Molecular evolution of the polyamine oxidase gene family in Metazoa

Directory of Open Access Journals (Sweden)

Polticelli Fabio

2012-06-01

Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

Effects of the inoculations using bacteria producing ACC deaminase on ethylene metabolism and growth of wheat grown under different soil water contents.

Science.gov (United States)

Zhang, Guozhuang; Sun, Yonglin; Sheng, Hao; Li, Haichao; Liu, Xiping

2018-04-01

Crop growth and productivity are often impacted by the increased ethylene content induced by adverse environmental conditions such drought. Inoculations with bacteria producing ACC deaminase is considered as a potential biological approach to improve the growth and tolerance of stressed plants by lowering endogenous ethylene level. In this study, germinated wheat seeds were inoculated using three species of the rhizobacteria, which were isolated from the rhizosphere of wheat growing in dryland, and sown in pots. After three weeks, wheat seedlings were exposed to non-limiting water condition, medium drought and severe drought, respectively, for six weeks. The results showed that, irrespective of rhizobacterial inoculations, decreased soil water contents stimulated wheat ethylene metabolism, which was reflected by the significantly increased activity of ACC synthetase and ACC oxidase, besides an increased content of ACC both in the roots and leaves, and an enhanced capacity of leaves to release ethylene, concomitant with a significant decline in shoot and roots biomass. The inoculations of all three rhizobacterial species under each water condition reduced ACC content in wheat leaves, but effects of the inoculations on ACC synthase and ACC oxidase activity in the leaves and roots, ACC content in the roots, the capacity of leaves to release ethylene, and wheat growth varied with water conditions and bacterial species. Hence, both soil water conditions and rhizobacterial inoculations acted on all the processes of ethylene metabolism, with the former being dominant. The inoculations under non-limiting water condition and medium drought promoted shoot and root growth of wheat plants. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

Science.gov (United States)

Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

2013-02-01

Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

Identification of a melatonin receptor type 1A gene ( AccMTNR1A) in Apis cerana cerana and its possible involvement in the response to low temperature stress

Science.gov (United States)

Li, Guilin; Zhang, Yanming; Ni, Yong; Wang, Ying; Xu, Baohua; Guo, Xingqi

2018-04-01

It is known that melatonin plays an indispensable role in the defense against some environment-induced stresses. The melatonin receptor (MTNR) is also closely linked to the environmental stress response in mammals. However, little is known about the function of the MTNR in insects, including honeybees. In this study, we identified a MTNR from Apis cerana cerana named AccMTNR1A, which contained a typical seven-transmembrane domain common to this family of receptors. A subcellular localization analysis showed that AccMTNR1A was localized in the cytomembrane. Additionally, we found that cold stress apparently boosted AccMTNR1A transcription, indicating that AccMTNR1A possibly connects to the cold stress response. The knockdown of AccMTNR1A attenuated the expression level of some genes associated with the cold stress response, suggesting that AccMTNR1A likely plays an analogous role with these genes during low temperature stress response. Moreover, silencing of AccMTNR1A also suppressed the transcription of some antioxidant genes, prompting the possibility that the response of AccMTNR1A to cold stress response may be related to antioxidant signaling pathways. Collectively, the findings presented here provide evidence that AccMTNR1A may play essential roles in protecting Apis cerana cerana from cold stress.

Characterization of a Decapentapletic Gene (AccDpp from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress.

Directory of Open Access Journals (Sweden)

Guilin Li

Full Text Available To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ signal pathway. Decapentapletic gene (Dpp belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana. In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp.

Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Markakis Marios

2012-11-01

Full Text Available Abstract Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone. Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

Science.gov (United States)

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

Science.gov (United States)

Prayuni, Kinasih; Dwivany, Fenny M.

2015-09-01

Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.

Science.gov (United States)

Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong

2016-06-01

Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

Chondrogenic potential of canine articular cartilage derived cells (cACCs

Directory of Open Access Journals (Sweden)

Nowak Urszula

2016-01-01

Full Text Available In the present paper, the potential of canine articular cartilage-derived cells (cACCs for chondrogenic differentiation was evaluated. The effectiveness of cACCs’ lineage commitment was analyzed after 14 days of culture in chondorgenic and non-chondrogenic conditions. Formation of proteoglycan-rich extracellular matrix was assessed using histochemical staining – Alcian Blue and Safranin-O, while elemental composition was determined by means of SEM-EDX. Additionally, ultrastructure of cACCs was evaluated using TEM. The expression of genes involved in chondrogenesis was monitored with quantitative Real Time PCR. Results obtained indicate that the potential of cACCs for cartilagous extracellular matrix formation may be maintained only in chondrogenic cultures. The formation of specific chondro-nodules was not observed in a non-chondrogenic culture environment. The analysis of cACCs’ ultrastructure, both in non-chondrogenic and chondrogenic cultures, revealed well-developed rough endoplasmatic reticulum and presence of mitochondria. The cACCs in chondrogenic medium shed an increased number of microvesicles. Furthermore, it was shown that the extracellular matrix of cACCs in chondrogenic cultures is rich in potassium and molybdenum. Additionally, it was determined that gene expression of collagen type II, aggrecan and SOX-9 was significantly increased during chondrogenic differentiation of cACCs. Results obtained indicate that the culture environment may significantly influence the cartilage phenotype of cACCs during long term culture.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

Science.gov (United States)

Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

2018-02-17

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

NARCIS (Netherlands)

Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

1989-01-01

We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

Science.gov (United States)

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

Science.gov (United States)

Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

2018-01-01

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

Science.gov (United States)

Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

2009-05-01

The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

Distal truncation of KCC3 in non-French Canadian HMSN/ACC families.

NARCIS (Netherlands)

Salin-Cantegrel, A.; Riviere, J.B.; Dupre, N.; Charron, F.M.; Shekarabi, M.; Karemera, L.; Gaspar, C.; Horst, J. van der; Tekin, M.; Deda, G.; Krause, A.; Lippert, M.M.; Willemsen, M.A.A.P.; Jarrar, R.; Lapointe, J.Y.; Rouleau, G.A.

2007-01-01

BACKGROUND: Hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC) is a severe and progressive autosomal recessive polyneuropathy. Mutations in the potassium-chloride cotransporter 3 gene (KCC3) were identified as responsible for HMSN/ACC in the French Canadian (FC)

An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

Energy Technology Data Exchange (ETDEWEB)

Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

1997-03-01

An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

[A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

Science.gov (United States)

Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

2013-08-04

Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

Directory of Open Access Journals (Sweden)

O.I. Grabelnych

2017-02-01

Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

[Abundances of ammonia-oxidizing archaeal accA and amoA genes in response to NO2 - and NO3 - of hot springs in Yunnan province].

Science.gov (United States)

Song, Zhaoqi; Wang, Li; Zhou, Enmin; Wang, Fengping; Xiao, Xiang; Zhang, Chuanlun; Li, Wenjun

2014-12-04

Yunnan hot springs have highly diverseammonia-oxidizing archaea (AOA), which are autotrophic and can fix CO2 using the 3-hydroxypropionate/ 4-hydroxybutyrate (HP/HD) pathway. In this study, we investigated the abundances of prokaryotic 16S rRNA gene and archaeal accA and amoA genes in the sediments of hot springs of Yunnan Province, and analysed the correlations between the above gene abundances and environmental factors. We selected the sediments of twenty representative hot springs, and detected the gene abundances by quantitative polymerase chain reaction (qPCR). The principal component analysis (PCA) and the Mantel test in the R software package were performed for the correlations of gene abundance and environmental variables. The bacterial and archaeal 16S rRNA gene abundances were from 6.6 x 10(7) to 4.19 x 10(11) and from 1.27 x 10(6) to 1.51 x 10(11) copies/g sediment, respectively; Archaeal accA and amoA genes were from 8.89 x 10(3) to 6.49 x 10(5) and from 7.64 x 10(3) to 4.36 x 10(5) copies/g sediment, respectively. The results of mantel test showed that accA gene was significantly (R = 0.98, P < 0.001) correlated with amoA gene; Both of them also were correlated significantly with NO2- and NO3 -, but not with pH. The abundances of bacterial and archaeal 16S rRNA genes and the ratio between them varied significantly among Yunnan hot springs. The archaealaccA and amoA genes showed significant correlation with each other, validating our previous finding that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

Science.gov (United States)

Tucker, Mark L; Xue, Ping; Yang, Ronghui

2010-01-01

Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

ACCES

DEFF Research Database (Denmark)

Nikitin, Artyom; Laoudias, Christos; Chatzimilioudis, Georgios

2017-01-01

In this demonstration we present ACCES, a novel framework that enables quality assessment of arbitrary fingerprint maps and offline accuracy estimation for the task of fingerprint-based indoor localization. Our framework considers collected fingerprints disregarding the physical origin of the data...... will be able to use our service directly to collect signal measurements over the venue using an Android smartphone; and (ii) Reflection Mode, where attendees will be able to observe the collected measurements and the respective ACCES accuracy estimations in the form of an overlay heatmap....

ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

Science.gov (United States)

Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

2008-05-01

The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

Genetic profiling reveals cross-contamination and misidentification of 6 adenoid cystic carcinoma cell lines: ACC2, ACC3, ACCM, ACCNS, ACCS and CAC2.

Directory of Open Access Journals (Sweden)

Janyaporn Phuchareon

Full Text Available Adenoid cystic carcinoma (ACC is the second most common malignant neoplasm of the salivary glands. Most patients survive more than 5 years after surgery and postoperative radiation therapy. The 10 year survival rate, however, drops to 40%, due to locoregional recurrences and distant metastases. Improving long-term survival in ACC requires the development of more effective systemic therapies based on a better understanding of the biologic behavior of ACC. Much preclinical research in this field involves the use of cultured cells and, to date, several ACC cell lines have been established. Authentication of these cell lines, however, has not been reported. We performed DNA fingerprint analysis on six ACC cell lines using short tandem repeat (STR examinations and found that all six cell lines had been contaminated with other cells. ACC2, ACC3, and ACCM were determined to be cervical cancer cells (HeLa cells, whereas the ACCS cell line was composed of T24 urinary bladder cancer cells. ACCNS and CAC2 cells were contaminated with cells derived from non-human mammalian species: the cells labeled ACCNS were mouse cells and the CAC2 cells were rat cells. These observations suggest that future studies using ACC cell lines should include cell line authentication to avoid the use of contaminated or non-human cells.

The terminal oxidases of Paracoccus denitrificans

NARCIS (Netherlands)

de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

A structural and functional model for the 1-aminocyclopropane-1-carboxylic acid oxidase.

Science.gov (United States)

Sallmann, Madleen; Oldenburg, Fabio; Braun, Beatrice; Réglier, Marius; Simaan, A Jalila; Limberg, Christian

2015-10-12

The hitherto most realistic low-molecular-weight analogue for the 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) is reported. The ACCOs 2-His-1-carboxylate iron(II) active site was mimicked by a TpFe moiety, to which the natural substrate ACC could be bound. The resulting complex [Tp(Me,Ph) FeACC] (1), according to X-ray diffraction analysis performed for the nickel analogue, represents an excellent structural model, featuring ACC coordinated in a bidentate fashion-as proposed for the enzymatic substrate complex-as well as a vacant coordination site that forms the basis for the first successful replication also of the ACCO function: 1 is the first known ACC complex that reacts with O2 to produce ethylene. As a FeOOH species had been suggested as intermediate in the catalytic cycle, H2 O2 was tested as the oxidant, too, and indeed evolution of ethylene proceeded even more rapidly to give 65 % yield. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

OpenAIRE

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

Tuning OpenACC loop execution

KAUST Repository

Feki, Saber

2017-01-07

The purpose of this chapter is to help OpenACC developer who is already familiar with the basic and essential directives to further improve his code performance by adding more descriptive clauses to OpenACC loop constructs. At the end of this chapter the reader will: • Have a better understanding of the purpose of the OpenACC loop construct and its associated clauses illustrated with use cases • Use the acquired knowledge in practice to further improve the performance of OpenACC accelerated codes

Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)

DEFF Research Database (Denmark)

Juul, Maja Bech; Vestergaard, Hanne; Petersen, Jesper

2012-01-01

Hb Taybe is a highly unstable hemoglobin (Hb) variant caused by a 3 bp deletion at codons 38/39 (-ACC) on the α1-globin gene. We report for the first time, a patient with a compound heterozygosity for Hb Taybe and a 5 bp deletion at the splice donor site of IVS-I on the α2-globin gene and ischemic...

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

Science.gov (United States)

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Manipulation of carbon flux into fatty acid biosynthesis pathway in Dunaliella salina using AccD and ME genes to enhance lipid content and to improve produced biodiesel quality

Directory of Open Access Journals (Sweden)

Ahmad Farhad Talebi

2014-08-01

Full Text Available Advanced generations of biofuels basically revolve around non-agricultural energy crops. Among those, microalgae owing to its unique characteristics i.e. natural tolerance to waste and saline water, sustainable biomass production and high lipid content (LC, is regarded by many as the ultimate choice for the production of various biofuels such as biodiesel. In the present study, manipulation of carbon flux into fatty acid biosynthesis pathway in Dunaliella salina was achieved using pGH plasmid harboring AccD and ME genes to enhance lipid content and to improve produced biodiesel quality. The stability of transformation was confirmed by PCR after several passages. Southern hybridization of AccD probe with genomic DNA revealed stable integration of the cassette in the specific positions in the chloroplast genome with no read through transcription by indigenous promoters. Comparison of the LC and fatty acid profile of the transformed algal cell line and the control revealed the over-expression of the ME/AccD genes in the transformants leading to 12% increase in total LC and significant improvements in biodiesel properties especially by increasing algal oil oxidation stability. The whole process successfully implemented herein for transforming algal cells by genes involved in lipid production pathway could be helpful for large scale biodiesel production from microalgae.

NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis

Science.gov (United States)

Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.

2003-01-01

Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

Science.gov (United States)

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Ethylene biosynthesis by 1-aminocyclopropane-1-carboxylic acid oxidase: a DFT study.

Science.gov (United States)

Bassan, Arianna; Borowski, Tomasz; Schofield, Christopher J; Siegbahn, Per E M

2006-11-24

The reaction catalyzed by the plant enzyme 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) was investigated by using hybrid density functional theory. ACCO belongs to the non-heme iron(II) enzyme superfamily and carries out the bicarbonate-dependent two-electron oxidation of its substrate ACC (1-aminocyclopropane-1-carboxylic acid) concomitant with the reduction of dioxygen and oxidation of a reducing agent probably ascorbate. The reaction gives ethylene, CO(2), cyanide and two water molecules. A model including the mononuclear iron complex with ACC in the first coordination sphere was used to study the details of O-O bond cleavage and cyclopropane ring opening. Calculations imply that this unusual and complex reaction is triggered by a hydrogen atom abstraction step generating a radical on the amino nitrogen of ACC. Subsequently, cyclopropane ring opening followed by O-O bond heterolysis leads to a very reactive iron(IV)-oxo intermediate, which decomposes to ethylene and cyanoformate with very low energy barriers. The reaction is assisted by bicarbonate located in the second coordination sphere of the metal.

Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

2012-01-01

PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

A colorimetric assay of 1-aminocyclopropane-1-carboxylate (ACC) based on ninhydrin reaction for rapid screening of bacteria containing ACC deaminase.

Science.gov (United States)

Li, Z; Chang, S; Lin, L; Li, Y; An, Q

2011-08-01

1-Aminocyclopropane-1-carboxylate (ACC) deaminase activity is an efficient marker for bacteria to promote plant growth by lowering ethylene levels in plants. We aim to develop a method for rapidly screening bacteria containing ACC deaminase, based on a colorimetric ninhydrin assay of ACC. A reliable colorimetric ninhydrin assay was developed to quantify ACC using heat-resistant polypropylene chimney-top 96-well PCR plates, having the wells evenly heated in boiling water, preventing accidental contamination from boiling water and limiting evaporation. With this method to measure bacterial consumption of ACC, 44 ACC-utilizing bacterial isolates were rapidly screened out from 311 bacterial isolates that were able to grow on minimal media containing ACC as the sole nitrogen source. The 44 ACC-utilizing bacterial isolates showed ACC deaminase activities and belonged to the genus Burkholderia, Pseudomonas or Herbaspirillum. Determination of bacterial ACC consumption by the PCR-plate ninhydrin-ACC assay is a rapid and efficient method for screening bacteria containing ACC deaminase from a large number of bacterial isolates. The PCR-plate ninhydrin-ACC assay extends the utility of the ninhydrin reaction and enables a rapid screening of bacteria containing ACC deaminase from large numbers of bacterial isolates. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

Science.gov (United States)

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Advanced Cruise Control (ACC).

NARCIS (Netherlands)

2010-01-01

Advanced Cruise Control (ACC), ook bekend als Adaptive, Active of Intelligent Cruise Control, handhaaft niet alleen de door de bestuurder ingestelde rijsnelheid, maar stemt ook de snelheid van het voertuig af op die van de voorligger. ACC helpt op deze manier om een vooraf bepaalde volgtijd tot de

Advanced Cruise Control (ACC).

NARCIS (Netherlands)

2008-01-01

Advanced Cruise Control (ACC), also known as adaptive or intelligent cruise control, not only maintains the driver-set vehicle speed, but also adjusts the vehicle's speed to that of a preceding vehicle, and helps to maintain a pre-selected headway time to the vehicle ahead. ACC systems can have a

Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

Science.gov (United States)

Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

1999-10-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

Czech Academy of Sciences Publication Activity Database

Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef

2012-01-01

Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

Heterologous co-expression of accA, fabD, and thioesterase genes for improving long-chain fatty acid production in Pseudomonas aeruginosa and Escherichia coli.

Science.gov (United States)

Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon

2012-05-01

The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.

NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

Directory of Open Access Journals (Sweden)

Jagna Chmielowska-Bąk

2017-06-01

Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

Science.gov (United States)

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Tuning OpenACC loop execution

KAUST Repository

Feki, Saber; Smaoui, Malek

2017-01-01

The purpose of this chapter is to help OpenACC developer who is already familiar with the basic and essential directives to further improve his code performance by adding more descriptive clauses to OpenACC loop constructs. At the end

Obesity Drives Th17 Cell Differentiation by Inducing the Lipid Metabolic Kinase, ACC1.

Science.gov (United States)

Endo, Yusuke; Asou, Hikari K; Matsugae, Nao; Hirahara, Kiyoshi; Shinoda, Kenta; Tumes, Damon J; Tokuyama, Hirotake; Yokote, Koutaro; Nakayama, Toshinori

2015-08-11

Chronic inflammation due to obesity contributes to the development of metabolic diseases, autoimmune diseases, and cancer. Reciprocal interactions between metabolic systems and immune cells have pivotal roles in the pathogenesis of obesity-associated diseases, although the mechanisms regulating obesity-associated inflammatory diseases are still unclear. In the present study, we performed transcriptional profiling of memory phenotype CD4 T cells in high-fat-fed mice and identified acetyl-CoA carboxylase 1 (ACC1, the gene product of Acaca) as an essential regulator of Th17 cell differentiation in vitro and of the pathogenicity of Th17 cells in vivo. ACC1 modulates the DNA binding of RORγt to target genes in differentiating Th17 cells. In addition, we found a strong correlation between IL-17A-producing CD45RO(+)CD4 T cells and the expression of ACACA in obese subjects. Thus, ACC1 confers the appropriate function of RORγt through fatty acid synthesis and regulates the obesity-related pathology of Th17 cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

Science.gov (United States)

Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

1999-01-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

Application of randomly amplified polymorphic DNA (RAPD ...

African Journals Online (AJOL)

Jane

2011-10-10

Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...

Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

Science.gov (United States)

Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

2011-04-01

Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Isolated sulfite oxidase deficiency.

Science.gov (United States)

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

Directory of Open Access Journals (Sweden)

Hamed Esmaeil Lashgarian

2016-10-01

Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

Lattice QCD simulations using the OpenACC platform

International Nuclear Information System (INIS)

Majumdar, Pushan

2016-01-01

In this article we will explore the OpenACC platform for programming Graphics Processing Units (GPUs). The OpenACC platform offers a directive based programming model for GPUs which avoids the detailed data flow control and memory management necessary in a CUDA programming environment. In the OpenACC model, programs can be written in high level languages with OpenMP like directives. We present some examples of QCD simulation codes using OpenACC and discuss their performance on the Fermi and Kepler GPUs. (paper)

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

Energy Technology Data Exchange (ETDEWEB)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

A role for NADPH oxidase in antigen presentation

Directory of Open Access Journals (Sweden)

Gail J Gardiner

2013-09-01

Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

Science.gov (United States)

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

Science.gov (United States)

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Science.gov (United States)

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis.

