and "placing foot on stool" when analyzing postural control deficits related to fall risk. Future research should analyze whether balance training including the aforementioned items is effective in reducing fall risk. © 2016 American Physical Therapy Association.

Muslim Prison Ministry: Hindering the Spread of the Radical, Militant, Violent and Irreconcilable Wing of Islam

Science.gov (United States)

2006-05-25

radical, militant, violent and irreconcilable wing of Islam Approved by: __________________________________ Monograph Director Timothy L . Challans, Ph.D...Honorable Harley Lapin (BOP), Dr. Michael Waller (Institute of World Politics), Mr. Paul Rogers (ACCA), and Mr. A. J. Sabree (ACCA). 78 Ibid., 12...London, United Kingdom: Verso books, 2005. Patai, Raphael. The Arab Mind, Long Island City, NY: Hatherleigh Press, 2002. Pederson , Dick. Defeating

Adsorption of Pb{sup 2+} and Cd{sup 2+} onto a novel activated carbon-chitosan complex

Energy Technology Data Exchange (ETDEWEB)

Ge, H.; Fan, X. [College of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou 510640 (China)

2011-10-15

A novel activated carbon-chitosan complex adsorbent (ACCA) was prepared via the crosslinking of glutaraldehyde and activated carbon-(NH{sub 2}-protected) chitosan complex under microwave irradiation. The surface morphology of this adsorbent was characterized. The adsorption of ACCA for Pb{sup 2+} and Cd{sup 2+} was investigated. The results demonstrate that ACCA has higher adsorption capacity than chitosan. The adsorption follows pseudo first-order kinetics. The isotherm adsorption equilibria are better described by Freundlich and Dubinin-Radushkevich isotherms than by the Langmuir isotherm. The adsorbent can be recycled. These results have important implications for the design of low-cost and effective adsorbents in the removal of heavy metal ions from wastewaters. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Acetyl-CoA carboxylase-a as a novel target for cancer therapy.

Science.gov (United States)

Wang, Chun; Rajput, Sandeep; Watabe, Kounosuke; Liao, Duan-Fang; Cao, Deliang

2010-01-01

Acetyl-CoA carboxylases (ACC) are rate-limiting enzymes in de novo fatty acid synthesis, catalyzing ATP-dependent carboxylation of acetyl-CoA to form malonyl-CoA. Malonyl-CoA is a critical bi-functional molecule, i.e., a substrate of fatty acid synthase (FAS) for acyl chain elongation (fatty acid synthesis) and an inhibitor of carnitine palmitoyltransferase I (CPT-I) for fatty acid beta-oxidation. Two ACC isoforms have been identified in mammals, i.e. ACC-alpha (ACCA, also termed ACC1) and ACC-beta (ACCB, also designated ACC2). ACC has long been used as a target for the management of metabolic diseases, such as obesity and metabolic syndrome, and various inhibitors have been developed in clinical trials. Recently, ACCA up-regulation has been recognized in multiple human cancers, promoting lipogenesis to meet the need of cancer cells for rapid growth and proliferation. Therefore, ACCA might be effective as a potent target for cancer intervention, and the inhibitors developed for the treatment of metabolic diseases would be potential therapeutic agents for cancer therapy. This review summarizes our recent findings and updates the current understanding of the ACCA with focus on cancer research.

Cloning and expression analysis of carboxyltransferase of acetyl-coA carboxylase from Jatropha curcas.

Science.gov (United States)

Xie, Wu-Wei; Gao, Shun; Wang, Sheng-Hua; Zhu, Jin-Qiu; Xu, Ying; Tang, Lin; Chen, Fang

2010-01-01

A full-length cDNA of the carboxyltransferase (accA) gene of acetyl-coenzym A (acetyl-CoA) carboxylase from Jatropha curcas was cloned and sequenced. The gene with an open reading frame (ORF) of 1149 bp encodes a polypeptide of 383 amino acids, with a molecular mass of 41.9 kDa. Utilizing fluorogenic real-time polymerase chain reaction (RT-PCR), the expression levels of the accA gene in leaves and fruits at early, middle and late stages under pH 7.0/8.0 and light/darkness stress were investigated. The expression levels of the accA gene in leaves at early, middle and late stages increased significantly under pH 8.0 stress compared to pH 7.0. Similarly, the expression levels in fruits showed a significant increase under darkness condition compared to the control. Under light stress, the expression levels in the fruits at early, middle and late stages showed the largest fluctuations compared to those of the control. These findings suggested that the expression levels of the accA gene are closely related to the growth conditions and developmental stages in the leaves and fruits of Jatropha curcas.

[Determination of residual solvents in 7-amino-3-chloro cephalosporanic acid by gas chromatography].

Science.gov (United States)

Ma, Li; Yao, Tong-wei

2011-01-01

To develop a gas chromatography method for determination of residual solvents in 7-amino-3-chloro cephalosporanic acid (7-ACCA). The residual levels of acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine and toluene in 7-ACCA were measured by gas chromatography using Agilent INNOWAX capillary column (30 m × 0.32 mm,0.5 μm). The initial column temperature was 70° maintained for 6 min and then raised (10°C/min) to 160°C for 1 min. Nitrogen gas was used as carrier and FID as detector. The flow of carrier was 1.0 ml/min, the temperature of injection port and detector was 200°C and 250°C, respectively. The limits of detection for acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine, toluene in 7-ACCA were 2.5 μg/ml, 1.5 μg/ml, 15 μg/ml, 2.5 μg/ml, 2.5 μg/ml, 2.5 μg/ml and 11 μg/ml, respectively. Only acetone was detected in the sample, and was less than the limits of Ch.P. The method can effectively detect the residual solvents in 7-ACCA.

TOFA (5-tetradecyl-oxy-2-furoic acid) reduces fatty acid synthesis, inhibits expression of AR, neuropilin-1 and Mcl-1 and kills prostate cancer cells independent of p53 status.

Science.gov (United States)

Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B

2011-07-01

A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.

Dynamics of autotrophic marine planktonic thaumarchaeota in the East China Sea.

Directory of Open Access Journals (Sweden)

Anyi Hu

Full Text Available The ubiquitous and abundant distribution of ammonia-oxidizing Thaumarchaeota in marine environments is now well documented, and their crucial role in the global nitrogen cycle has been highlighted. However, the potential contribution of Thaumarchaeota in the carbon cycle remains poorly understood. Here we present for the first time a seasonal investigation on the shelf region (bathymetry≤200 m of the East China Sea (ECS involving analysis of both thaumarchaeal 16S rRNA and autotrophy-related genes (acetyl-CoA carboxylase gene, accA. Quantitative PCR results clearly showed a higher abundance of thaumarchaeal 16S and accA genes in late-autumn (November than summer (August, whereas the diversity and community structure of autotrophic Thaumarchaeota showed no statistically significant difference between different seasons as revealed by thaumarchaeal accA gene clone libraries. Phylogenetic analysis indicated that shallow ecotypes dominated the autotrophic Thaumarchaeota in the ECS shelf (86.3% of total sequences, while a novel non-marine thaumarchaeal accA lineage was identified in the Changjiang estuary in summer (when freshwater plumes become larger but not in autumn, implying that Changjiang freshwater discharge played a certain role in transporting terrestrial microorganisms to the ECS. Multivariate statistical analysis indicated that the biogeography of the autotrophic Thaumarchaeota in the shelf water of the ECS was influenced by complex hydrographic conditions. However, an in silico comparative analysis suggested that the diversity and abundance of the autotrophic Thaumarchaeota might be biased by the 'universal' thaumarchaeal accA gene primers Cren529F/Cren981R since this primer set is likely to miss some members within particular phylogenetic groups. Collectively, this study improved our understanding of the biogeographic patterns of the autotrophic Thaumarchaeota in temperate coastal waters, and suggested that new accA primers with

Dynamics of autotrophic marine planktonic thaumarchaeota in the East China Sea.

Science.gov (United States)

Hu, Anyi; Yang, Zao; Yu, Chang-Ping; Jiao, Nianzhi

2013-01-01

The ubiquitous and abundant distribution of ammonia-oxidizing Thaumarchaeota in marine environments is now well documented, and their crucial role in the global nitrogen cycle has been highlighted. However, the potential contribution of Thaumarchaeota in the carbon cycle remains poorly understood. Here we present for the first time a seasonal investigation on the shelf region (bathymetry≤200 m) of the East China Sea (ECS) involving analysis of both thaumarchaeal 16S rRNA and autotrophy-related genes (acetyl-CoA carboxylase gene, accA). Quantitative PCR results clearly showed a higher abundance of thaumarchaeal 16S and accA genes in late-autumn (November) than summer (August), whereas the diversity and community structure of autotrophic Thaumarchaeota showed no statistically significant difference between different seasons as revealed by thaumarchaeal accA gene clone libraries. Phylogenetic analysis indicated that shallow ecotypes dominated the autotrophic Thaumarchaeota in the ECS shelf (86.3% of total sequences), while a novel non-marine thaumarchaeal accA lineage was identified in the Changjiang estuary in summer (when freshwater plumes become larger) but not in autumn, implying that Changjiang freshwater discharge played a certain role in transporting terrestrial microorganisms to the ECS. Multivariate statistical analysis indicated that the biogeography of the autotrophic Thaumarchaeota in the shelf water of the ECS was influenced by complex hydrographic conditions. However, an in silico comparative analysis suggested that the diversity and abundance of the autotrophic Thaumarchaeota might be biased by the 'universal' thaumarchaeal accA gene primers Cren529F/Cren981R since this primer set is likely to miss some members within particular phylogenetic groups. Collectively, this study improved our understanding of the biogeographic patterns of the autotrophic Thaumarchaeota in temperate coastal waters, and suggested that new accA primers with improved coverage

Final disposal of high-level radioactive waste and/or long-living nuclear waste in a clay formation in the Belgian-Dutch border region; Definitieve berging van hoogradioactief en/of langlevend kernafval in een kleiformatie in de Belgisch-Nederlandse grensstreek

Energy Technology Data Exchange (ETDEWEB)

Weyns, W.

2010-10-15

Recently, the Belgian organization NIRAS presented its 'Draft Waste Plan'. In this plan NIRAS chooses clay as the reference option for final geological disposal of high-level radioactive and/or long-living nuclear waste (b and C waste). The author presents an overview of the current state of affairs in scientific research on underground storage of radioactive waste in Belgian clay layers. [Dutch] Recent presenteerde het Belgische NIRAS het 'Ontwerp Afvalplan'. In dit plan kiest NIRAS als referentieoptie voor definitieve geologische berging van hoogradioactief en/of langlevend kernafval (B- en C-afval) in klei. De auteur geeft een overzicht van de stand van zaken van wetenschappelijk onderzoek naar ondergrondse opslag van radioactief afval in Belgische kleilagen.

Short Berg Balance Scale, BBS-9, as a predictor of fall risk among the aged: a prospective 12-month follow-up study.

Science.gov (United States)

Hohtari-Kivimäki, Ulla; Salminen, Marika; Vahlberg, Tero; Kivelä, Sirkka-Liisa

2013-12-01

The aim of this study was to assess the adequacy of the short, 9-item Berg Balance Scale (BBS-9) to predict fall risk among the community-dwelling aged. The subjects (n = 519) were derived from the participants in a multifactorial fall prevention intervention conducted in Pori, Finland. Receiver operating characteristic (ROC) analysis was used to determine the cut-off score for BBS-9 (range 0-36) to classify aged people with a fall risk during a 12-month follow-up. Logistic regression was used to analyse the relationship of potential confounders with fall risk. The association between the cut-off score for BBS-9 and fall risk was tested using the Chi-square test. In determining the cut-off score of BBS-9 to classify fall risk, the highest sensitivity (0.51) and specificity (0.57) (when both presumed to be above 0.50) sum score was within the limit range 32 scores or below. The area under curve (AUC) was significantly better in the model adjusted for significant confounders (vision and the number of regularly used drugs) (AUC = 0.64) than in the unadjusted model (AUC = 0.57) (p = 0.045). Among patients who scored 32 or below in BBS-9 the incidence of multiple falls was 20.0 %, whereas among those who scored 33-36 it was 15.7 %. BBS-9 with the cut-off score of 32/33 together with data on vision and the number of regularly used drugs predicted moderately the risk of falling among the community-dwelling aged.

Education of mining engineers with the specialization in Rescue, fire and safety technique at the BERG Faculty of the Technical University of Košice

Directory of Open Access Journals (Sweden)

Sedlatý Václav

2002-12-01

Full Text Available After the separation of Czechoslovakia, in 1993, the Mining Faculty (now BERG Faculty of the Technical University of Košice started a teaching program with the specialization in mining rescue, fire guard and safety technique at the Detachment in Prievidza, because of all the needs and conditions related to the education of engineers in the mentioned areas. During the last 10 years, the Detachment in Prievidza has been growing in terms of number of students. From the beginning of this period to present days 75 students graduated. The full-time studies last five years and the academic years are divided into two semesters of 15 weeks each. The semesters are finished by examination sessions. The first 2 years, in principle, include basic studies in mathematics, scientific subjects and some subjects related to earth sciences. The third and fourth year are generally devoted to basic technical subjects of mining and underground works, and then to rescue, fire and safety subjects. A practical work experience has to be gained by students in a mine or fire and safety stations. The practical training term is scheduled after the third academic year. During the last two semesters the students are preparing their Master’s degree thesis using a stay in the mine company or other firms to receive the necessary information and data.

Levantamento de Tibouchina Aubl. (Melastomataceae no Parque Estadual da Serra do Mar – Núcleo Curucutu – São Paulo. Survey of Tibouchina Aubl. (Melastomataceae at the Serra do Mar State Park – Curucutu Nucleous – São Paulo, Brazil.

Directory of Open Access Journals (Sweden)

Cíntia Vieira da SILVA

2005-12-01

Full Text Available Este trabalho consiste no levantamentodas espécies de Tibouchina Aubl. (Melastomataceaeocorrentes no Parque Estadual da Serra do Mar,Núcleo Curucutu, Estado de São Paulo. Foramregistradas sete espécies de Tibouchina:Tibouchina cerastifolia (Naud. Cogn., Tibouchinaclinopodifolia (DC. Cogn., T. fothergillae (DC.Cogn., T. pulchra (Cham. Cogn., T. sellowiana(Cham. Cogn., T. trichopoda (DC. Baill. eT. virgata (Gard. Cogn. Para reconhecimento dasespécies são apresentadas chave analítica, descrições,ilustrações, observações fenológicas, distribuiçãogeográfica e comentários.This work is a survey of the species ofTibouchina Aubl. (Melastomataceae at the Serra doMar State Park, Curucutu Nucleus, situated inSão Paulo State. Seven species were recordedfor Tibouchina: T. cerastifolia (Naud. Cogn.,T. clinopodifolia (DC Cogn., T. fothergillae (DC.Cogn., T. pulchra (Cham. Cogn., T. sellowiana(Cham. Cogn., T. trichopoda (DC. Baill.and T. virgata (Gard. Cogn. Analytical key,descriptions, illustrations, phenological observations,geographic distribution and comments on thespecies are presented.

Community structure and function of planktonic Crenarchaeota: changes with depth in the South China Sea.

Science.gov (United States)

Hu, Anyi; Jiao, Nianzhi; Zhang, Chuanlun L

2011-10-01

Marine Crenarchaeota represent a widespread and abundant microbial group in marine ecosystems. Here, we investigated the abundance, diversity, and distribution of planktonic Crenarchaeota in the epi-, meso-, and bathypelagic zones at three stations in the South China Sea (SCS) by analysis of crenarchaeal 16S rRNA gene, ammonia monooxygenase gene amoA involved in ammonia oxidation, and biotin carboxylase gene accA putatively involved in archaeal CO(2) fixation. Quantitative PCR analyses indicated that crenarchaeal amoA and accA gene abundances varied similarly with archaeal and crenarchaeal 16S rRNA gene abundances at all stations, except that crenarchaeal accA genes were almost absent in the epipelagic zone. Ratios of the crenarchaeal amoA gene to 16S rRNA gene abundances decreased ~2.6 times from the epi- to bathypelagic zones, whereas the ratios of crenarchaeal accA gene to marine group I crenarchaeal 16S rRNA gene or to crenarchaeal amoA gene abundances increased with depth, suggesting that the metabolism of Crenarchaeota may change from the epi- to meso- or bathypelagic zones. Denaturing gradient gel electrophoresis profiling of the 16S rRNA genes revealed depth partitioning in archaeal community structures. Clone libraries of crenarchaeal amoA and accA genes showed two clusters: the "shallow" cluster was exclusively derived from epipelagic water and the "deep" cluster was from meso- and/or bathypelagic waters, suggesting that niche partitioning may take place between the shallow and deep marine Crenarchaeota. Overall, our results show strong depth partitioning of crenarchaeal populations in the SCS and suggest a shift in their community structure and ecological function with increasing depth.

Seasonal cultivated and fallow cropland mapping using MODIS-based automated cropland classification algorithm

Science.gov (United States)

Wu, Zhuoting; Thenkabail, Prasad S.; Mueller, Rick; Zakzeski, Audra; Melton, Forrest; Johnson, Lee; Rosevelt, Carolyn; Dwyer, John; Jones, Jeanine; Verdin, James P.

2014-01-01

Increasing drought occurrences and growing populations demand accurate, routine, and consistent cultivated and fallow cropland products to enable water and food security analysis. The overarching goal of this research was to develop and test automated cropland classification algorithm (ACCA) that provide accurate, consistent, and repeatable information on seasonal cultivated as well as seasonal fallow cropland extents and areas based on the Moderate Resolution Imaging Spectroradiometer remote sensing data. Seasonal ACCA development process involves writing series of iterative decision tree codes to separate cultivated and fallow croplands from noncroplands, aiming to accurately mirror reliable reference data sources. A pixel-by-pixel accuracy assessment when compared with the U.S. Department of Agriculture (USDA) cropland data showed, on average, a producer's accuracy of 93% and a user's accuracy of 85% across all months. Further, ACCA-derived cropland maps agreed well with the USDA Farm Service Agency crop acreage-reported data for both cultivated and fallow croplands with R-square values over 0.7 and field surveys with an accuracy of ≥95% for cultivated croplands and ≥76% for fallow croplands. Our results demonstrated the ability of ACCA to generate cropland products, such as cultivated and fallow cropland extents and areas, accurately, automatically, and repeatedly throughout the growing season.

Antibodies against glucan, chitin, and Saccharomyces cerevisiae mannan as new biomarkers of Candida albicans infection that complement tests based on C. albicans mannan.

Science.gov (United States)

Sendid, B; Dotan, N; Nseir, S; Savaux, C; Vandewalle, P; Standaert, A; Zerimech, F; Guery, B P; Dukler, A; Colombel, J F; Poulain, D

2008-12-01

Antibodies against Saccharomyces cerevisiae mannan (ASCA) and antibodies against synthetic disaccharide fragments of glucans (ALCA) and chitin (ACCA) are biomarkers of Crohn's disease (CD). We previously showed that Candida albicans infection generates ASCA. Here, we explored ALCA and ACCA as possible biomarkers of invasive C. albicans infection (ICI). ASCA, ALCA, ACCA, and Candida mannan antigen and antibody detection tests were performed on 69 sera obtained sequentially from 18 patients with ICIs proven by blood culture, 59 sera from CD patients, 47 sera from hospitalized subjects colonized by Candida species (CZ), and 131 sera from healthy controls (HC). ASCA, ALCA, and ACCA levels in CD and ICI patients were significantly different from those in CZ and HC subjects (PACCA, and Platelia Candida tests, 100% of ICIs were detected, with the kinetics of the antibody response depending on the patient during the time course of infection. A large number of sera presented with more than three positive tests. This is the first evidence that the detection of antibodies against chitin and glucans has diagnostic value in fungal infections and that these tests can complement more specific tests. Future trials are necessary to assess the value of these tests in multiparametric analysis, as well as their pathophysiological relevance.

Seasonal cultivated and fallow cropland mapping using MODIS-based automated cropland classification algorithm

Science.gov (United States)

Wu, Zhuoting; Thenkabail, Prasad S.; Mueller, Rick; Zakzeski, Audra; Melton, Forrest; Johnson, Lee; Rosevelt, Carolyn; Dwyer, John; Jones, Jeanine; Verdin, James P.

2014-01-01

Increasing drought occurrences and growing populations demand accurate, routine, and consistent cultivated and fallow cropland products to enable water and food security analysis. The overarching goal of this research was to develop and test automated cropland classification algorithm (ACCA) that provide accurate, consistent, and repeatable information on seasonal cultivated as well as seasonal fallow cropland extents and areas based on the Moderate Resolution Imaging Spectroradiometer remote sensing data. Seasonal ACCA development process involves writing series of iterative decision tree codes to separate cultivated and fallow croplands from noncroplands, aiming to accurately mirror reliable reference data sources. A pixel-by-pixel accuracy assessment when compared with the U.S. Department of Agriculture (USDA) cropland data showed, on average, a producer’s accuracy of 93% and a user’s accuracy of 85% across all months. Further, ACCA-derived cropland maps agreed well with the USDA Farm Service Agency crop acreage-reported data for both cultivated and fallow croplands with R-square values over 0.7 and field surveys with an accuracy of ≥95% for cultivated croplands and ≥76% for fallow croplands. Our results demonstrated the ability of ACCA to generate cropland products, such as cultivated and fallow cropland extents and areas, accurately, automatically, and repeatedly throughout the growing season.

Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis

Science.gov (United States)

Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang

2009-01-01

Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551

Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.

Science.gov (United States)

Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang

2009-07-31

Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.

Accounting for carbon

OpenAIRE

Lovell, Heather; Sales de Aguiar, Thereza; Bebbington, Jan; Larrinaga-Gonzalez, Carlos; International Emissions Trading Association

2010-01-01

ACCA working in partnership with IETA This report reveals how large emitters in the European Emissions Trading Scheme (EU ETS) are accounting for emission allowances. The diversity of emission-allowance accounting practices being used in Europe shows carbon financial accounting to be in its formative stages - rules and practices are still unsettled. With this report, ACCA, in partnership with IETA, is opening up the debate to a wider international audience. Publisher PDF

Comparison of the Mini-Balance Evaluations Systems Test with the Berg Balance Scale in relationship to walking speed and motor recovery post stroke.

Science.gov (United States)

Madhavan, Sangeetha; Bishnoi, Alka

2017-12-01

The Mini-BESTest is a recently developed balance assessment tool that incorporates challenging dynamic balance tasks. Few studies have compared the psychometric properties of the Mini-BESTest to the commonly used Berg Balance Scale (BBS). However, the utility of these scales in relationship to post stroke walking speeds has not been explored. The purpose of this study was to compare the sensitivity and specificity of the Mini-BESTest and BBS to evaluate walking speeds in individuals with stroke. A retrospective exploratory design. Forty-one individuals with chronic stroke were evaluated with the Mini-BESTest, BBS, and 10-meter self-selected walk test (10MWT). Based on their self-selected gait speeds (below or above 0.8 m/s), participants were classified as slow and fast walkers. Significant linear correlations were observed between the Mini-BESTest vs. BBS (r = 0.72, p ≤ 0.001), Mini-BESTest vs. 10MWT (r = 0.58, p ≤ 0.001), and BBS vs. 10MWT (r = 0.30, p = 0.05). Independent t-tests comparing the balance scores for the slow and fast walkers revealed significant group differences for the Mini-BESTest (p = 0.003), but not for the BBS (p = 0.09). The Mini-BESTest demonstrated higher sensitivity (93%) and specificity (64%) compared to the BBS (sensitivity 81%, specificity 56%) for discriminating participants into slow and fast walkers. The Mini-BESTest has a greater discriminative ability than the BBS to categorize individuals with stroke into slow and fast walkers.

Effects of sucrose and irradiance on germination and early gametophyte growth of the endangered tree fern Dicksonia sellowiana Hook (Dicksoniaceae Efeito da sacarose e irradiância na germinação e crescimento inicial do gametófito da samambaia arbórea Dicksonia sellowiana Hook (Dicksoniaceae em perigo de extinção

Directory of Open Access Journals (Sweden)

Gladys Daniela Rogge Renner

2004-06-01

Full Text Available It is an endangered tree fern that grows in mixed umbrophylus forests in the tropics. Sterilized spores were germinated at 25 ± 2ºC under a 16-hour photoperiod, in Dyer and MS medium supplemented with 0 to 5% sucrose. The germination was lower with the addition of sucrose. Dry mass was higher in 30-day-old gametophytes cultivated in Dyer medium with the addition of 3 to 5% of sucrose. The dry mass decreased in 30-day-old gametophytes cultivated in Dyer and MS media without sucrose and in MS medium with the addition of 4 or 5% of sucrose. The effect of different irradiance on the germination and early gametophyte development of D. sellowiana was analyzed in the autumn of 1998 (May until July. Conical flasks containing spores were kept over a period of 49 days in 50cm³ boxes covered with black shade netting, which gave 5, 20, 36 and 50% of irradiance. The lower mean germination time was observed for spores cultivated under 5% and 20% of irradiance. The highest chlorophyll content was recorded in gametophytes cultivated for 49 days under 20% and 5% of irradiance .The highest soluble sugar content was recorded in gametophytes cultivated under 5% and 20% of irradiance.Esta samambaia arbórea ameaçada de extinção ocorre na floresta ombrófila mista, nos trópicos. Esporos esterilizados germinaram a 25 ± 2ºC em fotoperíodo de 16 horas, em meios de Dyer e MS, acrescidos de 0 a 5% de sacarose. A massa seca foi maior em gametófitos de 30 dias de idade, cultivados em meio Dyer com adição de 3% a 5% de sacarose e em meio MS com adição de 2% de sacarose. A massa seca diminuiu em gametófitos crescidos em meios Dyer e MS na ausência de sacarose e em meio MS acrescido de 5% de sacarose. O efeito de diferentes irradiâncias na germinação e desenvolvimento inicial de gametófitos foi analisado no outono de 1998 (de maio a julho. Frascos cônicos contendo esporos foram mantidos durante 49 dias dentro de caixas de 50cm³ revestidas por telas que

Software for Avionics.