Science.gov (United States)

Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao

2018-04-01

We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

Science.gov (United States)

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

Science.gov (United States)

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

Science.gov (United States)

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

Science.gov (United States)

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

Science.gov (United States)

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

Science.gov (United States)

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

CAPS OpenACC Compilers: Performance and Portability

CERN Multimedia

CERN. Geneva

2013-01-01

The announcement late 2011 of the new OpenACC directive-based programming standard supported by CAPS, CRAY and PGI compilers has open up the door to more scientific applications that can be ported on many-core systems. Following a porting methodology, this talk will first review the principles of programming with OpenACC and then the advanced features available in the CAPS compilers to further optimize OpenACC applications: library integration, tuning directives with auto-tune mechanisms to build applications adaptive to different GPUs. CAPS compilers use hardware vendors' backends such as NVIDIA CUDA and OpenCL making them the only OpenACC compilers supporting various many-core architectures. About the speaker Stéphane Bihan is co-funder and currently Director of Sales and Marketing at CAPS enterprise. He has held several R&D positions in companies such as ARC international plc in London, Canon Research Center France, ACE compiler experts in Amsterdam and the INRIA r...

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

use

2011-12-07

Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Genetics Home Reference: isolated sulfite oxidase deficiency

Science.gov (United States)

... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

Directory of Open Access Journals (Sweden)

Yan Zhao

Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

Science.gov (United States)

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Complete plastid genome sequence of Primula sinensis (Primulaceae: structure comparison, sequence variation and evidence for accD transfer to nucleus

Directory of Open Access Journals (Sweden)

Tong-Jian Liu

2016-06-01

Full Text Available Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp were separated by a large single-copy region (82,064 bp and a small single-copy region (17,725 bp. The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

OpenAIRE

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-01-01

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

Reward salience and risk aversion underlie differential ACC activity in substance dependence.

Science.gov (United States)

Alexander, William H; Fukunaga, Rena; Finn, Peter; Brown, Joshua W

2015-01-01

The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed.

Predictive Performance Tuning of OpenACC Accelerated Applications

KAUST Repository

Siddiqui, Shahzeb; Feki, Saber

2014-01-01

, with the introduction of high level programming models such as OpenACC [1] and OpenMP 4.0 [2], these devices are becoming more accessible and practical to use by a larger scientific community. However, performance optimization of OpenACC accelerated applications usually

Genotype-specific enrichment of ACC deaminase-positive bacteria in winter wheat rhizospheres

Science.gov (United States)

Bacteria that produce ACC deaminase promote plant growth and development by lowering levels of the stress hormone ethylene through deamination of 1-aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Therefore, it is hypothesized that ACC deaminase positive (ACC+) bacteri...

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

Science.gov (United States)

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

Science.gov (United States)

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli.

Science.gov (United States)

Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito

2009-01-01

Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Asian Care Certificate (ACC): a care quality assurance framework.

Science.gov (United States)

Talaie, Tony

2018-04-16

Purpose Quality assuring elderly care through a viable and feasible standard framework is a major challenge for Asian governments. Although several attempts have been made to tackle foreign care worker (FCW) shortage, assuring the quality of the care they provide has been overlooked. The original framework allowed a better control over service quality to assure the elderly about their care according to the agreed standards. The paper aims to discuss these issues. Design/methodology/approach Through several Japanese Governmental meetings, a new Asian Care Certificate (ACC) program is discussed based on the Japanese Care Certificate (JCC). The governments' representatives adopted the JCC to form the ACC, which enables the ACC board to evaluate care workers and to intervene whenever the desired quality level is not achieved. Findings The author describes a new program. The findings of this paper will be confirmed when the ACC is implemented. Practical implications Using the ACC framework, the challenge in providing a high-quality care service using FCWs across Asia would be partly resolved. FCWs' quality of life might also gradually improve especially regarding to their human rights. Originality/value The ACC provides a new framework. Its value is recognized if one considers that many Asian populations are rapidly aging and many governments compromise quality by employing overseas workers to solve care worker shortages.

Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition.

Science.gov (United States)

Kolla, Nathan J; Chiuccariello, Lina; Wilson, Alan A; Houle, Sylvain; Links, Paul; Bagby, R Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V; Pasricha, Suvercha; Meyer, Jeffrey H

2016-01-15

Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. [(11)C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = -.44, p = .023). These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition

Science.gov (United States)

Kolla, Nathan J.; Chiuccariello, Lina; Wilson, Alan A.; Houle, Sylvain; Links, Paul; Bagby, R. Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V.; Pasricha, Suvercha; Meyer, Jeffrey H.

2016-01-01

BACKGROUND Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. METHODS [11C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. RESULTS Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = −.44, p = .023). CONCLUSIONS These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. PMID:25698585

Analisis de correlación canonica (ACC e investigacion cientifica.

Directory of Open Access Journals (Sweden)

Badii, M.H.

2007-07-01

Full Text Available The concept of Analysis of Canonical Correlation (ACC is given. The basic conditions, initial questions, and main objectives are provided. The fundamentals of ACC design and the adjustments are touched upon. Field application of ACC is highlighted. The intricacies involving the profiling, validation, and redundant variables of the method are discussed. Finally, the statistical significance and theoretical interpretation of the model are explained.

Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type

NARCIS (Netherlands)

Costa, A.F.; Altemani, A.; Vékony, H.; Bloemena, E.; Fresno, F.; Suárez, C.; Llorente, J.L.; Hermsen, M.

2011-01-01

Background: ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

Science.gov (United States)

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Discovery and optimization of antibacterial AccC inhibitors

Energy Technology Data Exchange (ETDEWEB)

Cheng, Cliff C.; Shipps, Jr., Gerald W.; Yang, Zhiwei; Sun, Binyuan; Kawahata, Noriyuki; Soucy, Kyle A.; Soriano, Aileen; Orth, Peter; Xiao, Li; Mann, Paul; Black, Todd; (SPRI)

2010-09-17

The biotin carboxylase (AccC) is part of the multi-component bacterial acetyl coenzyme-A carboxylase (ACCase) and is essential for pathogen survival. We describe herein the affinity optimization of an initial hit to give 2-(2-chlorobenzylamino)-1-(cyclohexylmethyl)-1H-benzo[d]imidazole-5-carboxamide (1), which was identified using our proprietary Automated Ligand Identification System (ALIS). The X-ray co-crystal structure of 1 was solved and revealed several key interactions and opportunities for further optimization in the ATP site of AccC. Structure Based Drug Design (SBDD) and parallel synthetic approaches resulted in a novel series of AccC inhibitors, exemplified by (R)-2-(2-chlorobenzylamino)-1-(2,3-dihydro-1H-inden-1-yl)-1H-imidazo[4,5-b]pyridine-5-carboxamide (40). This compound is a potent and selective inhibitor of bacterial AccC with an IC{sub 50} of 20 nM and a MIC of 0.8 {micro}g/mL against a sensitized strain of Escherichia coli (HS294 E. coli).

Predictive Performance Tuning of OpenACC Accelerated Applications

KAUST Repository

Siddiqui, Shahzeb

2014-05-04

Graphics Processing Units (GPUs) are gradually becoming mainstream in supercomputing as their capabilities to significantly accelerate a large spectrum of scientific applications have been clearly identified and proven. Moreover, with the introduction of high level programming models such as OpenACC [1] and OpenMP 4.0 [2], these devices are becoming more accessible and practical to use by a larger scientific community. However, performance optimization of OpenACC accelerated applications usually requires an in-depth knowledge of the hardware and software specifications. We suggest a prediction-based performance tuning mechanism [3] to quickly tune OpenACC parameters for a given application to dynamically adapt to the execution environment on a given system. This approach is applied to a finite difference kernel to tune the OpenACC gang and vector clauses for mapping the compute kernels into the underlying accelerator architecture. Our experiments show a significant performance improvement against the default compiler parameters and a faster tuning by an order of magnitude compared to the brute force search tuning.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

Directory of Open Access Journals (Sweden)

Dinesh Kumar

2015-10-01

Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

Science.gov (United States)

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Portable LQCD Monte Carlo code using OpenACC

Science.gov (United States)

Bonati, Claudio; Calore, Enrico; Coscetti, Simone; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Fabio Schifano, Sebastiano; Silvi, Giorgio; Tripiccione, Raffaele

2018-03-01

Varying from multi-core CPU processors to many-core GPUs, the present scenario of HPC architectures is extremely heterogeneous. In this context, code portability is increasingly important for easy maintainability of applications; this is relevant in scientific computing where code changes are numerous and frequent. In this talk we present the design and optimization of a state-of-the-art production level LQCD Monte Carlo application, using the OpenACC directives model. OpenACC aims to abstract parallel programming to a descriptive level, where programmers do not need to specify the mapping of the code on the target machine. We describe the OpenACC implementation and show that the same code is able to target different architectures, including state-of-the-art CPUs and GPUs.

Effects of small interfering RNA targeting thymidylate synthase on survival of ACC3 cells from salivary adenoid cystic carcinoma

International Nuclear Information System (INIS)

Shirasaki, Takashi; Maruya, Shin-ichiro; Mizukami, Hiroki; Kakehata, Seiji; Kurotaki, Hidekachi; Yagihashi, Soroku; Shinkawa, Hideichi

2008-01-01

Thymidylate synthase (TS) is an important target for chemotherapeutic treatment of cancer and high expression of TS has been associated with poor prognosis or refractory disease in several cancers including colorectal and head and neck cancer. Although TS is known to regulate cell cycles and transcription factors, its potency as a therapeutic target has not been fully explored in adenoid cystic carcinoma (ACC). An ACC cell line (ACC3) was transfected with siRNA targeting the TS gene and inhibition of cell growth and induction of apoptosis-associated molecules were evaluated in vitro. In addition, the in vivo effect of TS siRNA on tumor progression was assessed using a xenograft model. Our results demonstrated that ACC3 cells showed significantly higher TS expression than non-cancer cell lines and the induction of TS siRNA led to inhibition of cell proliferation. The effect was associated with an increase in p53, p21, and active caspase-3 and S-phase accumulation. We also found up-regulation of spermidine/spermine N1-acetyltransferase (SSAT), a polyamine metabolic enzyme. Furthermore, treatment with TS siRNA delivered by atelocollagen showed a significant cytostatic effect through the induction of apoptosis in a xenograft model. TS may be an important therapeutic target and siRNA targeting TS may be of potential therapeutic value in ACC

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

NARCIS (Netherlands)

Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.

2007-01-01

A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

Science.gov (United States)

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase.

Science.gov (United States)

Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T

2005-04-15

In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type

NARCIS (Netherlands)

Costa, A.F.; Altemani, A.; Vékony, H.; Bloemena, E.; Fresno, F.; Suárez, C.; Llorente, J.L.; Hermsen, M.

2010-01-01

Background: ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACCHGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGTis generally considered to be an aggressive variant of ACC, even more

Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

Science.gov (United States)

Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

2015-10-01

A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

The glossyhead1 allele of acc1 reveals a principal role for multidomain acetyl-coenzyme a carboxylase in the biosynthesis of cuticular waxes by Arabidopsis

KAUST Repository

Lu, Shiyou

2011-09-23

A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C 20:0 or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling. © 2011 American Society of Plant Biologists. All Rights Reserved.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

Science.gov (United States)

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Polyamines and ethylene interact in rice grains in response to soil drying during grain filling.

Science.gov (United States)

Chen, Tingting; Xu, Yunji; Wang, Jingchao; Wang, Zhiqin; Yang, Jianchang; Zhang, Jianhua

2013-05-01

This study tested the hypothesis that the interaction between polyamines and ethylene may mediate the effects of soil drying on grain filling of rice (Oryza sativa L.). Two rice cultivars were pot grown. Three treatments, well-watered, moderate soil drying (MD), and severe soil drying (SD), were imposed from 8 d post-anthesis until maturity. The endosperm cell division rate, grain-filling rate, and grain weight of earlier flowering superior spikelets showed no significant differences among the three treatments. However, those of the later flowering inferior spikelets were significantly increased under MD and significantly reduced under SD when compared with those which were well watered. The two cultivars showed the same tendencies. MD increased the contents of free spermidine (Spd) and free spermine (Spm), the activities of S-adenosyl-L-methionine decarboxylase and Spd synthase, and expression levels of polyamine synthesis genes, and decreased the ethylene evolution rate, the contents of 1-aminocylopropane-1-carboxylic acid (ACC) and hydrogen peroxide, the activities of ACC synthase, ACC oxidase, and polyamine oxidase, and the expression levels of ethylene synthesis genes in inferior spikelets. SD exhibited the opposite effects. Application of Spd, Spm, or an inhibitor of ethylene synthesis to rice panicles significantly reduced ethylene and ACC levels, but significantly increased Spd and Spm contents, grain-filling rate, and grain weight of inferior spikelets. The results were reversed when ACC or an inhibitor of Spd and Spm synthesis was applied. The results suggest that a potential metabolic interaction between polyamines and ethylene biosynthesis responds to soil drying and mediates the grain filling of inferior spikelets in rice.

Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

Science.gov (United States)

Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun

2017-11-01

Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Advanced cruise control (ACC) : gewenste beleidsmaatregelen bij de invoering van ACC. In opdracht van het Directoraat-Generaal Rijkswaterstaat, Adviesdienst Verkeer en Vervoer AVV.

NARCIS (Netherlands)

Oei, H.-l.

1999-01-01

Advanced Cruise Control (ACC) concerns an `ordinary' cruise control in which the desired speed is fixed manually, but also in which the headway to the vehicle in front is taken into account. Such an ACC system is meant for use on rural roads that are not too busy. The system is not meant to avoid a

Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

Science.gov (United States)

Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

2018-05-01

Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

Directory of Open Access Journals (Sweden)

Xiuchun Ge

Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Efthimios A. Andronis

2014-04-01

Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

Isolation and characterization of novel bacteria containing acc deaminase from the rhizosphere resource on dry-farming lands

International Nuclear Information System (INIS)

Zheng, P.; Tian, L.; Chen, F.; Cui, Z.

2014-01-01

Soil-microbe-plant interactions are known to be intricate and they can greatly influence the crop vigor and yield. Plant growth promoting rhizobacteria (PGPR) containing ACC deaminase can markedly affect plant metabolic processes under stress conditions. In the present study, we isolated 300 bacterial strains from the rhizosphere of maize or apple grown in drought-hit soil including four different locations of the Loess Plateau, China. Of all isolated strains, four with ACC deaminase activity (ranging from 28.88 to 155.12 nmol alpha-ketobutyrate mg-1 h-1) were further studied by determining their biological characters and sequencing the 16S rRNA gene. All four strains showed positive performance in terms of arabinose, citrate utilization, urease, indol, glucose and melibiose. In connection with the results of biochemical characters and phylogenetic analysis, these strains commonly belong to three different genera: Klebsiella, Pseudomonas and Raoultella and four different species: Klebsiella oxytoca, Klebsiella variicola, Pseudomonas fluorescens and Raoultella planticola. Although some researchers have reported their performance under stress conditions, we are the first to report Klebsiella oxytoca, Klebsiella variicola and Raoultella planticola containing ACC deaminase under drought stress. These findings are a reasonable explanation to their superb ability of causing stress-resistance in maize (Zea mays) or apple (Malus domestica) plants. The presence of diverse PGPR possessing potential ACC deaminase activity may be beneficial for enhancing crop production under different stress conditions. (author)

Advanced Cruise Control ACC in the Netherlands: a critical review.

NARCIS (Netherlands)

Hoetink, A.E.

2017-01-01

The aim of this literature study is to identify the needs and the demands of the stakeholders in the Netherlands with respect to ACC and to assess its safety impact. To assess the safety impact of ACC, three aspects should be considered: functional system safety, human machine interaction, and

Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

Science.gov (United States)

Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

2015-05-01

Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

Science.gov (United States)

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

Directory of Open Access Journals (Sweden)

Li Sheng-Bin

2011-10-01

Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

Directory of Open Access Journals (Sweden)

Yuange Wang

2014-08-01

Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

Directory of Open Access Journals (Sweden)

Buades-Rotger M

2014-07-01

Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts.

Science.gov (United States)

de Las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine; Mahabadi, Amir Abbas; Koenig, Wolfgang

2016-01-01

The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. We studied 5,238 participants from the KORA surveys S3 (1994-1995) and S4 (1999-2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000-2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany.

Driver's behavioral adaptation to adaptive cruise control (ACC): the case of speed and time headway.

Science.gov (United States)

Bianchi Piccinini, Giulio Francesco; Rodrigues, Carlos Manuel; Leitão, Miguel; Simões, Anabela

2014-06-01

The Adaptive Cruise Control is an Advanced Driver Assistance System (ADAS) that allows maintaining given headway and speed, according to settings pre-defined by the users. Despite the potential benefits associated to the utilization of ACC, previous studies warned against negative behavioral adaptations that might occur while driving with the system activated. Unfortunately, up to now, there are no unanimous results about the effects induced by the usage of ACC on speed and time headway to the vehicle in front. Also, few studies were performed including actual users of ACC among the subjects. This research aimed to investigate the effect of the experience gained with ACC on speed and time headway for a group of users of the system. In addition, it explored the impact of ACC usage on speed and time headway for ACC users and regular drivers. A matched sample driving simulator study was planned as a two-way (2×2) repeated measures mixed design, with the experience with ACC as between-subjects factor and the driving condition (with ACC and manually) as within-subjects factor. The results show that the usage of ACC brought a small but not significant reduction of speed and, especially, the maintenance of safer time headways, being the latter result greater for ACC users, probably as a consequence of their experience in using the system. The usage of ACC did not cause any negative behavioral adaptations to the system regarding speed and time headway. Based on this research work, the Adaptive Cruise Control showed the potential to improve road safety for what concerns the speed and the time headway maintained by the drivers. The speed of the surrounding traffic and the minimum time headway settable through the ACC seem to have an important effect on the road safety improvement achievable with the system. Copyright © 2014 Elsevier Ltd. All rights reserved.

Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

NARCIS (Netherlands)

Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

Science.gov (United States)

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Effects of feeding transgenic corn with mCry1Ac or maroACC gene to laying hens for 12 weeks on growth, egg quality and organ health.

Science.gov (United States)

Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F

2016-08-01

The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Accès à l'information et protection des renseignements personnels ...

International Development Research Centre (IDRC) Digital Library (Canada)

Le Centre de recherches pour le développement international (CRDI) appuie ... morale présente au Canada le droit d'accéder aux documents qui relèvent du CRDI, ... à la disposition du public, indiquant ainsi l'importance de l'accès informel.

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

Directory of Open Access Journals (Sweden)

Yuanman Tang

2017-11-01

Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

African Journals Online (AJOL)

Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

Inducing salt tolerance in maize through ACC-deaminase biotechnology (abstract)

International Nuclear Information System (INIS)

Shahroona, B.; Arshad, M.; Zahir, Z.A.

2005-01-01

Ethylene is one of the five established classes of phytohormones. Its involvement in evoking physiological responses in plants exposed to any kind of environmental stresses (such as salinity, drought and metal toxicity stresses) is well established, thus it has also been designated as 'stress' hormone. It is generally believed that stress induces accelerated synthesis of ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC), which subsequently results in the out burst of ethylene production and plant responds to this higher level of ethylene. Thus any check on this accelerated ethylene production in plants exposed to salinity stress could help in minimizing the negative impact of this stress and plants might survive better. There are some soil bacteria which carry ACC-deaminase enzyme and their presence on root surface results in lowering the accelerated production of ethylene. Trials were conducted under axenic condition to study the effect of inoculation with ACC-deaminase containing rhizobacteria to ameliorate the effect of salinity on seedling growth. Maize seedlings were exposed to different salinity levels and results indicated that inoculation with ACC-deaminase containing rhizobacteria significantly increased root elongation, shoot length, fresh and dry weight of seedlings at all the salinity levels. (author)

Biotin augments acetyl CoA carboxylase 2 gene expression in the hypothalamus, leading to the suppression of food intake in mice.

Science.gov (United States)

Sone, Hideyuki; Kamiyama, Shin; Higuchi, Mutsumi; Fujino, Kaho; Kubo, Shizuka; Miyazawa, Masami; Shirato, Saya; Hiroi, Yuka; Shiozawa, Kota

2016-07-29

It is known that biotin prevents the development of diabetes by increasing the functions of pancreatic beta-cells and improving insulin sensitivity in the periphery. However, its anti-obesity effects such as anorectic effects remain to be clarified. Acetyl CoA carboxylase (ACC), a biotin-dependent enzyme, has two isoforms (ACC1 and ACC2) and serves to catalyze the reaction of acetyl CoA to malonyl CoA. In the hypothalamus, ACC2 increases the production of malonyl CoA, which acts as a satiety signal. In this study, we investigated whether biotin increases the gene expression of ACC2 in the hypothalamus and suppresses food intake in mice administered excessive biotin. Food intake was significantly decreased by biotin, but plasma regulators of appetite, including glucose, ghrelin, and leptin, were not affected. On the other hand, biotin notably accumulated in the hypothalamus and enhanced ACC2 gene expression there, but it did not change the gene expression of ACC1, malonyl CoA decarboxylase (a malonyl CoA-degrading enzyme), and AMP-activated protein kinase α-2 (an ACC-inhibitory enzyme). These findings strongly suggest that biotin potentiates the suppression of appetite by upregulating ACC2 gene expression in the hypothalamus. This effect of biotin may contribute to the prevention of diabetes by biotin treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

Directory of Open Access Journals (Sweden)

Rogayah Sekeli

2014-06-01

Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

Science.gov (United States)

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

ACC International Academic Collaborative receives special award

OpenAIRE

Felker, Susan B.

2006-01-01

The Atlantic Coast Conference's new International Academic Collaborative (ACC/IAC) has been singled out by the New York-based Institute of International Education (IIE) for a special award for innovation in international education.

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

Science.gov (United States)

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

Energy Technology Data Exchange (ETDEWEB)

Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)

2010-07-30

Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

Science.gov (United States)

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Réseaux d'accès communautaire : faire accéder à Internet un ...

International Development Research Centre (IDRC) Digital Library (Canada)

En dépit des récents progrès en diffusion de la technologie mobile, plus de quatre milliards de personnes n'ont pas de connexion Internet et ont un accès limité à l'infrastructure mondiale des télécommunications. Le coût de mettre en œuvre une infrastructure de connectivité dans les régions mal desservies demeure un ...

Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

Directory of Open Access Journals (Sweden)

Deepak Verma

2017-10-01

Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

Science.gov (United States)

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

DEFF Research Database (Denmark)

Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid

2009-01-01

-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

Science.gov (United States)

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

Czech Academy of Sciences Publication Activity Database

Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.

2014-01-01

Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

Science.gov (United States)

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

Czech Academy of Sciences Publication Activity Database

Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.

2004-01-01

Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

Science.gov (United States)

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

Science.gov (United States)

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

ACCTuner: OpenACC Auto-Tuner For Accelerated Scientific Applications

KAUST Repository

Alzayer, Fatemah

2015-05-17

We optimize parameters in OpenACC clauses for a stencil evaluation kernel executed on Graphical Processing Units (GPUs) using a variety of machine learning and optimization search algorithms, individually and in hybrid combinations, and compare execution time performance to the best possible obtained from brute force search. Several auto-tuning techniques – historic learning, random walk, simulated annealing, Nelder-Mead, and genetic algorithms – are evaluated over a large two-dimensional parameter space not satisfactorily addressed to date by OpenACC compilers, consisting of gang size and vector length. A hybrid of historic learning and Nelder-Mead delivers the best balance of high performance and low tuning effort. GPUs are employed over an increasing range of applications due to the performance available from their large number of cores, as well as their energy efficiency. However, writing code that takes advantage of their massive fine-grained parallelism requires deep knowledge of the hardware, and is generally a complex task involving program transformation and the selection of many parameters. To improve programmer productivity, the directive-based programming model OpenACC was announced as an industry standard in 2011. Various compilers have been developed to support this model, the most notable being those by Cray, CAPS, and PGI. While the architecture and number of cores have evolved rapidly, the compilers have failed to keep up at configuring the parallel program to run most e ciently on the hardware. Following successful approaches to obtain high performance in kernels for cache-based processors using auto-tuning, we approach this compiler-hardware gap in GPUs by employing auto-tuning for the key parameters “gang” and “vector” in OpenACC clauses. We demonstrate results for a stencil evaluation kernel typical of seismic imaging over a variety of realistically sized three-dimensional grid configurations, with different truncation error orders

Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

Directory of Open Access Journals (Sweden)

Alessandro R. Ferrari

2018-01-01

Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

Le Service Accueil et Contrôle d'Accès

CERN Document Server

Ducastel, C

1999-01-01

L'utilisateur qui vient au CERN pour la première fois, est accueilli généralement par les membres du service 'Accueil et Contrôle d'Accès'. Cet utilisateur sera tout d'abord orienté vers un des postes d'hôtesses d'accueil en charge de l'enregistrement et de la délivrance de cartes CERN. Les informations seront saisies et immédiatement disponibles et transmises, via le système AMS, aux équipements de contrôle d'accès et à la Centrale de Surveillance des accès, chargée de la supervision de tout le dispositif de contrôle d'accès au domaine. Ces contrôles aux entrées et accueil des visiteurs individuels sont complétés par des missions de surveillance à l'intérieur du Domaine pour les agents, et par des travaux de gestions de dossiers administratifs (service enregistrement) pour les hôtesses. Un contrat commun assure une uniformité de formation des agents et hôtesses. Ce contrat est assorti d'une clause de Bonus Malus afin de tendre vers une optimisation des performances.

Towards personalised automated driving: Prediction of preferred ACC behaviour based on manual driving

NARCIS (Netherlands)

Gelder, E. de; Cara, I.; Uittenbogaard, J.; Kroon, L.; Iersel, S. van; Hogema, J.

2016-01-01

More and more Advanced Driver Assistance Systems (ADASs) are entering the market for improving both safety and comfort. Adaptive Cruise Control (ACC) is an ADAS application that has high interaction with the driver. ACC systems use limited sensor input and have only few configuration possibilities.

gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower

International Nuclear Information System (INIS)

Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.

1997-01-01

gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested

Glucose oxidase variants with improved properities

OpenAIRE

Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje

2014-01-01

Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

Driver behavior analysis during ACC activation and deactivation in a real traffic environment

NARCIS (Netherlands)

Pauwelussen, J.; Feenstra, P.J.

2010-01-01

For the development of a traffic-simulation model to estimate the effect of adaptive cruise control (ACC) systems on traffic safety, throughput, and environment, data of a field operational test (FOT) were analyzed, in which vehicles were equipped with ACC and lane-departure warning (LDW) systems.

Molecular Cloning and Characterization of Two Genes for the Biotin Carboxylase and Carboxyltransferase Subunits of Acetyl Coenzyme A Carboxylase in Myxococcus xanthus

OpenAIRE

Kimura, Yoshio; Miyake, Rina; Tokumasu, Yushi; Sato, Masayuki

2000-01-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar t...

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Science.gov (United States)

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

A New Characterization of ACC0 and Probabilistic CC0

DEFF Research Database (Denmark)

Hansen, Kristoffer Arnsfelt; Koucký, Michal

2010-01-01

Barrington, Straubing & Thérien (1990) conjectured that the Boolean And function can not be computed by polynomial size constant depth circuits built from modular counting gates, i.e., by CC0 circuits. In this work we show that the And function can be computed by uniform probabilistic CC0 circuits...... that use only O(log n) random bits. This may be viewed as evidence contrary to the conjecture. As a consequence of our construction we get that all of ACC0 can be computed by probabilistic CC0 circuits that use only O(log n) random bits. Thus, if one were able to derandomize such circuits, one would obtain...... a collapse of circuit classes giving ACC0 = CC0. We present a derandomization of probabilistic CC0 circuits using And and Or gates to obtain ACC0 = And ο Or ο CC0 = Or ο And ο CC0. (And and Or gates of sublinear fan-in suffice in non-uniform setting.) Both these results hold for uniform as well as non...

Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase

OpenAIRE

Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata

2017-01-01

Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

Airborne Cloud Computing Environment (ACCE)

Science.gov (United States)

Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

2011-01-01

Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

Interactions of early adversity with stress-related gene polymorphisms impact regional brain structure in females.

Science.gov (United States)

Gupta, Arpana; Labus, Jennifer; Kilpatrick, Lisa A; Bonyadi, Mariam; Ashe-McNalley, Cody; Heendeniya, Nuwanthi; Bradesi, Sylvie; Chang, Lin; Mayer, Emeran A

2016-04-01

Early adverse life events (EALs) have been associated with regional thinning of the subgenual cingulate cortex (sgACC), a brain region implicated in the development of disorders of mood and affect, and often comorbid functional pain disorders, such as irritable bowel syndrome (IBS). Regional neuroinflammation related to chronic stress system activation has been suggested as a possible mechanism underlying these neuroplastic changes. However, the interaction of genetic and environmental factors in these changes is poorly understood. The current study aimed to evaluate the interactions of EALs and candidate gene polymorphisms in influencing thickness of the sgACC. 210 female subjects (137 healthy controls; 73 IBS) were genotyped for stress and inflammation-related gene polymorphisms. Genetic variation with EALs, and diagnosis on sgACC thickness was examined, while controlling for race, age, and total brain volume. Compared to HCs, IBS had significantly reduced sgACC thickness (p = 0.03). Regardless of disease group (IBS vs. HC), thinning of the left sgACC was associated with a significant gene-gene environment interaction between the IL-1β genotype, the NR3C1 haplotype, and a history of EALs (p = 0.05). Reduced sgACC thickness in women with the minor IL-1β allele, was associated with EAL total scores regardless of NR3C1 haplotype status (p = 0.02). In subjects homozygous for the major IL-1β allele, reduced sgACC with increasing levels of EALs was seen only with the less common NR3C1 haplotype (p = 0.02). These findings support an interaction between polymorphisms related to stress and inflammation and early adverse life events in modulating a key region of the emotion arousal circuit.

Accès au savoir en Afrique australe : le libre accès à la recherche à l ...

International Development Research Centre (IDRC) Digital Library (Canada)

Access to Knowledge Southern Africa (A2KSA) a pour but de mieux comprendre les différentes contraintes entourant l'accès des universités d'Afrique australe au savoir à des fins de recherche et d'enseignement. Le projet, une collaboration de recherche entre la Southern African Regional Universities Association ...

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

Science.gov (United States)

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

Science.gov (United States)

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Les grands accélérateurs de particules

Science.gov (United States)

Patoux, A.; Perot, J.

1991-02-01

The different types of accelerators are recalled with emphasis on the most powerful : the synchrotron particle colliders. The use of superconductors in accelerator magnets as well as in RF cavities is discussed. The characteristics of the large accelerators, existing and planned, are given together with the level of industry involvement in their construction. Details concerning superconducting magnets and cryogenic plants are investigated. Finally, detectors, the most important tool for physics, are mentionned. Après avoir rappelé les différents types d'accélérateurs utilisés, l'accent est mis sur les plus puissants, c'est-à-dire les synchrotrons fonctionnant en anneaux de collision. Le rôle des supraconducteurs est analysé aussi bien pour les aimants que pour les cavités accélératrices. Les caractéristiques des principaux accélérateurs existants ou en projet sont données ainsi que l'implication de l'industrie dans leur fabrication. On insiste plus particulièrement sur les aimants supraconducteurs et les installations cryogéniques. Enfin les détecteurs, éléments indispensables à la physique, sont également évoqués.

Norrie disease gene is distinct from the monoamine oxidase genes

OpenAIRE

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

Science.gov (United States)

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Accès au savoir en Afrique australe : le libre accès à la recherche à l ...

International Development Research Centre (IDRC) Digital Library (Canada)

Access to Knowledge Southern Africa (A2KSA) a pour but de mieux comprendre les différentes contraintes entourant l'accès des universités d'Afrique australe au savoir à des fins de recherche et ... A new website and resource library will help improve developing country registration and information systems for vital events.

Citrate effects on amorphous calcium carbonate (ACC) structure, stability, and crystallization

DEFF Research Database (Denmark)

Tobler, Dominique Jeanette; Rodriguez Blanco, Juan Diego; Dideriksen, Knud

2015-01-01

Understanding the role of citrate in the crystallization kinetics of amorphous calcium carbonate (ACC) is essential to explain the formation mechanisms, stabilities, surface properties, and morphologies of CaCO3 biominerals. It also contributes to deeper insight into fluid-mineral inte......Understanding the role of citrate in the crystallization kinetics of amorphous calcium carbonate (ACC) is essential to explain the formation mechanisms, stabilities, surface properties, and morphologies of CaCO3 biominerals. It also contributes to deeper insight into fluid...

Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI

Directory of Open Access Journals (Sweden)

Jana Zweerings

2018-05-01

Full Text Available Background: Post-traumatic stress disorder (PTSD is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC, contributing to aberrant limbic responses in PTSD.Methods: Real-time fMRI neurofeedback (rt-fMRI NF assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days.Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients.Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

Science.gov (United States)

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Constant Width Planar Computation Characterizes ACC0

DEFF Research Database (Denmark)

Hansen, Kristoffer Arnsfelt

2006-01-01

We obtain a characterization of ACC0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

Technologies omniprésentes et accès au savoir (A2K) | CRDI ...

International Development Research Centre (IDRC) Digital Library (Canada)

... à la commercialisation de masse ont eu une influence majeure sur l'accès au savoir (A2K). ... Le mouvement pour l'accès au savoir cherche à promouvoir de nouvelles ... [President] for and on behalf of Centre For Internet And Society.

Accès à l'eau

International Development Research Centre (IDRC) Digital Library (Canada)

Grâce à la modélisation par ordinateur faisant appel à des techniques de pointe et à la consultation des collectivités, l'organisme bolivien Agua Sustentable a trouvé des solu- tions politiques à des conflits qui auraient pu s'avérer désastreux au sujet de l'accès à l'eau. Cet organisme de recherche subventionné par le CRDI ...

[Isolation, identification and characterization of ACC deaminase-containing endophytic bacteria from halophyte Suaeda salsa].

Science.gov (United States)

Teng, Songshan; Liu, Yanping; Zhao, Lei

2010-11-01

We Isolated and characterized 1-aminocyclopropane-1-carboxylate (ACC) deaminase-containing endophytic bacteria from halophyte Suaeda salsa to understand the interactions between endophytes and halophyte. ACC deaminase-containing endophytic bacteria were isolated from root, stalk and leaf of Suaeda salsa and were identified based on morphological, physiological-biochemical properties, API and 16S rRNA sequence analysis. Isolates were evaluated for their ACC deaminase, antifungal, protease activity, siderophores and phytohormones, such as indole-3-acetic acid, gibberellic acid and abscisic acid production, as well as atmospheric nitrogen fixation and phosphate solubilization. Four ACC deaminase-containing endophytic bacteria strains named as LP11, SS12, TW1 and TW2 were isolated and identified as Pseudomonas oryzihabitans, Pseudomonas sp., Pantoea agglomerans and Pseudomonas putida respectively. All the strains possessed the phosphate-solubilizing ability and could produce siderophores and phytohormones more or less. None of them could fix atmospheric nitrogen or produce protease. Only strain SS12 showed antagonism against two phytopathogenic fungi viz Fusarium oxysporum f. sp. conglutinans and F. oxysporum f. sp. cucumerinum. ACC deaminase-containing endophytic bacteria of Pseudomonas sp. and Pantoea sp. isolated from halophyte Suaeda salsa have abundant biological characteristics related to plant growth promotion, stress homeostasis regulation and biocontrol activity.

Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

Directory of Open Access Journals (Sweden)

Verónica Loera-Castañeda

2014-01-01

Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

Science.gov (United States)

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Science.gov (United States)

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

Science.gov (United States)

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

A broad distribution of the alternative oxidase in microsporidian parasites.

Directory of Open Access Journals (Sweden)

Bryony A P Williams

2010-02-01

Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

Organiser l'accès électronique à des périodiques : Analyse des outils et proposition pour la mise en place d'une solution d'accès à la bibliothèque d'HEC

OpenAIRE

Boutin, Christine

2007-01-01

Ce mémoire est centré sur l'organisation de l'accès aux périodiques et l'offre du marché dans ce domaine. Pour circonscrire l'ensemble de la problématique, les différentes offres de périodiques, les besoins en accès des utilisateurs et les contraintes posées par les modalités d'accès sont définis. Sont alors présentés quelques produits ayant vocation à l'unification de l'accès aux périodiques. Puis une évaluation de ces outils est menée à partir du cas de la bibliothèque d'HEC : elle est l'oc...

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Science.gov (United States)

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia.

Science.gov (United States)

Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain

2009-08-01

The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

Rapport annuel au Parlement Loi sur l'accès à l'information Centre ...

International Development Research Centre (IDRC) Digital Library (Canada)

leonardi

accès à l'information. Source. Nombre de demandes. 0. Médias. 1. Rapport statistique sur la Loi sur l'accès à l'information. Nom de l'institution : Centre de recherches pour le développement international. Période visée par le ...

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

Science.gov (United States)

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

Science.gov (United States)

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

Science.gov (United States)

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

The transformation of amorphous calcium carbonate, ACC, to crystalline phases as function of time and temperature.

Science.gov (United States)

Gies, Hermann; Happel, Marian; Niedermayr, Andrea; Immenhauser, Adrian

2017-04-01

We present results from a structural study of the transformation of freeze dried amorphous calcium carbonate, ACC, in crystalline material using pair distribution function analysis, PDF analysis, of X-ray powder diffraction data, XPD data. PDF analysis allows for the analysis of local order of structural subunit in the range between molecular unit (1. and 2. coordination sphere) and long range periodicity as in crystalline materials. ACC was precipitated from aqueous solutions at 298 K and 278 K using different amounts of Mg cations as stabilizer. The samples were immediately separated from the solution and freeze dried. For the transformation study, the samples were heated and analysed using XPD until they were crystallized. The radial distribution obtained from the XPD data were compared to simulated radial distributions of the calcium carbonate polymorphs and their hydrated phases. An ACC precipitated from a solution with Ca:Mg:CO3 = 1:5:4 at 298 K (ration in mmol, pH = 8.2) and freeze dried right after isolation from the solution revealed a close resemblance with ikaite in its local order. Another ACC with Ca:Mg:CO3 = 1:10:1.4 (T = 298, pH = 8.7) showed distinctly different local order resembling monohydrocalcite. Both ACC, however, still had considerable amounts of water dominating the Ca-coordination sphere. During the transformation to calcite, the structural changes in the sample concerned the hydrate water coordinating Ca which was removed and replaced by the carbonate oxygens. The study shows that ACC obtained from different starting solutions show specific local order. Freeze drying leads to solid ACC powder which still contain considerable amounts of hydrate water. Structural subunits are distinct in ACC and different from the crystalline phase. The study supplements recent reports presented by Konrad et al., Purgstaller et al., and Tobler et al.. F. Konrad et al., Cryst. Growth Des. 16, 6310-6317(2016) B. Purgstaller et al., Geochimica et Cosmochimica

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

Science.gov (United States)

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

Science.gov (United States)

Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

2014-05-01

In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

[The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

Science.gov (United States)

Stasia, Marie-José

2007-05-01

Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

Norrie disease gene is distinct from the monoamine oxidase genes.

Science.gov (United States)

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Oxidase-based biocatalytic processes

DEFF Research Database (Denmark)

Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

A halotolerant Enterobacter sp. displaying ACC deaminase activity promotes rice seedling growth under salt stress.

Science.gov (United States)

Sarkar, Anumita; Ghosh, Pallab Kumar; Pramanik, Krishnendu; Mitra, Soumik; Soren, Tithi; Pandey, Sanjeev; Mondal, Monohar Hossain; Maiti, Tushar Kanti

2018-01-01

Agricultural productivity is proven to be hampered by the synthesis of reactive oxygen species (ROS) and production of stress-induced ethylene under salinity stress. One-aminocyclopropane-1-carboxylic acid (ACC) is the direct precursor of ethylene synthesized by plants. Bacteria possessing ACC deaminase activity can use ACC as a nitrogen source preventing ethylene production. Several salt-tolerant bacterial strains displaying ACC deaminase activity were isolated from rice fields, and their plant growth-promoting (PGP) properties were determined. Among them, strain P23, identified as an Enterobacter sp. based on phenotypic characteristics, matrix-assisted laser desorption ionization-time of flight mass spectrometry data and the 16S rDNA sequence, was selected as the best-performing isolate for several PGP traits, including phosphate solubilization, IAA production, siderophore production, HCN production, etc. Enterobacter sp. P23 was shown to promote rice seedling growth under salt stress, and this effect was correlated with a decrease in antioxidant enzymes and stress-induced ethylene. Isolation of an acdS mutant strain enabled concluding that the reduction in stress-induced ethylene content after inoculation of strain P23 was linked to ACC deaminase activity. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

L'accès à l'information gagne du terrain en Afrique | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

29 mars 2012 ... Il est largement reconnu que l'accès à l'information est l'une des pierres angulaires de la bonne gouvernance ainsi qu'un important outil de lutte contre la corruption. Près d'une centaine de pays, dont 10 en Afrique, ont adopté des lois ou des décrets nationaux qui reconnaissent le droit du public à l'accès ...