Science.gov (United States)

1983-01-01

fonctions gfinbrales et lea uti- litaires fournis en particulier grice 41 UNIX, sont intfigrfs aelon divers points de vue: - par leur accas 41 travers le...Are They Really A Problem? Proceedings, 2nd International Conference On Software Engineering, pp 91-68. Long acCA : IEEE Computer Society. Britton...CD The Hague. Nc KLEINSCIIMIDT, M. Dr Fa. LITEF. Poatfach 774. 7800 Freiburg i. Br., Ge KLEMM, R. Dr FGAN- FFM , D 5 307 Watchberg-Werthhoven. Ge KLENK

Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment

Science.gov (United States)

2010-08-01

overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10

The structural and electro-optical characteristics of AZO/Cr:Cu/AZO transparent conductive film

International Nuclear Information System (INIS)

Lin, Tien-Chai; Huang, Wen-Chang; Tsai, Fu-Chun

2015-01-01

A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO (ACCA), was presented in the paper. The structural and electro-optical properties of the ACCA film were discussed. The thickness of the middle metal layer was constant and those of the AZO layers were varied. The ACCA film shows an obvious ZnO (002) c-axis preferential growth. No diffraction peaks related to Cr and Cu were observed through x-ray diffraction analysis. The middle Cr:Cu layer showed a thickness of 8.16 nm with a continuous and amorphous structure by the observation of a high-resolution transmission electron microscopy (HR-TEM). For the electro-optical characteristic, a best figure of merit (FOM) value of 3.54 × 10 −3 Ω −1 with a corresponding transmittance of 85% was obtained at the thickness of 116 nm of ACCA film. The high FOM value of the film is due to the improvement of conductivity and small sacrifices of transparency. - Highlights: • A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO is developed. • Chromium is added to copper to reduce the oxidation–reduction reaction. • The film has a FOM of 3.54 × 10 −3 Ω −1 with a corresponding transmittance of 85%. • The Cr:Cu layer shows a continuous and amorphous structure

Secretory carcinoma of the breast and its histopathological mimics: value of markers for differential diagnosis.

Science.gov (United States)

Osako, Tomo; Takeuchi, Kengo; Horii, Rie; Iwase, Takuji; Akiyama, Futoshi

2013-10-01

Secretory carcinoma (SC) is a rare histological type of breast cancer, and ETV6-NTRK3 gene fusion is highly specific to it. The differential diagnoses of SC include acinic cell carcinoma (ACCA) and cystic hypersecretory carcinoma (CHC), as well as invasive ductal carcinoma (IDC). For patients with these rare but distinctive histological subtypes, SC and its histopathological mimics should be differentiated from each other. However, differential markers have not yet been assessed systematically, and we aimed to identify and evaluate novel and existing markers. We reviewed 19 cases diagnosed initially as SC using integrated diagnostic techniques, including morphology, immunohistochemistry and molecular pathology, and validated promising markers in 445 breast cancers. We reclassified 19 formerly diagnosed 'SCs' into nine SCs, three ACCAs, three CHCs, three IDCs and one microglandular adenosis. We confirmed that ETV6-NTRK3 gene rearrangement and amylase positivity are good diagnostic markers for SC and ACCA, respectively. Vacuolar staining for adipophilin, positivity for α-lactalbumin and negativity for ETV6 rearrangement are diagnostic markers for CHC. In this study, we propose a panel of four markers (ETV6 rearrangement, amylase, α-lactalbumin and adipophilin) for distinguishing SC, ACCA, CHC and IDC. This simple but robust panel will serve pathologists well as a practical guide for reaching an appropriate diagnosis. © 2013 John Wiley & Sons Ltd.

The structural and electro-optical characteristics of AZO/Cr:Cu/AZO transparent conductive film

Energy Technology Data Exchange (ETDEWEB)

Lin, Tien-Chai [Department of Electrical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China); Huang, Wen-Chang, E-mail: wchuang@mail.ksu.edu.tw [Department of Electro-Optical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China); Tsai, Fu-Chun [Department of Electro-Optical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China)

2015-08-31

A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO (ACCA), was presented in the paper. The structural and electro-optical properties of the ACCA film were discussed. The thickness of the middle metal layer was constant and those of the AZO layers were varied. The ACCA film shows an obvious ZnO (002) c-axis preferential growth. No diffraction peaks related to Cr and Cu were observed through x-ray diffraction analysis. The middle Cr:Cu layer showed a thickness of 8.16 nm with a continuous and amorphous structure by the observation of a high-resolution transmission electron microscopy (HR-TEM). For the electro-optical characteristic, a best figure of merit (FOM) value of 3.54 × 10{sup −3} Ω{sup −1} with a corresponding transmittance of 85% was obtained at the thickness of 116 nm of ACCA film. The high FOM value of the film is due to the improvement of conductivity and small sacrifices of transparency. - Highlights: • A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO is developed. • Chromium is added to copper to reduce the oxidation–reduction reaction. • The film has a FOM of 3.54 × 10{sup −3} Ω{sup −1} with a corresponding transmittance of 85%. • The Cr:Cu layer shows a continuous and amorphous structure.

Functioning adrenal tumours in children and adolescents: an institutional experience.

Science.gov (United States)

Mishra, A; Agarwal, G; Misra, A K; Agarwal, A; Mishra, S K

2001-02-01

The purpose of the present paper was to carry out an audit of clinicopathological profile and treatment outcome in 13 children with functioning adrenal tumours. The medical records of 13 children with functioning adrenal tumours who were managed between June 1990 and January 1999 were reviewed. Demographic data, clinical features, biochemical and localization studies, operative details and follow-up records were studied. Children with neuroblastoma were excluded. The mean age was 7.4 +/- 5.3 years. Seven patients had Cushing's syndrome (CS), two patients had virilizing tumours, three patients had phaeochromocytoma (PCC) and one patient had Conn's syndrome. All patients (except one child with CS) were treated surgically. Two children with adrenocortical carcinoma (ACCa) died during the perioperative period. Histopathological diagnosis was adrenal cortical adenoma (ACAd) in four patients, ACCa in five patients and PCC in three patients. Two ACCa patients died of metastases at 12 and 14 months, respectively, while the third is alive and well at 30 months. Children with ACAd are alive and well at 91, 56, 32 and 27 months postoperatively. Children with PCC are free of disease (normal urinary metanephrines) at 63, 18 and 8 months after surgery but require antihypertensive drugs in low doses. The outcome of surgery is good in cases of ACAd and PCC. Although outcome is poor in ACCa, surgery remains the mainstay of treatment and offers good palliation.

[Molecular biology, darwinism and nomogenesis].

Science.gov (United States)

Vol'kenshteĭn, M V

1987-01-01

The theory of nomogenesis put forward by L. S. Berg in 1922 is discussed. It is shown that side by side with some erroneous anti-darwinian ideas the theory contains a series of important suggestions which anticipate the further development of the synthetic theory of evolution. Berg has foreseen the development of molecular biology. Thus he was the fore-teller of our branch of science. The theory of nomogenesis emphasized the limitations of natural selection which determine the directionality of evolution. Berg treated the speciation as a kind of phase transition. Even the most conscientious critics of Berg have misrepresented the real sense of his works. It is totally groundless to treat nomogenesis as an idealistic of Lamarkian theory. Berg was superior to his critics. However the enthusiasm about nomogenesis in our time shows the inability to separate "the grains from weeds".

Comparing the Fullerton Advanced Balance Scale with the Mini-BESTest and Berg Balance Scale to assess postural control in patients with Parkinson disease.

Science.gov (United States)

Schlenstedt, Christian; Brombacher, Stephanie; Hartwigsen, Gesa; Weisser, Burkhard; Möller, Bettina; Deuschl, Günther

2015-02-01

To validate the Fullerton Advanced Balance (FAB) Scale for patients with idiopathic Parkinson disease (PD); and to compare the FAB Scale with the Mini-Balance Evaluation Systems Test (Mini-BESTest) and Berg Balance Scale (BBS). Observational study to assess concurrent validity, test-retest, and interrater reliability of the FAB Scale in patients with PD and to compare the distribution of the scale with the Mini-BESTest and BBS. University hospital in an urban community. Patients with idiopathic PD (N=85; Hoehn and Yahr stages 1-4). Not applicable. FAB Scale, Mini-BESTest, BBS, timed Up and Go test, Unified Parkinson's Disease Rating Scale, and visual analog scale. Interrater (3 raters) and test-retest (3±1 d) reliability were high for all scales (ICCs≥.95). The FAB Scale was highly correlated with the Mini-BESTest (Spearman ρ=.87) and timed Up and Go test item of the Mini-BESTest (Spearman ρ=.83). In contrast with the BBS, the FAB Scale and Mini-BESTest have only minimal ceiling effects. The FAB Scale demonstrated the most symmetric distribution when compared with the Mini-BESTest and BBS (skewness: FAB scale: -.54; Mini-BESTest: -1.07; BBS: -2.14). The FAB Scale is a valid and reliable tool to assess postural control in patients with PD. No ceiling effect was noted for the FAB Scale. Although the items of the FAB Scale are more detailed when compared with the Mini-BESTest, interrater and test-retest reliability were excellent. The scale is a promising tool to detect small changes of the postural control system in individuals with PD. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Integreret rapportering i praksis

DEFF Research Database (Denmark)

Pontoppidan, Caroline Aggestam; Sonnerfeldt, Amanda

2017-01-01

Formålet med denne artikel er at bidrage til en dybere forståelse af fænomenet integreret rapporte-ring () og, hvordan IIRC’s begrebsramme afspejles i praksis i virksomheder og af interessen-ter. Artiklen tager udgangspunkt i nyere empiriske forskningsprojekter, som bringer viden omkring......; 1) brugeres (stakeholders) informationsbehov, herunder anvendelsen og nytteværdien af og 2) praktiske udfordringer samt ’best practice’ tendenser inden for (ACCA, 2016; ACCA 2017; AcE, 2017; IFAC 2017)....

Proceedings of the Annual Symposium of Frequency Control (43rd) Held in Denver, Colorado on 31 May - 2 June 1989

Science.gov (United States)

1989-01-01

determined by using a mobile earth OW .F’ Mv TJM station and by calculating the Sagnac effect. Td us f ot- Several auditional stations will participate in...a0Mlerad alon theX drecton.SC-cut, four-point mount acca -leratedalong the X direction, along the X direction. FREOUENCY SHIrT IN 1l SC-CUT rOR Txx Taz...removing mapped figure errors. Ailthough PCE is highly acca - gen compensates for the higher evaporation rate ot the hotter rate and repeatable without

Design, Construction, Testing and Evaluation of a Residential Ice Storage Air Conditioning System.

Science.gov (United States)

1982-11-01

handler and chilled water coil from previous research. This was a necessity because of the financial constraints of ] the project. 2. The trailer was...Load lbs ice/12 hr Calculation Btuh req’d @ 8 FLEOB 1. NFPA 501 BM 25,043 1391 2. ACCA Manual J 27,571 1537 using manufacturer’sdata 3. ACCA Manual J...kilowatt hrf - ~0.197 (N da• y The equivalent ice requirement was estimated using the above data and 144 Btu/pound of ice. This does not account for any

Engineering Design Handbook. Helicopter Engineering. Part Two. Detail Design

Science.gov (United States)

1976-01-01

lubrication, the splines and the monoball oc- ge’~ll ar pity -agd stac mt uis brekawy snip v casionzily require lubricationforce. F6 , A~sj, the di~aphiag tc 5v...being stowed ian aminimum volum, so as Hap sad daue co a be Wooatd in accas *.m M~ to isseff-a with the traosport of cor.. wi& MaL4T.5M= so that the men...helicopter to If lubrication is required, fittings must be located placement of modules - limited piece-part replace- where accas is possible using

Advanced asymmetric synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid by alkylation/cyclization of newly designed axially chiral Ni(II) complex of glycine Schiff base.

Science.gov (United States)

Kawashima, Aki; Shu, Shuangjie; Takeda, Ryosuke; Kawamura, Akie; Sato, Tatsunori; Moriwaki, Hiroki; Wang, Jiang; Izawa, Kunisuke; Aceña, José Luis; Soloshonok, Vadim A; Liu, Hong

2016-04-01

Asymmetric synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is in extremely high demand due to the pharmaceutical importance of this tailor-made, sterically constrained α-amino acid. Here we report the development of an advanced procedure for preparation of the target amino acid via two-step SN2 and SN2' alkylation of novel axially chiral nucleophilic glycine equivalent. Excellent yields and diastereoselectivity coupled with reliable and easy scalability render this method of immediate use for practical synthesis of (1R,2S)-vinyl-ACCA.

Optimization of Selected Remote Sensing Algorithms for Embedded NVIDIA Kepler GPU Architecture

Science.gov (United States)

Riha, Lubomir; Le Moigne, Jacqueline; El-Ghazawi, Tarek

2015-01-01

This paper evaluates the potential of embedded Graphic Processing Units in the Nvidias Tegra K1 for onboard processing. The performance is compared to a general purpose multi-core CPU and full fledge GPU accelerator. This study uses two algorithms: Wavelet Spectral Dimension Reduction of Hyperspectral Imagery and Automated Cloud-Cover Assessment (ACCA) Algorithm. Tegra K1 achieved 51 for ACCA algorithm and 20 for the dimension reduction algorithm, as compared to the performance of the high-end 8-core server Intel Xeon CPU with 13.5 times higher power consumption.

Fort Drum Preliminary Fiscal Impact Analysis: Technical Appendices,

Science.gov (United States)

1986-01-01

the Capital Expenditure table are those normally included in "equipment and capital outlay" by the New York State Department of Audit and Control...19 . - - C a a * -~- -- - - e a aa - - -- - C a c z - =----- -- a X- - - - Z.-.- -- -- - - a - - - I . Ch ... .aCa aC... - "-a C " fl C ana~ acca ...a - I m a - * Sa a - - S a -* ma m aaamn n * a -- a a a * a a C~0aaa~ aCCa -----------,a a 0~ an a a - - - - ma a a . - a * - aa a a a S a - a

Detection of Naturally Occurring Gear and Bearing Faults in a Helicopter Drivetrain

Science.gov (United States)

2014-01-01

Detection of Naturally Occurring Gear and Bearing Faults in a Helicopter Drivetrain by Kelsen E. LaBerge, Eric C. Ames, and Brian D. Dykas...5066 ARL-TR-6795 January 2014 Detection of Naturally Occurring Gear and Bearing Faults in a Helicopter Drivetrain Kelsen E. LaBerge...ELEMENT NUMBER 6. AUTHOR(S) Kelsen E. LaBerge, Eric C. Ames, and Brian D. Dykas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER

A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens.

Directory of Open Access Journals (Sweden)

Abbas El Sahili

2015-08-01

Full Text Available Periplasmic binding proteins (PBPs in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3'-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the

A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens.

Science.gov (United States)

El Sahili, Abbas; Li, Si-Zhe; Lang, Julien; Virus, Cornelia; Planamente, Sara; Ahmar, Mohammed; Guimaraes, Beatriz G; Aumont-Nicaise, Magali; Vigouroux, Armelle; Soulère, Laurent; Reader, John; Queneau, Yves; Faure, Denis; Moréra, Solange

2015-08-01

Periplasmic binding proteins (PBPs) in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3'-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the rational design of

Abelhas visitantes nas flores da jabuticabeira (Myrciaria cauliflora Berg. e produção de frutos - DOI: 10.4025/actascianimsci.v26i1.1890 Bees visits associated to Brazilian grape tree flowers (Myrciaria cauliflora Berg. and fruit production - DOI: 10.4025/actascianimsci.v26i1.1890

Directory of Open Access Journals (Sweden)

Regina Helena Nogueira-Couto

2004-04-01

Full Text Available O objetivo deste trabalho foi verificar a atratividade das flores da jabuticabeira (Myrciaria cauliflora Berg. para os insetos, o comportamento, o tipo de coleta e o efeito dessas visitas na produção de frutos. Foram observados o tempo de desenvolvimento e a quantidade de açúcar solúvel do néctar de flores; os insetos e o tipo de coleta desses insetos. Foram marcados 400 botões florais (200 descobertos e 200 cobertos, para impedir a visita dos insetos. A duração da flor foi de 48 ± 4,6 horas. A quantidade de açúcar solúvel foi baixa (7.14 ± 0.70µg glicose/flor e semelhante entre os horários. As abelhas Apis mellifera, Tetragonisca angustula, Chloralictus sp e Trigona spinipes foram os únicos insetos nas flores (98,0%, 0,88%, 0,57% e 0,55%, respectivamente e coletaram exclusivamente pólen. A porcentagem de frutificação não foi diferente nos tratamentos coberto (19,80% e descoberto (18,62%, mostrando que a presença das abelhas não afetou a produção.This research aimed to verify the Brazilian grape tree flowers’ Myrciaria cauliflora attraction to insects, including their behaviour, sample kind and effect of insect visits on fruit production. The development time and the amount of flower’s nectar soluble sugar, the insects and sample kind were observed. Four hundred flower buds were tagged (200 covered and 200 uncovered, with 5 replications to determine fruiting percentage. Only the bees Apis mellifera, Tetragonisca angustula, Chloralictus sp and Trigona spinipes visited the flowers (98.0, 0.88, 0.57 and 0.55%, respectively, collecting exclusively pollen. Percentage of fruiting did not differ between covered (19.80% and uncovered (18.62% treatments, showing that the bees visits did not affect fruit production.

Droplet Size and Liquid Water Characteristics of the USAAEFA (CH-47) Helicopter Spray System and Natural Clouds as Sampled by a JUH-1H Helicopter.

Science.gov (United States)

1980-08-01

o080Atalea Cal lolna 9" C’ lelephone 121 3) 79, .I 9" lee f6 5A2i A S.,&,osa’fr o MC CALIBRAT ION REPORT Date: 1/8/80 Instrument: ASSP-l 00-1 Size Size...c% c l a a 0 -1 a*’ ac e a***cca *a c a am a*ca c acca =aac ca~ac caaa U𔃺 C C C C0 C C C C C C C C Q C C C C C C C> C C C C C C C CD C C C C CD 0 a C...C C atI 0 l C 0 .C C 0 0 QC 0 0 0 c CD C c 0 C C 0 Q 0 CIC C C0 C 0 C C> C go 1 C 0j C C C QC 0 QQO0COQC=C0c 00CC =1C Q0c cC aCCa CSQ --- -V -, -7

Stabilization of Angiotensin-(1-7) by key substitution with a cyclic non-natural amino acid.

Science.gov (United States)

Wester, Anita; Devocelle, Marc; Tallant, E Ann; Chappell, Mark C; Gallagher, Patricia E; Paradisi, Francesca

2017-10-01

Angiotensin-(1-7) [Ang-(1-7)], a heptapeptide hormone of the renin-angiotensin-aldosterone system, is a promising candidate as a treatment for cancer that reflects its anti-proliferative and anti-angiogenic properties. However, the peptide's therapeutic potential is limited by the short half-life and low bioavailability resulting from rapid enzymatic metabolism by peptidases including angiotensin-converting enzyme (ACE) and dipeptidyl peptidase 3 (DPP 3). We report the facile assembly of three novel Ang-(1-7) analogues by solid-phase peptide synthesis which incorporates the cyclic non-natural δ-amino acid ACCA. The analogues containing the ACCA substitution at the site of ACE cleavage exhibit complete resistance to human ACE, while substitution at the DDP 3 cleavage site provided stability against DPP 3 hydrolysis. Furthermore, the analogues retain the anti-proliferative properties of Ang-(1-7) against the 4T1 and HT-1080 cancer cell lines. These results suggest that ACCA-substituted Ang-(1-7) analogues which show resistance against proteolytic degradation by peptidases known to hydrolyze the native heptapeptide may be novel therapeutics in the treatment of cancer.

Evidence against translational repression by the carboxyltransferase component of Escherichia coli acetyl coenzyme A carboxylase.

Science.gov (United States)

Smith, Alexander C; Cronan, John E

2014-11-01

In Escherichia coli, synthesis of the malonyl coenzyme A (malonyl-CoA) required for membrane lipid synthesis is catalyzed by acetyl-CoA carboxylase, a large complex composed of four subunits. The subunit proteins are needed in a defined stoichiometry, and it remains unclear how such production is achieved since the proteins are encoded at three different loci. Meades and coworkers (G. Meades, Jr., B. K. Benson, A. Grove, and G. L. Waldrop, Nucleic Acids Res. 38:1217-1227, 2010, doi:http://dx.doi.org/10.1093/nar/gkp1079) reported that coordinated production of the AccA and AccD subunits is due to a translational repression mechanism exerted by the proteins themselves. The AccA and AccD subunits form the carboxyltransferase (CT) heterotetramer that catalyzes the second partial reaction of acetyl-CoA carboxylase. Meades et al. reported that CT tetramers bind the central portions of the accA and accD mRNAs and block their translation in vitro. However, long mRNA molecules (500 to 600 bases) were required for CT binding, but such long mRNA molecules devoid of ribosomes seemed unlikely to exist in vivo. This, plus problematical aspects of the data reported by Meades and coworkers, led us to perform in vivo experiments to test CT tetramer-mediated translational repression of the accA and accD mRNAs. We report that increased levels of CT tetramer have no detectable effect on translation of the CT subunit mRNAs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

EXPOSÉ DE POLITIQUE DU PROGRAMME ACCA

International Development Research Centre (IDRC) Digital Library (Canada)

afin qu'elle soit plus accessible aux utilisateurs que les prévisions saisonnières nationales brutes. Ces plateformes ont resserré la communication entre des acteurs de la chaîne de l'information qui n'ont pas l'habitude de travailler ensemble. Ce processus collaboratif sur l'information climatique saisonnière a eu pour effet ...

AGARD (Advisory Group for Aerospace Research & Development) Index of Publications, 1986-1988

Science.gov (United States)

1989-08-01

paper looks in rather more detail (AGARD-LS.147) Avaii NTIS HC A07’MF A01 at how non inear FFM may Le Replied in support of structral These lecture...p 24H 1160 19923 0 net laInar- -ae.le.. tol 10 stdy Iho tne. OS (RNNE -1loopua In entocl~on le-1. sharing T_ accas -a Iu la.. any din a bepetaton...gudnc 173 Ni89 1706 IcAaAR A-2541 p 14 88828883 radon target doxintangootoosianga ragn of ihot RADAR RESOLUTION QUALITY CONTROL accaes P t3O N87-18744

Cumulative percent energy deposition of photon beam incident on different targets, simulated by Monte Carlo

International Nuclear Information System (INIS)

Kandic, A.; Jevremovic, T.; Boreli, F.

1989-01-01

Monte Carlo simulation (without secondary radiation) of the standard photon interactions (Compton scattering, photoelectric absorption and pair protection) for the complex slab's geometry is used in numerical code ACCA. A typical ACCA run will yield: (a) transmission of primary photon radiation differential in energy, (b) the spectrum of energy deposited in the target as a function of position and (c) the cumulative percent energy deposition as a function of position. A cumulative percent energy deposition of photon monoenergetic beam incident on simplest and complexity tissue slab and Fe slab are presented in this paper. (author). 5 refs.; 2 figs

Elements of Dynamic Programming,

Science.gov (United States)

1981-02-02

step/pitch lies in the fact that us ia .o eacerprise P, cf means x". to enter.rise P2 - means xan sc L Jsing widely used teraiAo.j, :onrrol U, it is... acca ~acj ,,L ra sauticn of protlem. Is qenertity intuitively it ii cliax thi-t with at. increat-e in the number aoc = 80151502 FAG E of stips/pitches...Ad.aua inccme W*.. 5S on the ,raph/curve Fig. 9.10 bitn ;.A Leut Z, = 0.75.x2 + 0.3 (Z, - xl); it is obtained value w. 4 . .o.& acca ayq.n they are

Berliini! Berliini! / Maimu Berg

Index Scriptorium Estoniae

Berg, Maimu, 1945-

1999-01-01

Ehitusjärgus uuest Berliinist. Uksed avanud Riigipäevahoonest (arhitekt Paul Wallot, ümberehituse projekteerijate juht sir Norman Foster, kupli sisekujundaja taani disainer Per Arnoldi), Juudi muuseumist (arhitekt Daniel Liebeskind). Berliini projekteerima kutsutud arhitekte

Leerstellen, weiße Flecken und blassrote Zeichen im Schnee. Von Sinnverlust und Sinnfindung im mythischen Land der Kham-Nomaden in Christoph Ransmayrs Roman «Der fliegende Berg»[Blank Spots, White Flecks and Pale Red Signs in the Snow. Of Meaning Lost and Found in the Mythical Land of the Kham Nomads in Christoph Ransmayr’s Novel «The Flying Mountain»

Directory of Open Access Journals (Sweden)

Gabriele Eichmanns Maier

2017-06-01

Full Text Available In his novel Der fliegende Berg, Christoph Ransmayr plays with seemingly contradictory myths that surround the Himalayan mountain Phur-Ri, a mountain that is not marked on any maps and symbolizes a void, a figment of the imagination that serves as a foil for unfulfilled longings and desires. Using Roland Barthes and Mircea Eliade as its theoretical framework, this article analyzes the function of myths in Ransmayr’s novel and explores whether his use of myth can fill the void with meaning – or whether the void remains a vacuum that repells rather than allows for any form of signification.

KERAGAMAN VEGETASI GULMA DI BAWAH TEGAKAN POHON KARET ( Hevea brasiliensis PADA UMUR DAN ARAH LERENG YANG BERBEDA DI PTPN IX BANYUMAS

Directory of Open Access Journals (Sweden)

Bhaskara Anggarda Gathot Subroto

2018-02-01

Full Text Available This research was conducted in PTPN IX Afdeling Krumput Banyumas in July 2016, with observational survey method is by field orientation, exploration, and analysis of vegetation. The data collection is done by means of interviews and direct observation. Preliminary surveys conducted to seek information from relevant agencies, environmental conditions around the rubber planting. The main survey is done to take samples of weeds in every age group, every group performed 5 times the sampling is considered to represent the age group. The variables measured were type of weed, SDR, and the coefficient Communities (C.The results showed that the weed dominant in the younger age group (1-5 years: Cyperus Kyllingia, Axonopus compressus, Clibadium Surinames, adolescent age group (6-10 years: Cyperus Kyllingia, Paspalum conjugatum Berg, Calopogonium mucuinoides Desv., Group age youth (11-15 years: Cyperus Kyllingia, Paspalum conjugatum Berg, Chromolaena odorata., adult group (16-20 years: Eleusine indica, Paspalum conjugatum Berg, Chromolaena odorata, then the dominant weeds on the slopes of the West-East direction (BT is Calopogonium mucuinoides Desv., Clibadium Surinames, Paspalum conjugatum Berg, and the dominant weed species in the North-South direction of the slope (US is Calopogonium mucuinoides Desv., Paspalum conjugatum Berg., and Axonopus compressus. Weeds dominant age group and Directions Slope is Cyperus killingia and Eleusine indica (L, Paspalum conjugatum Berg, Axonopus compressus, Clibadium Surinames and Calopogonium mucuinoides Desv.Keywords : weeds, rubber tree, group age, slopes, SDR

Leg strength or velocity of movement: which is more influential on the balance of mobility limited elders?