The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

Directory of Open Access Journals (Sweden)

Suriana

2012-08-01

Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Directory of Open Access Journals (Sweden)

Hoi-Sen Yong

Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

WASTE-ACC: A computer model for analysis of waste management accidents

International Nuclear Information System (INIS)

Nabelssi, B.K.; Folga, S.; Kohout, E.J.; Mueller, C.J.; Roglans-Ribas, J.

1996-12-01

In support of the U.S. Department of Energy's (DOE's) Waste Management Programmatic Environmental Impact Statement, Argonne National Laboratory has developed WASTE-ACC, a computational framework and integrated PC-based database system, to assess atmospheric releases from facility accidents. WASTE-ACC facilitates the many calculations for the accident analyses necessitated by the numerous combinations of waste types, waste management process technologies, facility locations, and site consolidation strategies in the waste management alternatives across the DOE complex. WASTE-ACC is a comprehensive tool that can effectively test future DOE waste management alternatives and assumptions. The computational framework can access several relational databases to calculate atmospheric releases. The databases contain throughput volumes, waste profiles, treatment process parameters, and accident data such as frequencies of initiators, conditional probabilities of subsequent events, and source term release parameters of the various waste forms under accident stresses. This report describes the computational framework and supporting databases used to conduct accident analyses and to develop source terms to assess potential health impacts that may affect on-site workers and off-site members of the public under various DOE waste management alternatives

Historic Learning Approach for Auto-tuning OpenACC Accelerated Scientific Applications

KAUST Repository

Siddiqui, Shahzeb

2015-04-17

The performance optimization of scientific applications usually requires an in-depth knowledge of the hardware and software. A performance tuning mechanism is suggested to automatically tune OpenACC parameters to adapt to the execution environment on a given system. A historic learning based methodology is suggested to prune the parameter search space for a more efficient auto-tuning process. This approach is applied to tune the OpenACC gang and vector clauses for a better mapping of the compute kernels onto the underlying architecture. Our experiments show a significant performance improvement against the default compiler parameters and drastic reduction in tuning time compared to a brute force search-based approach.

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

Science.gov (United States)

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.

Science.gov (United States)

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

Directory of Open Access Journals (Sweden)

Laura A Nucci

Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

Potential US Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

Science.gov (United States)

Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

2018-01-09

The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among US adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9 623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce US population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among US adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of US adults, respectively. Nonpharmacological intervention is advised for the 9.4% of US adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among US adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of US adults recommended for antihypertensive medication, and more intensive BP lowering for many

Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

International Nuclear Information System (INIS)

Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan

2017-01-01

Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

L'accès à l'information gagne du terrain en Afrique | CRDI - Centre ...

International Development Research Centre (IDRC) Digital Library (Canada)

29 mars 2012 ... Les trois pays où se déroule le projet en sont à divers stades de cette démarche. ... La loi sur l'accès à l'information de l'Ouganda a été promulguée en ... en matière d'accès à l'information dans les secteurs de l'énergie et des ...

Influence of Magnesium Content on the Local Structure of Amorphous Calcium Carbonate (ACC): Real Time Determination by In Situ PDF Analysis

Science.gov (United States)

Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

2016-12-01

Calcium carbonate minerals are an essential component in the exoskeletons of crustaceans and mollusks. The onset of exoskeleton mineralization includes the precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that later transforms to produce diverse structures. Despite the importance of ACC as a critical phase during skeleton formation, the chemical and physical properties are not well characterized at conditions that approximate biological environments. Of particular interest are the solubility of ACC, the short-range structure at the time of formation, and the evolution of ACC structure to final products. Recent advances showing the widespread occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015) underline the importance of understanding amorphous intermediates. Using quantitative laboratory techniques developed by our research group (Blue et al., 2013; Blue and Dove, 2015; Blue et al., in press), this experimental study quantifies the solubility of ACC in parallel with the physical characterization of the corresponding structure. We measured ACC solubility at specific time points during the precipitation and during its subsequent evolution under the mild pH conditions that approximate biological and environmental conditions. In parallel experiments, structural data were collected from in situ pair distribution function (PDF) analyses were conducted to follow the evolution of individual samples from initial precipitation to final product. The measurements are leading to a quantitative solubility function for ACC with variable Mg contents and an x-ray based understanding of ACC structure in the same particles. We are also finding temporal changes in the short-range order of ACC after precipitation and this order is dependent upon Mg content. Moreover, the data show Mg distribution through the ACC particles is dependent upon total alkalinity. Insights from this study hold promise

Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger.

Science.gov (United States)

Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro

2012-03-01

The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

Science.gov (United States)

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

Science.gov (United States)

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

ACCE/ACS National Educator and Leader of the Year Winners: AEC Congratulates These Outstanding Educators

Science.gov (United States)

Australian Educational Computing, 2012

2012-01-01

This article presents the ACCE/ACS National Educator and Leader of the Year winners. Anne Mirtschin is the recipient of the ACCE/ACS 2012 Educator of the Year Award. Mirtschin is an innovative teacher at Hawkesdale P-12 College a small rural school that is isolated culturally and geographically. She uses online tools and technology to create…

The effects of deactivation and (re)activation of ACC on driver behaviour analyzed in real traffic

NARCIS (Netherlands)

Pauwelussen, J.; Minderhoud, M.

2008-01-01

For the development of a micro-simulation model to estimate the effect of Adaptive Cruise Control (ACC) systems on traffic safety, throughput and environment, data of a Field Operational Test (FOT) was analyzed in which vehicles were equipped with ACC and Lane Departure Warning (LDW) systems. The

Exploring flavin-containing carbohydrate oxidases

NARCIS (Netherlands)

Ferrari, Alessandro Renato

2017-01-01

Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

International Nuclear Information System (INIS)

Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

2008-01-01

Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

Science.gov (United States)

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

A glutathione S-transferase gene associated with antioxidant properties isolated from Apis cerana cerana

Science.gov (United States)

Liu, Shuchang; Liu, Feng; Jia, Haihong; Yan, Yan; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

2016-06-01

Glutathione S-transferases (GSTs) are an important family of multifunctional enzymes in aerobic organisms. They play a crucial role in the detoxification of exogenous compounds, especially insecticides, and protection against oxidative stress. Most previous studies of GSTs in insects have largely focused on their role in insecticide resistance. Here, we isolated a theta class GST gene designated AccGSTT1 from Apis cerana cerana and aimed to explore its antioxidant and antibacterial attributes. Analyses of homology and phylogenetic relationships suggested that the predicted amino acid sequence of AccGSTT1 shares a high level of identity with the other hymenopteran GSTs and that it was conserved during evolution. Quantitative real-time PCR showed that AccGSTT1 is most highly expressed in adult stages and that the expression profile of this gene is significantly altered in response to various abiotic stresses. These results were confirmed using western blot analysis. Additionally, a disc diffusion assay showed that a recombinant AccGSTT1 protein may be roughly capable of inhibiting bacterial growth and that it reduces the resistance of Escherichia coli cells to multiple adverse stresses. Taken together, these data indicate that AccGSTT1 may play an important role in antioxidant processes under adverse stress conditions.

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

Science.gov (United States)

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

Identifying human disease genes through cross-species gene mapping of evolutionary conserved processes.

Directory of Open Access Journals (Sweden)

Martin Poot

2011-05-01

Full Text Available Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes.We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC development.From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC and those covered by copy number variations (CNV yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10(-5.This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia.

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

An Analysis of OpenACC Programming Model: Image Processing Algorithms as a Case Study

Directory of Open Access Journals (Sweden)

M. J. Mišić

2014-06-01

Full Text Available Graphics processing units and similar accelerators have been intensively used in general purpose computations for several years. In the last decade, GPU architecture and organization changed dramatically to support an ever-increasing demand for computing power. Along with changes in hardware, novel programming models have been proposed, such as NVIDIA’s Compute Unified Device Architecture (CUDA and Open Computing Language (OpenCL by Khronos group. Although numerous commercial and scientific applications have been developed using these two models, they still impose a significant challenge for less experienced users. There are users from various scientific and engineering communities who would like to speed up their applications without the need to deeply understand a low-level programming model and underlying hardware. In 2011, OpenACC programming model was launched. Much like OpenMP for multicore processors, OpenACC is a high-level, directive-based programming model for manycore processors like GPUs. This paper presents an analysis of OpenACC programming model and its applicability in typical domains like image processing. Three, simple image processing algorithms have been implemented for execution on the GPU with OpenACC. The results were compared with their sequential counterparts, and results are briefly discussed.

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

Science.gov (United States)

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

Role of pH in oxidase variability of Aeromonas hydrophila.

OpenAIRE

Hunt, L K; Overman, T L; Otero, R B

1981-01-01

Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

The human ACC2 CT-domain C-terminus is required for full functionality and has a novel twist

Energy Technology Data Exchange (ETDEWEB)

Madauss, Kevin P. [Department of Computational and Structural Chemistry, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States); Burkhart, William A.; Consler, Thomas G. [Department of Biochemical Reagents and Assay Development, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States); Cowan, David J. [Department of Chemistry in the Center for Excellence in Metabolic Pathways Drug Discovery, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States); Gottschalk, William K. [Institute for Genome Sciences and Policy and Department of Medicine, Division of Neurology, Duke University, Durham, NC 27708 (United States); Miller, Aaron B. [Department of Computational and Structural Chemistry, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States); Short, Steven A. [Department of Biochemical Reagents and Assay Development, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States); Tran, Thuy B. [Department of Physiology, UNC School of Medicine, University of North Carolina, Chapel Hill, NC 27515 (United States); Williams, Shawn P., E-mail: shawn.p.williams@gsk.com [Department of Computational and Structural Chemistry, GlaxoSmithKline Inc., Five Moore Drive, Research Triangle Park, NC 27709 (United States)

2009-05-01

The use of biophysical assays permitted the identification of a specific human ACC2 carboxyl transferase (CT) domain mutant that binds inhibitors and crystallizes in their presence. This mutant led to determination of the human ACC2 CT domain–CP-640186 complex crystal structure, which revealed differences in the inhibitor conformation from the yeast protein complex that are caused by differing residues in the binding pocket. Inhibition of acetyl-CoA carboxylase (ACC) may prevent lipid-induced insulin resistance and type 2 diabetes, making the enzyme an attractive pharmaceutical target. Although the enzyme is highly conserved amongst animals, only the yeast enzyme structure is available for rational drug design. The use of biophysical assays has permitted the identification of a specific C-terminal truncation of the 826-residue human ACC2 carboxyl transferase (CT) domain that is both functionally competent to bind inhibitors and crystallizes in their presence. This C-terminal truncation led to the determination of the human ACC2 CT domain–CP-640186 complex crystal structure, which revealed distinctions from the yeast-enzyme complex. The human ACC2 CT-domain C-terminus is comprised of three intertwined α-helices that extend outwards from the enzyme on the opposite side to the ligand-binding site. Differences in the observed inhibitor conformation between the yeast and human structures are caused by differing residues in the binding pocket.

Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

NARCIS (Netherlands)

Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.

2002-01-01

Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

ACC/AHA guidelines superior to ESC/EAS guidelines for primary prevention with statins in non-diabetic Europeans

DEFF Research Database (Denmark)

Mortensen, Martin Bødtker; Nordestgaard, Børge G; Afzal, Shoaib

2017-01-01

Aim We compared the 2013 American College of Cardiology/American Heart Association (ACC/AHA) and the 2016 European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) guidelines on prevention of atherosclerotic cardiovascular disease (ASCVD) using different risk prediction models [US......-calibrated around decision thresholds for statin therapy. For a Class I recommendation, 42% of individuals qualified for statins using the ACC/AHA guidelines vs. 6% with the ESC/EAS guidelines. Using ACC/AHA- vs. ESC/EAS-defined statin eligibility led to a substantial gain in sensitivity (+62% for any ASCVD and+76......% for fatal ASCVD) with a smaller loss in specificity (-35% for any ASCVD and -36% for fatal ASCVD). Similar differences between the ACC/AHA and ESC/EAS guidelines were found for men and women separately, and for Class IIa recommendations. The sensitivity and specificity of a US-PCE risk of 5% were similar...

Establishing the solubility and local structure(s) of Amorphous Calcium Carbonate (ACC): Toward an understanding of invertebrate biomineralization

Science.gov (United States)

Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

2017-12-01

Recent advances in high-resolution imaging show the widespreadd occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015, Science). For example, carbonate biomineralization often involves precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that subsequently transforms to crystalline products with diverse structures. Although current carbonate mineral proxies are based upon the composition of final crystalline products, the final signatures may be recording the properties of the initial amorphous phase. Thus, it is critical to establish the physical properties of ACC and understand the factors that influence its evolution to final products at conditions that approximate biological environments. This disconnect limits our ability to build a process-based understanding of when/how minor and trace elements are recorded in mineral composition proxies. In this experimental study, we quantified the chemical and physical properties of ACC and its evolution to final products. We first determined ACC solubility under controlled chemical conditions using a new type of flow-through reactor developed by our research group (Blue and Dove, 2015, GCA; Blue et al., 2017, GCA). The experimental design varied Mg concentration and total alkalinity while maintaining a mild pH that approximates biological environments. ACC solubility was measured at specific time points during the precipitation (from super- and undersaturated conditions) and during its subsequent evolution. Parallel experiments characterized the structure of the corresponding amorphous products using in situ pair distribution function (PDF) and small-angle x-ray scattering (SAXS) analyses. The measurements demonstrate at least two types of ACC can be produced by tuning Mg concentration and alkalinity. Each "phase" exhibits distinct short-range ordering that demonstrates structure-specific solubility. We also find temporal changes in the

Effects of aminoisobutyric acid on 1-aminocyclopropane-1-carboxylic acid uptake, ethylene production and content of ACC in water-stressed tomato plants

International Nuclear Information System (INIS)

Kalantari, Kh.M.; Bolourani, P.

2000-01-01

The effect of water stress on the regulation of ethylene biosynthesis has not yet clearly been established. Both the formation and utilization of aminocyclopropane-1-carboxylic acid, ACC, are considered to be major regulatory points in ethylene biosynthesis. There is evidence that ACC synthase is the key control enzyme in response to various stimuli associated with the induction of ethylene biosynthesis. It has been reported that aminoisobutyric acid, AIB, inhibits ethylene production in some plants and AIB may inhibit the conversion of ACC to ethylene. For this reason, the possibility of inhibition of ACC uptake in the presence of AIB was examined. It was observed that the rate of 14 C-ACC uptake decreased with an increase in the concentration of AIB in the solution. Calculating the percentage of ACC converted to ethylene on the basis of uptake shows that AIB inhibits the conversion of 14 C-ACC to ethylene and that this inhibition is increased with an increase in the concentration of AIB in the solution. This suggests that a portion of the inhibition of the conversion of ACC to ethylene in the presence of AIB is partly due to the competition for absorption. However, the ability of AIB to inhibit ethylene production in leaf tissue without an exogenous supply of ACC clearly indicates that AIB inhibits ethylene production. The present study was undertaken to elucidate the regulation of ethylene biosynthesis in water-stressed plants and the results are discussed

Constant Width Planar Computation Characterizes ACC⁰

DEFF Research Database (Denmark)

Hansen, K.A.

2004-01-01

We obtain a characterization of ACC 0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

Directory of Open Access Journals (Sweden)

Sluse F.E.

1998-01-01

Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

Directory of Open Access Journals (Sweden)

Veerachat Muangsombut

2017-08-01

Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

Report of the Annual Scientific Session of the American College of Cardiology (ACC) 2018, Orlando.

Science.gov (United States)

Hashimoto, Takuya; Ako, Junya

2018-04-28

The 67 th Annual Scientific Session and Expo of the American College of Cardiology (ACC) were held at the Orange County Convention Center, Orlando, from March 10-12, 2018. This meeting offered 2,700 accepted abstracts presented in oral and poster sessions by 2,100 experts and 37 Late-Breaking Clinical Trials and Featured Clinical Research presentations. This report introduces the key presentations and highlights from the ACC 2018 Scientific Session.

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

Science.gov (United States)

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

The kinetics and mechanisms of amorphous calcium carbonate (ACC) crystallization to calcite, via vaterite.

Science.gov (United States)

Rodriguez-Blanco, Juan Diego; Shaw, Samuel; Benning, Liane G

2011-01-01

The kinetics and mechanisms of nanoparticulate amorphous calcium carbonate (ACC) crystallization to calcite, via vaterite, were studied at a range of environmentally relevant temperatures (7.5-25 °C) using synchrotron-based in situ time-resolved Energy Dispersive X-ray Diffraction (ED-XRD) in conjunction with high-resolution electron microscopy, ex situ X-ray diffraction and infrared spectroscopy. The crystallization process occurs in two stages; firstly, the particles of ACC rapidly dehydrate and crystallize to form individual particles of vaterite; secondly, the vaterite transforms to calcite via a dissolution and reprecipitation mechanism with the reaction rate controlled by the surface area of calcite. The second stage of the reaction is approximately 10 times slower than the first. Activation energies of calcite nucleation and crystallization are 73±10 and 66±2 kJ mol(-1), respectively. A model to calculate the degree of calcite crystallization from ACC at environmentally relevant temperatures (7.5-40 °C) is also presented.

Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

Directory of Open Access Journals (Sweden)

Makkonen J.

2015-01-01

Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

Energy Technology Data Exchange (ETDEWEB)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

Characterization of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase-Containing Pseudomonas spp. in the Rhizosphere of Salt-Stressed Canola

NARCIS (Netherlands)

Akhgar, A.; Arzanlou, M.; Bakker, Peter; Hamidpour, M.

2014-01-01

When exposed to biotic or abiotic stress conditions, plants produce ethylene from its immediate precursor 1-aminocyclopropane-1- carboxylate (ACC), leading to retarded root growth and senescence. Many plant growth-promoting rhizobacteria contain the enzyme ACC deaminase and this enzyme can cleave

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

Science.gov (United States)

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Science.gov (United States)

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

Energy Technology Data Exchange (ETDEWEB)

Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))

1989-09-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

International Nuclear Information System (INIS)

Johnson, J.L.; Rajagopalan, K.V.; London, R.E.

1989-01-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well

Ervaringen met Advanced Cruise Control (ACC) in een korte praktijkproef.

NARCIS (Netherlands)

Oei, H.-l.

2003-01-01

Experiences with Advanced Cruise Control in traffic; a limited experiment. Advanced Cruise Control (ACC) is an ordinary cruise control in which the desired speed is installed manually, but in which the headway time to the vehicle in front is also taken into account. If the headway time becomes less

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

Science.gov (United States)

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

ACC deaminase and IAA producing growth promoting bacteria from the rhizosphere soil of tropical rice plants.

Science.gov (United States)

Bal, Himadri Bhusan; Das, Subhasis; Dangar, Tushar K; Adhya, Tapan K

2013-12-01

Beneficial plant-associated bacteria play a key role in supporting and/or promoting plant growth and health. Plant growth promoting bacteria present in the rhizosphere of crop plants can directly affect plant metabolism or modulate phytohormone production or degradation. We isolated 355 bacteria from the rhizosphere of rice plants grown in the farmers' fields in the coastal rice field soil from five different locations of the Ganjam district of Odisha, India. Six bacteria producing both ACC deaminase (ranging from 603.94 to 1350.02 nmol α-ketobutyrate mg(-1)  h(-1) ) and indole acetic acid (IAA; ranging from 10.54 to 37.65 μM ml(-1) ) in pure cultures were further identified using polyphasic taxonomy including BIOLOG((R)) , FAME analysis and the 16S rRNA gene sequencing. Phylogenetic analyses of the isolates resulted into five major clusters to include members of the genera Bacillus, Microbacterium, Methylophaga, Agromyces, and Paenibacillus. Seed inoculation of rice (cv. Naveen) by the six individual PGPR isolates had a considerable impact on different growth parameters including root elongation that was positively correlated with ACC deaminase activity and IAA production. The cultures also had other plant growth attributes including ammonia production and at least two isolates produced siderophores. Study indicates that presence of diverse rhizobacteria with effective growth-promoting traits, in the rice rhizosphere, may be exploited for a sustainable crop management under field conditions. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Health Literacy: Readability of ACC/AHA Online Patient Education Material.