Science.gov (United States)

Mayson, Douglas J; Kiely, Dan K; LaRose, Sharon I; Bean, Jonathan F

2008-12-01

To determine which component of leg power (maximal limb strength or limb velocity) is more influential on balance performance in mobility limited elders. In this cross-sectional analysis we evaluated 138 community-dwelling older adults with mobility limitation. Balance was measured using the Unipedal Stance Test, the Berg Balance Test (BERG), the Dynamic Gait Index, and the performance-oriented mobility assessment. We measured one repetition maximum strength and power at 40% one repetition maximum strength, from which velocity was calculated. The associations between maximal estimated leg strength and velocity with balance performance were examined using separate multivariate logistic regression models. Strength was found to be associated [odds ratio of 1.06 (95% confidence interval, 1.01-1.11)] with performance on the Unipedal Stance Test, whereas velocity showed no statistically significant association. In contrast, velocity was consistently associated with performance on all composite measures of balance (BERG 14.23 [1.84-109.72], performance-oriented mobility assessment 33.92 [3.69-312.03], and Dynamic Gait Index 35.80 [4.77-268.71]). Strength was only associated with the BERG 1.08 (1.01-1.14). Higher leg press velocity is associated with better performance on the BERG, performance-oriented mobility assessment, and Dynamic Gait Index, whereas greater leg strength is associated with better performance on the Unipedal Stance Test and the BERG. These findings are likely related to the intrinsic qualities of each test and emphasize the relevance of limb velocity.

A comparison of performance of automatic cloud coverage assessment algorithm for Formosat-2 image using clustering-based and spatial thresholding methods

Science.gov (United States)

Hsu, Kuo-Hsien

2012-11-01

Formosat-2 image is a kind of high-spatial-resolution (2 meters GSD) remote sensing satellite data, which includes one panchromatic band and four multispectral bands (Blue, Green, Red, near-infrared). An essential sector in the daily processing of received Formosat-2 image is to estimate the cloud statistic of image using Automatic Cloud Coverage Assessment (ACCA) algorithm. The information of cloud statistic of image is subsequently recorded as an important metadata for image product catalog. In this paper, we propose an ACCA method with two consecutive stages: preprocessing and post-processing analysis. For pre-processing analysis, the un-supervised K-means classification, Sobel's method, thresholding method, non-cloudy pixels reexamination, and cross-band filter method are implemented in sequence for cloud statistic determination. For post-processing analysis, Box-Counting fractal method is implemented. In other words, the cloud statistic is firstly determined via pre-processing analysis, the correctness of cloud statistic of image of different spectral band is eventually cross-examined qualitatively and quantitatively via post-processing analysis. The selection of an appropriate thresholding method is very critical to the result of ACCA method. Therefore, in this work, We firstly conduct a series of experiments of the clustering-based and spatial thresholding methods that include Otsu's, Local Entropy(LE), Joint Entropy(JE), Global Entropy(GE), and Global Relative Entropy(GRE) method, for performance comparison. The result shows that Otsu's and GE methods both perform better than others for Formosat-2 image. Additionally, our proposed ACCA method by selecting Otsu's method as the threshoding method has successfully extracted the cloudy pixels of Formosat-2 image for accurate cloud statistic estimation.

Numerical Study of the Buoyancy-Driven Flow in a Four-Electrode Rectangular Electrochemical Cell

Science.gov (United States)

Sun, Zhanyu; Agafonov, Vadim; Rice, Catherine; Bindler, Jacob

2009-11-01

Two-dimensional numerical simulation is done on the buoyancy-driven flow in a four-electrode rectangular electrochemical cell. Two kinds of electrode layouts, the anode-cathode-cathode-anode (ACCA) and the cathode-anode-anode-cathode (CAAC) layouts, are studied. In the ACCA layout, the two anodes are placed close to the channel outlets while the two cathodes are located between the two anodes. The CAAC layout can be converted from the ACCA layout by applying higher electric potential on the two middle electrodes. Density gradient was generated by the electrodic reaction I3^-+2e^- =3I^-. When the electrochemical cell is accelerated axially, buoyancy-driven flow occurs. In our model, electro-neutrality is assumed except at the electrodes. The Navier-Stokes equations with the Boussinesq approximation and the Nernst-Planck equations are employed to model the momentum and mass transports, respectively. It is found that under a given axial acceleration, the electrolyte density between the two middle electrodes determines the bulk flow through the electrochemical cell. The cathodic current difference is found to be able to measure the applied acceleration. Other important electro-hydrodynamic characteristics are also discussed.

Development of the Landsat Data Continuity Mission Cloud Cover Assessment Algorithms

Science.gov (United States)

Scaramuzza, Pat; Bouchard, M.A.; Dwyer, John L.

2012-01-01

The upcoming launch of the Operational Land Imager (OLI) will start the next era of the Landsat program. However, the Automated Cloud-Cover Assessment (CCA) (ACCA) algorithm used on Landsat 7 requires a thermal band and is thus not suited for OLI. There will be a thermal instrument on the Landsat Data Continuity Mission (LDCM)-the Thermal Infrared Sensor-which may not be available during all OLI collections. This illustrates a need for CCA for LDCM in the absence of thermal data. To research possibilities for full-resolution OLI cloud assessment, a global data set of 207 Landsat 7 scenes with manually generated cloud masks was created. It was used to evaluate the ACCA algorithm, showing that the algorithm correctly classified 79.9% of a standard test subset of 3.95 109 pixels. The data set was also used to develop and validate two successor algorithms for use with OLI data-one derived from an off-the-shelf machine learning package and one based on ACCA but enhanced by a simple neural network. These comprehensive CCA algorithms were shown to correctly classify pixels as cloudy or clear 88.5% and 89.7% of the time, respectively.

Coal combustion products: trash or treasure?

Energy Technology Data Exchange (ETDEWEB)

Hansen, T.

2006-07-15

Coal combustion by-products can be a valuable resource to various industries. The American Coal Ash Association (ACAA) collects data on production and uses of coal combustion products (CCPs). 122.5 million tons of CCPs were produced in 2004. The article discusses the results of the ACCA's 2004 survey. Fly ash is predominantly used as a substitute for Portland cement; bottom ash for structural fill, embankments and paved road cases. Synthetic gypsum from the FGD process is commonly used in wallboard. Plant owners are only likely to have a buyer for a portion of their CCPs. Although sale of hot water (from Antelope Valley Station) from condensers for use in a fish farm to raise tilapia proved unviable, the Great Plains Synfuels Plant which manufactures natural gas from lignite produces a wide range of products including anhydrous ammonia, phenol, krypton, carbon dioxide (for enhanced oil recovery), tar oils and liquid nitrogen. ACCA's goal is to educate people about CCPs and how to make them into useful products, and market them, in order to reduce waste disposal and enhance revenue. The article lists members of the ACCA. 2 photos., 1 tab.

Demonstration of Thermal Stripping of JP-4 and Other VOCs from Soils at Tinker Air Force Base Oklahoma City, Oklahoma

Science.gov (United States)

1990-03-01

alof basedles app dtch. 7 he is tade dew b proosed Vgla ayb Ceontamintant Ionc s tomectses for i bvuto Oefui e fe avda -𔃺Abtelee ae f6 = vsW...cu__teApcue i ee~n be mede acca ~nrd to the provisions to MA4IinS h trave i o AoObtoi esf § 25L for casia-by-case nenkatlovsaf tea of Aie solvents.i Duo...U61a eu,1=4tk’z tn~Jusiing equivulent~ satndsr& Gop nia~ an orýtreplezztfo h prvso itc o T&?O* 1.es POWuVer, acca agtoorized a State M=1 13r .13 &~n

Reappraisal of paleomagnetic data from Gargano (South Italy)

NARCIS (Netherlands)

Vandenberg, J.

1983-01-01

VandenBerg, J., 1983. Reappraisal of paleomagnetic data from Gargano (South Italy). In: E. McClelland Brown and J. VandenBerg (Editors), Palaeomagnetism of Orogenic Belts. Tectonophysics, 98: 29-41. The platform limestones of Apulia (Italy) outcropping in the Gargano peninsula have been

Evolution of the U.S. Army aviation during Operation Enduring Freedom in Afghanistan

Science.gov (United States)

2015-06-12

40 Bruce L. Berg and Howard Lune , Qualitative Research Methods for the Social Sciences (Boston, MA: Pearson, 2004...a Time of War.” Monograph, School of Advanced Military Studies, 2006. Berg, Bruce L., and Howard Lune . Qualitative Research Methods for the Social

Leg Strength or Velocity of Movement Which Is More Influential on the Balance of Mobility Limited Elders?

Science.gov (United States)

Mayson, Douglas J.; Kiely, Dan K.; LaRose, Sharon I.; Bean, Jonathan F.

2009-01-01

Objective To determine which component of leg power (maximal limb strength or limb velocity) is more influential on balance performance in mobility limited elders. Design In this cross-sectional analysis we evaluated 138 community-dwelling older adults with mobility limitation. Balance was measured using the Unipedal Stance Test, the Berg Balance Test (BERG), the Dynamic Gait Index, and the performance-oriented mobility assessment. We measured one repetition maximum strength and power at 40% one repetition maximum strength, from which velocity was calculated. The associations between maximal estimated leg strength and velocity with balance performance were examined using separate multivariate logistic regression models. Results Strength was found to be associated [odds ratio of 1.06 (95% confidence interval, 1.01–1.11)] with performance on the Unipedal Stance Test, whereas velocity showed no statistically significant association. In contrast, velocity was consistently associated with performance on all composite measures of balance [BERG 14.23 (1.84–109.72), performance-oriented mobility assessment 33.92 (3.69–312.03), and Dynamic Gait Index 35.80 (4.77–268.71))]. Strength was only associated with the BERG 1.08 (1.01–1.14). Conclusions Higher leg press velocity is associated with better performance on the BERG, performance-oriented mobility assessment, and Dynamic Gait Index, whereas greater leg strength is associated with better performance on the Unipedal Stance Test and the BERG. These findings are likely related to the intrinsic qualities of each test and emphasize the relevance of limb velocity. PMID:19033758

Subtribos Eugeniinae O. Berg e Myrtinae O. Berg (Myrtaceae na Restinga da Marambaia, RJ, Brasil Subtribes Eugeniinae O. Berg and Myrtinae O. Berg (Myrtaceae at Marambaia Restinga, Rio de Janeiro State, Brazil

Directory of Open Access Journals (Sweden)

Marcelo da Costa Souza

2008-09-01

Full Text Available Myrtaceae é uma das famílias com maior riqueza de espécies nas Restingas. O objetivo deste trabalho foi o levantamento das subtribos Eugeniinae e Myrtinae (Myrtaceae nas diferentes formações vegetais da Restinga da Marambaia, no Estado do Rio de Janeiro (43º32' e 44º01'W; 23º01' e 23º06'S. Foram registrados 17 táxons para Eugeniinae e quatro para Myrtinae, sendo a subtribo com maior número de espécies Eugeniinae. Apresenta-se uma chave de identificação para as espécies, bem como descrições, ilustrações, dados relativos às épocas de floração e de frutificação e distribuição geográfica.The Myrtaceae is one of the most species-rich families in "restinga" vegetation. This study aimed to survey the subtribes Eugeniinae and Myrtinae (Myrtaceae within the different vegetation types at Marambaia Restinga, in Rio de Janeiro state, Brazil (43º32' - 44º01'W; 23º01' - 23º06'S. Seventeen taxa of Eugeniinae and four of Myrtinae were found, the subtribe with greatest number of species being the Eugeniinae. A species key is presented, as well as descriptions, illustrations, data on flowering and fruiting periods, and the geographic distribution of these species.

Electromagnetic and quantum measurements a bitemporal neoclassical theory

CERN Document Server

Wessel-Berg, Tore

2001-01-01

It is a pleasure to write a foreword for Professor Tore Wessel-Berg's book, "Electromagnetic and Quantum Measurements: A Bitemporal Neoclassical Theory." This book appeals to me for several reasons. The most important is that, in this book, Wessel-Berg breaks from the pack. The distinguished astrophysicist Thomas Gold has written about the pressures on scientists to move in tight formation, to avoid having their legs nipped by the sheepdogs of science. This book demonstrates that Wessel-Berg is willing to take that risk. I confess that I do not sufficiently understand this book to be able to either agree or disagree with its thesis. Nevertheless, Wessel-Berg makes very cogent arguments for setting out on his journey. The basic equations of physics are indeed time-reversible. Our experience, that leads us to the concept of an "arrow of time," is derived from macro­ scopic phenomena, not from fundamental microscopic phenomena. For this reason, it makes very good sense to explore the consequences of treating mi...

Anticarbohydrate antibodies as markers of inflammatory bowel disease in a Central European cohort.

Science.gov (United States)

Malickova, Karin; Lakatos, Peter L; Bortlik, Martin; Komarek, Viktor; Janatkova, Ivana; Lukas, Milan

2010-02-01

The study discusses the role of antichitobioside carbohydrate antibody (ACCA), antilaminaribioside carbohydrate antibodies (ALCA), and antimannobioside carbohydrate antibodies (AMCA) in Central European patients with inflammatory bowel disease (IBD). Twohundred and seventy-two serum samples were used - 116 Crohn's disease (CD), 84 ulcerative colitis, and 72 healthy control samples. All samples were evaluated using enzyme-linked immunosorbent assay for the following four anticarbohydrate assays: ACCA, ALCA, AMCA, and anti-Saccharomyces cerevisiae antibodies (gASCA). gASCA antibodies showed the highest sensitivity (67%) for a CD diagnosis, followed by AMCA (31%), ACCA (27%), and ALCA (25%). Positivity of at least one of the four assays increased the overall sensitivity of antibody testing in CD up to 85.5%. Mean serum gASCA levels were significantly higher in CD patients who were younger at diagnosis and had a longer disease duration before blood sampling (PACCA, and ALCA) antibodies and CD location, behavior, age at onset, and disease duration was found; however, that sample size of some of our subgroups was probably too small to make firm conclusions on associations with all CD phenotypes. None of the assessed anticarbohydrate assays was predictive of colonic CD in patients in whom the distinction between CD and ulcerative colitis is not obvious using routine diagnostic methods. There was no relationship between the presence or concentration of anticarbohydrate antibodies and the inflammation measured by C-reactive protein levels. The use of a panel of anticarbohydrate antibodies may provide additional help in distinguishing IBD from non-IBD disease patterns. The addition of AMCA, ALCA, and ACCA assays as IBD serology markers improves the overall sensitivity of immunological examinations in IBD; however, anticarbohydrate assays are not helpful for predicting CD behavior.

Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number, Fiscal Year 1992 (Transtainer System-ZZYZK)

Science.gov (United States)

1993-01-01

FFm ...EU a a- a 7- a a) axa ( 0) E acca - aaw wa w w) I ’a a w IH aCC ~~ BC).-) rJ~)D~~ 04r -. raz z n -Ha C 0 al C) aj t0- - I a O a a - a "U-u4 a ~ 0.-- a...z’aC a’a’ a G.’ -L X1a-.a- m m- W a to ~ ~ :D ’-l’ a’ f .- a.,- aCca 0 ( a ’ n -aa. ~ a-aaa-’- - Iwo -. a-a .a--a’t ~ ’a cc - - , a I. a~~J..IJ~t~aa

Windshear Case Study: Denver, Colorado, July 11, 1988

Science.gov (United States)

1989-11-01

04/03/88 JR) GTF 1850 120 SC.T 250 -OVC: 45 032/83/40/n7/973/TC -.W 04COAS NE-E AND SW-NW GTF 1750 200 -SCT 250 -OVC 45 041/81/48/1306/?76/ ACCAS NE...2104/96) P: WND ; 000 /WSHFT 04 ACCAS S+W RS 1848 ----------------- ENROLITE TERMINAL FORECASTS:----------------- OMA FT11 111717 80 SCT 250 -BKN...Llvina TZz:i - 17 2 I / WPOMI 07/11/10 )ffZ=: 22:09:0@ @ ffM : 22: 09: 0 me! up or:p or -0 SA MR a I,92 - - , . va://94 7t2 18i1:S OA~tR 07/1/m w MInqu

Real-Time Implementation of a Speech Digitization Algorithm Combining Time-Domain Harmonic Scaling and Adaptive Residual Coding. Volume 2.

Science.gov (United States)

1983-06-01

V4.0 MODULE PAGE 6 LOC OBJ LINE SOURCE STATEMENT 0 0178 30 275 Sim () 0179 F3 276 DI 277 ; 017A C38700 278 JP PXNXT 279 ; 0000 280 END RSTOO I6 j 6 B.3...003E XOR ACCB,IDB 0089 003F LD! ITR,000H 0090 0040 SPOS: LDI eg,-6 0091 0041 OP NOV @K,A 0092 0042 OP SUB ACCA ,IDD 0092 0042 NOV £NONRO 0092 0042...004B NOv NON,RP / 0102 004C OP XCHG ACCA 1$ STEP BITS .1 0102 004C NOV @RPv 0103 004D OP ADD ACCAIDB 0103 004D NOV @NONtRO ; le ADD CORD *1 0104 004E OP

Turbulence Spectral Widths View Angle Independence as Observed by Doppler Radar

Science.gov (United States)

1989-10-01

t, 1*+ 0 1T t+ ( 10) 2.+ 1I+. 3 3 1 9 Z1 9 1 1 21 S I 10 30 .. 1 11 30 49 3 D. 10 33 !’~3 . 02 2. F6 ’ -36 6 3 6 5 so 6 6 31 If., 68r t+.+ I’. . . .I... ACCA . .. AbA Co. CA•,A~ ... . ... C . .* CC~ CC C .... AC ... C . AC... CC CC . . . .. AAA C A 52CCC.CCCC A C AC. 51. CC 37. A. CACC C Cb...coeCcients b t e. and CCC ’l C. ..... .. o. oCA . .... °AACAA CC * C ... C 12.)0 35. 39. ’.. ’.5. A.. 37. 51 . 18. A• ACCA CCCCCCCCCCCCCCCCCCCCCC

Readressing the role of Toll-like receptor-4 alleles in inflammatory bowel disease: colitis, smoking, and seroreactivity.

Science.gov (United States)

Manolakis, Anastassios C; Kapsoritakis, Andreas N; Kapsoritaki, Anastasia; Tiaka, Elisavet K; Oikonomou, Konstantinos A; Lotis, Vassilis; Vamvakopoulou, Dimitra; Davidi, Ioanna; Vamvakopoulos, Nikolaos; Potamianos, Spyros P

2013-02-01

Toll-like receptor (TLR) polymorphisms, and especially TLR-4 Asp299Gly and TLR-4 Thr399Ile, have been linked with Crohn's disease (CD) and to a lesser extent with ulcerative colitis (UC), CD behavior, and compromised seroreactivity to microbial antigens. Available data, however, are conflicting. To address these issues, the distribution of TLR-4 polymorphic alleles was assessed in patients with UC, CD, and healthy controls (HC), considering patient and disease characteristics as well as related serological markers. TLR-4 Asp299Gly and TLR-4 Thr399Ile polymorphisms were determined in 187 UC and 163 CD patients and 274 randomly selected HC. C reactive protein, anti-Saccharomyces cerevisiae mannan antibodies, anti-mannobioside carbohydrate antibodies, anti-laminariobioside carbohydrate antibodies IgG, and anti-chitobioside carbohydrate antibodies (ACCA) IgA levels were also assessed. UC and especially pancolitis patients carried the mutant alleles more frequently compared to CD patients and HC or UC patients with different disease extents (P = 0.002 and P ACCA IgA were lower in inflammatory bowel disease (IBD) patients carrying the mutant compared to those with wild-type alleles (0.075 ACCA IgA levels. Smoking reduces the extent of UC, even in the presence of mutant alleles.

Enhanced Enzymatic Synthesis of a Cephalosporin, Cefadroclor, in the Presence of Organic Co-solvents.

Science.gov (United States)

Liu, Kun; Li, Sha; Pang, Xiao; Xu, Zheng; Li, Dengchao; Xu, Hong

2017-05-01

In this study, we investigated the enzymatic synthesis of a semi-synthetic cephalosporin, cefadroclor, from 7-aminodesacetoxymethyl-3-chlorocephalosporanic acid (7-ACCA) and p-OH-phenylglycine methyl ester (D-HPGM) using immobilized penicillin G acylase (IPA) in organic co-solvents. Ethylene glycol (EG) was employed as a component of the reaction mixture to improve the yield of cefadroclor. EG was found to increase the yield of cefadroclor by 15-45%. An investigation of altered reaction parameters including type and concentration of organic solvents, pH of reaction media, reaction temperature, molar ratio of substrates, enzyme loading, and IPA recycling was carried out in the buffer mixture. The best result was a 76.5% conversion of 7-ACCA, which was obtained from the reaction containing 20% EG (v/v), D-HPGM to 7-ACCA molar ratio of 4:1 and pH 6.2, catalyzed by 16 IU mL -1 IPA at 20 °C for 10 h. Under the optimum conditions, no significant loss of IPA activity was found after seven repeated reaction cycles. In addition, cefadroclor exhibited strong inhibitory activity against yeast, Bacillus subtilis NX-2, and Escherichia coli and weaker activity against Staphylococcus aureus and Pseudomonas aeruginosa. Cefadroclor is a potential antibiotic with activity against common pathogenic microorganisms.

Frutescent species of the genus Dorstenia L. (Moraceae) in the Paleotropics

NARCIS (Netherlands)

Hijman, Maria E.E.

1980-01-01

A revision is presented of the group of frutescent Dorstenia species with a single row of appendages on the margin of the receptacle which occur in rain-forest areas of tropical Africa. The group comprises : D. dorstenioides (Engl.) M. Hijman & C. C. Berg, D. involuta M. Hijman & C. C. Berg, D.

PPARα, PPARγ and SREBP-1 pathways mediated waterborne iron (Fe)-induced reduction in hepatic lipid deposition of javelin goby Synechogobius hasta.

Science.gov (United States)

Chen, Guang-Hui; Luo, Zhi; Chen, Feng; Shi, Xi; Song, Yu-Feng; You, Wen-Jing; Liu, Xu

2017-07-01

The 42-day experiment was conducted to investigate the effects and mechanism of waterborne Fe exposure influencing hepatic lipid deposition in Synechogobius hasta. For that purpose, S. hasta were exposed to four Fe concentrations (0 (control), 0.36, 0.72 and 1.07μM Fe) for 42days. On days 21 and 42, morphological parameters, hepatic lipid deposition and Fe contents, and activities and mRNA levels of enzymes and genes related to lipid metabolism, including lipogenic enzymes (6PGD, G6PD, ME, ICDH, FAS and ACC) and lipolytic enzymes (CPTI, HSL), were analyzed. With the increase of Fe concentration, hepatic Fe content tended to increase but HSI and lipid content tended to decrease. On day 21, Fe exposure down-regulated the lipogenic activities of 6PGD, G6PD, ICDH and FAS as well as the mRNA levels of G6PD, ACCa, FAS, SREBP-1 and PPARγ, but up-regulated CPT I, HSLa and PPARα mRNA levels. On day 42, Fe exposure down-regulated the lipogenic activities of 6PGD, G6PD, ICDH and FAS as well as the mRNA levels of 6PGD, ACCa, FAS and SREBP-1, but up-regulated CPT I, HSLa, PPARα and PPARγ mRNA levels. Using primary S. hasta hepatocytes, specific pathway inhibitors (GW6471 for PPARα and fatostatin for SREBP-1) and activator (troglitazone for PPARγ) were used to explore the signaling pathways of Fe reducing lipid deposition. The GW6471 attenuated the Fe-induced down-regulation of mRNA levels of 6PGD, G6PD, ME, FAS and ACCa, and attenuated the Fe-induced up-regulation of mRNA levels of CPT I, HSLa and PPARα. Compared with single Fe-incubated group, the mRNA levels of G6PD, ME, FAS, ACCa, ACCb and PPARγ were up-regulated while the CPT I mRNA levels were down-regulated after troglitazone pre-treatment; fatostatin pre-treatment down-regulated the mRNA levels of 6PGD, ME, FAS, ACCa, ACCb and SREBP-1, and increased the CPT I and HSLa mRNA levels. Based on these results above, our study indicated that Fe exposure reduced hepatic lipid deposition by down-regulating lipogenesis

Prosody's Contribution to Fluency: An Examination of the Theory of Automatic Information Processing

Science.gov (United States)

Schrauben, Julie E.

2010-01-01

LaBerge and Samuels' (1974) theory of automatic information processing in reading offers a model that explains how and where the processing of information occurs and the degree to which processing of information occurs. These processes are dependent upon two criteria: accurate word decoding and automatic word recognition. However, LaBerge and…

Body Awareness in Children with Mental Retardation

Science.gov (United States)

Simons, Johan; Dedroog, Inge

2009-01-01

The body awareness of 124 toddlers with mental retardation and of 124 children developing normally matched to them on age and gender was examined. Twenty-nine of the children with mental retardation were diagnosed as Down syndrome (DS). The "Pointing and Naming" Test of Berges and Lezine [Berges, J., & Lezine, I. (1978). "Test d'imitation de…

Two Sides of the Same Coin: Leadership.

Science.gov (United States)

Berg, Steven; Burns, James MacGregor; McKay, Ritchie

2002-01-01

This article presents a transcript of Steven Berg's interviews with James MacGregor Burns and Ritchie McKay regarding leadership. James Burns is a senior fellow in the Jepson School of Leadership Studies at the University of Richmond, Virginia. Ritchie McKay is Head Coach of the men's basketball team at University of New Mexico. Steven Berg is an…

LEAF RESIDUE DECOMPOSITION OF SELECTED ATLANTIC FOREST TREE SPECIES

Directory of Open Access Journals (Sweden)

Helga Dias Arato

2018-02-01

Full Text Available ABSTRACT Biogeochemical cycling is essential to establish and maintain plant and animal communities. Litter is one of main compartments of this cycle, and the kinetics of leaf decomposition in forest litter depend on the chemical composition and environmental conditions. This study evaluated the effect of leaf composition and environmental conditions on leaf decomposition of native Atlantic Forest trees. The following species were analyzed: Mabea fistulifera Mart., Bauhinia forficata Link., Aegiphila sellowiana Cham., Zeyheria tuberculosa (Vell, Luehea grandiflora Mart. et. Zucc., Croton floribundus Spreng., Trema micrantha (L Blume, Cassia ferruginea (Schrad Schrad ex DC, Senna macranthera (DC ex Collad. H. S. Irwin and Barney and Schinus terebinthifolius Raddi (Anacardiaceae. For each species, litter bags were distributed on and fixed to the soil surface of soil-filled pots (in a greenhouse, or directly to the surface of the same soil type in a natural forest (field. Every 30 days, the dry weight and soil basal respiration in both environments were determined. The cumulative decomposition of leaves varied according to the species, leaf nutrient content and environment. In general, the decomposition rate was lowest for Aegiphila sellowiana and fastest for Bauhinia forficate and Schinus terebinthifolius. This trend was similar under the controlled conditions of a greenhouse and in the field. The selection of species with a differentiated decomposition pattern, suited for different stages of the recovery process, can help improve soil restoration.

Serology of Patients with Ulcerative Colitis After Pouch Surgery Is More Comparable with that of Patients with Crohn's Disease.

Science.gov (United States)

Goren, Idan; Yahav, Lior; Tulchinsky, Hagit; Dotan, Iris

2015-10-01

The serologic status of patients with ulcerative colitis (UC) who develop postoperative pouchitis was compared with that of patients with Crohn's disease (CD) and unoperated patients with UC. Pouch patients were stratified into normal pouch, acute/recurrent acute pouchitis, and chronic pouchitis/Crohn's-like disease of the pouch groups. Antibodies against glycans associated with CD (anti-Saccharomyces cerevisiae, anti-laminaribioside, anti-chitobioside, and anti-mannobioside carbohydrate antibodies [ASCA, ALCA, ACCA, and AMCA, respectively]) were detected and correlated with type of inflammatory bowel disease and pouch behavior. A total of 501 patients with inflammatory bowel diseases were recruited: 250 (50%) CD, 124 (24.7%) unoperated UC, and 127 (25.3%) UC-pouch. At least 1 positive antibody was detected in 77.6% CD, 52.0% UC-pouch and 33.1% unoperated UC (P ACCA and AMCA prevalence in CD, UC-pouch and unoperated patients with UC were 33.2%, 24.4%, and 16.9% (P = 0.003 for all) and 35.2%, 26.8%, and 7.3%, respectively (P ACCA and AMCA is significantly increased in UC-pouch patients, suggesting that pouch surgery may trigger differential immune responses to glycans. The finding that the serology of UC-pouch patients shares similarities with that of patients with CD supports the notion that those 2 inflammatory bowel diseases share a common pathogenic pathway.

Implementation on Landsat Data of a Simple Cloud Mask Algorithm Developed for MODIS Land Bands

Science.gov (United States)

Oreopoulos, Lazaros; Wilson, Michael J.; Varnai, Tamas

2010-01-01

This letter assesses the performance on Landsat-7 images of a modified version of a cloud masking algorithm originally developed for clear-sky compositing of Moderate Resolution Imaging Spectroradiometer (MODIS) images at northern mid-latitudes. While data from recent Landsat missions include measurements at thermal wavelengths, and such measurements are also planned for the next mission, thermal tests are not included in the suggested algorithm in its present form to maintain greater versatility and ease of use. To evaluate the masking algorithm we take advantage of the availability of manual (visual) cloud masks developed at USGS for the collection of Landsat scenes used here. As part of our evaluation we also include the Automated Cloud Cover Assesment (ACCA) algorithm that includes thermal tests and is used operationally by the Landsat-7 mission to provide scene cloud fractions, but no cloud masks. We show that the suggested algorithm can perform about as well as ACCA both in terms of scene cloud fraction and pixel-level cloud identification. Specifically, we find that the algorithm gives an error of 1.3% for the scene cloud fraction of 156 scenes, and a root mean square error of 7.2%, while it agrees with the manual mask for 93% of the pixels, figures very similar to those from ACCA (1.2%, 7.1%, 93.7%).

Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

Science.gov (United States)

Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

2011-04-01

Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

KARAKTER IDEAL KONSELOR DALAM BUDAYA BUGIS KAJIAN HERMENEUTIK TERHADAP TEKS PAPPASENG

Directory of Open Access Journals (Sweden)

Sitti Rahmi

2017-02-01

Penelitian ini bertujuan untuk mengkaji empat nilai di dalam teks pappaseng, yakni acca (kecakapan, lempu (kejujuran, warani (keberanian, dan getteng (keteguhan yang dapat diserap menjadi konsep karakter ideal konselors. Penelitian ini menggunakan pendekatan kualitatif dengan data, analisis dan interpretasinya mengikuti kaidah-kaidah hermeneutika Gadamerian. Temuan penelitian menunjukkan (1 nilai acca (kecakapan mengacu pada aspek kecerdasan dan kompetensi yang ditandai dengan ciri sikap penuh pertimbangan, terampil berkomunikasi dan menyelesaikan masalah, berpikir logis, teguh terhadap kejujuran, (2 nilai lempu (kejujuran mengacu pada aspek keterampilan hubungan interpersonal dengan ciri meliputi dapat dipercaya, menghormati hak orang lain, rendah hati, prososial dan taat kepada Tuhan, (3 nilai warani (keberanian mengacu pada aspek kekuatan mental konselor dengan ciri sikap kesiapan diri dan kestabilan emosi, dan (4 nilai getteng (keteguhan mengacu pada komitmen konselor terhadap pengambangan profesi dengan ciri konsisten.

Erratum

Directory of Open Access Journals (Sweden)

van Gils PF

2012-05-01

Full Text Available van Gils PF, Lambooij MS, Flanderijn MHW, van den Berg M, de Wit GA, Schuit AJ, Struijs JN. Willingness to participate in a lifestyle intervention program of patients with type 2 diabetes mellitus: a conjoint analysis. Patient Prefer Adherence. 2011;5:537–546.Dr B van den Berg was mistakenly removed from the list of authors of this paper.Read the original article.

MFA Graduate Show 2015: In the Usual Direction of Travel

OpenAIRE

2015-01-01

Avgangsstudenter: Patrik Berg, Christian Magnus Tømmeraas Berg, Maia Birkeland, Matilda Björkne, Stine Bråthen, Stein Are Kjærås Dahl, Emil Gustafsson, Jeanett Gustavsen, hÅkon gÅre, Jørgen Frederik Scheel Haarstad, Anita Hanch-Hansen, Elin Hedberg, Andrea Wikhammer Heir, Steinar Laumann, Aron-Irving Li, Tina Lindvall, Rebecca Szabo Onstad, Zahra Rashid, Hege Cathrine Hauge Thoresen

proximate, caffeine and tannin analyses in some brands of tea

African Journals Online (AJOL)

DR. AMINU

fifteen essential trace and toxic elements in some green tea samples and ... grade, distilled water was used as solvent for solution preparation and all ... weighing the ash and calculation (ACCA, 2002). Ether .... Pharmacologyonline 3: 164-174.

Carbon taxation and corporate behaviour

OpenAIRE

Association of Chartered Certified Accountants

2012-01-01

This report summarises the breakfast briefing held by ACCA on 23 February 2012. The session looked at the role of carbon taxation in mitigating climate change and its value when compared with other market mechanisms. Publisher PDF

Fulltext PDF

Indian Academy of Sciences (India)

TECS

(a) Gearheart L A, Somoza M M, Rivers W E, Mur- phy C J, Coleman R S and Berg M A 2003 J. Am. Chem. Soc. 125 11812; (b) Brauns E B, Madaras M. L, Coleman R S and Berg M A 2002 Phys. Rev. Lett. 88 158101-1-4. 19. Frauchiger L, Shirota H, Uhrich K E and Castner E. W Jr 2002 J. Phys. Chem. B106 7463. 20.

Automatic cell cloning assay for determining the clonogenic capacity of cancer and cancer stem-like cells.

Science.gov (United States)

Fedr, Radek; Pernicová, Zuzana; Slabáková, Eva; Straková, Nicol; Bouchal, Jan; Grepl, Michal; Kozubík, Alois; Souček, Karel

2013-05-01

The clonogenic assay is a well-established in vitro method for testing the survival and proliferative capability of cells. It can be used to determine the cytotoxic effects of various treatments including chemotherapeutics and ionizing radiation. However, this approach can also characterize cells with different phenotypes and biological properties, such as stem cells or cancer stem cells. In this study, we implemented a faster and more precise method for assessing the cloning efficiency of cancer stem-like cells that were characterized and separated using a high-speed cell sorter. Cell plating onto a microplate using an automatic cell deposition unit was performed in a single-cell or dilution rank mode by the fluorescence-activated cell sorting method. We tested the new automatic cell-cloning assay (ACCA) on selected cancer cell lines and compared it with the manual approach. The obtained results were also compared with the results of the limiting dilution assay for different cell lines. We applied the ACCA to analyze the cloning capacity of different subpopulations of prostate and colon cancer cells based on the expression of the characteristic markers of stem (CD44 and CD133) and cancer stem cells (TROP-2, CD49f, and CD44). Our results revealed that the novel ACCA is a straightforward approach for determining the clonogenic capacity of cancer stem-like cells identified in both cell lines and patient samples. Copyright © 2013 International Society for Advancement of Cytometry.

Study of Worldwide Occurrence of Fog, Thunderstorms, Supercooled Low Clouds and Freezing Temperatures. Change 1

Science.gov (United States)

1978-09-01

a ace ea acca cm eaz aaaa w~asa cau adm cca a (a a- aoMnor t oftfa of M -of zatof saorWo f aco-f ax t ofn la rwo f o To noono -L a~N n i NflatOa t-mN...8217Uc)- - - - - - - - - -- W -, N’p V UN- - - - -V a . It - .1 - a -- - - - - - - - - - c-cfMWý - M;S N ’ ffm .-’ 0Z0 N CT IX a SI a a W af a x S: ’-’K...c t 1 vN P to N OUNU OC9 C n 9~~~~~~ ~ ~ ~ 9(0)999 19 11 !I ý1 -; - : f - - - ýrl C acca aa~ad alz ael C.C da qa.O O 0 00. 000 AOO .OA 0O 000 00,AO O

Comité Scientifique de la Revue des Sciences et de la Technologie ...

African Journals Online (AJOL)

MICROSIM

berges ou dans l'eau libre, soit par basculement du corps, ou par immersion du bec ou de la tête de l'oiseau. Mots clés : Fulica atra - El-Kala .... de l'avant du corps dans l'eau et alimentation à pied dans les vasières et les berges. .... moyens matériels et humains nécessaires à la réalisation de ce travail sur le terrain.

Germinação de Aechmea nudicaulis (L.) Griseb. (Bromeliaceae) em diferentes substratos alternativos ao pó de xaxim

OpenAIRE

Anacleto,Adilson; Negrelle,Raquel Rejane Bonato; Koehler,Henrique Soares

2008-01-01

Avaliou-se a germinação das sementes de Aechmea nudicaulis (L.) Griseb. (Bromeliaceae). As tentativas de produção desta espécie, a partir de sementes, têm ocorrido de forma empírica, utilizando-se substrato à base de pó de xaxim (Dicksonia sellowiana Hook.), que tem restrições de uso, por estar ameaçada de extinção. Foram testados cinco tipos alternativos de substratos de fácil acessibilidade: húmus de minhoca, areia, fibra de casca de coco, serapilheira e Plantmax®. O experimento foi realiza...

Assurance Statement Practice in Environmental, Social and Sustainability Reporting: A Critical Evaluation

NARCIS (Netherlands)

O'Dwyer, B.; Owen, D.L.

2005-01-01

This paper reports on a detailed critical analysis of assurance statements appearing in environmental, social and ‘sustainability’ reports short-listed for the 2002 Association of Chartered Certified Accountants (ACCA) UK and European Sustainability Reporting Awards scheme. Drawing on an evaluative

Sinopse das espécies de Marlierea Cambess. (Myrtaceae na Amazônia brasileira Sinopse of the species of Marlierea Cambess. (Myrtaceae in Amazonian Brazil

Directory of Open Access Journals (Sweden)

Alessandro Silva do Rosário

2006-03-01

Full Text Available O estudo de Marlierea Cambess. na Amazônia Brasileira tem como principal objetivo atualizar os dados sobre a morfologia e taxonomia das espécies da região, bem como fornecer subsídios para esclarecer a separação de Marlierea de Myrcia DC. ex Guill., conforme sugerem alguns autores. Na Amazônia Brasileira, Marlierea está representada por 11 espécies (Marlierea bipennis (O. Berg McVaugh, M. caudata McVaugh, M. ensiformis McVaugh, M. ferruginea (Poir. McVaugh, M. mcvaughii B. Holst, M. scytophylla Diels, M. spruceana O. Berg, M. subulata McVaugh, M. summa McVaugh, M. umbraticola (Kunth O. Berg e M. velutina McVaugh e uma mal conhecida (M. obumbrans (O. Berg Nied., habitando principalmente áreas de formações florestais. O gênero se caracteriza pelo hábito arbóreo ou arbustivo; folhas opostas (exceto em M. velutina que pode apresentar folhas opostas e/ou alternas; as inflorescências em panículas (de fascículos, racemos, cimeiras ou dicásios; botões florais geralmente fechados, abertura irregular do cálice, em 4-5 lobos, pétalas freqüentemente ausentes. Os Estados do Amazonas e Pará representam os dois principais centros de distribuição dessas espécies, sendo M. spruceana e M. umbraticola as espécies mais comuns. Marlierea obumbrans será melhor estudada posteriormente, devido apresentar sua delimitação taxonômica confusa entre Myrcia e Marlierea.A morphological study of Marlierea Cambess. occurring in Amazonian Brazil was carried out in order to obtain a better understanding of the morphology and taxonomy of all species in the region and to provide data to elucidate the taxonomic segregation of Marlierea from the morphologically similar Myrcia DC. ex Guill. In Amazonian Brazil, Marlierea is represented by 11, primarily forest, species (Marlierea bipennis (O. Berg McVaugh, M. caudata McVaugh, M. ensiformis McVaugh, M. ferruginea (Poir. McVaugh, M. mcvaughii B. Holst, M. scytophylla Diels, M. spruceana O. Berg, M

Association of Anti-glycan Antibodies and Inflammatory Bowel Disease Course.

Science.gov (United States)

Paul, S; Boschetti, G; Rinaudo-Gaujous, M; Moreau, A; Del Tedesco, E; Bonneau, J; Presles, E; Mounsef, F; Clavel, L; Genin, C; Flourié, B; Phelip, J-M; Nancey, S; Roblin, X

2015-06-01

The usefulness of anti-glycan antibodies alone or combined with anti-Saccharomyces cerevisiae [ASCA] or perinuclear antineutrophil cytoplasmic [pANCA] antibodies for diagnosis of inflammatory bowel disease [IBD], differentiation between Crohn's disease [CD] and ulcerative colitis [UC], disease stratification including IBD phenotype, and also for determination of the course of the disease, remain unclear. A large panel of serological anti-glycan carbohydrate antibodies, including anti-mannobioside IgG antibodies [AMCA], anti-chitobioside IgA [ACCA], anti-laminaribioside IgG antibodies [ALCA], anti-laminarin [anti-L] and anti-chitine [anti-C] were measured in the serum from a cohort of 195 patients with IBD] [107 CD and 88 UC]. The respective accuracy of isolated or combined markers for diagnosis, disease differentiation, stratification disease phenotype, and severity of the disease course, defined by a wide panel of criteria obtained from the past medical history, was assessed. The positivity of at least one anti-glycan antibody was detected in a significant higher proportion of CD and UC compared with healthy controls [p ACCA [> 51U/ml] and anti-laminarin [> 31U/ml] were significantly linked with a higher association with steroid dependency (odds ratio [OR] =2.0 [1.0-4.0], p = 0.03 and OR = 2.4 [1.1-5.2], p = 0.02, respectively]. We further defined the respective performance of anti-glycan antibodies to discriminate between patients with severe or not severe CD and UC course and determined the associated optimal cut-off values: severe CD course was significantly more likely in case of AMCA > 77U/ml [OR = 4.3; p = 0.002], ASCA > 63U/ml [OR = 3.5; p ACCA > 50U/ml [OR = 2.8; p 52U/ml [OR = 3.4; p = 0.04] and ACCA > 25U/ml [OR = 3.0; p < 0.04]. Anti-glycan antibodies are valuable serological markers, especially AMCA antibodies that may help clinicians to promptly classify patients into high risk for severe disease. Copyright © 2015 European Crohn’s and Colitis

Involvement of NFκB in the antirheumatic potential of Chenopodium album L., aerial parts extracts.

Science.gov (United States)

Arora, Sumit K; Itankar, Prakash R; Verma, Prashant R; Bharne, Ashish P; Kokare, Dadasaheb M

2014-08-08

Chenopodium album L. (C. album) is commonly known as Bathua in Hindi (Family: Chenopodiaceae). Traditionally, the plant is used as a laxative, diuretic, sedative and the infusion of the plant is used for the treatment of rheumatism. However, no scientific validation is available on the antirheumatic potential of the plant. In the present investigation, role of NF kappa B (NFκB) in the antiarthritic potential of extracts of aerial parts of Chenopodium album was explored and evaluated. The defatted aerial parts of Chenopodium album were successively extracted with ethylacetate, acetone, methanol and 50% methanol to study their antioxidant capacity followed by antiarthritic potential using Complete Freund׳s adjuvant (CFA) induced arthritis model in rats. The polyphenol, flavonoid and flavanone contents of different extracts were quantified and correlated with their antioxidant capacity, antiarthritic activity and NFκB inhibition potential. The experimental data indicated that the acetone extract of Chenopodium album (ACCA) has shown significant reduction in rat paw edema (80.13%) at dose level of 200 mg/kg per oral in 21 days of this study. On 22nd day, hematological and biochemical parameters were estimated and it was observed that the altered hematological parameters (Hb, RBC, WBC and ESR), biochemical parameters (Serum creatinine, total proteins and acute phase proteins) and loss in body weight in the arthritic rats were significantly brought back to near normal level by the ACCA extract. ACCA extract significantly decreased the NFκB expression in paraventricular nucleus of hypothalamus and this effect is comparable with standard indomethacine in CFA treated rats. The polyphenolic and flavonoid content of different extracts were in the range of 14.56±0.21-42.00±0.2 mg (gallic acid equivalent/g extract) and 2.20±0.003-7.33±0.5 mg (rutin equivalent/g extract) respectively. The antiarthritic activity possessed by ACCA extract can be correlated directly to its

[A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

Science.gov (United States)

Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

2013-08-04

Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

The Shock and Vibration Bulletin. Part 4. Dynamic Properties of Materials, Applications of Materials, Shock and Blast, Fragments

Science.gov (United States)

1980-09-01

individual m.crophone readings using the following standard formula: SPI- AVE " ,0 LOG ( S lOSPM/lo/n) i*I ’ where: SPLAVE " Sound pressure...Godes- berg 1975 |4| NEIER-DemBERG. K.-E.i ’Reference Pa- rameters for Shock Inputs and Shock Tolerance Limits. ACARO Conference Proceedings No...occurrence In the Polsson counting process, equals v.{t), the av - erage barrier crossing rate of the response ran- dom process for a barrier with

Do People Take Stimulus Correlations into Account in Visual Search (Open Source)

Science.gov (United States)

2016-03-10

RESEARCH ARTICLE Do People Take Stimulus Correlations into Account in Visual Search? Manisha Bhardwaj1, Ronald van den Berg2,3, Wei Ji Ma2,4...journal.pone.0149402 March 10, 2016 1 / 16 OPEN ACCESS Citation: Bhardwaj M, van den Berg R, Ma WJ, Josić K (2016) Do People Take Stimulus Correlations into...different values of ρ, larger set sizes, and more extensive training could shed more light on how exactly people misestimate stimulus correlations in

Armastuse feng shui / Peeter Rüberg

Index Scriptorium Estoniae

Rüberg, Peeter

2000-01-01

Järg Jan/13;20;27/Feb/3;10;17;23/Mar/2;9;16 ;30/Apr/13/May/4;11 lk. 22;38;56;70;87;102;118;134;150;166;198;230;278 ;296Vanal hiina kodu- ja elukunstil on igaks armuelu juhtumiks varuks praktilisi nõuandeid ja võtteid

Rahumeelsemasse maailma sõjaootusega / Eiki Berg

Index Scriptorium Estoniae

Berg, Eiki, 1970-

2004-01-01

Ilmunud ka: Nädaline, 8. mai 2004, lk. 4; Meie Maa, 8. mai 2004, lk. 2; Lääne Elu, 11. mai 2004, lk. 4; Vooremaa, 11. mai 2004, lk. 2; Põhjarannik, 11. mai 2004, lk. 2; Severnoje Poberezhje, 11. mai 2004, lk. 2; Valgamaalane, 11. mai 2004, lk. 2; Hiiu Leht, 11. mai 2004, lk. 2; Vali Uudised, 12. mai 2004, lk. 2. Seoses EL-iga liitumisega toimunud hinnatõusudest, kauba kallinemist mõjutavatest teguritest

The DoD Enterprise Model. Volume 1. Strategic Activity and Data Models

Science.gov (United States)

1994-01-01

materiel items, real estate/facilities, or * Acca services into the inventory (e.g., first destination "* Take Deivery transportation of materiel items...the purposes of their relationships with other specific items makes it possible to develop information, and ultimately through continuous audit and

Theater-Level Stochastic Air-to-Air Engagement Modeling via Event Occurrence Networks Using Piecewise Polynomial Approximation

Science.gov (United States)

2001-09-01

diagnosis natural language understanding circuit fault diagnosis pattern recognition machine vision nancial auditing map learning sensor... ACCA ACCB A ights degree of command and control FCC value is assumed to be the average of all the ACC values of the aircraft in the

Edging towards better accounting

OpenAIRE

Schumesch, Patrice

2014-01-01

The ACCA's International Public Sector Conference explored the direction of public sector reporting, and rebuilding public trust through improved financial reporting. Other speakers included Carla Moordy of Monitory UK, Zinga Venner of the World Bank, and Professor Michael Parker of Henley Business School.

Risk assesment in the context of EC directives on genetically modified organisms

Energy Technology Data Exchange (ETDEWEB)

Meer, P.J. van der [Ministry for the Environment (Netherlands)

1992-07-01

The introduction of these new molecular technologies initiated an international discussion on the safety in biotechnology. In 1974 one of the pioneers of this new technology, Paul Berg, expressed his view on the potential risks of recombinant DNA applications in the famous 'Berg letter', leading to a self-imposed moratorium on certain experiments. Following the Berg letter and the Asilomar convention, much international attention has been given to the question of safety in biotechnology. This attention resulted in hundreds of documents, research programmes, guidelines and regulations. This resulted, among others, in two EC Directives on genetically modified organisms: the EC Directive 90/219/EEC on the contained use of genetically modified micro-organisms, and Directive 90/220/EEC on the release of genetically modified organisms. These directives lay down a system for harmonization of risk assessment and risk management with regard to the safety for human health and the environment.

Risk assesment in the context of EC directives on genetically modified organisms

International Nuclear Information System (INIS)

Meer, P.J. van der

1992-01-01

The introduction of these new molecular technologies initiated an international discussion on the safety in biotechnology. In 1974 one of the pioneers of this new technology, Paul Berg, expressed his view on the potential risks of recombinant DNA applications in the famous 'Berg letter', leading to a self-imposed moratorium on certain experiments. Following the Berg letter and the Asilomar convention, much international attention has been given to the question of safety in biotechnology. This attention resulted in hundreds of documents, research programmes, guidelines and regulations. This resulted, among others, in two EC Directives on genetically modified organisms: the EC Directive 90/219/EEC on the contained use of genetically modified micro-organisms, and Directive 90/220/EEC on the release of genetically modified organisms. These directives lay down a system for harmonization of risk assessment and risk management with regard to the safety for human health and the environment

Reply to "Comment on `Penetration of Action Potentials During Collision in the Median and Lateral Giant Axons of Invertebrates"'

Science.gov (United States)

Wang, Tian; Gonzalez-Perez, Alfredo; Budvytyte, Rima; Jackson, Andrew D.; Heimburg, Thomas

2017-04-01

Berg et al. did not reproduce our results but worked on different preparations and, in one central experiment, used a significantly different electrode configuration. To clarify the situation, we have repeated their experiment on the walking leg of a lobster using an apparatus that can produce both electrode configurations. With the configuration used by Berg et al., the signal of the nerve pulse disappears when forced to pass through the region strongly perturbed by the second stimulus. In our original collision setup, pulses do not travel through perturbed regions, and pulses pass through each other without annihilation as previously reported. These results demonstrate that we handle the preparations correctly. Furthermore, they call for a reinterpretation of the so-called collision block experiment performed by Berg et al. Most likely, their results merely indicate inhibition of the nerve pulse by a strong stimulus and not annihilation upon collision as claimed.

Vitamina C em "cabeludinha" (Myrciaria glomerata Berg Vitamin C content in fruits of Myrciaria glomerata

Directory of Open Access Journals (Sweden)

J. Soubihe Sobrinho

1955-01-01

" é a fonte mais rica de vitamina C entre as mirtáceas nacionais e de tôdas as frutas brasileiras. Comparando-se a "cabeludinha" com outras frutas exóticas, ricas em ácido ascórbico, nota-se que somente a cereja das Antilhas (Malpighia spp. lhe leva vantagem.The studies on the vitamin C content in fruits of Myrciaria glomerata Berg, reported in this paper were complementary to the breeding work on fruit plantas of Myrtacex, carried out cooperatively by the Seção de Frutas Tropicais, Instituto Agronômico, Campinas, and Seção de Genética, E.S.A. "Luiz de Queiroz", Piracicaba. The ascorbic acid content was determined in the blend obtained by running the pitted fruits in a blendor for 2 minutes in presence of a 0.4 per cent oxalic acid protecting solution. The quantitative determinations were made with an EEL portable colorimeter. The total vitamin C content in fresh fruits from trees exposed to full sunlight were as follows (in mg/100 g : tree n.° 1, 2,417 ; tree n.° 2, 2,389 ; tree n.° 3, 2,322. Assays made with fruits at different stages of maturity gave the following results : green fruits, 2,716 ; full developed fruits, 2,391 ; ripe fruits, 2,417. Green fruits had thus a higher vitamin C content than either partially or completely ripe fruits ; the difference between the last two types was not significant. Different parts of the fruit that were assayed separately had the following vitamin C content (mg/100 g : peel, 2,482 ; pulp (without seed, 3,018. The pulp which is the edible part of the fruit is thus richer than the peel. Vitamin C determinations in ripe fresh fruits from four shaded trees gave the following results (mg/100 g : tree n.° 1, 717.28 ; tree n.° 2, 838.66 ; tree n.° 3, 560.83 ; tree n.° 4, 713.38. Fruits produced on shaded trees are therefore poorer in ascorbic acid than those from trees exposed to full sunlight. The variations between trees in the shaded group may be ascribed to genetic origin. Myrciaria glomerata fruits have the

Amount of balance necessary for the independence of transfer and stair-climbing in stroke inpatients.