Science.gov (United States)

Kapoor, Karan; George, Praveen; Evans, Matthew C; Miller, Weldon J; Liu, Stanley S

To determine whether the online patient education material offered by the American College of Cardiology (ACC) and the American Heart Association (AHA) is written at a higher level than the 6th-7th grade level recommended by the National Institute of Health (NIH). Online patient education material from each website was subjected to reading grade level (RGL) analysis using the Readability Studio Professional Edition. One-sample t testing was used to compare the mean RGLs obtained from 8 formulas to the NIH-recommended 6.5 grade level and 8th grade national mean. In total, 372 articles from the ACC website and 82 from the AHA were studied. Mean (±SD) RGLs for the 454 articles were 9.6 ± 2.1, 11.2 ± 2.1, 11.9 ± 1.6, 10.8 ± 1.6, 9.7 ± 2.1, 10.8 ± 0.8, 10.5 ± 2.6, and 11.7 ± 3.5 according to the Flesch-Kincaid grade level (FKGL), Simple Measure of Gobbledygook (SMOG Index), Coleman-Liau Index (CLI), Gunning-Fog Index (GFI), New Dale-Chall reading level formula (NDC), FORCAST, Raygor Readability Estimate (RRE), and Fry Graph (Fry), respectively. All analyzed articles had significantly higher RGLs than both the NIH-recommended grade level of 6.5 and the national mean grade level of 8 (p education material provided on the ACC and AHA websites is written above the NIH-recommended 6.5 grade level and 8th grade national mean reading level. Additional studies are required to demonstrate whether lowering the RGL of this material improves outcomes among patients with cardiovascular disease. © 2017 S. Karger AG, Basel.

Polyphenol Oxidase Enzyme and Inactivation Methods

Directory of Open Access Journals (Sweden)

Leman Yılmaz

2018-03-01

Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

Science.gov (United States)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

Science.gov (United States)

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior.

Science.gov (United States)

Bergauer, Kristin; Sintes, Eva; van Bleijswijk, Judith; Witte, Harry; Herndl, Gerhard J

2013-06-01

Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (accA subunit), a key enzyme powering inter alia the 3-hydroxypropionate/4-hydroxybutyrate cycle (HP/HB) and the archaeal ammonia monooxygenase (amoA). Quantification of accA-like genes revealed a consistent depth profile in the upper mesopelagial with increasing gene abundances from subsurface layers towards the oxygen minimum zone (OMZ), coinciding with an increase in archaeal amoA gene abundance. Gene abundance profiles of metabolic marker genes (accA, amoA) were correlated with thaumarchaeal 16S rRNA gene abundances as well as CO2 fixation rates to link the genetic potential to actual rate measurements. AccA gene abundances correlated with archaeal amoA gene abundance throughout the water column (r(2)  = 0.309, P < 0.0001). Overall, a substantial genetic predisposition of CO2 fixation was present in the dark realm of the tropical Atlantic in both Archaea and Bacteria. Hence, dark ocean CO2 fixation might be more widespread among prokaryotes inhabiting the oxygenated water column of the ocean's interior than hitherto assumed. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

The relation between in vivo ethylene production and oxygen partial pressure

NARCIS (Netherlands)

Sanders, M.G.; Wild, de H.P.J.

2003-01-01

Modelling in vivo ethylene production rate in relation to O2 partial pressure was used to improve understanding of enzyme kinetics of 1-aminocyclopropane-1-carboxylate oxidase (ACC oxidase). Tomato fruit were stored in an extensive range of O2 partial pressures at 8, 13 and 18 °C. Ethylene

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

Science.gov (United States)

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

The Effect of Electroacupuncture on PKMzeta in the ACC in Regulating Anxiety-Like Behaviors in Rats Experiencing Chronic Inflammatory Pain

Directory of Open Access Journals (Sweden)

Junying Du

2017-01-01

Full Text Available Chronic inflammatory pain can induce emotional diseases. Electroacupuncture (EA has effects on chronic pain and pain-related anxiety. Protein kinase Mzeta (PKMzeta has been proposed to be essential for the maintenance of pain and may interact with GluR1 to maintain CNS plasticity in the anterior cingulate cortex (ACC. We hypothesized that the PKMzeta-GluR1 pathway in the ACC may be involved in anxiety-like behaviors of chronic inflammatory pain and that the mechanism of EA regulation of pain emotion may involve the PKMzeta pathway in the ACC. Our results showed that chronic inflammatory pain model decreased the paw withdrawal threshold (PWT and increased anxiety-like behaviors. The protein expression of PKCzeta, p-PKCzeta (T560, PKMzeta, p-PKMzeta (T560, and GluR1 in the ACC of the model group were remarkably enhanced. EA increased PWT and alleviated anxiety-like behaviors. EA significantly inhibited the protein expression of p-PKMzeta (T560 in the ACC, and only a downward trend effect for other substances. Further, the microinjection of ZIP remarkably reversed PWT and anxiety-like behaviors. The present study provides direct evidence that the PKCzeta/PKMzeta-GluR1 pathway is related to pain and pain-induced anxiety-like behaviors. EA treatment both increases pain-related somatosensory behavior and decreases pain-induced anxiety-like behaviors by suppressing PKMzeta activity in the ACC.

L'intégration des accélérateurs du CERN

CERN Document Server

Chemli, S; CERN. Geneva. TS Department

2008-01-01

L?intégration du LHC a ouvert des perspectives pour une gestion plus complète des accélérateurs du CERN. La base de données LAYOUT a permis d'assurer la continuité des phases de définition optique du projet, d'intégration 3D et de contrôles de conformité des installations. Les scans et modélisations 3D en couches des installations réalisées constituent un outil déterminant pour la préparation des interventions dans le cadre des procédures de sécurité ALARA. Il est proposé de reproduire cette méthodologie pour les nouveaux projets comme pour les accélérateurs existants. La mise à jour de l'anneau SPS dans LAYOUT semble être la priorité. La base de données SURVEY contient déjà une vue d'ensemble des accélérateurs, chaque composant étant référencé dans le Système de Coordonnées du CERN, selon les définitions théoriques "sources" au 1/100 mm. Base pour l'alignement, elle stocke également les positions réelles des machines. Elle complète ainsi l'information linéaire de LAY...

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

Science.gov (United States)

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

Chromium downregulates the expression of Acetyl CoA Carboxylase 1 gene in lipogenic tissues of domestic goats: a potential strategy for meat quality improvement.

Science.gov (United States)

Najafpanah, Mohammad Javad; Sadeghi, Mostafa; Zali, Abolfazl; Moradi-Shahrebabak, Hossein; Mousapour, Hojatollah

2014-06-15

Acetyl CoA Carboxylase 1 (ACC1) is a biotin-dependent enzyme that catalyzes the carboxylation of Acetyl CoA to form Malonyl CoA, the key intermediate metabolite in fatty acid synthesis. In this study, the mRNA expression of the ACC1 gene was evaluated in four different tissues (liver, visceral fat, subcutaneous fat, and longissimus muscle) of the domestic goat (Capra hircus) kids feeding on four different levels of trivalent chromium (0, 0.5, 1, and 1.5mg/day) as food supplementation. RT-qPCR technique was used for expression analyses and heat shock protein 90 gene (HSP-90) was considered as reference gene for data normalization. Our results revealed that 1.5mg/day chromium significantly reduced the expression of the ACC1 gene in liver, visceral fat, and subcutaneous fat tissues, but not in longissimus muscles (Pmeat quality in domestic animals. Copyright © 2014 Elsevier B.V. All rights reserved.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

Science.gov (United States)

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

Science.gov (United States)

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

Ethylene production, ACC and MACC content of freesia buds and florets.

NARCIS (Netherlands)

Spikman, G.

1988-01-01

Changes in ethylene production, ACC (1-aminocyclopropane-1-carboxylic acid) and MACC (1-(malonylamino)-cyclopropane-1-carboxylic acid) content of buds and florets of detached inflorescences were studied. Most of the ethylene produced by the inflorescences came from small buds at the apex. This

Historic Learning Approach for Auto-tuning OpenACC Accelerated Scientific Applications

KAUST Repository

Siddiqui, Shahzeb; Alzayer, Fatemah; Feki, Saber

2015-01-01

on a given system. A historic learning based methodology is suggested to prune the parameter search space for a more efficient auto-tuning process. This approach is applied to tune the OpenACC gang and vector clauses for a better mapping of the compute

D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

DEFF Research Database (Denmark)

Andreou, Dimitrios; Saetre, Peter; Werge, Thomas

2012-01-01

The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

Confirmation of a blocked amino terminus of sulfhydryl oxidase

International Nuclear Information System (INIS)

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.

1990-01-01

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

Immobilization of oxidases and their analytical applications

International Nuclear Information System (INIS)

Yasinzai, M.

2007-01-01

Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

NADPH Oxidases: Progress and Opportunities

OpenAIRE

San Martin, Alejandra; Griendling, Kathy K.

2014-01-01

From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

Science.gov (United States)

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

Accès à des accouchements sans risques en Tanzanie (ISMEA ...

International Development Research Centre (IDRC) Digital Library (Canada)

accès en temps utile aux services assurant des accouchements sans risques. Par ailleurs, on constate des lacunes sur le plan du soutien et du mentorat offerts par le personnel plus expérimenté, le manque de motivation à participer à des cours de ...

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

Science.gov (United States)

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

Directory of Open Access Journals (Sweden)

Barbaro Michela

2013-01-01

Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

Warm Water Pathways in the Northeastern North Atlantic ACCE RAFOS Float Data Report

National Research Council Canada - National Science Library

Furey, Heather

2001-01-01

...). The RAFOS float component of ACCE, entitled "Warm Water Pathways and Intergyre Exchange in the Northeastern North Atlantic", was designed to measure the warm water currents entering the northeastern...

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

Science.gov (United States)

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

Contexte de l'accès au matériel didactique dans les universités des ...

International Development Research Centre (IDRC) Digital Library (Canada)

Les étudiants ont de plus en plus accès à tout ce dont ils ont besoin, dans une ... de textes électroniques soumis à aucun contrôle et auquel l'on a accès sans ... et de la dynamique des politiques, de même qu'au mouvement émergent en ce qui ... IWRA/CRDI sur les changements climatiques et la gestion adaptive de l'eau.

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

Science.gov (United States)

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

Modulation of NADPH oxidase activity by known uraemic retention solutes

DEFF Research Database (Denmark)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera

2014-01-01

chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...

Gravity Responsive NADH Oxidase of the Plasma Membrane

Science.gov (United States)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

Science.gov (United States)

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect

Directory of Open Access Journals (Sweden)

Nikola Kovářová

2016-06-01

Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

International Nuclear Information System (INIS)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F.

2009-01-01

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

Science.gov (United States)

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Molecular cloning and characterization of a new peroxidase gene ...

African Journals Online (AJOL)

length cDNA of O.violaceus peroxidase gene (OvRCI, GenBank. Acc. No. AY428037) was 1220 bp and contained an 1128 bp open reading frame encoding a protein of 375 amino acids. Homology analysis and molecular modeling revealed that ...

Calcium transport in vesicles energized by cytochrome oxidase

Energy Technology Data Exchange (ETDEWEB)

Rosier, Randy N. [Univ. of Rochester, NY (United States)

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K⁺ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K⁺ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.

Changes in gene expression and sensitivity of cocaine reward produced by a continuous fat diet.

Science.gov (United States)

Blanco-Gandía, M Carmen; Aracil-Fernández, Auxiliadora; Montagud-Romero, Sandra; Aguilar, Maria A; Manzanares, Jorge; Miñarro, José; Rodríguez-Arias, Marta

2017-08-01

Preclinical studies report that free access to a high-fat diet (HFD) alters the response to psychostimulants. The aim of the present study was to examine how HFD exposure during adolescence modifies cocaine effects. Gene expression of CB1 and mu-opioid receptors (MOr) in the nucleus accumbens (N Acc) and prefrontal cortex (PFC) and ghrelin receptor (GHSR) in the ventral tegmental area (VTA) were assessed. Mice were allowed continuous access to fat from PND 29, and the locomotor (10 mg/kg) and reinforcing effects of cocaine (1 and 6 mg/kg) on conditioned place preference (CPP) were evaluated on PND 69. Another group of mice was exposed to a standard diet until the day of post-conditioning, on which free access to the HFD began. HFD induced an increase of MOr gene expression in the N Acc, but decreased CB1 receptor in the N Acc and PFC. After fat withdrawal, the reduction of CB1 receptor in the N Acc was maintained. Gene expression of GHSR in the VTA decreased during the HFD and increased after withdrawal. Following fat discontinuation, mice exhibited increased anxiety, augmented locomotor response to cocaine, and developed CPP for 1 mg/kg cocaine. HFD reduced the number of sessions required to extinguish the preference and decreased sensitivity to drug priming-induced reinstatement. Our results suggest that consumption of a HFD during adolescence induces neurobiochemical changes that increased sensitivity to cocaine when fat is withdrawn, acting as an alternative reward.

Key role of alternative oxidase in lovastatin solid-state fermentation.

Science.gov (United States)

Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

2017-10-01

Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

H2O2 and NADPH oxidases involve in regulation of 2-(2-phenylethyl)chromones accumulation during salt stress in Aquilaria sinensis calli.

Science.gov (United States)

Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei

2018-04-01

2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.

Qualité, portée et incidence de l'édition savante en libre accès en ...

International Development Research Centre (IDRC) Digital Library (Canada)

Une meilleure compréhension du libre accès aux recherches savantes aidera à déterminer en quoi il contribue à accroître la circulation des connaissances et la diffusion des résultats de recherche en Amérique latine. Le libre accès (le fait de pouvoir consulter, sans restriction aucune, des articles publiés dans des revues ...

Droits des femmes et accès à la terre au Sénégal : une citoyenneté ...

International Development Research Centre (IDRC) Digital Library (Canada)

Incidence de l'accès des femmes au foncier dans le développement local : le cas des femmes du GIE Seydy Ababacar Sy de Ross Bethio dans la vallée du fleuve Sénégal. Download PDF. Papers. Plaquette de présentation du projet Droits des femmes et accès au foncier : une citoyenneté à conquérir. Download PDF.

Modulation of NADPH oxidase activity by known uraemic retention solutes.

Science.gov (United States)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim

2014-08-01

Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

Potential U.S. Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

Science.gov (United States)

Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

2018-01-16

The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among U.S. adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9,623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce U.S. population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among U.S. adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of U.S. adults, respectively. Nonpharmacological intervention is advised for the 9.4% of U.S. adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among U.S. adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of U.S. adults recommended for antihypertensive medication, and more intensive BP

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

Science.gov (United States)

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Analysis of an ACC System for Sliding Mode and MPC under Transitional Manoeuvers

Directory of Open Access Journals (Sweden)

Zeeshan Ali Memon

2012-10-01

Full Text Available Two different control algorithms, sliding mode and MPC (Model Predictive Control are employed to analyse the performance of a linear vehicle model equipped with an ACC (Adaptive Cruise Control system. Both controllers are analysed under critical TM (Transitional Maneuvers to investigate their suitability for the ACC system. The simulation results, for the same scenario, from both controllers\\' approach have been compared. The results show that the MPC is more robust than the SMC (Sliding Model Controller. The results show that the SMC algorithm is not suitable for the proposed vehicle model. The shortcomings of the SMC have been highlighted and the comparisons are made with the previous studies. The proposed approach can be useful for the selection of the appropriate controller for the given application.

Lysyl oxidase in colorectal cancer

DEFF Research Database (Denmark)

Cox, Thomas R; Erler, Janine T

2013-01-01

Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

Science.gov (United States)

El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

2012-01-01

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

Science.gov (United States)

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

Science.gov (United States)

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

Directory of Open Access Journals (Sweden)

Tao Zhan

Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

Directory of Open Access Journals (Sweden)

Saied Reza Naddaf

2012-12-01

Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

Production of rabbit antibodies against purified Glucose oxidase

Directory of Open Access Journals (Sweden)

Muhammad Anjum Zia

2012-02-01

Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

Czech Academy of Sciences Publication Activity Database

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra

2013-01-01

Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

Effects of 5-aza-2′deoxycytidine on RECK gene expression and tumor invasion in salivary adenoid cystic carcinoma

International Nuclear Information System (INIS)

Zhou, X.Q.; Huang, S.Y.; Zhang, D.S.; Zhang, S.Z.; Li, W.G.; Chen, Z.W.; Wu, H.W.

2014-01-01

Reversion-inducing cysteine-rich protein with kazal motifs (RECK), a novel tumor suppressor gene that negatively regulates matrix metalloproteinases (MMPs), is expressed in various normal human tissues but downregulated in several types of human tumors. The molecular mechanism for this downregulation and its biological significance in salivary adenoid cystic carcinoma (SACC) are unclear. In the present study, we investigated the effects of a DNA methyltransferase (DNMT) inhibitor, 5-aza-2′deoxycytidine (5-aza-dC), on the methylation status of the RECK gene and tumor invasion in SACC cell lines. Methylation-specific PCR (MSP), Western blot analysis, and quantitative real-time PCR were used to investigate the methylation status of the RECK gene and expression of RECK mRNA and protein in SACC cell lines. The invasive ability of SACC cells was examined by the Transwell migration assay. Promoter methylation was only found in the ACC-M cell line. Treatment of ACC-M cells with 5-aza-dC partially reversed the hypermethylation status of the RECK gene and significantly enhanced the expression of mRNA and protein, and 5-aza-dC significantly suppressed ACC-M cell invasive ability. Our findings showed that 5-aza-dC inhibited cancer cell invasion through the reversal of RECK gene hypermethylation, which might be a promising chemotherapy approach in SACC treatment

Effects of 5-aza-2′deoxycytidine on RECK gene expression and tumor invasion in salivary adenoid cystic carcinoma

Energy Technology Data Exchange (ETDEWEB)

Zhou, X.Q. [Department of Oral and Maxillofacial Surgery, School of Stomatology, Shandong University, Jinan (China); Department of Oral and Maxillofacial Surgery, The First People' s Hospital of Jining, Shandong (China); Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital, Affiliated to Shandong University, Jinan (China); Huang, S.Y. [Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital, Affiliated to Shandong University, Jinan (China); Zhang, D.S. [Department of Oral and Maxillofacial Surgery, School of Stomatology, Shandong University, Jinan (China); Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital, Affiliated to Shandong University, Jinan (China); Zhang, S.Z.; Li, W.G.; Chen, Z.W.; Wu, H.W. [Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital, Affiliated to Shandong University, Jinan (China)

2014-12-12

Reversion-inducing cysteine-rich protein with kazal motifs (RECK), a novel tumor suppressor gene that negatively regulates matrix metalloproteinases (MMPs), is expressed in various normal human tissues but downregulated in several types of human tumors. The molecular mechanism for this downregulation and its biological significance in salivary adenoid cystic carcinoma (SACC) are unclear. In the present study, we investigated the effects of a DNA methyltransferase (DNMT) inhibitor, 5-aza-2′deoxycytidine (5-aza-dC), on the methylation status of the RECK gene and tumor invasion in SACC cell lines. Methylation-specific PCR (MSP), Western blot analysis, and quantitative real-time PCR were used to investigate the methylation status of the RECK gene and expression of RECK mRNA and protein in SACC cell lines. The invasive ability of SACC cells was examined by the Transwell migration assay. Promoter methylation was only found in the ACC-M cell line. Treatment of ACC-M cells with 5-aza-dC partially reversed the hypermethylation status of the RECK gene and significantly enhanced the expression of mRNA and protein, and 5-aza-dC significantly suppressed ACC-M cell invasive ability. Our findings showed that 5-aza-dC inhibited cancer cell invasion through the reversal of RECK gene hypermethylation, which might be a promising chemotherapy approach in SACC treatment.

Chemoenzymatic combination of glucose oxidase with titanium silicalite -1

DEFF Research Database (Denmark)

Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.

2010-01-01

Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....

Doctors' knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore.

Science.gov (United States)

Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

2015-01-01

There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians' response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40-80 mg and rosuvastatin 20-40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations.

Doctors’ knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore

Science.gov (United States)

Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

2015-01-01

Purpose There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians’ response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. Methods This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Results Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40–80 mg and rosuvastatin 20–40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Conclusion Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations. PMID:26082642

Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of banana fruit.