Science.gov (United States)

Fujita, Takaaki; Sato, Atsushi; Ohashi, Yuji; Nishiyama, Kazutaka; Ohashi, Takuro; Yamane, Kazuhiro; Yamamoto, Yuichi; Tsuchiya, Kenji; Otsuki, Koji; Tozato, Fusae

2018-05-01

The purpose of this study was to clarify the amount of balance necessary for the independence of transfer and stair-climbing in stroke patients. This study included 111 stroke inpatients. Simple and multiple regression analyses were conducted to establish the association between the FIM ® instrument scores for transfer or stair-climbing and Berg Balance Scale. Furthermore, receiver operating characteristic curves were used to elucidate the amount of balance necessary for the independence of transfer and stair-climbing. Simple and multiple regression analyses showed that the FIM ® instrument scores for transfer and stair-climbing were strongly associated with Berg Balance Scale. On comparison of the independent and supervision-dependent groups, Berg Balance Scale cut-off values for transfer and stair-climbing were 41/40 and 54/53 points, respectively. On comparison of the independent-supervision and dependent groups, the cut-off values for transfer and stair-climbing were 30/29 and 41/40 points, respectively. The calculated cut-off values indicated the amount of balance necessary for the independence of transfer and stair-climbing, with and without supervision, in stroke patients. Berg Balance Scale has a good discriminatory ability and cut-off values are clinically useful to determine the appropriate independence levels of transfer and stair-climbing in hospital wards. Implications for rehabilitation The Berg Balance Scale's (BBS) strong association with transfer and stair-climbing independence and performance indicates that establishing cut-off values is vitally important for the established use of the BBS clinically. The cut-off values calculated herein accurately demonstrate the level of balance necessary for transfer and stair-climbing independence, with and without supervision, in stroke patients. These criteria should be employed clinically for determining the level of independence for transfer and stair-climbing as well as for setting balance training

The Naval Reserve Sea Air Mariner VOTECH (Vocational/Technical) Program: Qualified Civilian Schools for Ramp (Reserve Allied Medical Personnel Program)

Science.gov (United States)

1985-09-15

l= C~tl Ffm R ~ s .8 isnMs?.y91 ed*% i ClassCap 116j 819= ia 2: 1.11.87 4 eed Vd.W1, AC.~aA I -ýS S 3601ŕ - __ =V3 EC=t8 I14 Ce’s Nee0’Rs-1 1987...8050551a 10106%8316- Ca’tilvtV-1-a2g-i- -,:! 2~ ~~ 55Br AV-S 3203 acca - C.-o- V V Klta MD $3Mcc14en R" C-n-VAr-M R’y’~oo M -ey r eca tt w 2 c-r *U. flgrD...A t62O24242100 E. Hcnrkt Rd. T- acca indumm Vocatonnal Technica Rochestr NY 14M2 State Te€]b- Inttt as Mmpbk A,• 4100 Co,ean Rd. 1I6) 424,-5M0 5993

Analysis of metabolic networks of Streptomyces leeuwenhoekii C34 by means of a genome scale model: Prediction of modifications that enhance the production of specialized metabolites.

Science.gov (United States)

Razmilic, Valeria; Castro, Jean F; Andrews, Barbara; Asenjo, Juan A

2018-07-01

The first genome scale model (GSM) for Streptomyces leeuwenhoekii C34 was developed to study the biosynthesis pathways of specialized metabolites and to find metabolic engineering targets for enhancing their production. The model, iVR1007, consists of 1,722 reactions, 1,463 metabolites, and 1,007 genes, it includes the biosynthesis pathways of chaxamycins, chaxalactins, desferrioxamines, ectoine, and other specialized metabolites. iVR1007 was validated using experimental information of growth on 166 different sources of carbon, nitrogen and phosphorous, showing an 83.7% accuracy. The model was used to predict metabolic engineering targets for enhancing the biosynthesis of chaxamycins and chaxalactins. Gene knockouts, such as sle03600 (L-homoserine O-acetyltransferase), and sle39090 (trehalose-phosphate synthase), that enhance the production of the specialized metabolites by increasing the pool of precursors were identified. Using the algorithm of flux scanning based on enforced objective flux (FSEOF) implemented in python, 35 and 25 over-expression targets for increasing the production of chaxamycin A and chaxalactin A, respectively, that were not directly associated with their biosynthesis routes were identified. Nineteen over-expression targets that were common to the two specialized metabolites studied, like the over-expression of the acetyl carboxylase complex (sle47660 (accA) and any of the following genes: sle44630 (accA_1) or sle39830 (accA_2) or sle27560 (bccA) or sle59710) were identified. The predicted knockouts and over-expression targets will be used to perform metabolic engineering of S. leeuwenhoekii C34 and obtain overproducer strains. © 2018 Wiley Periodicals, Inc.

Metabolic targeting of lactate efflux by malignant glioma inhibits invasiveness and induces necrosis: an in vivo study.

Science.gov (United States)

Colen, Chaim B; Shen, Yimin; Ghoddoussi, Farhad; Yu, Pingyang; Francis, Todd B; Koch, Brandon J; Monterey, Michael D; Galloway, Matthew P; Sloan, Andrew E; Mathupala, Saroj P

2011-07-01

Glioblastoma multiforme (GBM) are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs). We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA), a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain) slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion). Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity.

Metabolic Targeting of Lactate Efflux by Malignant Glioma Inhibits Invasiveness and Induces Necrosis: An In Vivo Study1

Science.gov (United States)

Colen, Chaim B; Shen, Yimin; Ghoddoussi, Farhad; Yu, Pingyang; Francis, Todd B; Koch, Brandon J; Monterey, Michael D; Galloway, Matthew P; Sloan, Andrew E; Mathupala, Saroj P

2011-01-01

Glioblastoma multiforme (GBM) are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs). We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA), a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain) slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion). Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity. PMID:21750656

Computational Fluid Dynamics Analysis of Flexible Duct Junction Box Design

Energy Technology Data Exchange (ETDEWEB)

Beach, Robert [IBACOS Inc., Pittsburgh, PA (United States); Prahl, Duncan [IBACOS Inc., Pittsburgh, PA (United States); Lange, Rich [IBACOS Inc., Pittsburgh, PA (United States)

2013-12-01

IBACOS explored the relationships between pressure and physical configurations of flexible duct junction boxes by using computational fluid dynamics (CFD) simulations to predict individual box parameters and total system pressure, thereby ensuring improved HVAC performance. Current Air Conditioning Contractors of America (ACCA) guidance (Group 11, Appendix 3, ACCA Manual D, Rutkowski 2009) allows for unconstrained variation in the number of takeoffs, box sizes, and takeoff locations. The only variables currently used in selecting an equivalent length (EL) are velocity of air in the duct and friction rate, given the first takeoff is located at least twice its diameter away from the inlet. This condition does not account for other factors impacting pressure loss across these types of fittings. For each simulation, the IBACOS team converted pressure loss within a box to an EL to compare variation in ACCA Manual D guidance to the simulated variation. IBACOS chose cases to represent flows reasonably correlating to flows typically encountered in the field and analyzed differences in total pressure due to increases in number and location of takeoffs, box dimensions, and velocity of air, and whether an entrance fitting is included. The team also calculated additional balancing losses for all cases due to discrepancies between intended outlet flows and natural flow splits created by the fitting. In certain asymmetrical cases, the balancing losses were significantly higher than symmetrical cases where the natural splits were close to the targets. Thus, IBACOS has shown additional design constraints that can ensure better system performance.

Metabolic Targeting of Lactate Efflux by Malignant Glioma Inhibits Invasiveness and Induces Necrosis: An In Vivo Study

Directory of Open Access Journals (Sweden)

Chaim B Colen

2011-07-01

Full Text Available Glioblastoma multiforme (GBM are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs. We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA, a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion. Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity.

Changes in balance in older adults based on use of physical therapy vs the Wii Fit gaming system: a preliminary study.

Science.gov (United States)

Bateni, Hamid

2012-09-01

To determine the effectiveness of Wii Fit training on balance control in older adults compared with physical therapy training. Quasi-experimental design. Eight males and nine females aged 53 to 91 years. Participants were divided into three groups: one group received both physical therapy training and Wii Fit training (PW group), one group received Wii Fit training alone (WI group), and one group received physical therapy training alone (PT group). Training consisted of three sessions per week for 4 weeks. Berg Balance Scale (all groups) and Bubble Test (PW and WI groups) scores. Descriptive statistics, medians, interquartile ranges and 95% confidence intervals are reported to identify trends in balance control as a result of different types of training. All subjects showed improvement in the Berg Balance Scale and Bubble Test scores. The PT and PW groups tended to perform better than the WI group on the Berg Balance Scale following treatment. Although the differences in the Bubble Test score were not substantial between the PW and WI groups, the PW group performed slightly better than the WI group on the Berg Balance Scale. Wii Fit training appears to improve balance. However, physical therapy training on its own or in addition to Wii Fit training appears to improve balance to a greater extent than Wii Fit training alone. Copyright © 2011 Chartered Society of Physiotherapy. Published by Elsevier Ltd. All rights reserved.

Technical Objective Document for Food and Food Service Systems

Science.gov (United States)

1990-10-01

full ntission posture for exlended duration . 3. POCGRESS AND ACCa -fPLISHMENI’S Natick is responsible for many Research, Development, Test , and...Dr. David L. Kaplan Telephone (508) 651-5525 (Biotechnology) b. Technology Program (1) FY91 Planned Programs Complete Joint Services Front End

Motion Cues in Flight Simulation and Simulator Induced Sickness

Science.gov (United States)

1988-06-01

military F7 .. vehicles, surface excavation equipment, underground mining devices, railway locomotives, .A space vehicles, shiv bridges, and submarines. Of...Evaluatort Rleference to Fukuda is: Fukuda, T. Postural behavior and motion sickness. Acca Otolaryngol. (Stockholm), 1976, B1:37-241.) %kI RTD-5

New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia

Science.gov (United States)

Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), ...

A Commentary on "Integrated Reporting: A Review of Developments and Their Implications for the Accounting Curriculum"

Science.gov (United States)

Kamp-Roelands, Nancy

2013-01-01

In this commentary, Kamp-Roelands states that it was very encouraging to observe that the Association of Chartered Certified Accountants (ACCA) recognises that responding to "Integrated Reporting" initiatives requires an "integrated approach" to accounting education. That change in financial reporting standards put pressure on…

The Chinese Diaspora: China’s Instrument of Power

Science.gov (United States)

2010-06-01

University Press, 2007. Bergère, Marie-Claire. L’âge d’or de la bourgeoisie chinoise 1911-1937. Paris, France : Flammarion, 1986. Biao, Xiang...in Marie- Claire Bergère, L’âge d’or de la bourgeoisie chinoise 1911-1937, (Paris, France : Flammarion,1986), 46. 121 Akin to slaves...communautés chinoises d’outre-mer. Paris, France : L’Harmattan, 1997. Puel, Caroline. ―Quand le monde parlera chinois.‖ LE POINT SPÉCIAL CHINE, 25

A Glossary of Terms, Definitions, Acronyms, and Abbreviations Related to the National Airspace System (NAS)

Science.gov (United States)

1990-06-01

System ACAS Airborne Collision Avoidance System ACB Adjacent Center Backup ACC ACCumulator ACC Area Control Center ACCAS Alto Cumulus CAtellanuS ACCC...subsystem) FFC For Further Clearance FFF Form, Fit, and Function FFF Form, Fix, and Function FFLT Familiarize FLighT FFM Far Field Monitor (associated with

A Commentary on "Integrated Reporting: A Review of Developments and Their Implications for the Accounting Curriculum"

Science.gov (United States)

Correa Ruiz, Carmen

2013-01-01

In this commentary, Correa Ruiz notes that from his analysis, Owen (2013) identified the essential elements to be included in a modern professional accounting curriculum, described how Association of Chartered Certified Accountants (ACCA) has embedded "Integrated Reporting" in its curriculum, and discussed future curriculum development,…

Proceedings of International Conference on the Role of the Polar Regions in Global Change Held in Fairbanks, Alaska on 11-15 June 1990. Volume 2

Science.gov (United States)

1992-03-01

submitted essays (two alizations from faculty observations of student behaviors students audited ). The means and minimum/maximum during the game and the...being directed towards tions has been carried out to evaluate the sensitivity of the analyses of the present Antarctic precipitation and acca - climate to

Short outlines of books by Estonian authors : [annotations] / Rutt Hinrikus, Janika Kronberg

Index Scriptorium Estoniae

Hinrikus, Rutt, 1946-

1997-01-01

Vint, Toomas. Kojamehe naine; Mihkelson, Ene. Surma sünnipäev; Vint, Toomas. Naisepiinaja õnnenatukene; Kross, Jaan. Mesmeri ring; Vetemaa, Enn. Väegade noobel kooljas...; Berg, Maimu. Ma armastasin venelast; Kivi, Aita. Jumalakäpp; Berg, Maimu. Mina, moeajakirjanik; Kivastik, Mart. Palun õnnelikuks; Kivisildnik, Sven. Nagu härjale punane kärbseseen; Varblane, Hannes. Vihkamiseta; Ehin, Andres. Rummu Jüri mälestused; Tode, Emil (Õnnepalu, Tõnu). Mõõt; Raudam, Toomas. Tarzani seiklused Tallinnas; Ehlvest, Jüri. Ikka veel Bagdadis; Ehlvest, Jüri. Krutsiaania

Hochauflösende Fourier-Transform-Emissionsspektroskopie

OpenAIRE

Uibel, Christian

2000-01-01

Mittels hochauflösender Fourier-Transform-Infrarot-Emissionsspektroskopie wurden tiefliegende elektronische Anregungszustände der mittelschweren zweiatomigen Radikale As2, Sb2 und TeF untersucht. Dabei lag das Interesse vor allem bei den Emissionen nicht voll erlaubter Übergänge wie beispielsweise der 3Σ +u →  1Σ +g- bzw. (1u) →  (0+g)-Übergänge bei den Stickstoff-Homologen. Dieses besondere Interesse an der genauen Analyse der 3Σ +u-Zustände liegt in ihrem metastab...

A study of airborne radon levels in Paarl houses (South Africa) and associated source terms, using electret ion chambers and gamma-ray spectrometry

Energy Technology Data Exchange (ETDEWEB)

Lindsay, R. [Department of Physics, University of the Western Cape, Private Bag X17, Bellville 7537 (South Africa)], E-mail: rlindsay@uwc.ac.za; Newman, R.T. [Environmental Radioactivity Laboratory, Physics Group, iThemba LABS, P.O. Box 722, Somerset West 7129 (South Africa); Speelman, W.J. [Department of Physics, University of the Western Cape, Private Bag X17, Bellville 7537 (South Africa)

2008-11-15

Indoor radon ({sup 222}Rn) concentrations were measured in Paarl homes by means of electret ion chambers. The concentrations varied between 28 and 465 Bq m{sup -3}. The average values (Bq m{sup -3}) found in houses on the west and east side of the Berg River, which bisects Paarl, were 132 ({+-}11) and 37 ({+-}3), respectively. Radiometric analyses of soils show that the mean {sup 226}Ra activity concentration is three times higher on the west than on the east side of the Berg River.

A study of airborne radon levels in Paarl houses (South Africa) and associated source terms, using electret ion chambers and gamma-ray spectrometry

International Nuclear Information System (INIS)

Lindsay, R.; Newman, R.T.; Speelman, W.J.

2008-01-01

Indoor radon ( 222 Rn) concentrations were measured in Paarl homes by means of electret ion chambers. The concentrations varied between 28 and 465 Bq m -3 . The average values (Bq m -3 ) found in houses on the west and east side of the Berg River, which bisects Paarl, were 132 (±11) and 37 (±3), respectively. Radiometric analyses of soils show that the mean 226 Ra activity concentration is three times higher on the west than on the east side of the Berg River

Census Report, Volume II, 1967 through 1974. Sanitized Version.

Science.gov (United States)

1985-08-15

SUNDSTROM, OSCAR J. 3 098229 0600 SUTHERLAND , ROBERT M. 3 008281 0638 SUTHERLAND , WILLIAM C. 3 094809 0688 SUTTEN, ADRIAN P. 2 6 642 76 Personnel Dose...BELTZ, GLEN D. 2 0607 "BENDER, KENNETH E. 2 0638 BENDINELLI, RALPH A. 2 0649 BERG, CHARLES A. 2 0638 BERG, CLINT 2 0680 148 Personnel Dose Information...MARVIN B. 2 06801 SUMMA, WILLIAM J. 2 0680 SUPPES, DUANE A. 2 0793 SUTHERLAND , ROBERT M. 2 0638 SUTTEN, ADRIAN P. 2 0642 SWAFFORD, FRED G. 3 092765 0602

Report Index for Years 1939-1985

Science.gov (United States)

1986-03-01

u 6) U u u 0 0 93 f3 m I N 0 - - U CU 2 a 3 - U 0 -J 6W W. W 6 2 W W W a a 61 w w w ’A a 1 A U) 41 V, 4A V) IU L V I 61 - 21 j -1 j .- - U - .j a a...ini ’ . W . 2; .c- 2j a a 2r LI or2- - - -a C 3 0-~~c 40 0: I a 2 n m IW Z =. r L j = 02 - I 31 a 0 4A a. 19 acca W- 0I - / 0 - (. I 0 - - 2~ w 6.1 .1...N~ ~ * A -1 A a a a A ’ aa . w w 61 1- 6, 1. 0 za ~ a3 1, .a wi ; CC 0 9- I a oi 10 ) = 11 W 62 a61 - I U w -4 a W aw acca a a u wi U 0 a

Exploring College Counselor Spiritual Competency in Relation to Training and Professional Practice

Science.gov (United States)

Conley, Abigail Holland

2012-01-01

The purpose of this mixed methods sequential explanatory study was to explore factors contributing to college counselors' spiritual competency by obtaining quantitative results from surveying 199 current members of the American College Counseling Association (ACCA) and then following up with 32 purposefully selected respondents based on high…

Fauna Simalurensis. Lepidoptera Rhopalocera: fam. Satyridae, Morphidae & Nymphalidae

NARCIS (Netherlands)

Eecke, van R.

1913-01-01

Continuing the enumeration of the Lepidoptera from Simalur and neighbouring islets, collected by Mr. Edw. Jacobson, I have to notice only one new form of Cethosia and of Acca among a number of 16 species of Nymphalidae. The Satyridae were represented by one species and the Morphidae by two.

Plan of Study for the Tidal Power Study, Cobscook Bay, Maine, USA

Science.gov (United States)

1978-09-01

engineering manuals, regula- tions and pamphlets. * Federal Register, Part IV, 29 June 1977, Federal Energy Administration, "Energy Audit Procedures...Impact of gcnoral inflation. Thia ia not valid oconomicaLly; it i merely iinaacial. At a i.n, the field ahould break the reuaona for the incr, acca out

The Development of an Officer Training School Board Score Prediction Method Using a Multi-Board Approach

Science.gov (United States)

1991-03-01

withdrawal$. courseI that e audited , or pa.ail. Lin each college or ut.enitiry separtely. total columns, fbi and (c). them. divide the total of column...CHA AAE FJBFBIBCMDLEMGADAA ED A C A CDHAGNCLGJIJPBJIB AAA A R AAA AFCHHFJEMPHVDRGMKBGACA e B DAAMCNKHKFMHPQIICHEDCAD s AA ACCA FDHQHNEJPPJJZJFKECAA A i

U.S. EPA, Pesticide Product Label, PROKIL PARATHION 4 LB, 01/06/1988

Science.gov (United States)

2011-04-21

... m:AIl [lmRE l.ARD .. II,.> "Ilirtly III acca,· .Irlll':a with dUllyers. ... f .• ,ricI'!'lIHII r.xlen~inn ;'l'rvIU~ ·(I.,ePII""I. ~:' . lhL· I.Sl::le. BEANS: "'I,hid~i. r;.!oi'f1·lli'.;. ...

Dinâmica da estrutura fitossociológica da regeneração natural em sub-bosque de Mimosa scabrella Bentham em área minerada, em Poços de Caldas, MG Phytosociology structure dynamics of natural regeneration in understory of Mimosa scabrella Bentham in mined area, Poços de Caldas, Brazil

Directory of Open Access Journals (Sweden)

Mauro Eloi Nappo

2004-12-01

Full Text Available Como estratégia de reabilitação de área minerada foram realizados, no ano agrícola 1982/1983, hidrossemeadura de gramíneas e leguminosa e o plantio puro de Mimosa scabrella Bentham em Poços de Caldas, MG. Em 1997 foi implantado um conjunto de 19 parcelas permanentes de 50 m² nessa área, para caracterização inicial do processo de regeneração natural. Em 2000, foi realizado o segundo inventário nas parcelas, para caracterização do processo de dinâmica da regeneração natural, que é o objeto deste trabalho. O processo de dinâmica da regeneração natural foi caracterizado mediante análises quantitativas e qualitativas da composição florística e da estrutura horizontal e vertical. O povoamento florestal do Retiro-Branco está sobre intensa atividade de estruturação, caracterizando o estágio inicial do processo de sucessão. O declínio do povoamento puro de Mimosa escabrella está modificando a ordem anteriormente estabelecida para o processo de sucessão da área, provocando a diversificação de condições de sítio e, assim, selecionando a ocupação deste em função dos grupos ecológicos, sendo as espécies pioneiras as mais favorecidas. As espécies secundárias são as de maior dominância nas maiores classes de altura e de diâmetro, sendo as principais responsáveis pela edificação do estrato superior, em especial a espécie Miconia sellowiana. As espécies que apresentaram melhor desempenho na colonização e estruturação da regeneração natural do Retiro-Branco, nos dois inventários, foram Miconia sellowiana, Psychotria sessilis, Leandra melastomoides, Clethra scabra, Myrsine umbellata, Miconia pepericarpa, Tibouchina candolleana, Cordia superba, Cestrum amictum, Alchornea triplinervia, Casearia sylvestris, Blepharocalyx salicifolius, Myrcia rostrata e Schinus terebinthifolius, sendo indicadas como espécies para uso nos programas de reabilitação de áreas mineradas em condições semelhantes sobre a

Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior.

Science.gov (United States)

Bergauer, Kristin; Sintes, Eva; van Bleijswijk, Judith; Witte, Harry; Herndl, Gerhard J

2013-06-01

Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (accA subunit), a key enzyme powering inter alia the 3-hydroxypropionate/4-hydroxybutyrate cycle (HP/HB) and the archaeal ammonia monooxygenase (amoA). Quantification of accA-like genes revealed a consistent depth profile in the upper mesopelagial with increasing gene abundances from subsurface layers towards the oxygen minimum zone (OMZ), coinciding with an increase in archaeal amoA gene abundance. Gene abundance profiles of metabolic marker genes (accA, amoA) were correlated with thaumarchaeal 16S rRNA gene abundances as well as CO2 fixation rates to link the genetic potential to actual rate measurements. AccA gene abundances correlated with archaeal amoA gene abundance throughout the water column (r(2)  = 0.309, P < 0.0001). Overall, a substantial genetic predisposition of CO2 fixation was present in the dark realm of the tropical Atlantic in both Archaea and Bacteria. Hence, dark ocean CO2 fixation might be more widespread among prokaryotes inhabiting the oxygenated water column of the ocean's interior than hitherto assumed. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

USN/USMC Commander’s Quick Reference Legal Handbook

Science.gov (United States)

2015-01-01

Family Advocacy Program FAR: Family Advocacy Representative FFM : Frequent Flyer Miles FITREP: Fitness Report 141    FJA: Fleet Judge...1107(e) ij theCA is authorized to set aside the findings or sentence or ij the findings or sentence were set aside by ACCA . "Evaluate each piece of

Department of the Navy FY 1990/FY 1991 Biennial Budget Estimates. Military Construction and Family Housing Program FY 1990. Justification Data Submitted to Congress

Science.gov (United States)

1989-01-01

properly configured for optimum space use, are inadequate, overcrowded, and cannot acca -modate all the children who need child care. Comeercial child... F6 -4 l’mestic Leasing Fiscal Year Summary: PY 1988 - The domestic leasing program consists of 1,324 units requiring funding of 09,551.0. runding in

Conference proceedings of Helmet Mounted Displays and Night Vision Goggles (Visuels Montes sur le Casque et Equipments de Vision Nocturne). Held in Pensacola, Florida, on May 2, 1991

Science.gov (United States)

1991-12-01

seinble IAL aussi conduit par Ie VOR. Le plateau observe on exeinple de comporteinent de recherche, associant sacca- entr Ia2Em Ct3 Cne accae d...6quipements, emplacoment dot ycux, forme et dimensions L’informsttion auditive roy~t une importance fondlamontale doeI to tet, emplacement Ct

Children of God in Bergen

Directory of Open Access Journals (Sweden)

Karin Kvideland

1975-01-01

Full Text Available The founder of the movement Children of God, David Berg, was born in Melrose, Oakland, Calif. on the 18th of February 1919. In 1969 the first congress takes place in Laurentide near Montreal. Here the followers of Berg establish themselves as a religious group. Bishops and elders were elected, Berg is called Moses, under which name he was referred to in the revelations of some of his young followers. The group is called Children of God, a name first used by a journalist and then adopted by them. The missionary efforts of the group are mainly directed towards the younger generation. Usually the members are in their late teens and early twenties. When joining the movement, they forsake everything. That means they leave school or universities, they give up other forms of training, they don't continue with their jobs and they leave their homes. They live together in communes, or as they prefer to call it "Christian house”. In 1972 the movement reached Europe. A colony was founded in London, and from there they proceeded to Oslo.

Effect of virtual reality in Parkinson's disease: a prospective observational study

Directory of Open Access Journals (Sweden)

Maria Izabel Rodrigues Severiano

Full Text Available ABSTRACT Objective: To assess the effectiveness of balance exercises by means of virtual reality games in Parkinson's disease. Methods: Sixteen patients were submitted to anamnesis, otorhinolaryngological and vestibular examinations, as well as the Dizziness Handicap Inventory, Berg Balance Scale, SF-36 questionnaire, and the SRT, applied before and after rehabilitation with virtual reality games. Results: Final scoring for the Dizziness Handicap Inventory and Berg Balance Scale was better after rehabilitation. The SRT showed a significant result after rehabilitation. The SF-36 showed a significant change in the functional capacity for the Tightrope Walk and Ski Slalom virtual reality games (p < 0.05, as well as in the mental health aspect of the Ski Slalom game (p < 0.05. The Dizziness Handicap Inventory and Berg Balance Scale showed significant changes in the Ski Slalom game (p < 0.05. There was evidence of clinical improvement in patients in the final assessment after virtual rehabilitation. Conclusion: The Tightrope Walk and Ski Slalom virtual games were shown to be the most effective for this population.

24 CFR 3285.4 - Incorporation by reference (IBR).

Science.gov (United States)

2010-04-01

..., Virginia 22206. (1) ACCA Manual J, Residential Load Calculation, 8th Edition, IBR approved for § 3285.503(a)(1)(i)(A). (2) [Reserved] (c) The materials listed below are available for purchase from APA—The...-6600, fax number (253) 565-7265. (1) PS1-95, Construction and Industrial Plywood (with typical APA...

Tangled up in Blue: Boosting Mental Health Services at Community Colleges

Science.gov (United States)

Finkel, Ed

2016-01-01

In a recent survey of 4,000 community college students, half reported experiencing a mental health condition. American College Counseling Association's (ACCA) fifth annual survey of personal and mental health counseling at community colleges provides some data from 159 professionals at two-year colleges in 41 states and Puerto Rico. Among the…

The Commander’s Handbook on the Law of Naval Operations NWP 9 (REV.A)/ FMFM 1-10. Annotated Supplement

Science.gov (United States)

1989-01-01

Channel ( Luzon Strait) Geographe Channel -Maemei Sudjo Bangka Passage Gibraltar, Strait of 1.4afia-St-a:t Bangki-Strait -Greyhound Strait Ma; acca Strait...if receipt and delivery not simultaneous, two separate msgs shall be sent) F6 AS7-6- 14 FORM 21 REPORT OF SPECIAL PRIZE COMMISSIONER UNITED STATES

U. S. Army Medical Research and Development Technical Report

Science.gov (United States)

1978-09-30

speed, accuracy, and precision cormared to the speed, accuracy, and precision of analysts counting manually was undertaken. If the ACCA prove to be...Fed Pruc 37 f6 ):1300, 1978 78-062 ZOLOCK, D.T., R.L. MORRISSEY, and D.D. BIKLE. 1,25-dihydro- xycholecalciferol (1,25(0112 )-mediated bone mineral

Provision of Personnel and Administrative Support to the Forward Deployed Forces

Science.gov (United States)

1975-06-06

Tor thaaa aystams to onerate reliably during combat. m. Baau.^hU^s^. A. Any cant,n.apay p.aa davalopad fan str^naU, and acca „„ti„s/pars...accounting, control and audit procedures for all replacements in the theater of operations. c. Receipt, processing, housing, feeding, clothing and

2008-2009 en bref

International Development Research Centre (IDRC) Digital Library (Canada)

La recherche-action participative(RAP) rassemble des représentants des groupes ... finance cinq projets pilotes, et le Programme de recherche sur l'eau, la santé et l'adaptation aux changements climatiques en Afrique, dans le cadre duquel le programme ACCA finance désormais six projets. Kezlya Magawa cultive du ...

SWiFT Software Quality Assurance Plan.

Energy Technology Data Exchange (ETDEWEB)

Berg, Jonathan Charles [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2016-01-01

This document describes the software development practice areas and processes which contribute to the ability of SWiFT software developers to provide quality software. These processes are designed to satisfy the requirements set forth by the Sandia Software Quality Assurance Program (SSQAP). APPROVALS SWiFT Software Quality Assurance Plan (SAND2016-0765) approved by: Department Manager SWiFT Site Lead Dave Minster (6121) Date Jonathan White (6121) Date SWiFT Controls Engineer Jonathan Berg (6121) Date CHANGE HISTORY Issue Date Originator(s) Description A 2016/01/27 Jon Berg (06121) Initial release of the SWiFT Software Quality Assurance Plan

A highly accurate benchmark for reactor point kinetics with feedback

International Nuclear Information System (INIS)

Ganapol, B. D.; Picca, P.

2010-10-01

This work apply the concept of convergence acceleration, also known as extrapolation, to find the solution to the reactor kinetics equations describing nuclear reactor transients. The method features simplicity in that an approximate finite difference formulation is constructed and converged to high accuracy from knowledge of how the error term behaves. Through Rom berg extrapolation, we demonstrate its high accuracy for a variety of imposed reactivity insertions found in the literature as well as nonlinear temperature and fission product feedback. A unique feature of the proposed method, called RKE/R(om berg) algorithm, is interval bisection to ensure high accuracy. (Author)

Berg River Textiles - Cleaner Production Option Report

DEFF Research Database (Denmark)

Wenzel, Henrik; Schneider, Zsig

schematics on the various wet treatment operations in the dyehouse, and water and energy balances were made to the extent data allowed. A number of options for saving water, energy and chemicals were identified. The potentials monetary savings and necessary investments were estimated, and a list of priority...... projects including milestone plans for their implementation was made. A saving potential of around 3 mill. R was identified with a pay-back period of around 0.2 years as average of the identified options. The company implemented a large number of the options right away....

Seta teenis 26 000 eurot / Maimu Berg

Index Scriptorium Estoniae

Berg, Maimu, 1945-

2003-01-01

Suvi Ahola tutvustas Soome Instituudis 2003. a. Finlandia auhinnale kandideerinud kirjanikke: Juhani Salokannel (romaaniga "Samast suguvõsast"), Joel Haahtela ("Elena"), Leena Lander ("Käsk"), Juha Itkonen ("Hilisemate aegade püha"), Juha Ruusuvuori ("Nokian nuorisoohjaaja"), Lars Sund ("Eriku raamat") ja hilisem võitja Pirkko Saisio ("Punainen erokirja")

Jabuticaba [Pliniajaboticaba (Vell.) Berg] skins decrease lipid ...

African Journals Online (AJOL)

SAM

2014-03-12

density lipoprotein cholesterol; MDA, malondialdehyde ... rats, and quantification and characterization of its .... Moisture and lipid content were determined using the methods ... acids and flavonoids were identified, presenting the.

BORAGINACEAE A. JUSS. SENSU LATO EM UMA FLORESTA ESTACIONAL DE TERRAS BAIXAS EM PERNAMBUCO, BRASIL

Directory of Open Access Journals (Sweden)

JOSÉ IRANILDO MIRANDA DE MELO

2009-01-01

Full Text Available This work deals with the survey of the family Boraginaceae in a lowland seasonal dry forest in the municipality of Aliança, Pernambuco, Northeast Brazil. Seven species and three genera were recorded: Cordia L., with three species (C. sellowiana Cham., C. taguahyensis Vell. and C. trichotoma (Vell. Arráb. ex Steud.; Heliotropium L., with only one species, H. elongatum (Lehm. I.M. Johnst. and Tournefortia L., represented by three species (T. bicolor Sw., T. gardneri A.DC. and T. rubicunda Salzm. ex A.DC.. A key to the recognition of the species, as well as descriptions and illustrations were given. Data about distribution, flowering and or fruiting of the species also are provided.

Diversity and Ecological Functions of Crenarchaeota in Terrestrial Hot Springs of Tengchong, China

Science.gov (United States)

Li, W.; Song, Z.; Chen, J.; Jiang, H.; Zhou, E.; Wang, F.; Xiao, X.; Zhang, C.

2010-12-01

The diversity and potential ecological functions of Crenarchaeota were investigated in eight terrestrial hot springs (pH: 2.8-7.7; temperature: 43.6-96 C) located in Tengchong, China, using 16S rRNA gene phylogenetic analysis. A total of 826 crenarchaeotal clones were analyzed and a total of 47 Operational taxonomic units (OTUs) were identified. Most (93%) of the identified OTUs were closely related (89-99%) to those retrieved from hot springs and other thermal environments. Our data showed that temperature may predominate over pH in affecting crenarchaeotal diversity in Tengchong hot springs. Crenarchaeotal diversity in moderate-temperature (59 to 77 C) hot springs was the highest, indicating that the moderate-temperature hot springs are more inclusive for Crenarchaeota. To understand what ecological functions these Crenarchaeota may play in Tengchong hot springs, we isolated the environmental RNA and constructed four cDNA clone libraries of the archaeal accA gene that encodes Acetyl CoA carboxylase. The accA gene represents one of the key enzymes responsible for the CO2 fixation in the 3-hydroxypropionate/4-hydroxybutyrate pathway. The results of phylogenetic analysis showed all the transcribed accA gene sequences can be classified into three large clusters, with the first one being affiliated with marine crenarchaeota, the second one with cultured crenarchaeota, and the third one with Chlorobi (Green sulfur bacteria), which have been proved to employ the 3-hydroxypropionate/4-hydroxybutyrate pathway. The long-branch distances of the phylogenetic tree suggest that these sequences represent novel accA-like gene. Our results also showed that sequences of the accA-like gene from the same hot spring belonged to one cluster, which suggests that a single crenarchaeotal group may fix CO2 via 3-hydroxypropionate/4-hydroxybutyrate pathway in the investigated hot springs.

Niche partitioning of marine group I Crenarchaeota in the euphotic and upper mesopelagic zones of the East China Sea.

Science.gov (United States)

Hu, Anyi; Jiao, Nianzhi; Zhang, Rui; Yang, Zao

2011-11-01

Marine group I Crenarchaeota (MGI) represents a ubiquitous and numerically predominant microbial population in marine environments. An understanding of the spatial dynamics of MGI and its controlling mechanisms is essential for an understanding of the role of MGI in energy and element cycling in the ocean. In the present study, we investigated the diversity and abundance of MGI in the East China Sea (ECS) by analysis of crenarchaeal 16S rRNA gene, the ammonia monooxygenase gene amoA, and the biotin carboxylase gene accA. Quantitative PCR analyses revealed that these genes were higher in abundance in the mesopelagic than in the euphotic zone. In addition, the crenarchaeal amoA gene was positively correlated with the copy number of the MGI 16S rRNA gene, suggesting that most of the MGI in the ECS are nitrifiers. Furthermore, the ratios of crenarchaeal accA to amoA or to MGI 16S rRNA genes increased from the euphotic to the mesopelagic zone, suggesting that the role of MGI in carbon cycling may change from the epipelagic to the mesopelagic zones. Denaturing gradient gel electrophoretic profiling of the 16S rRNA genes revealed depth partitioning in MGI community structures. Clone libraries of the crenarchaeal amoA and accA genes showed both "shallow" and "deep" groups, and their relative abundances varied in the water column. Ecotype simulation analysis revealed that MGI in the upper ocean could diverge into special ecotypes associated with depth to adapt to the light gradient across the water column. Overall, our results showed niche partitioning of the MGI population and suggested a shift in their ecological functions between the euphotic and mesopelagic zones of the ECS.

Serum anti-glycan antibodies in paediatric-onset Crohn's disease: association with disease phenotype and diagnostic accuracy.

Science.gov (United States)

Sładek, Małgorzata; Wasilewska, Agata; Swiat, Agnieszka; Cmiel, Adam

2014-01-01

Antibodies reacting with various microbial epitopes have been described in inflammatory bowel disease (IBD) and are associated with a specific diagnosis and clinical presentation. To evaluate the profile of new anti-glycan antibodies, their potential association with disease phenotype and diagnostic accuracy in paediatric Crohn's disease (CD). Blood samples from 134 paediatric IBD patients (109 CD, 25 ulcerative colitis (UC)) and 67 controls were blindly analysed for anti-Saccharomyces cerevisiae (ASCA), anti-chitobioside carbohydrate (ACCA), anti-laminaribioside carbohydrate (ALCA), and anti-mannobioside carbohydrate (AMCA) antibodies using commercially available assays. The serological response to glycans was correlated with clinical disease characteristics. At least one of the tested anti-glycan antibodies was present in 75% of CD patients. Despite the high frequency of reactivity to glycan epitopes, a limited overlap of serological markers was observed. In total, 49% of ASCA-negative patients presented with one of the following: ACCA, ALCA, or AMCA. The occurrence of one antibody from the anti-glycan panel was independently associated with complicated disease phenotype and ileocolonic disease location. A higher level of immune response as assessed by the quartile sum scores for ACCA, ALCA, and AMCA was linked with older age at diagnosis (10-17 years) and ileocolonic disease location. The ASCA had the greatest accuracy for diagnosis and differentiation of CD. Qualitative and quantitative serologicalal response to glycan epitopes was associated with distinct clinical presentation in paediatric CD patients. This raises the possibility for the use of these markers to differentiate subgroups of CD patients with more sever clinical presentation. The ASCA was the most accurate serological marker for CD; however, testing for the new anti-glycan antibodies may constitute an adjunctive tool in a specific group of patients to aid in the differentiation of CD with absent

The CARD8 p.C10X mutation associates with a low anti-glycans antibody response in patients with Crohn's disease.

Science.gov (United States)

Vasseur, Francis; Sendid, Boualem; Broly, Franck; Gower-Rousseau, Corinne; Sarazin, Aurore; Standaert-Vitse, Annie; Colombel, Jean-Frederic; Poulain, Daniel; Jouault, Thierry

2013-03-18

Crohn's disease (CD) is associated with elevated anti-glycans antibody response in 60% of CD patients, and 25% of healthy first-degree relatives (HFDRs), suggesting a genetic influence for this humoral response. In mice, anti-glucan antibody response depends on the NLRP3 inflammasome. Here, we explored the effect of mutated CARD8, a component of the inflammasome, on anti-glycans antibody response in human. The association between p.C10X mutation (rs2043211) of the CARD8 gene and the levels of anti-glycans antibody response was examined in 39 CD families. The family-based QTDT association test was used to test for the genetic association between CARD8 p.C10X mutation and anti-glycan antibodies in the pedigrees. The difference in antibody responses determined by ELISA was tested in a subgroup of CD probands (one per family) and in a subgroup of HFDRs using the Wilcoxon Kruskal Wallis non-parametric test. The QTDT familial transmission tests showed that the p.C10X mutation of CARD8 was significantly associated with lower levels of antibody to mannans and glucans but not chitin (p=0.024, p=0.0028 and p=0.577, for ASCA, ALCA and ACCA, respectively). These associations were independent of NOD2 and NOD1 genetic backgrounds. The p.C10X mutation significantly associated or displayed a trend toward lower ASCA and ALCA levels (p=0.038 and p=0.08, respectively) only in the subgroup of CD probands. Such associations were not significant for ACCA levels in both subgroups of CD probands and of HFDRs. Our results show that ASCA and ALCA but not ACCA levels are under the influence of CARD8 genotype. Alteration of CARD8, a component of inflammasome, is associated with lower levels of antibodies directed to mannans and glucans at least in CD patients.

Role of an Essential Acyl Coenzyme A Carboxylase in the Primary and Secondary Metabolism of Streptomyces coelicolor A3(2)

Science.gov (United States)

Rodríguez, E.; Banchio, C.; Diacovich, L.; Bibb, M. J.; Gramajo, H.

2001-01-01

Two genes, accB and accE, that form part of the same operon, were cloned from Streptomyces coelicolor A3(2). AccB is homologous to the carboxyl transferase domain of several propionyl coezyme A (CoA) carboxylases and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE shows no significant homology to any known protein. Expression of accB and accE in Escherichia coli and subsequent in vitro reconstitution of enzyme activity in the presence of the biotinylated protein AccA1 or AccA2 confirmed that AccB was the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex, suggesting that this small polypeptide is a functional component of the ACCase. The impossibility of obtaining an accB null mutant and the thiostrepton growth dependency of a tipAp accB conditional mutant confirmed that AccB is essential for S. coelicolor viability. Normal growth phenotype in the absence of the inducer was restored in the conditional mutant by the addition of exogenous long-chain fatty acids in the medium, indicating that the inducer-dependent phenotype was specifically related to a conditional block in fatty acid biosynthesis. Thus, AccB, together with AccA2, which is also an essential protein (E. Rodriguez and H. Gramajo, Microbiology 143:3109–3119, 1999), are the most likely components of an ACCase whose main physiological role is the synthesis of malonyl-CoA, the first committed step of fatty acid synthesis. Although normal growth of the conditional mutant was restored by fatty acids, the cultures did not produce actinorhodin or undecylprodigiosin, suggesting a direct participation of this enzyme complex in the supply of malonyl-CoA for the synthesis of these secondary metabolites. PMID:11526020

Thailand: Background and U.S. Relations

Science.gov (United States)

2006-10-02

Capabilities Will Be Emphasized Instead of Numbers of Troops,” State Department Press Releases and Documents. August 16, 2004. 28 Kaplan , Robert D., “How We...LAOS MALAYSIA Andaman Sea Str ai t of Mal acca INDONESIA Gul f of Thai l and South Chi na Sea Phuket Hat Yai Pattani Yala Narathiwat Nakhon Ratchasima

Radiolocation Techniques (Les Techniques de Radiolocalisation

Science.gov (United States)

1992-11-01

Dr R. Klemm DrD Rother FGAN- FFM SEL/LS/E Neuenahrer Strasse 20 Lorenzstrasse 10 D-5307 Wachtberg 7 D-7000 Stuttgart 40 Germany Germany Prof. G...des solutions. accas I lFionograinme, donc: aui profil. Cat article rapporte tine partie des Etudes mendes an La indthodo proposde s’inspirc de cette

Management Advisory Services by CPA’s. A Survey of Current Expansion of Sole Proprietor Professional Practice Units.

Science.gov (United States)

1981-12-01

national Busintess, 4th ed.. Multiastionals. Sethi & * sW imnuualnd ieansivin and dia. Wilcox (Irwin. 1971). Holim. ( Ffm Press. inmiveat cula...Ch7. 4. (Pretice.HaU, 19733. Specalits, Is.Part I (Oma. 30-37.3 (2) Pvoiysl anJ ecla *u,.ss .w only te Compute, ScwUV Securiy, Accuracy ad,uozed acca

Programme de bourses de recherche sur le changement climatique ...

International Development Research Centre (IDRC) Digital Library (Canada)

Une faculté d'adaptation limitée est souvent reconnue comme l'un des principaux facteurs de vulnérabilité aux changements climatiques. Le programme Adaptation aux changements climatiques en Afrique (ACCA) du CRDI vise à aider les sociétés africaines à faire face aux changements climatiques. Cette subvention ...

Suppressive Shields Structural Design and Analysis Handbook

Science.gov (United States)

1977-11-18

0.50 Aluminum ..... ......... ... 0.25 3.9 FIREBALL AND THERMAL ENVIRONMENT The fireball and thermal environment resulting from an acca ...289,440 lb The acceleration of the mass is given by F8 - 103,8682 a 0.05759 - 5,025,813 in/sec2 For the next step, the acceleration is assumed to be

Leveraging Executable Architectures in a Joint Environment

Science.gov (United States)

2009-01-01

Support of Type 2/3 Terminal Attack Control Call Wing Operations Center (WOC) to Task On-Call Aircraft Call Air Command and Control Agency ( ACCA ) to...MIDS MIDS MIDS X = Existing capability P1 = Partial - requires voice ack P2 = Partial - only some F/A-18s None P3 = remarks only TARGET LOCATION

Alpha List of Prime Contract Awards. Oct 92-Sep 93. FY93. (Claude Ralph - Day Francis O Co. Inc.)

Science.gov (United States)

1994-03-01

4LLAA ( LU AC x 0 m LA (LA 0 x1 (1A)LALLCA(A( AcCA L A 0 ( tALALA01upIc (00.- U1 C(0 (D0 (0’.CD(0 (D (D (D (DW 00 0 (m (m (0CD(D0(m0w(0(20 (D0w Lo(1(0...COVcII N 44444444444 4444444444 N c04 II 44 4444 N 0041 caoacao acca 0i 0o cn I’ ID6 OOCNY 2 N4NrJNNNNNN0 NNNNNNNNNN C3 cO-4 11 L) U0 0 0 0 0 0c 0 0 0 0...0.4 .. 14൰*o0oo 00 0 0 - .4 N 4j H 4 I0cc WOO 004 INN C 10 10 100N04144443(300 t0 I0.4 ffM MN 14 100 N 0YMIn C 0 0 (1 H ma I (fl>( IIO N N NN N 0 4

Tight-Binding Approach to Computational Materials Science, Symposium Held December 1-3, 1997, Boston, Massachusetts, USA. Volume 491

Science.gov (United States)

1998-01-01

many-body interactions. Then, hamiltonian (3) is reduced to: H = X PAT + Zfica + Tvc (c* aCca + C*aCva )] (5a) where --V2+V,(F) + V2(r) -^V2 +Vx{r...correction due to charge fluctuations is now represented by the Mulliken charge dependent contribution H^v to the matrix elements ffM „. As in

The Analysis of Design of Robust Nonlinear Estimators and Robust Signal Coding Schemes.

Science.gov (United States)

1982-09-16

b - )’/ 12. between uniform and nonuniform quantizers. For the nonuni- Proof: If b - acca then form quantizer we can expect the mean-square error to...in the window greater than or equal to the value at We define f7 ’(s) as the n-times filtered signal p + 1; consequently, point p + 1 is the median and

A New Procedure for Determination of Electron Temperatures and Electron Concentrations by Thomson Scattering and Analytical Plasmas

Science.gov (United States)

1988-10-28

Spectrochim. Acta 40B, 1211 (1985). 24 30. K. A. MARSHALL and G. M. HIEFTJE, Spectrochim. Acca (submitted, 1987). 31. H. J. KUNZE, Plasma Diagnostics, Ed...13 0,47689017-16 0 .4 F6 S6 7 E.16 26 Table 2. Correction table for Nd/YAG laser. Real (true) Te (top line) and Ne (left column) values and

Surface Observation Climatic Summaries for McChord AFB Washington

Science.gov (United States)

1989-07-01

0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

Appendices for Fort George G. Meade Active Sanitary Landfill and Clean Fill Dump Remedial Investigation Report

Science.gov (United States)

1992-12-01

3O VLYqq Time: P7 /0 Well Condition.: Well Diameter (inches): L4 U Odor (describe): Sounding Method: tW L= . . Measurement Reference: ’TOC Pv Stick... acca (f:):~ (=in)-__ --- 13.10 L AP Siium i=; ’are: _______________ Commane n ds Cbserwvuic-n: ______________________ 507 31 ,;IL 3: iL8.15 ’a~~l !o

Nuclear, Chemical and Biological Education and Training: A Review Across the Services and Joint Community

Science.gov (United States)

2007-09-01

13 1. Air Force Inspector General – CBRNE CERFP Program Audit ...14 2. Defense Medical...CBRNE CERFP Program Audit “The AFAA [Air Force Audit Agency] is assessing whether Air National Guard officials properly managed the Chemical...processing personnel through the aircrew contamination control area ( ACCA ). Flight Medicine provides training on agent toxicology and pharmacology. The

Preliminary Public Health, Environmental Risk, and Data Requirements Assessment for the Herbicide Orange Storage Site at Johnston Island

Science.gov (United States)

1991-10-01

included differences in results from field performance audit samples and performance evaluation standards. As stated above, these discrepancies may have...Turtiss arn. also se’nn acca : ,cnly IIhvoughout the lagoon andc chmnnn! arý4nz. 0TiO t-4-t-l. waz c ,!nusnd in April 1986 at" Station P5. Hawia %Ocn" sczls

Fundamental Electronic Properties of Donor-Type Graphite Intercalated Compounds.

Science.gov (United States)

1984-08-01

actulbndsbecauseofthe slight inaccu- of -0.09eOV. Thisis close but too low to give a racy of the fit which was, weighted to more acca - realistic Fermi...2). Further evidence and Dr. N. Wakabayashi and the generosity of of the failure of this model for LtC, is that ( p2 Dr. A. W. Moore of Union

Adapter l'information climatique aux besoins des utilisateurs | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

29 mars 2011 ... Cet exposé politique résume les leçons tirées du forum d'apprentissage du programme ACCA entitulé " Faciliter l'accès aux prévisions météorologiques saisonnières et savoir mieux les exploiter" qui a pris lieux à Nairobi, Kenya en mars 1010.

Effect of a rehabilitation program using virtual reality for balance and functionality of chronic stroke patients

Directory of Open Access Journals (Sweden)

Wagner Henrique Souza Silva

2015-09-01

Full Text Available AbstractThis study aimed to investigate the effect of a rehabilitation program using virtual reality (VR in addition to conventional therapy for improvement of balance (BERG scale and functional independence (FIM scale in chronic stroke patients. Ten individuals, mean age of 51.4 (± 6.7 years, participated of eight 60-minute sessions comprising kinesiotherapy (15min, Nintendo Wii (30min and Learning transfer (15min exercises. After training, nonparametric statistical analysis showed significant improvement in total FIM (p= .01 and BERG scores (p= .00, and in some of their subitems: FIM - dressing lower body (p= .01, transfer to bathtub/shower (p= .02 and locomotion: stairs (p= .03; BERG - reaching forward with outstretched arm (p= .01, retrieving object from the floor (p= .04, turning 360º (p= .01, placing alternate foot on step (p≤ .01, standing with one foot in front (p= .01, and one leg stand (p= .03. These findings suggest a positive influence of virtual reality exercises adjunct to conventional therapy on rehabilitation of balance and functionality post stroke, and indicate the feasibility of the proposed VR-based rehabilitation program.

Advanced Concepts for Avionics/Weapon System Design, Development and Integration: Conference Proceedings of the Avionics Panel Symposium (45th) Held at Ottawa, Canada on 18-22 April 1983.

Science.gov (United States)

1983-10-01

BIT A,, M 115V ACBB N 270V DC RETURN p 115V ACCA R IW DC POWER S INTERLOCK RETURN T STRUCTURE GROUND U FIBER OPTICS BUS V ADDRESS BIT A,, w...Ontario Kl A 0K2 Canada FGAN- FFM , D-5307 Wachtberg-Werthhoven Germany Concordia University, 7141 Sherbrooke St. W. Montreal, QueH4BlRG Canada

The Cloning, Characterization, and Functional Analysis of Murine Pregnancy Specific Glycoproteins

Science.gov (United States)

1999-07-23

wash at 550 C Sense AS Probe CTCCTCTCI I IrCATCTGT TCACTCATTT(AG~CACAGCCAG CTGGTACAAAGGGCTGATTG Cloni"gflllll~"gtltPsg19 5861 (AceS) 5859 ( AccAS ) 8050...12p40, iNOS, orTGF-1J mRNA. In RAW 264.7 cells, LPS upregulated mRNA expression for all cytokines examined, except for TGF- f3 mRNA. However, treatment

447 157 45 89 %

International Development Research Centre (IDRC) Digital Library (Canada)

Selon la prémisse de la recherche-action participative que nous avons financée, toute connaissance utile découle ... auprès des utilisateurs, le programme a financé des efforts supplémentaires de renforcement des capacités et de ... des retombées du programme. AfricaAdapt. Le programme ACCA finance AfricaAdapt afin.

Viterbi Tracking of Randomly Phase-Modulated Data (and Related Topics).