Science.gov (United States)

Inaba, Akitsugu; Liu, Xuejun; Yokotani, Naoki; Yamane, Miki; Lu, Wang-Jin; Nakano, Ryohei; Kubo, Yasutaka

2007-01-01

The feedback regulation of ethylene biosynthesis in banana [Musa sp. (AAA group, Cavendish subgroup) cv. Grand Nain] fruit was investigated in an attempt to clarify the opposite effect of 1-methylcyclopropene (1-MCP), an ethylene action inhibitor, before and after the onset of ripening. 1-MCP pre-treatment completely prevented the ripening-induced effect of propylene in pre-climacteric banana fruit, whereas treatment after the onset of ripening stimulated ethylene production. In pre-climacteric fruit, higher concentrations of propylene suppressed ethylene production more strongly, despite their earlier ethylene-inducing effect. Exposure of the fruit ripened by propylene to 1-MCP increased ethylene production concomitantly with an increase in 1-aminocyclopropane-1-carboxylate (ACC) synthase activity and ACC content, and prevented a transient decrease in MA-ACS1 transcripts in the pulp tissues. In contrast, in the peel of ripening fruit, 1-MCP prevented the increase in ethylene production and subsequently the ripening process by reduction of the increase in MA-ACS1 and MA-ACO1 transcripts and of ACC synthase and ACC oxidase activities. These results suggest that ethylene biosynthesis in ripening banana fruit may be controlled negatively in the pulp tissue and positively in the peel tissue. This differential regulation by ethylene in pulp and peel tissues was also observed for MA-PL, MA-Exp, and MA-MADS genes.

Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions

Directory of Open Access Journals (Sweden)

Sandip A. Ghuge

2015-07-01

Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.

Politique CERN pour le contrôle d'accès à son domaine et description de l'implantation en cours

CERN Document Server

Jacot, C

1998-01-01

Une volonté politique claire émanant de la direction du CERN et de l'Access Control Panel a chargé la section ST/MC/AC de mettre en place un concept de contrôle d'accès global et cohérent pour l'ensemble des accès au domaine et aux sites de ses accélérateurs. Cela implique que depuis l'accueil et l'enregistrement des personnes jusqu'à la gestion, la surveillance du domaine ainsi que les installations techniques de contrôle d'accès, tous ces services qui sont complémentaires sont désormais rassemblés dans une seule section. Un projet de management des autorisations fortement informatisé ainsi que la productions des cartes CERN sont en cours d'installation. De nombreuses autres installations de contrôle d'accès sont opérationnelles et d'autres sont en cours de réalisation. Toutes seront ensuite intégrées et supervisées depuis une centrale située dans le bâtiment 120, cette dernière est exploitée par une société de surveillance au bénéfice d'un contrat avec le CERN.

Baseline Blood Pressure, the 2017 ACC/AHA High Blood Pressure Guidelines, and Long-Term Cardiovascular Risk in SPRINT

DEFF Research Database (Denmark)

Vaduganathan, Muthiah; Pareek, Manan; Qamar, Arman

2018-01-01

BACKGROUND: The 2017 ACC/AHA guidelines include lower thresholds to define hypertension than previous guidelines. Little is known about the impact of these guideline changes in patients with or at high risk for cardiovascular disease. METHODS: In this exploratory analysis using baseline blood...... pressure assessments in SPRINT (Systolic Blood Pressure Intervention Trial), we evaluated the prevalence and associated cardiovascular prognosis of patients newly reclassified with hypertension based on the 2017 ACC/AHA (SBP≥130mmHg or DBP≥80mmHg) compared with the JNC 7 guidelines (SBP≥140mmHg or DBP≥90mm.......4%) were newly reclassified as having hypertension based on the 2017 ACC/AHA guidelines. Over 3.3-year median follow-up, 319 patients experienced the primary endpoint (87 of whom were newly reclassified with hypertension based on the revised guidelines). Patients with hypertension based on prior guidelines...

Gene expression analyses in tomato near isogenic lines provide evidence for ethylene and abscisic acid biosynthesis fine-tuning during arbuscular mycorrhiza development.

Science.gov (United States)

Fracetto, Giselle Gomes Monteiro; Peres, Lázaro Eustáquio Pereira; Lambais, Marcio Rodrigues

2017-07-01

Plant responses to the environment and microorganisms, including arbuscular mycorrhizal fungi, involve complex hormonal interactions. It is known that abscisic acid (ABA) and ethylene may be involved in the regulation of arbuscular mycorrhiza (AM) and that part of the detrimental effects of ABA deficiency in plants is due to ethylene overproduction. In this study, we aimed to determine whether the low susceptibility to mycorrhizal colonization in ABA-deficient mutants is due to high levels of ethylene and whether AM development is associated with changes in the steady-state levels of transcripts of genes involved in the biosynthesis of ethylene and ABA. For that, tomato (Solanum lycopersicum) ethylene overproducer epinastic (epi) mutant and the ABA-deficient notabilis (not) and sitiens (sit) mutants, in the same Micro-Tom (MT) genetic background, were inoculated with Rhizophagus clarus, and treated with the ethylene biosynthesis inhibitor aminoethoxyvinylglycine (AVG). The development of AM, as well as the steady-state levels of transcripts involved in ethylene (LeACS2, LeACO1 and LeACO4) and ABA (LeNCED) biosynthesis, was determined. The intraradical colonization in epi, not and sit mutants was significantly reduced compared to MT. The epi mutant completely restored the mycorrhizal colonization to the levels of MT with the application of 10 µM of AVG, probably due to the inhibition of the ACC synthase gene expression. The steady-state levels of LeACS2 and LeACO4 transcripts were induced in mycorrhizal roots of MT, whereas the steady-state levels of LeACO1 and LeACO4 transcripts were significantly induced in sit, and the steady-state levels of LeNCED transcripts were significantly induced in all genotypes and in mycorrhizal roots of epi mutants treated with AVG. The reduced mycorrhizal colonization in sit mutants seems not to be limited by ethylene production via ACC oxidase regulation. Both ethylene overproduction and ABA deficiency impaired AM fungal

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

Science.gov (United States)

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

Science.gov (United States)

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

[Sequencing of mitochondrial DNA cytochrome oxidase subunit I gene in sarcosaphagous flies from 14 provinces in China].

Science.gov (United States)

Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong

2010-08-01

To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and

Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

Science.gov (United States)

Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

2013-02-01

Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

user

2011-01-31

Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.

Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

Science.gov (United States)

Gudkova, O O; Latyshko, N V; Shandrenko, S G

2016-01-01

In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

Directory of Open Access Journals (Sweden)

Patti Hayes

2015-09-01

Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

Induction and requirement of gene expression in the anterior cingulate cortex and medial prefrontal cortex for the consolidation of inhibitory avoidance memory

Directory of Open Access Journals (Sweden)

Zhang Yue

2011-01-01

Full Text Available Abstract Background Memory consolidation is a process to stabilize short-term memory, generating long-term memory. A critical biochemical feature of memory consolidation is a requirement for gene expression. Previous studies have shown that fear memories are consolidated through the activation of gene expression in the amygdala and hippocampus, indicating essential roles of these brain regions in memory formation. However, it is still poorly understood whether gene expression in brain regions other than the amygdala/hippocampus is required for the consolidation of fear memory; however, several brain regions are known to play modulatory roles in fear memory formation. Results To further understand the mechanisms underlying the formation of fear memory, we first identified brain regions where gene expression is activated after learning inhibitory avoidance (IA by analyzing the expression of the immediately early genes c-fos and Arc as markers. Similarly with previous findings, the induction of c-fos and Arc expression was observed in the amygdala and hippocampus. Interestingly, we also observed the induction of c-fos and Arc expression in the medial prefrontal cortex (mPFC: prelimbic (PL and infralimbic (IL regions and Arc expression in the anterior cingulate cortex (ACC. We next examined the roles of these brain regions in the consolidation of IA memory. Consistent with previous findings, inhibiting protein synthesis in the hippocampus blocked the consolidation of IA memory. More importantly, inhibition in the mPFC or ACC also blocked the formation of IA memory. Conclusion Our observations indicated that the formation of IA memory requires gene expression in the ACC and mPFC as well as in the amygdala and hippocampus, suggesting essential roles of the ACC and mPFC in IA memory formation.

Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.

2004-01-01

The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol

Contribution du warrantage à l'accès des petits producteurs au ...

African Journals Online (AJOL)

Contribution du warrantage à l'accès des petits producteurs au marché des intrants et des produits agricoles dans les communes rurales de Kléla, Fama et Zebala dans la région de Sikasso au Mali. D Sogodogo, O Dembele, S Konate, S Koumare ...

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

Science.gov (United States)

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

Directory of Open Access Journals (Sweden)

Vera S Bogdanova

Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

Science.gov (United States)

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-03-17

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

Science.gov (United States)

Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

2017-06-05

Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

International Nuclear Information System (INIS)

Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette

2010-01-01

Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.

Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

Directory of Open Access Journals (Sweden)

Man K. Xu

2017-10-01

Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

Science.gov (United States)

Löw, Hans; Crane, Frederick L; Morré, D James

2012-11-01

The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Inhibitory effect and underlying mechanism of total saponins from Paris polyphylla var. yunnanensis on the proliferation of salivary adenoid cystic carcinoma ACC-83 cells].

Science.gov (United States)

Qiumin, He; Biao, Xu; Weihong, Wang; Chongyun, Bao; Shaowei, Hu

2017-06-01

To investigate the inhibitory effect and underlying mechanism of total saponins from Paris polyphylla var. yunnanensis on the proliferation of salivary adenoid cystic carcinoma ACC-83 cells. In vitro cell culture was performed. The proliferation of ACC-83 cells treated with different concentrations (5, 10, 20, 40, 60, 80, 100 μg·mL⁻¹) of total saponins from Paris polyphylla var. yunnanensis was observed using CCK-8 assay. Meanwhile, the apoptosis of ACC-83 cells treated with different concentrations (25, 50, 100 μg·mL⁻¹) of the total saponins was observed using flow cytometry. The expression levels of macrophage migration inhibitory factor (MIF) and CD74 were measured using Western blot and reverse transcription-polymerase chain reaction. The total saponins from Paris polyphylla var. yunnanensis induced apoptosis and expressed dose-effect relationship. ACC-83 cells expressed MIF and CD74, and the total saponins suppressed MIF and CD74 expression in ACC-83 cells. The total saponins from Paris polyphylla var. yunnanensis can significantly inhibit the proliferation, suppress MIF and CD74 expression, and promote apoptosis in ACC-83 cells. This study provides a theoretical basis for the treatment of salivary adenoid cystic carcinoma using Paris polyphylla var. yunnanensis.
.

In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

Science.gov (United States)

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

GATEWAY Report Brief: Tunable-White Lighting at the ACC Care Center

Energy Technology Data Exchange (ETDEWEB)

None, None

2016-09-30

Summary of a GATEWAY program report that documented the performance of tunable-white LED lighting systems installed in several spaces within the ACC Care Center, a senior-care facility in Sacramento, CA. The project results included energy savings and improved lighting quality, as well as other possible health-related benefits that may have been attributable, at least in part, to the lighting changes.

Monoamine Oxidase Inhibitors (MAOIs)

Science.gov (United States)

... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

Science.gov (United States)

Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

2016-12-01

Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

Science.gov (United States)

Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

2003-12-01

Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression Is Moderated by dACC Reactivity to Rejection.

Science.gov (United States)

Chester, David S; DeWall, C Nathan

2016-06-01

Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissists' motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Thirty participants (15 females; Mage  = 18.86, SD = 1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively toward one of the rejecters by blasting him or her with unpleasant noise. When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Narcissism's role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain's discrepancy detector registers the newly created gap between the grandiose and threatened selves. © 2015 Wiley Periodicals, Inc.

Effects upon metabolic pathways and energy production by Sb(III and As(III/Sb(III-oxidase gene aioA in Agrobacterium tumefaciens GW4.

Directory of Open Access Journals (Sweden)

Jingxin Li

Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

Science.gov (United States)

Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

2013-07-01

Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

Optimization of glucose oxidase production by Aspergillus niger

African Journals Online (AJOL)

user

2011-02-28

Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase

NARCIS (Netherlands)

Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.

2015-01-01

Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which

Rapport annuel au Parlement Loi sur l'Acces à l'information

International Development Research Centre (IDRC) Digital Library (Canada)

leonardi

1 juil. 1983 ... recherche, la production, la programmation de l'ordinateur, la préparation, le support de substitution et la reproduction des différents documents. Les droits en vigueur sont précisés dans le Règlement sur l'accès à l'information. Seuls les droits de 5 $ exigibles au moment de la présentation des demandes.

Tuning the light in senior care: Evaluating a trial LED lighting system at the ACC Care Center in Sacramento, CA

Energy Technology Data Exchange (ETDEWEB)

Davis, Robert G.; Wilkerson, Andrea M.; Samla, Connie; Bisbee, Dave

2016-08-31

This report summarizes the results from a trial installation of light-emitting diode (LED) lighting systems in several spaces within the ACC Care Center in Sacramento, CA. The Sacramento Municipal Utility District (SMUD) coordinated the project and invited the U.S. Department of Energy (DOE) to document the performance of the LED lighting systems as part of a GATEWAY evaluation. DOE tasked the Pacific Northwest National Laboratory (PNNL) to conduct the investigation. SMUD and ACC staff coordinated and completed the design and installation of the LED systems, while PNNL and SMUD staff evaluated the photometric performance of the systems. ACC staff also track behavioral and health measures of the residents; some of those results are reported here, although PNNL staff were not directly involved in collecting or interpreting those data. The trial installation took place in a double resident room and a single resident room, and the corridor that connects those (and other) rooms to the central nurse station. Other spaces in the trial included the nurse station, a common room called the family room located near the nurse station, and the ACC administrator’s private office.

Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise.

Science.gov (United States)

Li, Mengyao; Verdijk, Lex B; Sakamoto, Kei; Ely, Brian; van Loon, Luc J C; Musi, Nicolas

2012-01-01

AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. Published by Elsevier Ireland Ltd.

Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

Science.gov (United States)

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

2013-11-01

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

Science.gov (United States)

Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

2015-03-28

Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

Probing cytokinin homeostasis in Arabidopsis thaliana by constitutively overexpressing two forms of the maize cytokinin oxidase/dehydrogenase 1 gene

Czech Academy of Sciences Publication Activity Database

Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.

2006-01-01

Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006

Serum diamine oxidase activity in patients with histamine intolerance.

Science.gov (United States)

Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E

2016-03-01

Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.

Identification and characterization of an antennae-specific aldehyde oxidase from the navel orangeworm.

Directory of Open Access Journals (Sweden)

Young-Moo Choo

Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.

Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

Science.gov (United States)

Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

2012-04-01

Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

Structure and activity of Aspergillus nidulans copper amine oxidase

DEFF Research Database (Denmark)

McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A

2011-01-01

Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Association of GSTP1 gene polymorphisms with performance traits ...

African Journals Online (AJOL)

sony

The genetic variants were determined by PCR-SSCP technique. Two unique SSCP patterns were observed in fragment 1, 3, 5 and 6 of GSTP1 gene. Sequence analysis with reference to GenBank. Acc. no AC_000186.1 revealed polymorphisms at position 210, 746, 2438, 2439, 2443, 2507, 2695 and insertions between ...

Comparative effectiveness of ACC-deaminase and/or nitrogen-fixing rhizobacteria in promotion of maize (Zea mays L.) growth under lead pollution.

Science.gov (United States)

Hassan, Waseem; Bano, Rizwana; Bashir, Farhat; David, Julie

2014-09-01

Lead (Pb) pollution is appearing as an alarming threat nowadays. Excessive Pb concentrations in agricultural soils result in minimizing the soil fertility and health which affects the plant growth and leads to decrease in crop production. Plant growth promoting rhizobacteria (PGPR) are beneficial bacteria which can protect the plants against many abiotic stresses, and enhance the growth. The study aimed to identify important rhizobacterial strains by using the 1-aminocyclopropane-1-carboxylate (ACC) enrichment technique and examine their inoculation effects in the growth promotion of maize, under Pb pollution. A pot experiment was conducted and six rhizobacterial isolates were used. Pb was added to 2 kg soil in each pot (with 4 seeds/pot) using Pb(NO3)2 at the rate of 0, 100, 200, 300, and 400 mg kg(-1) Pb with three replications in completely randomized design. Rhizobacterial isolates performed significantly better under all Pb levels, i.e., 100 to 400 Pb mg kg(-1) soil, compared to control. Comparing the efficacy of the rhizobacterial isolates under different Pb levels, rhizobacterial isolates having both ACC-deaminase and nitrogen-fixing activities (AN8 and AN12) showed highest increase in terms of the physical, chemical and enzymatic growth parameters of maize, followed by the rhizobacterial isolates having ACC-deaminase activity only (ACC5 and ACC8), and then the nitrogen-fixing rhizobia (Azotobacter and RN5). However, the AN8 isolate showed maximum efficiency, and highest shoot and root length (14.2 and 6.1 cm), seedling fresh and dry weights (1.91 and 0.14 g), chlorophyll a, b, and carotenoids (24.1, 30.2 and 77.7 μg/l), protein (0.82 mg/g), proline (3.42 μmol/g), glutathione S-transferase, peroxidase and catalase (12.3, 4.2 and 7.2 units/mg protein), while the lowest Pb uptake in the shoot and root (0.83 and 0.48 mg/kg) were observed under this rhizobial isolate at the highest Pb level (i.e., 400 Pb mg kg(-1) soil). The results revealed that PGPR

Identification of candidate genes and molecular markers for heat-induced brown discoloration of seed coats in cowpea [Vigna unguiculata (L.) Walp].

Science.gov (United States)

Pottorff, Marti; Roberts, Philip A; Close, Timothy J; Lonardi, Stefano; Wanamaker, Steve; Ehlers, Jeffrey D

2014-05-01

Heat-induced browning (Hbs) of seed coats is caused by high temperatures which discolors the seed coats of many legumes, affecting the visual appearance and quality of seeds. The genetic determinants underlying Hbs in cowpea are unknown. We identified three QTL associated with the heat-induced browning of seed coats trait, Hbs-1, Hbs-2 and Hbs-3, using cowpea RIL populations IT93K-503-1 (Hbs positive) x CB46 (hbs negative) and IT84S-2246 (Hbs positive) x TVu14676 (hbs negative). Hbs-1 was identified in both populations, accounting for 28.3% -77.3% of the phenotypic variation. SNP markers 1_0032 and 1_1128 co-segregated with the trait. Within the syntenic regions of Hbs-1 in soybean, Medicago and common bean, several ethylene forming enzymes, ethylene responsive element binding factors and an ACC oxidase 2 were observed. Hbs-1 was identified in a BAC clone in contig 217 of the cowpea physical map, where ethylene forming enzymes were present. Hbs-2 was identified in the IT93K-503-1 x CB46 population and accounted for of 9.5 to 12.3% of the phenotypic variance. Hbs-3 was identified in the IT84S-2246 x TVu14676 population and accounted for 6.2 to 6.8% of the phenotypic variance. SNP marker 1_0640 co-segregated with the heat-induced browning phenotype. Hbs-3 was positioned on BAC clones in contig512 of the cowpea physical map, where several ACC synthase 1 genes were present. The identification of loci determining heat-induced browning of seed coats and co-segregating molecular markers will enable transfer of hbs alleles into cowpea varieties, contributing to higher quality seeds.

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

OpenAIRE

Legge, M; Duff, G B

1981-01-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...

Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity

International Nuclear Information System (INIS)

Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.

2004-01-01

Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational

Oxidases as Breast Cancer Oncogens

National Research Council Canada - National Science Library

Yeldandi, Anjana

2000-01-01

...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

Science.gov (United States)

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

Science.gov (United States)

Legge, M; Duff, G B

1981-02-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

Brain-derived neurotrophic factor (BDNF) in the rostral anterior cingulate cortex (rACC) contributes to neuropathic spontaneous pain-related aversion via NR2B receptors.

Science.gov (United States)

Zhang, Le; Wang, Gongming; Ma, Jinben; Liu, Chengxiao; Liu, Xijiang; Zhan, Yufeng; Zhang, Mengyuan

2016-10-01

The rostral anterior cingulate cortex (rACC) plays an important role in pain affect. Previous investigations have reported that the rACC mediates the negative affective component of inflammatory pain and contributed to the aversive state of nerve injury-induced neuropathic pain. Brain-derived neurotrophic factor (BDNF), an activity-dependent neuromodulator in the adult brain, is believed to play a role in the development and maintenance of inflammatory and neuropathic pain in the spinal cord. However, whether and how BDNF in the rACC regulates pain-related aversion due to peripheral nerve injury is largely unknown. Behaviorally, using conditioned place preference (CPP) training in rats, which is thought to reveal spontaneous pain-related aversion, we found that CPP was acquired following spinal clonidine in rats with partial sciatic nerve transection. Importantly, BDNF was upregulated within the rACC in of rats with nerve injury and enhanced the CPP acquisition, while a local injection of a BDNF-tropomyosin receptor kinase B (TrkB) antagonist into the rACC completely blocked this process. Finally, we demonstrated that the BDNF/TrkB pathway exerted its function by activating the NR2B receptor, which is widely accepted to be a crucial factor contributing to pain affect. In conclusion, our results demonstrate that the BDNF/TrkB-mediated signaling pathway in the rACC is involved in the development of neuropathic spontaneous pain-related aversion and that this process is dependent upon activation of NR2B receptors. These findings suggest that suppression of the BDNF-related signaling pathway in the rACC may provide a novel strategy to overcome pain-related aversion. Copyright © 2016 Elsevier Inc. All rights reserved.