Science.gov (United States)

1982-08-10

odd (#I,, P2 ," • Denote the conditional probability mass 46, ) function of 0k, given Ak, by p(Ok/Ak). For the (4, 4) diagram of Fig. 2(d), i, j even...Professor Electrical Engineering LS:fr I. II Recent (Jutstandinq Acca plisuneil: / - -017(, July 12, 1982 The problem of FM divdulation has a long hi.;try (f

Bionomia e ciclo de vida de Umbrina canosai, Berg (1895 The bionomics and life cycle of Umbrina canosai Berg (1895

Directory of Open Access Journals (Sweden)

Elza Matta Zaneti-Prado

1979-06-01

Full Text Available Ninety-two samples taken during four océanographie cruises (January/February, April, August, October/November, 1972 provided material to study the bionomics and life history of Umbrina canosai. As many as 1477 specimens were examined to determine individual total length and weight, age (through otoliths readings sex and maturity. A certain number of ovaries was examined to estimate their fecundity and determine spawning periodicity. Spatial distribution pattern of the species was obtained graphically for the different seasons using demographic isolines. Salinity, temperature and oxygen content of the bottom waters and depth related to the number of individuals caught by unit effort provided information to conclude that U. canosai migrates seasonally under the influence of the displacement of Subantarctic waters along the Southern Brazilian coast. A rather different spatial distribution was observed between immature and mature individuals. Spawning occurs throughout August/November and individuals spawn more than once during each spawning season. The recruitment of young specimens occurs during summer-autumn. There is no significant difference in the growth rate for both sexes. The weight/length relationship was significantly different for female and male values. It seems that U. canosai is closely associated with the presence of cold waters (below 16ºC.

Prediction of Risk of Falling among Institutionalized Elderly People in Iran

Directory of Open Access Journals (Sweden)

Ahmad Ali Akbari Kamrani

2005-09-01

Full Text Available Aging declines abilities and leads to increased risk of falling and subsequently poorer quality of life. The objective of this study was to identify a proper assessment for risk of falling among institutionalized elderly. In order to accomplish this aim, two functional assessment methods, Berg Scale and Tinetti Scale, were used and the validity indices of these methods were calculated. Prospective non-interventional methodological discriminative-validation study in order to make a comparative assessment of the discriminative validity of the two clinical assessment methods among the elderly people with/without history of falling. The frequency of falls within 6 months among institutionalized elderly individuals was prospectively studied. Finally, those having had two or more falls within 6 months were enrolled in the faller group and those having no falls within 6 months were enrolled in the non-faller group. Twenty-one women and 33 men (mean age: 75.79, standard deviation [SD]: 8.47, range: 61-98 independent in their daily activities and able to walk 10 meters using/without assistive devices volunteered to participate in the study with awareness. Background variables included age, gender, use/nonuse of assistive devices, height, weight, number of the drugs used, and number of the diseases; independent variable was history of falling; and dependent variables were the results of the two functional assessment methods. Independent t-test indicated a significant difference between the two groups of fallers and non-fallers in the mean scores on Berg Balance Scale (P=0.0001 and Tinetti Scale (P=0.0001. The results of logistic regression test indicated much more discriminative validity for Berg Balance Scale test than Tinetti Scale test. Studying the validity of Berg Balance Scale assessment method showed that all validity indices should be regarded as bases for clinical decision.

Does robotic gait training improve balance in Parkinson's disease? A randomized controlled trial.

Science.gov (United States)

Picelli, Alessandro; Melotti, Camilla; Origano, Francesca; Waldner, Andreas; Gimigliano, Raffaele; Smania, Nicola

2012-09-01

Treadmill training (with or without robotic assistance) has been reported to improve balance skills in patients with Parkinson's disease (PD). However, its effectiveness on postural instability has been evaluated mainly in patients with mild to moderate PD (Hoehn & Yahr stage ≤3). Patients with more severe disease may benefit from robot-assisted gait training performed by the Gait-Trainer GT1, as a harness supports them with their feet placed on motor-driven footplates. The aim of this study was to determine whether robot-assisted gait training could have a positive influence on postural stability in patients with PD at Hoehn & Yahr stage 3-4. Thirty-four patients with PD at Hoehn & Yahr stage 3-4 were randomly assigned into two groups. All patients received twelve, 40-min treatment sessions, three days/week, for four consecutive weeks. The Robotic Training group (n = 17) underwent robot-assisted gait training, while the Physical Therapy group (n = 17) underwent a training program not specifically aimed at improving postural stability. Patients were evaluated before, immediately after and 1-month post-treatment. Primary outcomes were: Berg Balance scale; Nutt's rating. A significant improvement was found after treatment on the Berg Balance Scale and the Nutt's rating in favor of the Robotic Training group (Berg: 43.44 ± 2.73; Nutt: 1.38 ± 0.50) compared to the Physical Therapy group (Berg: 37.27 ± 5.68; Nutt: 2.07 ± 0.59). All improvements were maintained at the 1-month follow-up evaluation. Robot-assisted gait training may improve postural instability in patients with PD at Hoehn & Yahr stage 3-4. Copyright © 2012 Elsevier Ltd. All rights reserved.

Prediction of Risk of Falling Among Institutionalized Elderly People in Iran

Directory of Open Access Journals (Sweden)

Ahmad Ali Akbari-Kamrani

2003-07-01

Full Text Available Objective: Aging decline abilities and leads to increased risk of falling and subsequently poorer quality of life. The objective of this study was to identify a proper assessment for risk of falling among institutionalized elderly people. Materials & Methods: Prospective non–interventional methodological discriminative–validation study in order to make a comparative assessment of the discriminative validity of the two clinical assessment methods among the elderly people with/ without history of falling. The frequency of falls within 6 months among institutionalized elderly individuals was prospectively studied. Finally, those having had two or more falls within 6 months were enrolled in the faller group and those having no falls within 6 months were enrolled in the non-faller group. Twenty-one women and 33 men (mean age: 75.79, standard deviation [SD]: 8.47, range: 61-98 independent in their daily activities and able to walk 10 meters using / without assistive devices volunteered to participate in the study with awareness. Background variables included age, gender, use / nonuse of assistive devices, height, weight, number of the drugs used, and number of the diseases independent variable was history of falling and dependent variables were the results of the two functional assessment methods. In order to accomplish the aim of study, two functional assessment methods, Berg scale and Tinetti scale, were used and the validity indices of these methods were calculated. Results: Independent t test indicated a significant difference between the two groups of fallers and non-fallers in the mean scores on Berg Balance Scale (p=0.00l and Tinetti Scale (p=0.00l. Conclusion: The results of logistic regression test indicated much more discriminative validity for Berg Balance Scale test than Tinetti Scale test. Studying the validity of Berg Balance Scale assessment method showed that all validity indices should be regarded as bases for clinical decision.

The Tribe Anisoscelini (Hemiptera: Heteroptera, Coreidae) in Argentina.

Science.gov (United States)

Coscarón, María Del Carmen; Pall, José Luis

2015-10-23

Eight genera and 21 species of the tribe Anisoscelini (Coreidae, Coreinae) are recorded in Argentina: Anisoscelis foliaceus (Fabricius); Coribergia declivicollis (Berg); Dalmatomammurius vandoesburgi (Brailovsky); Holymenia hystrio (Fabricius); Leptoglossus chilensis (Spinola); L. cinctus (Herrich-Schaeffer); L. concolor Walker; L. crassicornis (Dallas); L. dentatus Berg; L. fasciatus (Westwood); L. gonagra (Fabricius); L. impictus (Stål); L. ingens (Mayr); L. neovexillatus Allen; L. quadricollis (Westwood); L. stigma (Herbst); L. vexillatus (Stål); L. zonatus (Dallas); Phthia lunata (Fabricius); Phthiacnemia picta (Drury) and Ugnius kermesinus (Linnaeus). A key to genera belonging to the tribe is provided. L. stigma is recorded for the first time in Argentina with new locality records for La Rioja, Salta and San Juan.

Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number, Fiscal Year 1992 (Daubert Industries, Inc.-Gaylord Industries, Inc.)

Science.gov (United States)

1993-01-01

a0 m~ ar (0 - a 0 a4 04 H50 4 a 4 C-1 am a C3 L) 0ý an 0 a n c Za4 00 C.ým 4Lo j I N O Nol 0IS)0 cl r- m - anNe t"I ý ý Ll2 an N -z Do~ acca -fN- 0a’J...c to aQ Coo," I "o o) " ’ mC, ,I e nnI to a) ammc)oc Il I I L) o c wo x I Ca u m2 a. U r-7f cc ~ nl.< C0C) -*4~-0na-ao " 0 ELI ao (v acCa ’’ a~al~ nal...Fw IE~ 1. E F1 F4 o F. c4I F 4 F OF. F7 )I - F ~-4 .F 4 F 41) w 10 A F F W)( o4 v7- m ’mo7 l T =444 45 o o .7 c> S . o Lc4 mo - 04 NNr a)0 lo 7 1 7 o

Dollar Summary of Prime Contract Awards by Contractor, State or Country, and Place, FY 85. Part 2 (D & A Construction - H & H Service Corpor).

Science.gov (United States)

1985-01-01

4c4 ’n 8:r--t n0 . I L .I 0 In -4i n 0-1. :8:. 0 If In W I &n U) I I U UNS U g’-u U4 cc) I 040 0e a 6 e1 a. c C46, 4 C 1 00 t" .4 .. a4 4l f6 I. M t Co...1 a a - 0 -- - a44 ’ 0 Om 3"% am" aCCa - -1 aC- a amm m a t- I N N N m mCr- I4 a 21 - 0 I N C) C) c - " C) x C) x r.)mX a C -I c 0 = I= N -4 Noo W...0 aL NA aL N’-4’C 0-a Co -4 N N o 1 4 40- n N ) (DO4a *w w I-I )Ia m - 0Q’ CI "I "ao~ (.) (N 0 Z C-4 m 2lm acca -a: U 0 0 . I.- I.-1 I- nV -0LL J I I

A combined spectral and object-based approach to transparent cloud removal in an operational setting for Landsat ETM+

Science.gov (United States)

Watmough, Gary R.; Atkinson, Peter M.; Hutton, Craig W.

2011-04-01

The automated cloud cover assessment (ACCA) algorithm has provided automated estimates of cloud cover for the Landsat ETM+ mission since 2001. However, due to the lack of a band around 1.375 μm, cloud edges and transparent clouds such as cirrus cannot be detected. Use of Landsat ETM+ imagery for terrestrial land analysis is further hampered by the relatively long revisit period due to a nadir only viewing sensor. In this study, the ACCA threshold parameters were altered to minimise omission errors in the cloud masks. Object-based analysis was used to reduce the commission errors from the extended cloud filters. The method resulted in the removal of optically thin cirrus cloud and cloud edges which are often missed by other methods in sub-tropical areas. Although not fully automated, the principles of the method developed here provide an opportunity for using otherwise sub-optimal or completely unusable Landsat ETM+ imagery for operational applications. Where specific images are required for particular research goals the method can be used to remove cloud and transparent cloud helping to reduce bias in subsequent land cover classifications.

Quality indicators for acute myocardial infarction: A position paper of the Acute Cardiovascular Care Association.

Science.gov (United States)

Schiele, Francois; Gale, Chris P; Bonnefoy, Eric; Capuano, Frederic; Claeys, Marc J; Danchin, Nicolas; Fox, Keith Aa; Huber, Kurt; Iakobishvili, Zaza; Lettino, Maddalena; Quinn, Tom; Rubini Gimenez, Maria; Bøtker, Hans E; Swahn, Eva; Timmis, Adam; Tubaro, Marco; Vrints, Christiaan; Walker, David; Zahger, Doron; Zeymer, Uwe; Bueno, Hector

2017-02-01

Evaluation of quality of care is an integral part of modern healthcare, and has become an indispensable tool for health authorities, the public, the press and patients. However, measuring quality of care is difficult, because it is a multifactorial and multidimensional concept that cannot be estimated solely on the basis of patients' clinical outcomes. Thus, measuring the process of care through quality indicators (QIs) has become a widely used practice in this context. Other professional societies have published QIs for the evaluation of quality of care in the context of acute myocardial infarction (AMI), but no such indicators exist in Europe. In this context, the European Society of Cardiology (ESC) Acute Cardiovascular Care Association (ACCA) has reflected on the measurement of quality of care in the context of AMI (ST segment elevation myocardial infarction (STEMI) and non-ST segment elevation myocardial infarction (NSTEMI)) and created a set of QIs, with a view to developing programmes to improve quality of care for the management of AMI across Europe. We present here the list of QIs defined by the ACCA, with explanations of the methodology used, scientific justification and reasons for the choice for each measure.

Dollar Summary of Federal Supply Classification and Service Category by Company. Part 2 (B502-J066)

Science.gov (United States)

1990-01-01

U 0 V ) V ( w~~~~ ae a11 - 4 W 4 0~~~~ a a4 " A 0 1> z~~~~ a. a0 4 0 4 1 4 ,0 4 - 4a%- %. 0 4a4 t4 i acca Lu awHIu 0a 0 0 0 Iw awa In InI I IK t0 n 4...6. 1 4. P7 4 % -. I-J x >- .4.-H %- t- 10 *- C 4 c 6. 01 C 4 .4 &i >, L. *.4 9U 10 0. l4. .- H C 0 3’ 0 c .4 X -4.4 ); Al 31 1. 0. 40V-4 3. Il- I... acca o - z ow zi1- crw z aa 0 0 w w-U 1-00 0 .Z 0 0 <~ ~0 0 : ac 0 ow 0w xD 0 0 1-w 0. < z :I- 0~ OcOZ0 0- H z< U n Z>- ao1 w 0 WI H Z 0 0 0 00-0 al

Geradeheraus / Matthias Nöther

Index Scriptorium Estoniae

Nöther, Matthias

2008-01-01

Argentiina kirjaniku Esther Vilari romaani "Nina Glucksteini matemaatika" ainetel valminud Mari Vihmandi ooperist "Armastuse valem", libreto Maimu Berg, lavastaja Liis Kolle. Esietendus 17. oktoobril 2008 Tallinnas Rahvusooperis Estonia

Réponse équilibrée aux besoins en eau dans le bassin du Saïss au ...

International Development Research Centre (IDRC) Digital Library (Canada)

ACCA

par les changements climatiques. Ce projet du programme ACCA met l'accent sur l'agriculture, à l'origine de plus de 82 % de la consommation d'eau dans le bassin. Réponse équilibrée aux besoins en eaudans le bassin du Saïss au Maroc. De petits exploitants agricoles du bassin du Saïss font face aux pénuries d'eau ...

Helicopter Maneuverability and Agility Design Sensitivity and Air Combat Maneuver Data Correlation Study

Science.gov (United States)

1991-10-01

1 1 Hovar Bob-up: Mai ROC (fi/mm) 1400 60 00 6 00 36 00 80 00 27 00 2 Acca * Hovar to 60 kt«: Tima (aac) 10.51...5SA SPECIFIC FILE (Cont’d) ROPMP:t UVRUVRM ja? PSIWFM ItOPM RC.FLO F7 .P -20.0,20.0,2.0 RQFBI ?•« FUSELAGE ROLLING RORENT VI PSIWF •• {RAP

MAGMA: A Liquid Software Approach to Fault Tolerance, Computer Network Security, and Survivable Networking

Science.gov (United States)

2001-12-01

and Lieutenant Namik Kaplan , Turkish Navy. Maj Tiefert’s thesis, “Modeling Control Channel Dynamics of SAAM using NS Network Simulation”, helped lay...DEC99] Deconinck , Dr. ir. Geert, Fault Tolerant Systems, ESAT / Division ACCA , Katholieke Universiteit Leuven, October 1999. [FRE00] Freed...Systems”, Addison-Wesley, 1989. [KAP99] Kaplan , Namik, “Prototyping of an Active and Lightweight Router,” March 1999 [KAT99] Kati, Effraim

Secure DBMS Auditor

Science.gov (United States)

1990-07-01

a be (AUIT ALL) kzldal accas audited , ( AUDIT CHANGES) any changes but no read access andoad, ( AUDIT NONE) or not auditig. Securit au&i monitors the...prcessinglofea queery, (4)n ituio deteapctintecnologyurmay beic an ritultiora ftureseach andlitl (5) the audit system should be examined, in detail, c...10 4 Guidance on Auditing ......................................... 13 4.1 Guidance from the TCSEC Audit Guide . ..................... 13 4.2 The

East Europe Report

Science.gov (United States)

1987-02-02

85 Briefs Defense Ministry PZPR Meeting 86 Defense Ministry PZPR Audit Session 86 POLITICS GERMAN DEMOCRATIC REPUBLIC Peace Conference...indi- SotherTchesf accA T.T^ZX^^^ ^ . Position of sTl^scaleentrepreneur or self-employed person and the status workplace. One of the Hungarian...function of payment transactions is excessive in the Public Auditing Service [SDK]. We know that commercial banks carry out the entirity of payment

Annual Industrial Capabilities Report to Congress

Science.gov (United States)

2009-03-01

Demonstration (UCAS-D), Blackswift, Advanced Composite Cargo Aircraft ( ACCA ), Falcon, Speed Agile, and Vulture—are facing funding constraints that are...tasked the Defense Contract Audit Agency to provide annual IRAD spending reports. The TCG continues to work to gain insight into IRAD expenditures...following short-term TENTNET projects have either been funded or are being pursued: • University of Tennessee – Supply Chain Audit • University of

System Dynamics and Management Science Approaches Toward Increasing Acquisition Process Efficiency

Science.gov (United States)

2015-06-26

1-85908-475-5, The Association of Chartered Certified Accountants ( ACCA ), London, UK, February 2012 Wood 2012 Roy Wood: Schedule-Driven Costs in...especially in the context of so-called public private partnership (PPP). Improper contracts may cause significant delay and additional costs in...improvement of the project contracting process may have a significant contribution to reduce project delays, additional costs and improve outcome of

Design and Analysis of Reconfigurable Analog System

Science.gov (United States)

2011-02-01

34010010" �" �" �" �" �" �" �±" N3 N2 N± P1 P2 P3 * Current sources $RR = 1; *Ramp Rate (slope of the...2008/12/12/31e83bac-500f-4182- acca -4d360295fd9c.pdf, Analog Devices, Analog Dialogue 39-06, June 2005. [15] D. A. Johns, K. Martin "Analog Integrated

Alban Berg's Wozzeck : Revisiting a Historically Sedimented Metaphor

African Journals Online (AJOL)

South African Music Studies ... The binary opposition between music text and reader can be transformed into a dialogue when the text is allowed to "speak back". ... Thus within the social context of the opera, the systematic erosion of the circle during the work can be interpreted as symbolizes the systematic disintegration of ...

Ulmekaravan liigub / Veiko Belials

Index Scriptorium Estoniae

Belials, Veiko, 1966-

2001-01-01

Arvustus: Hargla, Indrek. Pan Grpowski üheksa juhtumit. Tallinn : Kuldsulg, 2001 ; Berg, Lew R. Tempel selvas. Tallinn : Salasõna, 2001 ; Veskimees, Siim. Operatsioon "Ogaline Päike. Tallinn : Fantaasia, 2001

Proceedings of NEUROTOX󈨜, Molecular Basis of Drug & Pesticide Action (3rd) Held in Bath, England on 10-15 April 1988: Abstracts

Science.gov (United States)

1988-04-15

cxy e n/ and i nve s iati r. t-’-e cs si~ mechanisms cf :.’.e cx~nac;:4on. RP 60- 2P~ 3- 40 5 /*I on fn A min in mh andr menrmm ma 1.1Lceda,K., Kaplan ,V...Biophys. Acca . 1988, (submitted for publica- tion). 5. Coronado.R. and Latore.R. Biophys. 1. 1983, 43 231-236. 144 POTASSIUM CHANNELS IN CULTURED

Transactions of the Conference of Army Mathematicians (26th) Held at Hanover, New Hampshire on 10 - 12 June 1980.

Science.gov (United States)

1981-01-01

swee r the Mlor-Le ’a ie tayl e to li thin thle acca - rae. i tti h n IIrfleI-ieCaL I dit a . Iceo inl t ii hreJries o. however, the iorteot the( pA1...bifurcations, which surprised us, the perturbed problem has solutions which may be approximated by the scheme proposed in fFM ]. In a way, the asser- tion

Damage Control Technology - A Literature Review

Science.gov (United States)

2006-03-01

The Canadian Navy has identified the reduction of the total operating cost ( TOC ) of new ships as a priority. The major contributors to the TOC of a...Corporation, California, USA AC-CAS Group Co. Ltd., Bangkok, Thailand Apollo Fire Detectors, Hempshire, England, UK Compania Panamena de Sistemas ...National Defence DRDC Defence Research and Development Canada TOC Total Operating Cost BDCS Battle Damage Control System DC-ARM Damage Control

Biological Effects of Laser Radiation. Volume I. Review of the Literature on Biological Effects of Laser Radiation-to 1965.

Science.gov (United States)

1978-10-17

ailsur-der stu-dy. Y’c~zcro-p c e:zuto s- zsne nodules -whi ch Iw r su- sbl : irracdiated revealed sho. -cyes c -,t-,i~lrg nut o-. -- "at ae thzan vale...Ham, W.T., Jr., ec al., Amer. J. Ophchal. 43, 711, 1957. 7. Ham, W.T., Jr., et al., Amer. J. Ophchal. 46, 700, 1958. 8. Ham, W.T., Jr., ec al., Acca

Mobility Performance of Towed and Self-Propelled Artillery and Related Vehicles

Science.gov (United States)

1977-01-01

K A means not applicable. (Sheet 5 of 6) (Set5 f6 Table oi (Concluded) Vehicle Characteristics Dimes- NO. Identification sions MIO9AI M107 MI1OE2...A/I *4W 0.,.ArAO.,fl 0 a,..,ntOC..=C a 04fl0040C.AA/ a anaaoaco,, aCCA % 00000 4................4..... 4--------.4 0r,..0o.atCa 4 NNCCSC0N .nrc.. 0

United States Air Force Statistical Digest, Fiscal Year 1968. Twenty Third Edition

Science.gov (United States)

1968-09-30

FY1968 f6 .Cl."!!!WfflR - m ... 919 5,765 1,039 68 5,758 13 7 508 6 450 SOllrCe: Data Applications ,Division, Dat$.,services Center, Canptroller of the...1.ceroatce S,..e... lIl.ella BJ.eet.-uc e..... . . . u.-t 1JIlc.e t alii Ope~ato~ hallllq Da1ou. • • • • •• ~ • ... ~cnft Acca ."I:J ceUDCe

Calculations of Shipboard Heat Exchangers,

Science.gov (United States)

1980-04-18

40 C. Absolute, either real, pxessuze: Pa F6 ( where P6 - atmospheric, or tarcmetric, pressure, am Hg; p - overpressure (reading mancmeter), ikm Hal. A...21,oA 44 wxv BOX. CT. I *OyllTKU. .2lObin 0.0703 Acca (32) ()I *ynl’/XB. ite0Ms 0.068o 4(?ii. anm I *0yHlt/Ku. itoil. 51 .712 .1A PT. CT. DOC

Pilot of the Modern Army Record-Keeping System (MARKS) at 5th Battalion, 73rd Armored Regiment, 194th Armored Brigade, Fort Knox, Kentucky

Science.gov (United States)

1984-08-01

patents, inventions, taxation , land litigation 7-. . . - - - - - - - - - - -- - - - - - - - - - - - .. . - . - - . . . . . .. - --- ----- Series 4...Jl~ 00 ;0 w 40 ow 03 -4 Ai’ Q3 r.. 41I acca -4 1.4 0.4 0 40 W A 1. 4 a C ’ 0 o-4 >4 u 0.-4 0d 0,U c c4E 0 ~ 0 .~ 4.4 C r-J * . 4 pq 4a *i LI 4) 4 4-44

Justice Department Enforcement of the Neutrality Statutes in the South Florida Area.

Science.gov (United States)

1984-04-16

At that time we will send copies to interested parties and make copies available to others upon request. William J. Anderson Director Accae -ss-ion F...that investigative matters against these activities have been declined for prosecution. As requested by your office, our audit work focused on...practices of U.S. attorneys’ offices. Our work was conducted in accordance with generally accepted government auditing standards. We performed our

An Evaluation of NEPTUNE - A Program for Estimating Life-Cycle Cost of Oily Waste/Waste Oil Collection, Transportation and Treatment Systems.

Science.gov (United States)

1981-04-01

are listed in Appendix B. There was a significant problem with the formal auditing of the NEPTUNE predictions since a complete manual checking effort...WRSE R. Z. ien BROKLY ! ACcA BSTON SATH CROTON SAT VALJLJO OUZ~A 5.3. NW AD AX A’s AMS AOFT AG! AZ AOSS AD "’s A AS& ASI AT! A’S AVM cc C"~ Cv DC OD963

Statement Testimony of Mr. Alan R. Shaffer, Principal Deputy, Defense Research and Engineering Before the United States House of Representatives Committee on Armed Services, Subcommittee on Terrorism, Unconventional Threats and Capabilities

Science.gov (United States)

2009-05-20

Advanced Composite Cargo Aircraft ( ACCA ) platform to assess and validate the structural behavior and cost impact of using large out-of-autoclave...capabilities to fight the current and future wars 3. Improving our acquisition capabilities and accountability . The Department of Defense S&T budget...In fact, the S&T program fared well in comparison to many other discretionary accounts . For instance, the RDT&E budget categories of Advanced

en bref

International Development Research Centre (IDRC) Digital Library (Canada)

réseaux qu'il finance et ses partenaires, travaille à ce que les leçons tirées et les résultats obtenus soient diffusés dans toute l'Afrique et ... ACCA finance aussi diverses initiatives de partage du savoir dans le cadre du réseau ... stratégie de recherche-action participative, de renforcement des capacités et de partage du ...

Le transfert de la direction des activités vers des institutions ...

International Development Research Centre (IDRC) Digital Library (Canada)

la recherche-action participative (RAP);. • l'éducation et la formation;. • les communications et le ... financé des ateliers de formation en anglais et en français sur les méthodes de RAP, l'évaluation des risques ... En 2010, le programme ACCA a financé une deuxième phase de l'ACCFP qui sera dirigée par l'Institut d' ...

Place à l'adaptAction | IDRC - International Development Research ...

International Development Research Centre (IDRC) Digital Library (Canada)

22 févr. 2011 ... Ces brefs profils de projets donnent un aperçu des types de défis auxquels les Africains font face dans le cadre de l'adaptation aux changements climatiques et des stratégies qu'ils mettent à l'essai dans le cadre des travaux de recherche appuyés par le programme ACCA.Les profils sont fondés sur des ...