Kaempferol modulates pro-inflammatory NF-κB activation by suppressing advanced glycation endproducts-induced NADPH oxidase

Science.gov (United States)

Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal

2010-01-01

Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987

A comparison of native GPU computing versus OpenACC for implementing flow-routing algorithms in hydrological applications

Science.gov (United States)

Rueda, Antonio J.; Noguera, José M.; Luque, Adrián

2016-02-01

In recent years GPU computing has gained wide acceptance as a simple low-cost solution for speeding up computationally expensive processing in many scientific and engineering applications. However, in most cases accelerating a traditional CPU implementation for a GPU is a non-trivial task that requires a thorough refactorization of the code and specific optimizations that depend on the architecture of the device. OpenACC is a promising technology that aims at reducing the effort required to accelerate C/C++/Fortran code on an attached multicore device. Virtually with this technology the CPU code only has to be augmented with a few compiler directives to identify the areas to be accelerated and the way in which data has to be moved between the CPU and GPU. Its potential benefits are multiple: better code readability, less development time, lower risk of errors and less dependency on the underlying architecture and future evolution of the GPU technology. Our aim with this work is to evaluate the pros and cons of using OpenACC against native GPU implementations in computationally expensive hydrological applications, using the classic D8 algorithm of O'Callaghan and Mark for river network extraction as case-study. We implemented the flow accumulation step of this algorithm in CPU, using OpenACC and two different CUDA versions, comparing the length and complexity of the code and its performance with different datasets. We advance that although OpenACC can not match the performance of a CUDA optimized implementation (×3.5 slower in average), it provides a significant performance improvement against a CPU implementation (×2-6) with by far a simpler code and less implementation effort.

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

Science.gov (United States)

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

Selection of efficient salt-tolerant bacteria containing ACC deaminase for promotion of tomato growth under salinity stress

Directory of Open Access Journals (Sweden)

Kannika Chookietwattana* and Kedsukon Maneewan

2012-05-01

Full Text Available For successful application of plant growth promoting bacteria (PGPB in salt-affected soil, bioinoculant with salt-tolerant property is required in order to provide better survival and perform well in the field. The present study aimed to select the most efficient salt-tolerant bacterium containing 1-aminocyclopropane-1-carboxylic acid (ACC deaminase from eighty four bacterial strains and to investigate the effects of the selected bacterium on the germination and growth of tomato (Licopersicon esculentum Mill. cv. Seeda under saline conditions. The Bacillus licheniformis B2r was selected for its ability to utilize ACC as a sole nitrogen source under salinity stress. It also showed a high ACC deaminase activity at 0.6 M NaCl salinity. Tomato plants inoculated with the selected bacterium under various saline conditions (0, 30, 60, 90 and 120 mM NaCl revealed a significant increase in the germination percentage, germination index, root length, and seedling dry weight especially at salinity levels ranging from 30-90 mM NaCl. The work described in this report is an important step in developing an efficient salt-tolerant bioinoculant to facilitate plant growth in saline soil.

Characterization and mutational analysis of omega-class GST (GSTO1 from Apis cerana cerana, a gene involved in response to oxidative stress.

Directory of Open Access Journals (Sweden)

Fei Meng

Full Text Available The Omega-class of GSTs (GSTOs is a class of cytosolic GSTs that have specific structural and functional characteristics that differ from those of other GST groups. In this study, we demonstrated the involvement of the GSTO1 gene from A. cerana cerana in the oxidative stress response and further investigated the effects of three cysteine residues of GSTO1 protein on this response. Real-time quantitative PCR (qPCR showed that AccGSTO1 was highly expressed in larvae and foragers, primarily in the midgut, epidermis, and flight muscles. The AccGSTO1 mRNA was significantly induced by cold and heat at 1 h and 3 h. The TBA (2-Thiobarbituric acid method indicated that cold or heat resulted in MDA accumulation, but silencing of AccGSTO1 by RNAi in honeybees increased the concentration of MDA. RNAi also increased the temperature sensitivity of honeybees and markedly reduced their survival. Disc diffusion assay indicated that overexpression of AccGSTO1 in E. coli caused the resistance to long-term oxidative stress. Furthermore, AccGSTO1 was active in an in vitro DNA protection assay. Mutations in Cys-28, Cys-70, and Cys-124 affected the catalytic activity and antioxidant activity of AccGSTO1. The predicted three-dimensional structure of AccGSTO1 was also influenced by the replacement of these cysteine residues. These findings suggest that AccGSTO1 plays a protective role in the response to oxidative stress.

Pyridox(am)ine-5-Phosphate Oxidase Deficiency Treatable Cause of Neonatal Epileptic Encephalopathy With Burst Suppression: Case Report and Review of the Literature.

Science.gov (United States)

Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet

2015-08-01

Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...

Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

Institute of Scientific and Technical Information of China (English)

Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou

2006-01-01

BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

Catalytic aspects of a copper(II) complex: biological oxidase to ...

Indian Academy of Sciences (India)

BISWAJIT CHOWDHURY

2017-10-03

Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.

Platelet monoamine oxidase: specific activity and turnover number in headache

International Nuclear Information System (INIS)

Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.

1982-01-01

Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)

[Prokaryotic expression of recombinant prochymosin gene and its antiserum preparation].

Science.gov (United States)

Li, Xin-ping; Liu, Huan-huan; Pu, Yan; Zhang, Fu-chun; Li, Yi-jie

2012-07-01

To optimize the prochymosin (pCHY) gene codons and express the gene in Escherichia coli (E.coli), and to prepare its antiserum and detect chymosin protein specifically. According to codon usage bias of E.coli, prochymosin gene sequence was synthesized based on the conserved sequences of prochymosin gene from bovine, lamb and camel, and then cloned into the plasmid pET-30a and pcDNA3-AAT-COMP-C3d3 (pcD-ACC), respectively. pET-30a-pCHY was expressed, as the detected antigen, in E.coli BL21(DE3) after IPTG induction. RT-PCR was used to detect prochymosin mRNA expression in liver from the mice injected pcDNA3-AAT-COMP-pCHY-C3d3(pACCC) by hydrodynamics-based transfection method. To prepare the antiserum of prochymosin, pACCC and GST-pCHY proteins were used to immunize New Zealand rabbits in accordance with DNA prime-protein boost strategy. Antibody levels were tested by ELISA. Western blotting showed the molecular weight of His-pCHY protein was about 55 000, similar to the expected molecular size. ELISA demonstrated that the titer level of prochymosin antiserum was high. Based on the codon optimization, we have obtained high-titer prochymosin antiserum through DNA vaccine vector pcD-ACC combined with DNA prime-protein boost strategy, similar to that by protein vaccine.

The Arabidopsis aldehyde oxidase 3 (AA03) gene product catalyzes the final step in abscisic acid biosynthesis in leaves

NARCIS (Netherlands)

Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.

2000-01-01

Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde

Increase in activity, glycosylation and expression of cytokinin oxidase/dehydrogenase during the senescence of barley leaf segments in the dark

Czech Academy of Sciences Publication Activity Database

Conrad, K.; Motyka, Václav; Schlüter, T.

2007-01-01

Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007

Droits d'auteur et accès au savoir en Afrique | IDRC - International ...

International Development Research Centre (IDRC) Digital Library (Canada)

incidence de celles-ci est loin de faire l'unanimité. La question de l'équilibre entre la protection des intérêts des producteurs et l'accès aux produits du savoir, comme le matériel didactique, inquiète particulièrement les pays en développement.

Immobilization of xanthine oxidase on a polyaniline silicone support.

Science.gov (United States)

Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

1996-03-01

A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

Variations of the Antarctic Circumpolar Current (ACC) in the Kerguelen Sector during the Last Deglaciation : sedimentological and geochemical evidences

Science.gov (United States)

Bout-Roumazeilles, V.; Beny, F.; Mazaud, A.; Michel, E.; Crosta, X.; Davies, G. R.; Bory, A. J. M.

2017-12-01

High-resolution sedimentological and geochemical records were obtained from two sediment cores recovered by the French R/V Marion Dufresne during the INDIEN-SUD-ACC cruises near the sub-Antarctic Kerguelen Islands (49°S). This area is ideal to record past oceanic and atmospheric changes in the Southern Ocean because they are currently located in the northern branch of the Antarctic Circumpolar Current and under the direct influence of Southern Hemisphere Westerly wind belt. This study focuses on the last termination, with specific emphasis on the impact of severe climatic events (Heinrich Stadial 1, Antarctic Cold Reversal, Younger Dryas) onto the ocean-atmospheric exchange. Results indicates that most of the sediment is derived from the Kerguelen Plateau, characterized by high smectite content. Periodically, a minor contribution of Antarctica is noticeable. In particular, illite variations suggest fast and short northward incursions of Antarctic Bottom Water, probably formed in the Prydz Bay during the last glaciation. Grainsize repartition combined to magnetic parameters show a southward migration of the ACC and the fronts associated from the beginning of the deglaciation, which is consistent with Southern Hemisphere climate variations. On the opposite, it highlights an asynchronous decrease of the ACC strength, with a large drop during the Antarctic Cold Reversal when atmospheric CO2 increase was slowed down. Thus, at least in the studied area, the ACC strength and the Antarctic Climate were not synchronous during the last deglaciation.

Technologies omniprésentes et accès au savoir (A2K) | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

... réseau transforme les modes d'accès à l'information partout dans le monde. ... En Indonésie, les portails Web locaux dominent le marché, sans pour autant toujours être en accord avec la loi nationale et internationale sur le droit d'auteur.

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

Science.gov (United States)

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Xanthine oxidase in human skeletal muscle following eccentric exercise

DEFF Research Database (Denmark)

Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.

1997-01-01

the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...

Assay Methods for ACS Activity and ACS Phosphorylation by MAP Kinases In Vitro and In Vivo.

Science.gov (United States)

Han, Xiaomin; Li, Guojing; Zhang, Shuqun

2017-01-01

Ethylene, a gaseous phytohormone, has profound effects on plant growth, development, and adaptation to the environment. Ethylene-regulated processes begin with the induction of ethylene biosynthesis. There are two key steps in ethylene biosynthesis. The first is the biosynthesis of 1-aminocyclopropane-1-carboxylic acid (ACC) from S-Adenosyl-Methionine (SAM), a common precursor in many metabolic pathways, which is catalyzed by ACC synthase (ACS). The second is the oxidative cleavage of ACC to form ethylene under the action of ACC oxidase (ACO). ACC biosynthesis is the committing and generally the rate-limiting step in ethylene biosynthesis. As a result, characterizing the cellular ACS activity and understanding its regulation are important. In this chapter, we detail the methods used to measure, (1) the enzymatic activity of both recombinant and native ACS proteins, and (2) the phosphorylation of ACS protein by mitogen-activated protein kinases (MAPKs) in vivo and in vitro.

Neuroprotection against oxidative stress by serum from heat acclimated rats.

Science.gov (United States)

Beit-Yannai, E; Trembovler, V; Horowitz, M; Lazarovici, P; Kohen, R; Shohami, E

1998-09-25

Exposure of PC12 cells, to 1% serum derived from normothermic (CON) rats resulted in 79% cell death. Sister cultures treated with 1% serum derived from heat acclimated (ACC) rats, were neuroprotected and expressed a significant reduction in cell death. In PC12 cells exposed to a free radical generator causing an oxidative stress, 90% cell death was measured in CON serum treated cultures, while ACC serum treated cultures were neuroprotected. Xanthine oxidase activity and uric acid (UA) levels were lower in ACC serum compared to CON. Addition of UA to both sera abolished the difference in cell viability, and toxicity of ACC serum reached that of CON. These findings suggest a causal relationship between the lower levels of UA in ACC and the neuroprotective effect observed. The present study proposes heat acclimation as an experimental and/or clinical tool for the achievement of neuroprotection.

Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-11-02

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-01-01

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

NARCIS (Netherlands)

Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.

2012-01-01

BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The

Les projets des jeunes ruraux : des stratégies diversifiées pour accéder au foncier et obtenir l’appui de l’Etat

Directory of Open Access Journals (Sweden)

Zhour Bouzidi

2015-06-01

Full Text Available Les initiatives publiques au Maroc n’offrent que très peu d’appuis spécifiquement dédiés aux jeunes ruraux. Cependant, certains jeunes réussissent à bénéficier de financements publics, tels que l’Initiative Nationale pour le Développement Humain ou le pilier II du Plan Maroc Vert, pour réaliser leurs projets. L’objectif de cet article est de caractériser la diversité des stratégies mises en place par ces jeunes pour accéder à l’appui de l’État. Nous avons pris l’exemple de l’accès au foncier, qui constitue une des obstacles auxquels sont confrontés les jeunes ruraux. Nous avons identifié trois types de projets : i des projets sans accès au foncier ; ii des projets où les jeunes s’arrangent avec un propriétaire de terre pour accéder au foncier ; et iii des projets où les jeunes sécurisent un droit propre d’accès au foncier. Si l’accès sécurisé au foncier permet aux jeunes d’obtenir une marge de manoeuvre importante dans la conception de leurs projets, en revanche leur autonomie est réduite pour les projets avec un accès négocié à la terre. Ce faisant, les projets hors sol constituent une voie de contournement de la contrainte foncière, mais font face à un ensemble de problèmes spécifiques. Bien que l’appui de l’État ne soit accessible qu’à peu de jeunes, les projets analysés créent des opportunités d’emploi et permettent de renforcer l’attachement des jeunes au milieu rural. Enfin, cet article propose des pistes pour améliorer l’accès des jeunes aux ressources productives (terre, eau, capital et mettre en place un appui efficient et adapté à leurs ambitions et leurs projets.

Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

Directory of Open Access Journals (Sweden)

Xiaohui eLi

2015-06-01

Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger

NARCIS (Netherlands)

Veenhuis, Marten; Dijken, Johannes Pieter van

1980-01-01

The subcellular localization of glucose oxidase (E.C. 1.1.3.4) in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both

Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

Directory of Open Access Journals (Sweden)

G.H.M. eSagor

2016-02-01

Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

Potentiation of motor sub-networks for motor control but not working memory: Interaction of dACC and SMA revealed by resting-state directed functional connectivity

Science.gov (United States)

Diwadkar, Vaibhav A.; Asemi, Avisa; Burgess, Ashley; Chowdury, Asadur; Bressler, Steven L.

2017-01-01

The dorsal Anterior Cingulate Cortex (dACC) and the Supplementary Motor Area (SMA) are known to interact during motor coordination behavior. We previously discovered that the directional influences underlying this interaction in a visuo-motor coordination task are asymmetric, with the dACC→SMA influence being significantly greater than that in the reverse direction. To assess the specificity of this effect, here we undertook an analysis of the interaction between dACC and SMA in two distinct contexts. In addition to the motor coordination task, we also assessed these effects during a (n-back) working memory task. We applied directed functional connectivity analysis to these two task paradigms, and also to the rest condition of each paradigm, in which rest blocks were interspersed with task blocks. We report here that the previously known asymmetric interaction between dACC and SMA, with dACC→SMA dominating, was significantly larger in the motor coordination task than the memory task. Moreover the asymmetry between dACC and SMA was reversed during the rest condition of the motor coordination task, but not of the working memory task. In sum, the dACC→SMA influence was significantly greater in the motor task than the memory task condition, and the SMA→dACC influence was significantly greater in the motor rest than the memory rest condition. We interpret these results as suggesting that the potentiation of motor sub-networks during the motor rest condition supports the motor control of SMA by dACC during the active motor task condition. PMID:28278267

Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A2

International Nuclear Information System (INIS)

Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.

1986-01-01

Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

Science.gov (United States)

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

Science.gov (United States)

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Directory of Open Access Journals (Sweden)

Koji Sode

2012-11-01

Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Antioxidative properties of the essential oil from Pinus mugo.

Science.gov (United States)

Grassmann, Johanna; Hippeli, Susanne; Vollmann, Renate; Elstner, Erich F

2003-12-17

The essential oil from Pinus mugo (PMEO) was tested on its antioxidative capacity. For this purpose, several biochemical test systems were chosen (e.g., the Fenton System, the xanthine oxidase assay, or the copper-induced oxidation of low-density lipoprotein (LDL)). The results show that there is moderate or weak antioxidative activity when tested in aqueous environments, like in the Fenton system, xanthine oxidase induced superoxide radical formation, or in the HOCl driven fragmentation of 1-aminocyclopropane-1-carboxylic acid (ACC). In contrast, when tested in more lipophilic environments (e.g., the ACC-cleavage by activated neutrophils in whole blood) the PMEO exhibits good antioxidative activity. PMEO does also show good antioxidative capacity in another lipophilic test system (i.e., the copper induced oxidation of LDL). Some components of PMEO (i.e., Delta(3)-carene, camphene, alpha-pinene, (+)-limonene and terpinolene) were also tested. As the PMEO, they showed weak or no antioxidant activity in aqueous environments, but some of them were effective antioxidants regarding ACC-cleavage by activated neutrophils in whole blood or copper-induced LDL-oxidation. Terpinolene, a minor component of PMEO, exhibited remarkable protection against LDL-oxidation.

Isolation of a candidate gene for Norrie disease by positional cloning

NARCIS (Netherlands)

Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.

1992-01-01

The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the

Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase.

Science.gov (United States)

Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao

2018-01-01

This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.

Production of rabbit antibodies against purified Glucose oxidase

OpenAIRE

Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur

2012-01-01

Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...

The use of galactose oxidase in lipid labeling

International Nuclear Information System (INIS)

Radin, N.S.; Evangelatos, G.P.

1981-01-01

Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate

L'accès aux collections physiques de la Bpi

OpenAIRE

Etesse, Cécile

2014-01-01

L'objectif de l’étude est d'analyser l’accès des usagers aux collections physiques de la Bpi. La méthodologierepose sur des entretiens semi-directifs - une quarantaine réalisés auprès d’usagers en situation de recherche dans la bibliothèque, dans les rayons ou aux bureaux d’information et sur un benchmarking auprès d’une dizaine de bibliothèques - portant sur leurs pratiques en matière de supports d’information, signalétique, mise en espace des collections et choix de classification.Les princ...

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

Science.gov (United States)

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Effects of Acute Exercise and Chronic Exercise on the Liver Leptin-AMPK-ACC Signaling Pathway in Rats with Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Xuejie Yi

2013-01-01

Full Text Available Aim. To investigate the effects of acute and chronic exercise on glucose and lipid metabolism in liver of rats with type 2 diabetes caused by a high fat diet and low dose streptozotocin (STZ. Methods. Animals were classified into control (CON, diabetes (DC, diabetic chronic exercise (DCE, and diabetic acute exercise (DAE groups. Results. Compared to CON, the leptin levels in serum and liver and ACC phosphorylation were significantly higher in DC, but the levels of liver leptin receptor, AMPKα1/2, AMPKα1, and ACC proteins expression and phosphorylation were significantly lower in DC. In addition, the levels of liver glycogen reduced significantly, and the levels of TG and FFA increased significantly in DC compared to CON. Compared to DC, the levels of liver AMPKα1/2, AMPKα2, AMPKα1, and ACC phosphorylation significantly increased in DCE and DAE. However, significant increase of the level of liver leptin receptor and glycogen as well as significant decrease of the level of TG and FFA were observed only in DEC. Conclusion. Our study demonstrated that both acute and chronic exercise indirectly activated the leptin-AMPK-ACC signaling pathway and increased insulin sensitivity in the liver of type 2 diabetic rats. However, only chronic and long-term exercise improved glucose and lipid metabolism of the liver.

Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

Science.gov (United States)

Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

2018-01-01

Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

Science.gov (United States)

Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

2006-06-01

The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase

Directory of Open Access Journals (Sweden)

Simon Burgener

2017-12-01

Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.

The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.

Science.gov (United States)

Elmer, Lawrence W; Bertoni, John M

2008-11-01

The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.

Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.

Science.gov (United States)

Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A

2001-07-01

Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).