Ooperi valem : Mari Vihmandi "Armastuse valem" / Evi Arujärv

Index Scriptorium Estoniae

Arujärv, Evi, 1953-

2009-01-01

Argentiina kirjaniku Esther Vilari romaani "Nina Glucksteini matemaatika" ainetel valminud Mari Vihmandi ooperist "Armastuse valem", libreto Maimu Berg, lavastaja Liis Kolle, tantsu- ja liikumisseaded Ana Mondini. Esietendus 17. oktoobril 2008 Rahvusooperis Estonia

Armastus kui vale(m) : Mari Vihmandi ooperi "Armastuse valem" lavastusest Estonias / Ester Võsu ja Kristel Pappel

Index Scriptorium Estoniae

Võsu, Ester, 1975-

2009-01-01

Argentiina kirjaniku Esther Vilari romaani "Nina Glucksteini matemaatika" ainetel valminud Mari Vihmandi ooperist "Armastuse valem", libreto Maimu Berg, lavastaja Liis Kolle, tantsu- ja liikumisseaded Ana Mondini. Esietendus 17. oktoobril 2008 Rahvusooperis Estonia

Swarm-based Sequencing Recommendations in E-learning

NARCIS (Netherlands)

Van den Berg, Bert; Tattersall, Colin; Janssen, José; Brouns, Francis; Kurvers, Hub; Koper, Rob

2005-01-01

Van den Berg, B., Tattersall, C., Janssen, J., Brouns, F., Kurvers, H., & Koper, R. (2006). Swarm-based Sequencing Recommendations in E-learning. International Journal of Computer Science & Applications, III(III), 1-11.

activit secondaire* du programme acca la cdp 12, cdp/rdp 2

International Development Research Centre (IDRC) Digital Library (Canada)

freelance

5.3. But et objectifs spécifiques de la stratégie de Partage des Risques ... EEEAO : Echange d'Energie Electrique en Afrique de l'Ouest. FAO: Food and Agriculture ...... 95 000 pour son noyau central) sur les deux rives du Delta du fleuve.

Effec blood cts of ja d gluco abotic ose an caba (M d chol Myrciar ...

African Journals Online (AJOL)

SAM

spartate amino poprotein; HPL xygen radical a .... are related to the reduction of cholesterol and bile acids .... chromatography (HPLC) (Agilent 1100), with manual injection (three injections ..... Berg), a Brazilian grape-like fruit, improves plasma.

Growth responses, excreta quality, nutrient digestibility, bone ...

African Journals Online (AJOL)

jannes

2013-07-31

Jul 31, 2013 ... The LTS test was performed according to the method of Berg &. Sanotra .... atomic emission spectrometry (ICP-AES) to determine the concentrations of calcium, phosphorus, magnesium ..... Validation of a three point gait.

Mütsiga lüües : kuidas väärikalt vananeda? / Imbi Jeletsky

Index Scriptorium Estoniae

Jeletsky, Imbi

2007-01-01

Vt. ka Kesknädal 21. nov., lk. 12. ETV saates "Vabariigi kodanikud" arutleti vananemise teemal. Stuudios olid kirjanik Maimu Berg, rahvastikuteadlane Kalev Katus ja kunstnik Heinz Valk, saatejuht oli Aarne Rannamäe

Effects of hippotherapy on recovery of gait and balance ability in patients with stroke.

Science.gov (United States)

Lee, Chae-Woo; Kim, Seong Gil; Yong, Min Sik

2014-02-01

[Purpose] The aim of this study was to examine the the effects of hippotherapy on gait and balance ability in patients with stroke. [Subjects and Methods] Thirty stroke patients were randomly divided into a hippotherapy group and a treadmill group and they conducted exercise for eight weeks. [Results] Berg Balance Scale score, gait velocity, and step length asymmetry ratio were significantly improved in the group receiving hippotherapy training. However, in the group receiving treadmill training, only step length asymmetry ratio was significantly improved. In the comparison between the hippotherapy group and treadmill group, there was no significant difference in Berg Balance Scale score, but a significant difference was found in gait velocity and step length asymmetry ratio. [Conclusion] The results of this study indicated that hippotherapy is a helpful treatment for stroke patients.

Composição química dos frutos de Campomanesia xanthocarpa Berg-Myrtaceae Chemical composition of Campomanesia xanthocarpa Berg -Myrtaceae Fruit

Directory of Open Access Journals (Sweden)

Maria Isabel Vallilo

2008-12-01

Full Text Available Frutos in natura de C. xanthocarpa (Myrtaceae, coletados em diferentes estádios de amadurecimento na Floresta Estadual de Assis, município de Assis - SP, foram avaliados por meio de métodos tradicionais de análise, técnicas cromatográficas e de espectrometria de massas e de emissão ótica quanto à composição nutricional, ao perfil químico do óleo volátil e ao teor de elementos inorgânicos. Os resultados mostraram alto teor de água (81,4%; lipídios (1,9%; carboidratos totais (8,9%; fibra alimentar (6,3%; além de quantidades razoáveis de ácido ascórbico (17,8 mg.100 g-1; e traços de riboflavina (0,09 mg.100 g-1. No óleo volátil (0,2%, pôde-se identificar 62 componentes, correspondendo a 100% dos constituintes do óleo, destacando-se dentre eles os monoterpenos α-pineno (15%, o-cimeno (10,8%, β-pineno (10,5%. Entre os minerais (16, os principais elementos foram o K (2084 mg.kg-1, P (149 mg.kg-1, Mg (135 mg.kg-1 e, como microelementos, o Fe (6,4 mg.kg-1, Cu (93,3 mg.100 g-1 e Pb (1,3 mg.kg-1. O valor energético do fruto (57,3 kcal.100 g-1 deve-se quase que exclusivamente aos teores de carboidratos totais (8,9%.Fresh fruit samples of Campomanesia xanthocarpa (Myrtaceae harvested at different maturity stages in Assis State Forest, Assis - SP were analyzed by traditional methods such as chromatographic techniques, mass spectrometry, and optical emission spectrometry in order to evaluate the nutritional composition, the volatile oil chemical profile, and the level of inorganic elements. The results indicated high content of water (81.4%, lipids (1.9%, total carbohydrates (8.9%, dietary fibers (6.3%, and reasonable amounts of ascorbic acids (17.8 mg.100 g-1, and traces of riboflavin (0.09 mg.100 g-1. 62 compounds were identified in the volatile oil (0.2% corresponding to 100% of the oil constituents presenting monoterpene hydrocarbons, α-pinene (15%, o-cymene (10.8%, and β-pinene (10.5% as major compounds. Among the minerals (16, the main elements were quantified as K (2084 mg.kg-1, P (149 mg.kg-1, and Mg (135 mg.kg-1; the microelements were quantified as Fe (6.4 mg.kg-1, Cu (93.3 mg.kg-1, and additionally, Pb (1.3 mg.kg-1 as the contaminant. The caloric value of the fruit (57.3 kcal.100 g-1 is almost exclusively due to the total carbohydrates (8.9% contents.

National Dam Safety Program. Junior Lake Dam, (MO 11526) Missouri - Kansas City Basin, Callaway County, Missouri. Phase I Inspection Report.

Science.gov (United States)

1980-10-01

Lake, Dam Inspection, Private Dams 20 AWTACT (Ce ffm ew - m*1et N naeey ad identfy by block number) This report was prepared under the National Program...cO r " 7 - IM-.r Il: r’ o .rrr4 QM zc PLT DL1 ~OC.4..NW to~.. c pz acca ~ ~ ~ 0 AaO cr~c 0000000000 ca~cc 0 NOCC~C ~ j...a ~ in =o ,0 0 00 O 0~ co

Low-Speed Wind Tunnel Test on Joined Wing and Monoplane Configurations. Volume 1. Analysis of Results.

Science.gov (United States)

1982-02-01

monoplane, with no sign that tis a max-mum. Trirned CLax comparisons are i’:en in g. 2O. 70 o.g- 0.2- 0.0- -o.2- G8WHD v+ 7s- PL’Ns 36 f7 L I I I I I I L... ACca equal to approximately 70% of that given by the vertical tail of configuration BUHDV. This is much more than would be expected from the relative

An Experimental Investigation of Computer Program Development Approaches and Computer Programming Metrics.

Science.gov (United States)

1979-12-01

8217 S A Air Force Office of Scientific Research/NM , Dccec f7 / Bolling AFB, Washington, DC 20332 N’" - E -E . 150 __" 74 MOJ’jT tRING AGENC NAME A...55t -3 O 2 a. tL loco o.uaZ 4 1 0 0 - .. a .CO acca 4 * ao -- c- - .an za-e~a- 2.5 aa34z98ba a- CHAPTER VII coipletely differentiated outcome is

Microcomputer-Assisted Flow-Through ASV System.

Science.gov (United States)

1979-09-01

FXVAL AND LPTNO,LXVAL *RETURN I-TRUE 0-FALSE IN ACCA *T VALUE ON LINE IS LEFT IN Y 0390 FE 0033 D AELINE LDX FPTNO /GET Ti 0393 09 DIX 1ST Y VALUE 0394...64D6 9 DEX 04D7 26 F3 04D4 SNE CLSA1 04D9 39 RTS *SAVE THE INTEGRATION RESULTS IN PROPER BUFFER ***** ** *** k******* 04DA 36 6633 D SAYRES LDAA ELN

Modeling and Simulation of Avionics Systems and Command, Control and Communications Systems

Science.gov (United States)

1980-01-01

CONDITIONS: ALL BEGIN IN THINK STATE _ ~(2) - F6 w 4(3) NTm35 E(RT)98.246 4 (1 -4-0NT a25 E’(RT) 3.415 L0 1OO 200 300 400 500 600 700 800 900 NUMBER OF...vibrations ou acca - llretions, Li En offet. is vol tactique tel qua le pratique l’Armle de Terra Frangalse, consiste A4 valer au plus prls du sal (hauteur

Proceedings of the Technical Forum (3rd) on the F-16 MIL-STD-1750A Microprocessor and the F-16 MIL-STD-1589B Compiler Held at Wright-Patterson AFB, OH on May 5-6, 1982. Volume 1. Papers,

Science.gov (United States)

1982-05-06

BUS MKS Fucioa Diagram ~ALAOAR *RSAU TT E E 0E U D*iQ MKSXQ16 Microinstruction Word 1 ~ ~5 .6 a7 . 6 1 1,I 1,. 151li "" SP*D ACCA CONTROL JASNTJ EX...result CALLSF 4F FA Call with ID in register GETSID 4F F9 Get re-time ID of function Data Forwarding FWD 4F F6 Forward integer DFWD 4F F5 Forward

Regional Employment Growth and Defense Spending.

Science.gov (United States)

1987-12-01

important part of regional growth. UI ACCA 9o1n For ’NDis i - Dljt s i-: . TABLE OF CONTENTS I. INTRODUCTION .. .. .. .... ..... .... .... .... ..... .. 7...Mideast and Great Lakes, all show spending to taxation ratios of less than one on a per capita basis, yet the Southwest and Rocky Mountain states have...because businesses look beyond the obvious nominal rate and locate according to effective rates of taxation , ie. actual tax liability. In addition, tax

JPRS Report Science & Technology China.

Science.gov (United States)

1989-04-18

revenue preferences for new products will be changed from a uniform exemption from taxation to either tax reduction or exemption. There will be...planning" and coordinating work of departments of S&T, finance, banking, and taxation to arrange for the input and matching of funds. This is the way...0081] of the Department of Virology, Xi’an Medical University] [Text] An ACCA -ELISA (IgA complex capture assay) method was established to detect

Analysis of Central Design Agency Alternatives for Navy Industrial Fund Accounting Systems: A Proposed Methodology.

Science.gov (United States)

1980-03-01

Postgraduate School ANA01611I NM61"fa Monterey, California 93940 1 CON TROLLING OFFICE NAMC &NO Accaes ii uOmvo*a Naval Postgraduate School March 1980...judge alternative 3, it is further recomended that the Naval Audit Service, private contractor or other independent agent be comissioned to perform an in...Government Accounting, Government Accounting, Auditing , and Financial Reporting, Chicago, Municipal Finance Officer’s Association, 1968, p. 3-4. 4

Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

Science.gov (United States)

1985-02-01

governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

Sensorimotor Interactions in the Haptic Perception of Virtual Objects

Science.gov (United States)

1997-01-01

the human user. 2 Compared to our understanding of vision and audition , our knowledge of the human haptic perception is very limited. Many basic...modalities such as vision and audition on haptic perception of viscosity or mass, for example. 116 Some preliminary work has already been done in this...string[3]; *posx="x" *forf="f’ *velv="v" * acca ="a" trial[64]; resp[64]; /* random number */ /* trial number */ /* index */ /* array holding stim

The Expert Infantryman Squad and Platoon Evaluation (EISPE) I Concept: Evaluations and Observations

Science.gov (United States)

1977-12-01

specific perforanc•a test imetditelv following the roa’ &.:-rch requires the Infantryman to show he r n still function AccA .-’a\\;ifter the stress of...weighed against thn cost of devoting an hour or two of valuable testing time to this activity. Similarly, it is debatable whether tre coordinated...the objective effective? (9) Was withdrawal free the objective rapid and organized? (10) Was everyone accounted for at the oojective raily point? (11

A Proposed RTN Officer Performance Evaluation System

Science.gov (United States)

1989-12-01

Taa& No. WokI Unlit Acca ~def 11¶. TITLE (biclde Securiy ClassifiCation) A PROPOSED ROYAL THAI NAVY OFIICER PERFORM NCE EVALUATION SYSTEM 12. PERSONAL...all aspects of performance into account , the commanding officer uses his opinion to decide who is "the best." There are no standard guidelines for...ftequently used in orgunsadozn as a bais for adminiardstive decisions such as employee promotion., tuufer, and allocation of financial reward; employee

The future of financial reporting 2013 : still grappling with major problems.

OpenAIRE

Jones, M.; Slack, R.E.

2013-01-01

A discussion paper based on the British Accounting Association Financial Accounting and Reporting Special Interest Group (FARSIG) Colloquium, 11 January 2013. ACCA was pleased to host again the FARSIG annual discussion of the future of financial reporting. The meeting continues to provide a valuable discussion between interested parties – principally academics studying financial reporting and those involved with its practical application in way or another. The line of speakers this year re...

Using satellite-based rainfall data to support the implementation of ...

African Journals Online (AJOL)

2009-10-30

Oct 30, 2009 ... of environmental water requirements in South Africa ... The methods currently available in South Africa to implement environmental flows are based on ..... B and TENTE T (2009) Decision support system for the Berg River.

Short Communication Report

African Journals Online (AJOL)

Dr Ahmed

Berg, 1997) and the disappearance of the species (American Bird. Conservation, 2008). ... where new ecological niches are created such as the wetlands and species richness is ... of field guide (Borrow & Demey, 2004). The duration of ...

USA suursaadik : hirmud on alistanud lootuse / Toomas Sildam

Index Scriptorium Estoniae

Sildam, Toomas, 1961-

2004-01-01

Eestist lahkuv USA suursaadik Joseph de Thomas andis USA iseseisvuspäeva kõnes hinnangu Eesti toetusele Iraagis ja USA Iraagi-poliitikale. Parlamendiliige Eiki Berg USA suursaadiku kõnest. Vt. ka: Suursaadiku sõnum lk. 10

(Smith) (Decapoda: Parastacidae)

African Journals Online (AJOL)

feeding. R.A. van den Berg,* H.J. Schoonbee and. H.H. du Preez. Research Unit for Aquatic and Terrestrial Ecosystems,. Department of .... crustacean larvae, big protozoa, unicellular algae and clusters of bacteria on ... Habits, functional.

A Holistic, Person-Centred Care Model for Victims of Sexual Violence in Democratic Republic of Congo: The Panzi Hospital One-Stop Centre Model of Care.

Science.gov (United States)

Mukwege, Denis; Berg, Marie

2016-10-01

Denis Mukwege and Marie Berg describe the One Stop Centre at Panzi Hospital in Eastern Democratic Republic of Congo that provides care for girls and women who have been raped in combination with extreme bodily harm.

Võrrand teadmata arvu tundmatutega / Anu Sõõro

Index Scriptorium Estoniae

Sõõro, Anu

2009-01-01

Argentiina kirjaniku Esther Vilari romaani "Nina Glucksteini matemaatika" ainetel valminud Mari Vihmandi ooperi "Armastuse valem" etendustest 19. ja 21. novembril Rahvusooperis Estonia, libreto Maimu Berg, lavastaja Liis Kolle, tantsu- ja liikumisseaded Ana Mondini. (Esietendus 17. oktoobril 2008)

PATTERNS OF SEVEN AND COMPLICATED MALARIA IN CHILDREN

African Journals Online (AJOL)

GB

2017-12-01

Dec 1, 2017 ... of intervention balance and functional mobility were assessed using Berg ... Poor balance control in cerebral palsy could be ..... integration as they grow older (5, 20,21). ... useful method to improve gait function of patients.

Reference: 178 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 15723040 2005 Mar EMBO reports Berg Howard|Dietrich Charles|Ge Xiaochun|Li Guojing|Matsuno Michiyo|Xia Yiji ...psis aspartic protease functions as an anti-cell-death component in reproduction and embryogenesis. 3 282-8

Relations between postural stability, gait and falls in elderly persons--preliminary report.

Science.gov (United States)

Baczkowicz, Dawid; Szczegielniak, Jan; Proszkowiec, Małgorzata

2008-01-01

Balance control in elderly patients is the area of interest of many researchers. The results of their studies suggest that the measurement of shifts in the centre of foot pressure on the support base (COP) can be used as a tool for identification of fall-prone persons. It is interesting whether there are any relations between functional status, gait, posture stability and the risk of falling. The aim of this study was to find the answer to this question. The study involved 20 patients (mean age 78.1+/-11.6). The functional status of the patients was evaluated according to the Barthel Index. Postural stability was assessed with the use of a Neurocom Balance Master platform. Three measurements were taken with visual feedback (eyes open-EO) and three without visual feedback (eyes closed-EC). Balance control was also evaluated with the Berg test and on the basis of the history of episodes of falling in the preceding six months. Gait was evaluated with the six-minute walking test. The parameters recorded by the force platform showed a significant relation to the values obtained in the Berg test (r=-0.60; pfalls showed a significant relation only to the EO test (r=0.4; pfalls was connected with increased body sway. 3. The functional status of the patient and the balance control evaluation according to the Berg test failed to determine the risk of falling. 4. A relation was observed between postural stability, functional status and gait.

Abnormal sensory integration affects balance control in hemiparetic patients within the first year after stroke

Directory of Open Access Journals (Sweden)

Clarissa B. Oliveira

2011-01-01

Full Text Available OBJECTIVE: Impairments in balance can be a consequence of changes in the motor, sensory, and integrative aspects of motor control. Abnormal sensory reweighting, i.e., the ability to select the most appropriate sensory information to achieve postural stability, may contribute to balance impairment. The Sensory Organization Test is a component of Computerized Dynamic Posturography that evaluates the impact of visual, vestibular, and somatosensory inputs, as well as sensory reweighting, under conditions of sensory conflict. The aim of this study is to compare balance control in hemiparetic patients during the first year post-stroke and in age-matched neurologically normal subjects using the Berg Balance Scale and Computerized Dynamic Posturography. METHODS: We compared the Berg Balance Scale and Sensory Organization Test scores in 21 patients with hemiparesis after first-ever ischemic stroke and in 21 age-matched, neurologically normal subjects. An equilibrium score was defined for each Sensory Organization Test condition. RESULTS: Berg Balance Scale scores were significantly lower in the patients than in the neurologically normal subjects. Equilibrium scores were significantly lower in the patients than in the neurologically normal subjects for those Sensory Organization Test conditions that did not provide appropriate somatosensory information and under conditions of sensory conflict. A history of falls was more frequent in patients with lower equilibrium scores. CONCLUSION: During the first year after a stroke, defective sensory reweighting significantly impacts balance control in hemiparetic patients. These results are important for the planning of effective rehabilitation interventions.

A validation of the new definition of drug-resistant epilepsy by the International League Against Epilepsy.

Science.gov (United States)

Téllez-Zenteno, Jose F; Hernández-Ronquillo, Lizbeth; Buckley, Samantha; Zahagun, Ricardo; Rizvi, Syed

2014-06-01

To establish applicability, the recently proposed International League Against Epilepsy (ILAE) consensus on drug-resistant epilepsy (DRE) requires testing in clinical and research settings. This study evaluates the reliability and validity of these criteria in a clinical population. In phase I, two independent evaluators reviewed 97 randomly selected medical records of patients with epilepsy at two separate intervals. Both ILEA consensus and standard diagnostic criteria were employed. Kappa, weighted kappa, and intraclass correlation coefficient (ICC) were used to determine interobserver and intraobserver variability. In phase II, ILAE consensus criteria were applied to 250 patients with epilepsy to determine risk factors associated with development of DRE and to calculate point prevalence. The interobserver agreement of the four definitions was as follows: Berg (0.56), Kwan and Brodie (0.58), Camfield and Camfield (0.69), and ILAE (0.77). The intraobserver agreement of the four definition was as follows: Berg (0.81), Kwan and Brodie (0.82), Camfield and Camfield (0.72), and ILAE (0.82). The prevalence of DRE was the following: with the Berg's definition was 28.4%, Kwan and Brodie 34%, Camfield and Camfield 37%, and with ILAE was 33%. This is first study to establish reliability and validity of ILAE criteria for the diagnosis of DRE. This new definition compares favorably with previously established constructs, which continue to retain clinical significance. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

Design Review Improvement Recommendations

Science.gov (United States)

2015-06-18

Worcester, Boeing Anne Ramsey, Harris Corporation Ronald H. Mandel, Lockheed Martin Mark King, Micropac Industries Melanie Berg, NASA Cindy...Peters, Raytheon Donna Potter , SSL ii Executive Summary The aerospace industry continues to experience design escapes that significantly impact

Biblical quotations in Faustus's Capitula | van den Berg | HTS ...

African Journals Online (AJOL)

Therefore, the work provides important insight into the Manichaeans' use and appreciation of Scripture. Faustus was well-known to the young Augustine and as a consequence the Capitula could well give us important insights into Augustine's knowledge of and opinions on Scripture as a Manichaean hearer. One problem ...

Preliminary investigation of seasonality in the Great Berg Estuary

CSIR Research Space (South Africa)

Slinger, JH

1994-10-01

Full Text Available in summer, while salinities in excess of 5 x 10(-3) occur 37 km from the mouth. The role of river flow in counterbalancing the upstream dispersion of salt during the summer season is highlighted. The relevance of these findings in the preliminary...

Exploitation Agricole des Berges : Une Strategie D'Adaptation aux ...

African Journals Online (AJOL)

et socio-économique. ... dynamique des paysages agraires et son impact sur le capital naturel surtout sur les .... favoriser leur germination et amorcer leur croissance. ..... similaires ont été relevées au Bénin où l'impact humain se traduit par le ...

The BERG faculty students readiness for information technologies study

Directory of Open Access Journals (Sweden)

Horovèák Pavel

2002-12-01

Full Text Available The contribution deals with the reconnaissance of our students’ readiness to study information technologies, its interpretation, comparison with some published data as well as with a completion and evaluation of the reconnaissance. It specifies methods and processes of evaluation, structure, sections and questions of the reconnaissance. The reconnaissance was oriented particularly to the evaluation of knowledge in the information technologies area acquired at secondary schools. It was completed in a classical paper form as a preparation for the realization and utilization of questionnaire in the electronic form. The following is constructed using modern internet and database technologies and presents extensive possibilities of evaluation answers respondents. The results of the reconnaissance are presented in the form distribution (sex, domicile, secondary school, secondary school influence, work with a computer, operating and exploitation of internet technologies, familiarity with operating systems and typical applications software and programming languages as well as the interest in information technologies of respondents. The results are compared with some other published data and future perspectives of completion and its evaluation of completion are outlined.

Technical Papers Presented at the Defense Nuclear Agency Global Effects Review. Held at Moffett Field, California on 25-27 February 1986. Volume 1.

Science.gov (United States)

1986-05-15

0.4 -4 -4.4 >1 -1 1% ~~~ 404EDCE doa- -4 -4 -45 ti ahEEED U.,~ U2. 44d 0 00.) ) 41 to0 4 V AJJV a09 00 go W Ac AC ACca .04J0.0 .0WhO >J413W...SCIENCES CORP ATTN MAJ GEN HJCOATES ATTN: M KAPLAN ATTN P PROSSER TECHNOLOGY INTERNATIONAL CORP BRITISH DEFENCE STAFF ""ATTN. W BOQUIST ATTN C FENWICK

Reliability-Based Performance Assessment of Damaged Ships

Science.gov (United States)

2006-10-01

37OR.A 2 AceI 2 oce 3 3C7R Main Deck Plan View at 9.906 metre STAA T~SIc ACCa IC 111 tI RO MAO ’ 2 0004 M 3O m 3 STORES) me 3 1 002~s STOR1 PfIS PlnVIS...Vol. 15, pp.7 4 -9 3 . Kaplan , M. Benatar, M., Bentson, J., Achtarides, T.A. (1984). "Analysis and assessment of major uncertainties associated with

Final Evaluation Report on Fort Ord Project VOLAR

Science.gov (United States)

1978-04-04

I%.p 4 .; .* . . . . .. .¾ 1. ...i ....j ... -4- tlVt ’,J~f ’..~ flt~UUf~jitf F7 ____ I -U- I- F ?. ;.’ 1777 I. I t:t:.. ’*1** I’ . It: 9...GENER4AL i POST ENV!RONMET fT .4 , h ,,. f avn an 31 :-12 4 two $000 tort Cd la󈨢 1.0-01 acca -O 2 :-g::2: 5~:4: BIih, Post’s Progress ri 1npuun 32 1

Role of the Neddylation Enzyme Uba3, A New Estrogen Receptor Corepressor, in Breast Cancer

Science.gov (United States)

2005-05-01

University School of Medicine, 302 Jordan Hall, 1001 East activates SCF( f3 (TrCP))-dependent ubiquitination of Third Street, Bloomington, Indiana...is essential for SCF( f3 -TrCP)-mediated ubiquitination ety Research Grant TBE-104125 (to K.P.N.), the Walther Can- and processing of the NF-K B...Nawaz Z, Lonard DM, Dennis AP, Smith CL, O’Malley BW position 3997, within the intron); reverse primer, 5’- ACCA - 1999 Proteasome-dependent degradation of

Technical Considerations for Improvement of USAF Operational Training, Testing and Evaluation (OTT and E)

Science.gov (United States)

1975-06-30

L LJ C9 - aCCa C= co =mp XE 0 a aLa C~= =b & -JA 0’-𔃺 z - -Lai’ = WE w.. _A oMac G = cm - cc0j -0, e 125 The total instrument error is a combination...C77 C/) V-C) r:C 7:C-) 0.. C:) f3 . C-) cC./) C) F-I = LU LUJ CAC: peripheral firmware devices. Any well defined process can and should be done by a

Radiation by Sources on Perfectly Conducting Convex Cylinders with an Impedance Surface Patch.

Science.gov (United States)

1980-01-01

U -- = - (a to0 . 0 0 m 4- 0 4- 04 0-0 1 - .0 4’ U-- ~4- 4 0 n4- -- C_ to S~0- 4J C >1 cu S)-0’ (0 C 0)~ 00 =3 .r aCCA 50 It is observed from these...by such a source has only a z-component and it will be denoted by H . H satisfies the reduced, inhomo- geneous wave equation, and the f6 1llowing