Effect of Curcumin on Phosphorylation of AMPK and ACC in C2C12 Skeletal Muscle Cells

Directory of Open Access Journals (Sweden)

F Ghanbarzadeh

2013-10-01

Full Text Available Introduction: AMP activated protein kinase (AMPK as key regulators of cell metabolism, plays a major role in the activation of catabolic pathways, such as glucose transport and fatty acid oxidation. Thus, activation of this pathway can be used in the treatment of diabetes and metabolic syndrome. Many studied proposed the effectiveness of the polyphenols present in rhizomes of turmeric (curcumin on diabetes and its related complications. Therefore, this study investigated the effects of curcumin as an activator of AMPK pathway in C2C12 muscle cells. Methods: This study was done on C2C12 skeletal muscle cell line. The cells were classified into two distinct groups: first group was treated with 40µM curcumin and the second one with 0.1% DMSO as a negative control. The phosphorylated (AMPK and phosphorylated acetyl COA carboxylase (ACC were evaluated and compared by Western blotting technique. Results: intracellular phosphorylated AMPK protein content in Curcumin-treated group was 132.6% and ACC protein phosphorylated was 366.47%. Conclusion: This study showed that the levels of phosphorylated AMPK and ACC protein in cells treated with curcumin are higher than the negative control. Thus curcumin can be regarded as an activator of AMPK activity in these cells and can assist as a potential target for making anti diabetic medecine that has a synergistic activity with insulin.

Lysyl oxidase in cancer research

DEFF Research Database (Denmark)

Perryman, Lara; Erler, Janine Terra

2014-01-01

Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...

Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase.

Science.gov (United States)

White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H

2009-04-01

The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.

Contribution of the NADH-oxidase (Nox) to the aerobic life of Lactobacillus sanfranciscensis DSM20451T.

Science.gov (United States)

Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F

2011-02-01

Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.

Rapport annuel au Parlement Loi sur l'accès à l'information Centre ...

International Development Research Centre (IDRC) Digital Library (Canada)

leonardi

1 juil. 1983 ... Partie 1 – Demandes reçues en vertu de la Loi sur l'accès à l'information . .... bureaux régionaux gèrent et administrent ces quatre secteurs d'activité. Le vice- ... Trois demandes ont été traitées dans un délai de 16 à 30 jours.

Mural granulosa cell gene expression associated with oocyte developmental competence

Directory of Open Access Journals (Sweden)

Jiang Jin-Yi

2010-03-01

Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

CE-ACCE: The Cloud Enabled Advanced sCience Compute Environment

Science.gov (United States)

Cinquini, L.; Freeborn, D. J.; Hardman, S. H.; Wong, C.

2017-12-01

Traditionally, Earth Science data from NASA remote sensing instruments has been processed by building custom data processing pipelines (often based on a common workflow engine or framework) which are typically deployed and run on an internal cluster of computing resources. This approach has some intrinsic limitations: it requires each mission to develop and deploy a custom software package on top of the adopted framework; it makes use of dedicated hardware, network and storage resources, which must be specifically purchased, maintained and re-purposed at mission completion; and computing services cannot be scaled on demand beyond the capability of the available servers.More recently, the rise of Cloud computing, coupled with other advances in containerization technology (most prominently, Docker) and micro-services architecture, has enabled a new paradigm, whereby space mission data can be processed through standard system architectures, which can be seamlessly deployed and scaled on demand on either on-premise clusters, or commercial Cloud providers. In this talk, we will present one such architecture named CE-ACCE ("Cloud Enabled Advanced sCience Compute Environment"), which we have been developing at the NASA Jet Propulsion Laboratory over the past year. CE-ACCE is based on the Apache OODT ("Object Oriented Data Technology") suite of services for full data lifecycle management, which are turned into a composable array of Docker images, and complemented by a plug-in model for mission-specific customization. We have applied this infrastructure to both flying and upcoming NASA missions, such as ECOSTRESS and SMAP, and demonstrated deployment on the Amazon Cloud, either using simple EC2 instances, or advanced AWS services such as Amazon Lambda and ECS (EC2 Container Services).

The role of brassinosteroids in the regulation of the plasma membrane H+-ATPase and NADPH oxidase under cadmium stress.

Science.gov (United States)

Jakubowska, Dagmara; Janicka, Małgorzata

2017-11-01

The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC 3.6.3.14) and NADPH oxidase (EC 1.6.3.1). Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.

Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity

Energy Technology Data Exchange (ETDEWEB)

Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)

2014-05-15

Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.

A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency.

Science.gov (United States)

Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia

2008-02-01

We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.

Optimization of ACC system spacing policy on curved highway

Science.gov (United States)

Ma, Jun; Qian, Kun; Gong, Zaiyan

2017-05-01

The paper optimizes the original spacing policy when adopting VTH (Variable Time Headway), proposes to introduce the road curve curvature K to the spacing policy to cope with following the wrong vehicle or failing to follow the vehicle owing to the radar limitation of curve in ACC system. By utilizing MATLAB/Simulink, automobile longitudinal dynamics model is established. At last, the paper sets up such three common cases as the vehicle ahead runs at a uniform velocity, an accelerated velocity and hits the brake suddenly, simulates these cases on the curve with different curvature, analyzes the curve spacing policy in the perspective of safety and vehicle following efficiency and draws the conclusion whether the optimization scheme is effective or not.

[Experimental rationale for the parameters of a rapid method for oxidase activity determination].

Science.gov (United States)

Butorina, N N

2010-01-01

Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

Accès à l'eau : des solutions techniques et sociales aident des ...

International Development Research Centre (IDRC) Digital Library (Canada)

Grâce à la modélisation par ordinateur faisant appel à des techniques de pointe et à la consultation des collectivités, l'organisme bolivien Agua Sustentable a trouvé des solutions politiques à des conflits qui auraient pu s'avérer désastreux au sujet de l'accès à l'eau. Cet organisme de recherche subventionné par le CRDI a ...

Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase.

Science.gov (United States)

Lehninger, A L; Reynafarje, B; Costa, L

1985-01-01

The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.

Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis

Directory of Open Access Journals (Sweden)

Richard Dela Cruz

2016-06-01

Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.

Vanillyl-alcohol oxidase, a tasteful biocatalyst

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.

2001-01-01

The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl

TIC pour un accès équitable aux ressources humaines en sante en ...

International Development Research Centre (IDRC) Digital Library (Canada)

Ce projet vise à mieux comprendre comment les TIC peuvent faciliter la distribution équitable des ressources humaines en santé en renforçant et consolidant des activités ... Technologies de l'Information et de la Communication (TIC) pour un Accès équitable aux Ressources Humaines en santé qualifiées, motivées et bien ...

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines

Directory of Open Access Journals (Sweden)

Diallo Amadou

2008-08-01

Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Andermann syndrome can be a phenocopy of hereditary motor and sensory neuropathy--report of a discordant sibship with a compound heterozygous mutation of the KCC3 gene.

Science.gov (United States)

Rudnik-Schöneborn, S; Hehr, U; von Kalle, T; Bornemann, A; Winkler, J; Zerres, K

2009-06-01

Andermann syndrome is a rare autosomal recessive disorder characterized by agenesis of the corpus callosum (ACC), progressive motor-sensory neuropathy, mental retardation and facial features. We report on two siblings with the clinical picture of a demyelinating hereditary motor and sensory neuropathy (HMSN), where only the presence of ACC in the younger brother pointed to the diagnosis of Andermann syndrome. Mutation analysis of the KCC3 (SLC12A6) gene showed a compound heterozygous mutation; a maternal missense mutation c.1616G>A (p.G539D) and a paternal splice mutation c.1118+1G>A in both siblings. We hypothesize that mutations of the KCC3 gene may result in non-syndromic childhood onset HMSN.

Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells

Directory of Open Access Journals (Sweden)

Peiying Yu

2014-01-01

Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.

The interleukin 1 beta (IL1B) gene is associated with failure to achieve remission and impaired emotion processing in major depression.

Science.gov (United States)

Baune, Bernhard T; Dannlowski, Udo; Domschke, Katharina; Janssen, Debbie G A; Jordan, Margaret A; Ohrmann, Patricia; Bauer, Jochen; Biros, Erik; Arolt, Volker; Kugel, Harald; Baxter, Alan G; Suslow, Thomas

2010-03-15

Accumulating evidence suggests the involvement of inflammatory processes and cytokines in particular in the pathophysiology of major depression (MDD) and resistance to antidepressant treatment. Furthermore, amygdala and anterior cingulate cortex (ACC) responsiveness to emotional stimuli has been suggested as a predictor of treatment response. This study investigated the association between genetic variants of the interleukin 1 beta (IL1B) gene and amygdala and ACC responsiveness to emotional stimuli and response to antidepressant treatment. In this analysis, 256 Caucasian patients with MDD (145 women, 111 men) were genotyped for variants rs16944, rs1143643, and rs1143634 in the IL1B gene (2q14). Response to antidepressant treatment over 6 weeks was defined as remission (50% decrease on Hamilton Rating Scale for Depression-21-question). Brain activity under visual presentation of emotional faces was assessed in a subsample of 32 depressed patients by means of functional magnetic resonance imaging at 3 T. Pharmacogenetic analyses show significant associations of the GG genotypes of single nucleotide polymorphisms (SNPs) rs16944 (odds ratio = 1.74; 95% confidence interval 1.2-4.3) and rs1143643 (odds ratio = 3.1; 95% confidence interval 1.3-7.8) (compared with the AA genotype) with nonremission after 6 weeks. The imaging analyses show that the number of G-alleles in both SNPs (rs16944 and rs1143643) was associated with reduced responsiveness of the amygdala and ACC to emotional stimulation. The present study suggests a negative effect of the IL1B gene on pharmacological response and amygdala and ACC function involving the same genotypes of two SNPs (rs16944, rs116343), which taken together increase the risk of nonremission over 6 weeks of antidepressant treatment in MDD. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Cytochemical localization of catalase and several hydrogen peroxide-producing oxidases in the nucleoids and matrix of rat liver peroxisomes

NARCIS (Netherlands)

Veenhuis, M.; Wendelaar Bonga, S.E.

1979-01-01

The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based

Gene expression changes in the prefrontal cortex, anterior cingulate cortex and nucleus accumbens of mood disorders subjects that committed suicide.

Directory of Open Access Journals (Sweden)

Adolfo Sequeira

Full Text Available Suicidal behaviors are frequent in mood disorders patients but only a subset of them ever complete suicide. Understanding predisposing factors for suicidal behaviors in high risk populations is of major importance for the prevention and treatment of suicidal behaviors. The objective of this project was to investigate gene expression changes associated with suicide in brains of mood disorder patients by microarrays (Affymetrix HG-U133 Plus2.0 in the dorsolateral prefrontal cortex (DLPFC: 6 Non-suicides, 15 suicides, the anterior cingulate cortex (ACC: 6NS, 9S and the nucleus accumbens (NAcc: 8NS, 13S. ANCOVA was used to control for age, gender, pH and RNA degradation, with P ≤ 0.01 and fold change ± 1.25 as criteria for significance. Pathway analysis revealed serotonergic signaling alterations in the DLPFC and glucocorticoid signaling alterations in the ACC and NAcc. The gene with the lowest p-value in the DLPFC was the 5-HT2A gene, previously associated both with suicide and mood disorders. In the ACC 6 metallothionein genes were down-regulated in suicide (MT1E, MT1F, MT1G, MT1H, MT1X, MT2A and three were down-regulated in the NAcc (MT1F, MT1G, MT1H. Differential expression of selected genes was confirmed by qPCR, we confirmed the 5-HT2A alterations and the global down-regulation of members of the metallothionein subfamilies MT 1 and 2 in suicide completers. MTs 1 and 2 are neuro-protective following stress and glucocorticoid stimulations, suggesting that in suicide victims neuroprotective response to stress and cortisol may be diminished. Our results thus suggest that suicide-specific expression changes in mood disorders involve both glucocorticoids regulated metallothioneins and serotonergic signaling in different regions of the brain.

Gene expression changes in the prefrontal cortex, anterior cingulate cortex and nucleus accumbens of mood disorders subjects that committed suicide.

Science.gov (United States)

Sequeira, Adolfo; Morgan, Ling; Walsh, David M; Cartagena, Preston M; Choudary, Prabhakara; Li, Jun; Schatzberg, Alan F; Watson, Stanley J; Akil, Huda; Myers, Richard M; Jones, Edward G; Bunney, William E; Vawter, Marquis P

2012-01-01

Suicidal behaviors are frequent in mood disorders patients but only a subset of them ever complete suicide. Understanding predisposing factors for suicidal behaviors in high risk populations is of major importance for the prevention and treatment of suicidal behaviors. The objective of this project was to investigate gene expression changes associated with suicide in brains of mood disorder patients by microarrays (Affymetrix HG-U133 Plus2.0) in the dorsolateral prefrontal cortex (DLPFC: 6 Non-suicides, 15 suicides), the anterior cingulate cortex (ACC: 6NS, 9S) and the nucleus accumbens (NAcc: 8NS, 13S). ANCOVA was used to control for age, gender, pH and RNA degradation, with P ≤ 0.01 and fold change ± 1.25 as criteria for significance. Pathway analysis revealed serotonergic signaling alterations in the DLPFC and glucocorticoid signaling alterations in the ACC and NAcc. The gene with the lowest p-value in the DLPFC was the 5-HT2A gene, previously associated both with suicide and mood disorders. In the ACC 6 metallothionein genes were down-regulated in suicide (MT1E, MT1F, MT1G, MT1H, MT1X, MT2A) and three were down-regulated in the NAcc (MT1F, MT1G, MT1H). Differential expression of selected genes was confirmed by qPCR, we confirmed the 5-HT2A alterations and the global down-regulation of members of the metallothionein subfamilies MT 1 and 2 in suicide completers. MTs 1 and 2 are neuro-protective following stress and glucocorticoid stimulations, suggesting that in suicide victims neuroprotective response to stress and cortisol may be diminished. Our results thus suggest that suicide-specific expression changes in mood disorders involve both glucocorticoids regulated metallothioneins and serotonergic signaling in different regions of the brain.

Lysyl Oxidase and the Tumor Microenvironment

Directory of Open Access Journals (Sweden)

Tong-Hong Wang

2016-12-01

Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.

Overexpression of a water-forming NADH oxidase improves the metabolism and stress tolerance of Saccharmyces cerevisiae in aerobic fermenation

Directory of Open Access Journals (Sweden)

Xinchi Shi

2016-09-01

Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved

Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask

OpenAIRE

Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ

2012-01-01

The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...

A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

Science.gov (United States)

Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

2007-04-01

Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

Science.gov (United States)

Vlahos, Ross; Selemidis, Stavros

2014-12-01

Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

Science.gov (United States)

Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

2015-01-01

COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

Accès des femmes à l'emploi | CRDI - Centre de recherches pour le ...

International Development Research Centre (IDRC) Digital Library (Canada)

... de mariage des femmes, l'accès à l'éducation et au perfectionnement des compétences, et le rôle des groupes collectifs de femmes, entre autres. En plus des exposés sur les projets ci-dessous, le texte qui suit résume les résultats des consultations de 2016 sur les femmes en affaires ainsi qu'une analyse documentaire.

Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties

NARCIS (Netherlands)

Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk

2011-01-01

Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two

A Comparative Analysis of the Integration of Faith and Learning between ACSI and ACCS Accredited Schools

Science.gov (United States)

Peterson, Daniel Carl

2012-01-01

The purpose of this descriptive quantitative study was to analyze and compare the integration of faith and learning occurring in Christian schools accredited by the Association of Christian Schools International (ACSI) and classical Christian schools accredited by the Association of Classical and Christian Schools (ACCS). ACSI represents the…

Sommaires des demandes d'accès à l'information complétées ...

International Development Research Centre (IDRC) Digital Library (Canada)

... à ces demandes, veuillez envoyer un courriel à ATIP-AIPRP@crdi.ca ou écrire à l'adresse suivante: Coordonnatrice de l'accès à l'information et de la protection des renseignements personnels. Bureau du secrétaire et conseiller juridique. Centre de recherches pour le développement international 150, rue Kent CP 8500

Ethylene-Related Gene Expression Networks in Wood Formation

Directory of Open Access Journals (Sweden)

Carolin Seyfferth

2018-03-01

Full Text Available Thickening of tree stems is the result of secondary growth, accomplished by the meristematic activity of the vascular cambium. Secondary growth of the stem entails developmental cascades resulting in the formation of secondary phloem outwards and secondary xylem (i.e., wood inwards of the stem. Signaling and transcriptional reprogramming by the phytohormone ethylene modifies cambial growth and cell differentiation, but the molecular link between ethylene and secondary growth remains unknown. We addressed this shortcoming by analyzing expression profiles and co-expression networks of ethylene pathway genes using the AspWood transcriptome database which covers all stages of secondary growth in aspen (Populus tremula stems. ACC synthase expression suggests that the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC is synthesized during xylem expansion and xylem cell maturation. Ethylene-mediated transcriptional reprogramming occurs during all stages of secondary growth, as deduced from AspWood expression profiles of ethylene-responsive genes. A network centrality analysis of the AspWood dataset identified EIN3D and 11 ERFs as hubs. No overlap was found between the co-expressed genes of the EIN3 and ERF hubs, suggesting target diversification and hence independent roles for these transcription factor families during normal wood formation. The EIN3D hub was part of a large co-expression gene module, which contained 16 transcription factors, among them several new candidates that have not been earlier connected to wood formation and a VND-INTERACTING 2 (VNI2 homolog. We experimentally demonstrated Populus EIN3D function in ethylene signaling in Arabidopsis thaliana. The ERF hubs ERF118 and ERF119 were connected on the basis of their expression pattern and gene co-expression module composition to xylem cell expansion and secondary cell wall formation, respectively. We hereby establish data resources for ethylene-responsive genes and

Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass)

OpenAIRE

Jonathan M. LaMantia; Ambika Chandra; David R. Huff

2018-01-01

Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...

Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

Science.gov (United States)

Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

2015-01-01

Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

Science.gov (United States)

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

Science.gov (United States)

Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

Effect of Creosote Bush-Derived NDGA on Expression of Genes Involved in Lipid Metabolism in Liver of High-Fructose Fed Rats: Relevance to NDGA Amelioration of Hypertriglyceridemia and Hepatic Steatosis.

Directory of Open Access Journals (Sweden)

Haiyan Zhang

Full Text Available Nordihydroguaiaretic acid (NDGA, the main metabolite of Creosote bush, has been shown to have profound effects on the core components of the metabolic syndrome (MetS, lowering blood glucose, free fatty acids (FFA and triglyceride (TG levels in several models of dyslipidemia, as well as improving body weight (obesity, insulin resistance, diabetes and hypertension, and ameliorating hepatic steatosis. In the present study, a high-fructose diet (HFrD fed rat model of hypertriglyceridemia was employed to further delineate the underlying mechanism by which NDGA exerts its anti-hypertriglyceridemic action. In the HFrD treatment group, NDGA administration by oral gavage decreased plasma levels of TG, glucose, FFA, and insulin, increased hepatic mitochondrial fatty acid oxidation and attenuated hepatic TG accumulation. qRT-PCR measurements indicated that NDGA treatment increased the mRNA expression of key fatty acid transport (L-FABP, CD36, and fatty acid oxidation (ACOX1, CPT-2, and PPARα transcription factor genes and decreased the gene expression of enzymes involved in lipogenesis (FASN, ACC1, SCD1, L-PK and ChREBP and SREBP-1c transcription factors. Western blot analysis indicated that NDGA administration upregulated hepatic insulin signaling (P-Akt, AMPK activity (P-AMPK, MLYCD, and PPARα protein levels, but decreased SCD1, ACC1 and ACC2 protein content and also inactivated ACC1 activity (increased P-ACC1. These findings suggest that NDGA ameliorates hypertriglyceridemia and hepatic steatosis primarily by interfering with lipogenesis and promoting increased channeling of fatty acids towards their oxidation.

Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats

Directory of Open Access Journals (Sweden)

José Luis Miguel-Carrasco

2012-01-01

Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.

Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.

Science.gov (United States)

Brattsten, L B; Wilkinson, C F; Eisner, T

1977-06-17

The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.

Open problems in CEM: Porting an explicit time-domain volume-integral- equation solver on GPUs with OpenACC

KAUST Repository

Ergü l, Ö zgü r; Feki, Saber; Al-Jarro, Ahmed; Clo, Alain M.; Bagci, Hakan

2014-01-01

-level approach, utilizing the OpenACC directive-based parallel programming model, is used to minimize two often-faced challenges in GPU programming: developer productivity and code portability. The MOT-TDVIE solver code, originally developed for CPUs

Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging.

Science.gov (United States)

Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R

2014-11-24

Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.